Avian Influenza H5N1: Vaccination Against a PandemicAvian Influenza H5N1: Vaccination Against a Pandemic

HPAI H5N1 Epidemic in Poultry Populations in Asia

Vaccination Against a Potential Pandemic

The WHO issued a influenza pandemic preparedness plan in 1999 One initiative of the plan is to rapidly prepare a vaccine against

H5N1 One commercial vaccine-producing institution and several research

institutions are currently on the case K. Subbarao et al. and M. Liu et al. have used a process of plasmid

based reverse genetics to create an experimentally working H5N1 vaccine

What Is H5N1?

Influenza A from the family of Orthomyxoviridae

Negative single-strand RNA virus with segment genome

Haemagglutiinin and Neuraminidase viral proteins

15 subtypes of haemagglutinin and 9 subtypes of neuraminidase

All subtypes exist in wild aquatic birds

H5N1 Statistics

Wild aquatic birds are a natural reservoir for all influenza A viruses

Hong Kong 1997 outbreak of H5N1 AI in poultry resulted in the first human cases: 18 infected, 6 die

In 2003 a new subtype of H5N1 AI infected humans

WHO reports that since January 28, 2004, 44 infected resulting in 32 deaths

New subtypes produce a morbidity rate of 70% in humans compared to 33% of the initial H5N1

Nomenclature AI : Avian Influenza HP: High Pathogenic LP: Low Pathogenic HA: Haemagglutinin NA: Neuraminidase

A/goose/Guangdong/1/1997 (H5N1)Antigenic Type

Infected animal

Geographic site of isolation Year of isolation

Antigenic description

• Influenza A H5N1 strain #1 isolated from a goose in Guangdong during 1997

Strain #

Increasing Virulence of H5N1

Antigenic drift resulting from point mutations in the HA and NA genes

Alterations in the surface protein (HA) results in the loss of antibody to neutralize new virus

Query: 541 aataataccaaccaagaagatcttttggtactnnnnnnnattcaccatcctaatgatgcg 600 |||||||||||||||||||||||||||||||| |||||||||||||||||||||Subjct:569 aataataccaaccaagaagatcttttggtactgtgggggattcaccatcctaatgatgcg 628

Query: 601 gcagagcagacaaagctctatcaaaacccaaccacctatatttccgttgggacatcaaca 660 ||||||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||Subjct:629 gcagagcagacaaggctctatcaaaacccaaccacttatatttccgttggaacatcaaca 688

• BLAST nucleotide alignment of two haemagglutinin genes from A/chicken/Hubei/489/2004(H5N1)and A/chicken/Thailand/CH-2/2004(H5N1)

Subbarao 2004

Haemagglutinin

HA is to binds to the host cell by sialic acid receptors containing either alpha 2,6-galactose linkages (human) or alpha 2,3-galactose linkages (avian)

Binding of alpha 2,6-galatose linkages corresponds to human epithelial cells and alpha 2,3-galactose linkages corresponds to avian intestinal epithelial cells

Possible reason why H5N1 is not able to cause human-to-human transmission is that haemagglutinin of avian origin has not acquired human receptor-binding specificity.

Once haemagglutinin binds it elicits a neutralizing antibody response

Determining Pathogenicty

Pathogenicity determined by cleavage of the haemagglutinin into two subunits

Low pathogenicity caused by proteases in mammalian respiratory tract/ avian intestinal tract cleaving the haemagglutinin

High pathogenicity determined by proteases present in a multitude of tissues to cleaving haemagglutinin

Highly pathogenic H5 has multiple basic amino acid in connecting peptide of the HA gene, which is adjacent to the cleavage site

Current vaccine research for HPAI H5N1 targeted to the multiple amino acid motif

Subbarao et al. and Liu et al. two groups of researchers that have created an inactivated H5 HA by eliminating the multiple amino acids.

Copyright ©2002 by the National Academy of Sciences

Guan, Y. et al. (2002) Proc. Natl. Acad. Sci. USA 99, 8950-8955

Fig. 1. Phylogenetic trees for the H5 HA1 (a), NP (b), and NS (c) genes of influenza A viruses

Vaccination Production By Reverse Genetics

Reverse genetics: method of genetically engineering portions of the genome and observing the resulting phenotype

Benefits of using reverse genetics:

1. creating a safer virus to work with

2. decreasing embryonated egg mortality

3. higher growth yields/ faster to produce

Can inactivate H5 HA gene by modifying the multiple basic amino acids adjacent to cleavage site associated with HPAI

Experiments: Subbarao et al. Targeted H5 Ha gene of wt HK/491/1997:

GAG AGA AGA AGA AAA AAG AGA GGA TTA TTT

Arg Arg Arg Arg Lys Lys Arg Gly Leu Phe

Modified:

ACT CGA GGA TTA TTT

Thr Arg Gly Leu Phe

• Removed basic amino acid motif by RRT-PCR

• Isolates and rescues PR8 gene from A/Puerto Rico/8/34 (PR8) (H1N1)

•Transfected 293t cells with plasmid containing isolated genes

• Reassortant phenotype: H5N1/PR8

Experiments: Subbarao et al.

Reassorted virus passed in 9-10 day old embryonated eggs Grown in the allantoic cavity to high infectivity titers No plaques on MDBK cells in absence of trypsin Tested virus on chickens resulting in no deaths, no shedding and

50% with detectable antibodies Tested on BALB/C mice, no deaths, but low detectable shedding in

lungs Removal of basic amino acid motif resulted in loss of virulence for

H5N1

Experiments: Subbarao et al.

Produced a Formalin-inactivated H5N1/PR8 vaccine Protected chickens and mice challenged with wt H5N1

Experiments: Liu et al.

Constructed efficacious H5N3 vaccine Still protected against H5N1 except with the benefit of differentiating

between the vaccinated and the infected by different NA Similar deactivation of H5 HA region: A/goose/HK/437-3/99 (H5N1)

GAG AGA AGA AGA AAA AAG AGA GGA TTA TTT

Arg Arg Arg Arg Lys Lys Arg Gly Leu Phe

Modified:

ACA AGA GGA TTA TTT

Thr Arg Gly Leu Phe

Experiments: Liu et al.

Also obtained PR8 from A/Puerto Rico/8/34 (PR8) (H1N1) N3 taken from A/Duck/Germany/1215/73 (H2N3) Same technique of reassortment No embryo death and no plaque formations No detectable replication in chickens Low replication in mice including brain and lungs, but not after 7

days

Experiments: Liu et al.

Tested the efficacy of the H5N3 vaccines on chickens Allantoic fluid of H5N3 vaccine in oil-emulsion adjuvant was

efficacious against H5N1, concentration or purification not needed Added benefit of discriminating between vaccinated and infected

individuals

Discussion of Results

Results of the attenuated reassortant viruses and vaccine production indicate that use of reverse genetics have relevance to the prevention and control of H5N1 in poultry populations and potential human pandemic

Testing for a better animal model for humans has potentially been found

The benefits of using reverse genetic for vaccine process were demonstrated

Currently no human vaccine is available, but trials will start soon

Points to Ponder

Exclusive use of cell culture to generate and grow vaccine Who/what target for vaccination Other means of prevention: surveillance, stockpiling, communication Intellectual property rights on reverse genetics technology

Finally…

There is a worldwide surveillance set-up and the US has been efforts to accrue prophylaxes drugs, especially neuraminidase inhibitors

Stricter hygiene guidelines have also been enforced in domesticated poultry farms

These efforts serve as a template for any new emerging infectious disease

Hopefully we will not see the projected statistics of a pandemic influenza due to early intervention