bellringer
DESCRIPTION
Bellringer. Chemical structures that are involved in physiological processes, such as hemoglobin in blood, insulin that regulates blood glucose levels, and enzymes that regulate body functions, are all made of proteins. Name some parts of the human body that contain proteins. Key Ideas. - PowerPoint PPT PresentationTRANSCRIPT
BellringerChemical structures that are involved in physiological processes, such as hemoglobin in blood, insulin that regulates blood glucose levels, and enzymes that regulate body functions, are all made of proteins. Name some parts of the human body that contain proteins.
Key Ideas What is the process of gene expression?
What role does RNA play in gene expression?
What happens during transcription?
How do codons determine the sequence of amino acids that results after translation?
What are the major steps of translation?
Do traits result from the expression of a single gene?
Objectives: Transcription & Translation
Today: Describe gene expression Explain the role of RNA in gene expression Summarize transcriptionTomorrow: Explain how codons determine the amino acid
sequence of a protein Describe the steps of translation Identify a complexity of gene expression
How we get from DNA to traits.
Gene Expression
VocabularyRNAGene expressionTranscriptionTranslationCodon
An Overview of Gene Expression So far, we’ve discussed the structure of DNA…
being made of nucleotides that contain 1 of 4 different nitrogenous bases.
You should know that DNA’s job is to store genetic information.
You’ve also learned the cell cycle. We’ll be spending
the next few days on G1 of the cell cycle.
This is the phase where most of “living” takes place.
It’s the phase that proteins and traits are made.
The Purpose of DNA… The purpose of DNA itself is to house the
information necessary for heritable traits…meaning that it holds the information from which proteins are made.
This is what living is all about. The DNA in our chromosomes is like books on the
shelf of a library… just waiting to be read.DNA provides the original
information from which proteins are made in a cell, but DNA does not directly make proteins.
The Purpose of Life
An Overview of Gene Expression, Gene expression is the manifestation of
genes (contained in DNA) into specific traits. What does manifestation mean?
THE CENTRAL DOGMA OF BIOLOGY = DNA mRNA Protein Trait This process takes place in two main stages,1. Transcription: the process of copying the
directions for traits out of DNA by making mRNA
2. Translation: reading the directions copied in RNA and turning them into the amino acid sequences for the gene.
Directions to make HAIR COLORACTGAACTGCACTG…
DNARNAPROTEINTRAIT
THE CENTRAL DOGMA OF BIOLOGY
Directions for HAIR COLOR
Directions for EYE COLOR
Directions for SKIN COLOR
Directions for HOW TALL YOU ARE
Directions for FRECKLES
Genes:The basic units of heredity.They are located on specific regions of chromosomes, contained in DNA.There are thousands of genes “written” into each of the 23 chromosomes in our cells. They come from the original genes given to us from mom & dad.
So What Does a Real Gene Look Like?
Pro-melanin-concentrating hormone tacagcgtgt ggcattctcc ccacattctc cttcggcttt acggagcagc aaacaggatg
gcgaagatga gcctctcttc ctacatgtta atgctggcct tttctttgtt ttctcacggc attttacttt cggcctccaa gtccatcagg aacgtagaag cgacatagt atttaataca ttcaggatgg ggaaagcctt tcagaaggaa ataccgcagaagatcggt tgttgctcct tctctggaag gatacaaaaa tgatgagagc ggcttcatga aggatgaaga tgacaagacc acaaaggtac gtgtatgcag tctgcctttt attgcactag agatgaaaac gatgtttaca attataagcc acccagaagt aaattttgta ttttaatttt ataaataggc tacatacag tcattgtgtg tattaagata actaggaaaa cgtcatacaa accaggcatt tccccattct atccagaatc ttgtatcttg tctcgcatat ggaggtaaag acagtataca gcatcttaga actgatcagc aagaatgttg tacaactgta ttctagctct actctgaaga agacagctgg gatacaaacc aatcttctct tcacagaaca caggctccaa gcagaatctc gtaactcacg gtctgcccct cagtctggct gtaaaacctt