beespace biology overview
DESCRIPTION
BeeSpace Biology Overview. BeeSpace Workshop IGB, UIUC • 21 May 2006. BeeSpace Goals. Analyze the relative contributions of Nature and Nurture in Societal Roles in Honey Bees Experimentally measure brain gene expression for important societal roles during normal behavior - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/1.jpg)
BeeSpaceBiology Overview
BeeSpace WorkshopIGB, UIUC • 21 May 2006
![Page 2: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/2.jpg)
BeeSpace Goals
Analyze the relative contributions of Nature and Nurture in
Societal Roles in Honey Bees
Experimentally measure brain gene expression for important societal roles during normal behavior
varying heredity (nature) and environment (nurture)
Interactively annotate gene functions for important gene clusters using concept navigation across biological
literature representing community knowledge
![Page 3: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/3.jpg)
Overview
Understanding Social Behavior
• Honey bees have only 1 million neurons
Yet…• Worker bee exhibits social behavior
• She forages when she is not hungry
but the Hive is• She fights when she is not threatened
but the Hive is
![Page 4: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/4.jpg)
Biology: The Model Organism
Western Honey Bee, Apis mellifera has become a primary model for social behavior
Complex social behavior in controllable “urban” environment
• Normal Behavior – honey bees live in the wild
• Controllable Environment – hives can be modified
Small size manageable with current genomic technology
• Capture bees on-the-fly during normal behavior
• Record gene expression for whole-brain or brain-region
![Page 5: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/5.jpg)
![Page 6: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/6.jpg)
Biological Foundations of BeeSpace
• There is a robust relationship between brain gene expression & social behavior
• Gene expression is the “first phenotype” and can be used to understand nature/nurture
![Page 7: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/7.jpg)
Nature and Nurture
both act on the genome
Heredity Environment
![Page 8: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/8.jpg)
(Whitfield et al, 2002)
![Page 9: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/9.jpg)
HomeComb build, Remove corpses, Hygienic behavior (remove diseased brood)
OffspringBrood care, Attend queen, Personal reproduction (worker)
DefenseGuard, Soldier
FoodForage for nectar, Forage for pollen, Forage for waterForage for resin, Scout, Process food (nectar to honey)Dance communication: sender, Dance communication: receiver
Principal Societal Rolesin the Honey Bee Colony
![Page 10: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/10.jpg)
Nature/Nurture Dissection I
Defense
Roles: Guard and Soldier (Hunt, Hoffmann, Alaux)
Nature: Types of Bees (European, African)
Nurture: Level of Threat (Alarm pheromone; Alaux)
![Page 11: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/11.jpg)
Nature/Nurture Dissection II
Role: Forager (onset age of foraging)
Hereditary factors:European and Africanized Bees (Hunt, Hoffmann)
ligustica and mellifera (Leconte, )
High/Low Pollen Hoarding Lines (Page, )
![Page 12: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/12.jpg)
Nature/Nurture Dissection III
Role: forager (onset age of foraging)
Social factorsPrecocious vs Normal Forager (Newman, Zhang, Ament)
Normal vs Overage Nurse
Typical vs Single-cohort colonyMales (?)
Queens (Corona, Hughes)
![Page 13: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/13.jpg)
Nature/Nurture Dissection IV
Role: Forager (onset age of foraging)
Physiological Manipulations affecting:
cGMP, Manganese, Insulin, Vitellogenin
Juvenile Hormone
TOFA (Fatty Acid inhibitor)(Maleszka, Ament)
Brood Pheromone, Queen Pheromone (Alaux)
![Page 14: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/14.jpg)
Nature/Nurture Dissection V
Dissection of Dance Communication
Species differences, Pts. 1 & 2 (Sarma)
“Distance genes” (Sarma)
“Direction genes” (Brockmann)
Time training (Moore and Naeger)
Scouts (Liang)
![Page 15: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/15.jpg)
Experimental Status
• Genome Complete and Microarray Fabricated (one + year late)
• Bees collected for Experiments– 3/4 last summer; 1/4 this summer
• Experiments complete with EST array• Experiments in progress with full array
• Initial Use of Interactive Annotation on-going• Planning Meta-level Functional Analysis
![Page 16: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/16.jpg)
Goals of Functional Analysis
• Identify genes regulated by heredity and environment… so what?
• Discover candidate genes (gene clusters, molecular pathways) for behavioral regulation… set up for causal experiments– Kr-h1 (Grozinger lab)
– In situ analysis project (Fahrbach lab)
![Page 17: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/17.jpg)
Examplar: Regulation of Brain Kr-h1 Expression by Queen pheromone
Regulates worker behavior:Retinue response
Delay nurse to forager transition**
Inhibit queen rearing
Inhibit ovary development
Christina Grozinger, NC State
![Page 18: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/18.jpg)
Worker responses to queen pheromone
In young bees: Retinue response (Slessor et al, Science 1988) Alter brain gene expression patterns (Grozinger et al PNAS 2003)
In forager bees: No retinue/attraction Still have antennal responses (Pham-Delegue et al 1993)
How is response modulated??
![Page 19: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/19.jpg)
Do foragers respond to QP at all?
• Look at brain gene expression– Kr-h1: downregulated by QP in the brains of
young bees• Place 30 foragers and 30 day-olds in a cage
with a queen for 3 days
![Page 20: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/20.jpg)
Does JH modulate response?