acctcgctct gaaaggacca gcagtcttcc cagctgagaa tggagttcag aatactgagt ccacacagga aaagagggaa attggggatg aagaaaactc agctaaattt cccataggaa ggagagattt tgacagtgag tagccttcta aacatgcaat tcctacatat taattttata aaagagctct gagcttcact gagttggatc tgaccataac aaaatcaaga ccatagttca gttctatcaa atagtaggca gcccacgtca aaatggggaa tttttcaaaa tcagtaatag tggtttgttt tattctggat tcattataag tccacagatt ctcttaattc tgtgtggtaa ttatagtcat tgtttgttcc ttttcagtgc tcaggtgtat gctgggacga gtctaccgac cctgttggca agtctgatac ctgctggtcc acaacatcct ttcagaagaa aacgattcat tgcaagtgga gagaaaagcc cttaatgttg atgtaacttg tgtatcatcc taaatgtctg ttttaaaaga aactggttac aatatgtaaa tgctatgtaa atgatatgct ttgacttgtg cattaaactt cacaaaaatt ctgcata
-http://www.ncbi.nlm.nih.gov/gene/24659#reference-sequences
Hemoglobin Gene TACCACGACAGAGGACGGCTGTTCTGGTTGCAGTTCCGGCGGAC
CCCGTTCCAACCGCGCGTGCGACCGCTCATACCACGCCTCCGGGACCTCTCCTACAAGGACAGGAAGGGGTGGTGGTTCTGGATGAAGGGCGTGAAGCTGGACTCGGTGCCGAGACGGGTCCAATTCCCGGTCCGTTCTTCCACCGGCTGCGCGACTGGTTGCGGCACCGCGTGCACCTGCTGTACGGGTTGCGCGACAGGCGGGACTCGCTGGACGTGCGCGTGTTCGAAGCCCACCTGGGCCAGTTGAAGTTCGAGGATTCGGTGACGGACGACCACTGGGACCGGCGGGTGGAGGGGCGGCTCAAGTGGGGACGCCACGTGCGGAGGGACCTGTTCAAGGACCGAAGACACTCGTGGCACGACTGGAGGTTTATGGCAATTCGACCTCGGAGCCATCGTCAAGGAGGACGGTCTACCCGGAGGGTTGCCCGGGAGGAGGGGAGGAACGTGGCCGGGAAGGACCAGAAACTTATTTCAGACTCACCCGCCG
http://www.bio.davidson.edu/courses/Bio111/Hemomut.html
Gene Transcription and TranslationWhere Does it Occur?
RNA: A Major PlayerAll of the steps in gene expression
involve RNA. What exactly is RNA, & how does is
compare to DNA?First, like DNA, RNA is a nucleic acid
made of nucleotide subunits linked together.
RNA vs. DNA RNA is a nucleic acid like DNA But RNA differs from DNA in 3 ways.
1. First, RNA usually is composed of one strand of nucleotides rather than two strands.
a. The exception occurs in viruses
2. Second, RNA nucleotides contain the five-carbon sugar ribose rather than the sugar deoxyribose.
3. Third, RNA nucleotides have a nitrogenous base called uracil (U) instead of the base thymine (T).
a. Uracil (U) is complementary to adenine (A) whenever RNA pairs with another nucleic acid.
DNA vs RNA Structure Deoxyribose Nucleic Acid =
DNA◦ Is missing one oxygen in the
ribose sugar.
Ribose Nucleic Acid = RNA◦ Has all oxygens
Visual Concept: Ribonucleic Acid (RNA)
RNA: A Major Player In cells, three types of RNA complement DNA and
translate the genetic code into proteins.
1. Messenger RNA (mRNA) is produced when DNA is transcribed into RNA.
The mRNA carries instructions for making a protein from a gene and delivers the instructions to the site of translation.
RNA: A Major Player2. Transfer RNA (tRNA) “reads” the
instructions carried by the mRNA at the site of translation, then translates the mRNA sequence into protein subunits called amino acids.
3. Ribosomal RNA (rRNA) is an RNA molecule that is part of the structure of ribosomes.
Recall from CH7, ribosomes are the cellular structure where protein production occurs.
Objectives Define Transcription Summarize the steps of transcription
In order to help keep this straight, make a chart like the one below.
Step Major events
1
2
3
Transcription: Reading the Gene Transcription Steps
1. Transcription begins when RNA polymerase binds to the specific DNA sequence in the gene that is called the promoter.
- The promoter’s role is to signal the RNA polymerase where to start transcription.
- The DNA always contains the sequence TAC for the “start” signal.
Transcription: Reading the Gene
2. RNA polymerase then unwinds and separates the two strands of the DNA double helix to expose the DNA bases on each strand.
Transcription: Reading the Gene, 3. RNA polymerase moves along the bases on the
DNA strand and adds complementary RNA nucleotides to a growing mRNA as it “reads” the DNA of the gene until it reaches the “stop” signal. Remember that in transcription “U” matches with “A”,
not “T” like in replication. The “A” still matched to “T” though.
- As RNA polymerase moves down the DNA strand, a single strand of mRNA grows.
- Just as there is a “start” signal on the DNA, signaling the start of the gene, there is a “stop” signal as well.
- This region is specially designed to let the RNA polymerase know when the gene ends & therefore when to stop transcription.
- This stop signal is one of 3 DNA sequences: - ATT, ATC, or ACT.- What would the RNA sequences be? - UAA, UAG, or UGA
Visual Concept: Transcription
Transcription
Review A gene is similar to a recipe. Gene expression is like the process of baking a secret cake
recipe, complicated because the recipe is written in a language the chefs don’t understand.
It is written as one long sentence composed of just one word. The word is written in the language of the nitrogenous bases,
A, T, G, & C A gene is written in a unique language that must be
transcribed by a messenger that speaks the language of the chefs.
The way the recipe is delivered to the chefs (the ribosomes) in the cytoplasm (the bakery) is by the messenger “mRNA”.
mRNA copies the recipe during transcription and delivers it to the bakery in the cytoplasm for translation to occur (decoding the recipe in a different language to allow for baking the recipe).
In the cytoplasm the recipe is translated into the language of proteins (amino acids) and finally made into proteins.
Finally, the secret cake is made. Now it’s your turn to read the recipe.
Practice Transcription…making an mRNA complement to the gene in DNA.
Examine the DNA sequence above. Look through and identify the promoter region containing the
“start signal” of DNA. Underline it. Do the same for the “stop signal”. Write an RNA sequence of bases using the complement to the
entire DNA sequence using the RNA bases (A-U-C-G), starting with the sequence of the “start” site all the way until you reach one of the 3 “stop” sequences.
Only write the RNA sequence that complements the DNA sequence from the “start” to “stop” signals.
You have 5 minutes. Ask questions if you need to.
DNA= TCTACAGGAGCGCTGGCAAGACTGCCG
RNA= You make it.
Practice…o Find the start sequence…underline it.o Find the stop sequence…underline it.o Starting with the start sequence, transcribe the gene using the
RNA bases.o What you end up with is an mRNA transcript of the gene
contained in the DNA.
DNA: TCTACAGGTGCAAGACTGCCGmRNA:
In-class Exercise/HW Practice Transcribing: You’re going to play the role of the messenger now. You need to
be able to take a DNA sequence and identify the mRNA that will “copy” the recipe, the gene for a protein, so the recipe can be made by the ribosomes.
Gene Xlr23: CGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG
1. Copy this sequence down on a sheet of paper.2. Identify the “start” sequence within the DNA above
(underline it).3. From the start sequence, count in groups of three until
you reach one of the three “stop” signals.4. What is the “stop” sequence (underline it).5. Just below the DNA sequence you copied, transcribe
the DNA into a sequence of mRNA for the gene Xlr23.Tomorrow we will use this sequence to practice
translation.
ReflectionsWhat did you learn today?
Design an acronym of pneumonic device to remember the types of RNA and steps in transcription.
In-class Exercise/HW Practice Transcribing: You’re going to play the role of the messenger now. You need to
be able to take a DNA sequence and identify the mRNA that will “copy” the recipe, the gene for a protein, so the recipe can be made by the ribosomes.
Gene Xlr23: CGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG
1. Copy this sequence down on a sheet of paper.2. Identify the “start” sequence within the DNA above
(underline it).3. From the start sequence, count in groups of three until
you reach one of the three “stop” signals.4. What is the “stop” sequence (underline it).5. Just below the DNA sequence you copied, transcribe
the DNA into a sequence of mRNA for the gene Xlr23.Tomorrow we will use this sequence to practice
translation.
In-class Exercise/HW Practice Transcribing: You’re going to play the role of the messenger now. You need to
be able to take a DNA sequence and identify the mRNA that will “copy” the recipe, the gene for a protein, so the recipe can be made by the ribosomes.
Gene Xlr23: CGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG
1. Copy this sequence down on a sheet of paper.2. Identify the “start” sequence within the DNA above
(underline it).3. From the start sequence, count in groups of three until
you reach one of the three “stop” signals.4. What is the “stop” sequence (underline it).5. Just below the DNA sequence you copied, transcribe
the DNA into a sequence of mRNA for the gene Xlr23.Tomorrow we will use this sequence to practice
translation.