• JH levels much higher in foragers than young bees
• Treat young bees with methoprene (JH analog)
• Methoprene reduces QP’s effects on gene expression
• But Met-treated bees still attracted to QP in retinue
Kr-
h1
re
lativ
e e
xpre
ssio
n le
vels
Grozinger and Robinson JCPA, 2007
Grozinger et al,Naturwissenschaften,
2007
![Page 21: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/21.jpg)
What does Kr-h1 do?
• Downregulated by QP (2x) (Grozinger et al 2003)
• High in foragers compared to nurses (4x)(Grozinger and Robinson 2007)
• QP regulates transition to foraging… so Kr-h1 involved in foraging?
• What aspect of foraging? (Fussnecker and Grozinger in prep)
– Preparation for flight
– Neuroanatomical changes
– Phototaxis
![Page 22: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/22.jpg)
Function of Kr-h1?
But what does Kr-h1 actually DO???
Study effects on neuron structure in Drosophila (Tzumin Lee, UMass)
Use MARCM to study single neurons
WT LOF GOF
Shi, Lin, Grinberg, Grozinger, Robinson, Lee. Dev Neurobio. in press
![Page 23: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/23.jpg)
Associated with permanent brain changes?
• MB expand in foragers
• When foragers revert to nursing behavior, MB stay the same size (Fahrbach et al 2003)
• Is Kr-h1 associated with flight behavior, or “permanent” brain changes?
• Kr-h1 expression correlates with permanent change in brain
(Fussnecker and Grozinger, in prep)
![Page 24: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/24.jpg)
Effect of cGMP on Kr-h1 expression?
(Fussnecker and Grozinger, in prep)
Background: cGMP treatment causes premature onset of positive
phototaxis (Ben-Shahar et al 2003)
![Page 25: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/25.jpg)
Regulated directly/indirectly by cGMP?
• cGMP response element(Hum et al 2004)
N = ATCG; R = A, G; K = G/T; Y = T/C
(Fussnecker and Grozinger, in prep)
ConsensusApisDrosophilaAedesTribolium
AaAtRKaNTTCaAcAKTY AAATAGTCTTCCAAAGTAAAACATTCTTCAAAATTCAAATGTTTTTCCAAATTGAAATATTTTTCTAAATTT
![Page 26: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/26.jpg)
Comparative studies… Bumble beesHoney bee• Kr-h1 associated with foraging…
– QP regulates transition from nursing to foraging– Foragers less responsive to QP
• Kr-h1 & foraging or Kr-h1 & QP?
Bumble bee• Nurse vs. forager –
determined by size• Queen presence regulates dominance
status (reproduction)• In collaboration with Guy Bloch… Z. Huang
![Page 27: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/27.jpg)
Comparative studies… Bumble bees
• Partially sequenced Bt_Kr-h1 and Bt_PKG – the foraging gene;
increased expression in honey bee forager brain
(Fan, Patch, Bloch and Grozinger,prelim results)
![Page 28: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/28.jpg)
Associated with flight?
• Drones become competent to take mating flights when they are approx 5-7 days old
• Compare drones of different ages, with and without flight experience
• Kr-h1 expression matches likelihood of flight; not affected by experience
Z. Huang, MSU
(Fussnecker and Grozinger, in prep)
![Page 29: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/29.jpg)
Cellular localization of gene expression using in situ hybridization
• information in the brain flows through chains of connected neurons (circuits)
• different populations of neurons express distinctive complements of proteins (gene products)
• in situ hybridization localizes mRNAs encoding specific proteins to individual neurons
• this allows gene expression to be studied in the context of the neural circuits that produce behavior
![Page 30: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/30.jpg)
BeeSpace in situ hybridization projectsFahrbach Lab
• Goal: create “brain maps” for genes identified in microarray studies as associated with bee behavior using in situ hybridization– leverages more than a century of neuroanatomical studies BUT– requires develop of efficient approaches– current bottlenecks: frozen sections (10 μm), color reaction to reveal
digoxigenin-labeled probes– proposed solutions: Vibratome sections (100 μm), fluorescent probes
• Test set: 36 neuropeptide-encoding genes identified in the bee genome by a UIUC team using bioinformatics and proteomics (Hummon et al. 2006 Science paper)– set is “right size” for a test of new methods– peptides are expressed abundantly in very small populations of
neurons (often fewer than 10, out of approximately 1 million total neurons in the bee brain), so identification is unambiguous
– data produced will be of interest to insect neurobiologists independent of methods advances
![Page 31: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/31.jpg)
Progress report
• Rodrigo Velarde (Ph.D., Entomology, UIUC, May 2007) has recently joined Fahrbach laboratory at Wake Forest University
• Velarde’s previous experience in the Robinson laboratory included use of in situ hybridization to map the feeding-related neuropeptide NPF
• as a postdoctoral researcher, Velarde will coordinate all BeeSpace in situ hybridization projects
![Page 32: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/32.jpg)
Goals of Functional Analysis
• Array studies as papers?• Identify genes regulated by heredity and environment… so
what?
Ghostbusters Paradigm (descriptive, then analytical)
MAPK (Whitfield lab, Jason Ebaugh)• Discover candidate genes (gene clusters, gene pathways)
for behavioral regulation… set up for causal experiments
Kr-h1 (Grozinger lab)
![Page 33: BeeSpace Biology Overview](https://reader035.vdocuments.net/reader035/viewer/2022062422/56812bc6550346895d9010a7/html5/thumbnails/33.jpg)