In-class Exercise/HW Practice Transcribing: You’re going to play the role of the messenger now. You need to
be able to take a DNA sequence and identify the mRNA that will “copy” the recipe, the gene for a protein, so the recipe can be made by the ribosomes.
Gene Xlr23: CGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG
1. Copy this sequence down on a sheet of paper.2. Identify the “start” sequence within the DNA above
(underline it).3. From the start sequence, count in groups of three until
you reach one of the three “stop” signals.4. What is the “stop” sequence (underline it).5. Just below the DNA sequence you copied, transcribe
the DNA into a sequence of mRNA for the gene Xlr23.Tomorrow we will use this sequence to practice
translation.
Objectives Day 2 Explain how codons determine the
amino acid sequence of a protein Describe the steps of translation Identify a complexity of gene expression
This is a short lecture so stay focused.
The Genetic Code: Three-Letter “Words”
What is the mRNA you decoded for gene Xlr23?TACAGTTCCGCGTCGGGCTAGACTGGAUGUCAAGGCGCAGCCCGAUCUGA ◦ Save this and we’ll move on…
What do you notice that is similar about the start and stop sequences?
There is significance in the number 3 in RNA.◦ It corresponds to what’s called a codon.
A codon is a three-nucleotide sequence in mRNA.
DNA
mRNA
The Genetic Code: Three-Letter “Words”
A codon is a key that corresponds to 1 of 20 amino acids. An amino acid is the building block of a protein.
Codons also act as the start or stop signal for translation. These “signals” are referred to as “start” and
“stop” codons on mRNA in genetics.So the start codon is…AUG (signals the
start of the gene)The stop codons are… UAA, UGA, UAG
(signals the end)
DNA, RNA, and Proteins Section 3
The Genetic Code: Three-Letter “Words” Refer to you handout. There are 64 mRNA codons.
The mRNA that is created in transcription is actually a collection of a series of 3-nucleotide sequences called codons. So each gene will contain nucleotides in
multiples of 3
The Genetic Code: Three-Letter “Words”
Your practice from last night…
Notice that the length of the gene is a multiple of 3…
This is the way all genes are…in multiples of 3.
This is why I asked you to count by threes until you reached the “stop” codon.
AUG-UCA-AGG-CGC-AGC-CCG-AUC-UGA
AUGUCAAGGCGCAGCCCGAUCUGA
The Genetic Code: Three-Letter “Words”
Each codon specifies for only one amino acid, but several amino acids have more than one codon.See leucine
This system of matching codons and amino acids is called the genetic code.
The genetic code is based on codons that each represent a specific amino acid.This is the translation tool that helps to
translate the mRNA from the nucleotide language into the language of amino acids.
Codons in mRNAFigure 13. The amino acid coded be a specific mRNA codon can be determined by following the three steps below. What amino acid does the codon GAA code for?
Translation: RNA to ProteinsTranslation is the process that changes the
mRNA molecule into the complementary amino acid sequence. Takes place in the cytoplasm occurs in a sequence of 5 steps Involves all three kinds of RNA and results in a complete polypeptide.
Translation: RNA to Proteins
Translation relies upon the tRNA molecule to act as the go-between for mRNA codon & the amino acid that corresponds to it.
There is only one specific amino acid for each codon.
The mRNA gets matched up with the right tRNA molecule because of the anti-codon region
An anticodon is a three-nucleotide sequence on tRNA that is complementary to an mRNA codon.
There are two important regions of a tRNA.
The area where the amino acid attaches &
The anticodon region, which is complementary to the codon of mRNA
The anticodon always decides which amino acid is carried.
AMINO ACID GOES HERE
tRNA matches mRNA here
The Steps to Translation
Translation: RNA to Proteins, Step 1 A ribosome attaches to the mRNA The UAC (methionine) tRNA attaches to the
start codon on mRNA within the ribosome. Step 2 The tRNA molecule that has the correct
anticodon and amino acid binds to the second codon on the mRNA. A peptide bond then forms between the two amino
acids, and the first tRNA is released from the ribosome.
Translation: RNA to Proteins, Step 3 The ribosome then moves one codon down
the mRNA, kicking the 1st tRNA out.
The amino acid chain continues to grow as each new amino acid binds to the chain and the previous tRNA is released.
Step 4 This process is repeated until one of three
stop codons is reached. A stop codon does not have an anticodon,
so protein production stops.
Translation: RNA to Proteins, Step 5 The newly made polypeptide falls of the ribosome, the
tRNA leaves the ribosome, & the ribosome falls apart.
Translation is complete & the polypeptide is free to go get processed into a protein in either the ER or the Golgi.
This is where translation ends but it doesn’t have to be the only protein made.
Repeating Translation Many copies of the same protein can be made rapidly
from a single mRNA molecule because several ribosomes can translate the same mRNA at the same time.
Translation: RNA to Proteins
AUG UCA AGG CGC AGC CCG AUC UGAStart Codon Other amino codons Stop Codon
Methionine
UAC
PEPTIDE BOND FORMS:Then the ribosome moves forward
RIBOSOME
Start Codon:
Always triggers the attraction of
the tRNA for methionine.
Anticodon
mRNA
AUG UCA AGG CGC AGC CCG AUC UGAUAC
Serine
AGUAnticodon
mRNA
Methionine
AUG UCA AGG CGC AGC CCG AUC UGAAGU
Serine
PEPTIDE BOND FORMS:Then the ribosome moves forward
The growing chain of amino acids is a
polypeptide, or in other words…a
proteinAnticodon
mRNA
Methionine
AUG UCA AGG CGC AGC CCG AUC UGAUCC
?
PEPTIDE BOND FORMS:Then the ribosome moves forward
Anticodon
mRNA
SerineMethionine
AUG UCA AGG CGC AGC CCG AUC UGAGCG
?
PEPTIDE BOND FORMS:Then the ribosome moves forward
?
Anticodon
mRNA
SerineMethionine
AUG UCA AGG CGC AGC CCG AUC UGAUCG
?
PEPTIDE BOND FORMS:Then the ribosome moves forward
?
Anticodon
mRNA
?SerineMethionine
AUG UCA AGG CGC AGC CCG AUC UGAGGC
?
PEPTIDE BOND FORMS:Then the ribosome moves forward
?
Anticodon
mRNA
? ?SerineMethionine
AUG UCA AGG CGC AGC CCG AUC UGAUAG
? ?
Anticodon
mRNA
? ? ?
Once the stop codon is reached translation terminates. There is no tRNA for the stop codon so the ribosome know to detach. The newly formed polypeptide then leaves to get processed.
SerineMethionine
Complexities of Gene Expression The relationship between genes and their effects is
complex. Despite the neatness of the genetic code, every gene cannot be simply linked to a single outcome.
Some genes are expressed only at certain times or under specific conditions.
Variations and mistakes can occur at each of the steps in replication and expression.
The final outcome of gene expression is affected by the environment of the cells, the presence of other cells, and the timing of gene expression.
Summary Gene expression produces proteins by
transcription and translation. This process takes place in two stages, both of which involve RNA.
In cells, three types of RNA complement DNA and translate the genetic code into proteins.
During transcription, the information in a specific region of DNA (a gene) is transcribed, or copied, into mRNA.
Summary, continued The genetic code is based on codons that each
represent a specific amino acid.
Translation occurs in a sequence of steps, involves three kinds of RNA, and results in a complete polypeptide.
The relationship between genes and their effects is complex. Despite the neatness of the genetic code, every gene cannot be simply linked to a single outcome.
In Class ExerciseCGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG AUGUCAAGGCGCAGCCCGAUCUGA Complete the Gene. Translation is the last step of gene expression as it forms
the final polypeptide. Your exercise today is to take the gene we transcribed into mRNA yesterday and translate it into a polypeptide. Write your polypeptide as a series of circles with the name of the corresponding amino acid within. This is the protein for the gene you transcribed.
Check these off with me to make sure you got it… Tomorrow you’ll have to transcribe & translate a much
bigger gene.
Methionine ? ? ? ? ? ?
How are you progressing? Answers to IC/HW Exercise
mRNA = AUGUCAAGGCGCAGCCCGAUCUGA Poly peptide chain = Methionine
Serine Arginine Arginine Serine Proline
Isoleucine
Homework
Now onto the Transcription/translation Exercise… Grab a ¼ sheet with the assignment
“Using the Genetic Code” This is CW/HW and it’s due tomorrow. It’s worth 25 pts “Assignments” Tomorrow you’ll use this knowledge to
transcribe and translate another gene.
Transcription/Translation Lab Working with a partner, analyze the
gene Xlr24 to determine the DNA sequence of the gene, the sequence of the mRNA, and the sequence of the amino acids that will form the polypeptide.
Answer the associated questions. This is a 100pt lab due next Monday.