Development 113, 539-550 (1991)Printed in Great Britain © The Company of Biologists Limited 1991

539

Binding of a factor to an enhancer element responsible for the tissue-

specific expression of the chicken aA-crystallin gene

ISAO MATSUO1, MASAHI KITAMURA1, KENJI OKAZAKI2, and KUNIO YASUDA1*1 Department of Biophysics, Faculty of Science, Kyoto University, Kyoto 606, Japan2Division of Molecular Genetics, Institute of Life Science, Kurume University, Kurume 830, Japan

* Author for correspondence

Summary

We have characterized a regulatory region of thechicken aA-crystallin gene using transfection assays,which revealed that a 84 base pair element (—162 to—79) in the 5' flanking sequence is necessary andsufficient for lens-specific expression. A multimer of thiselement functions as lens-specific enhancer and syner-gistically activates transcription from chicken aA-crystallin or /J-actin basal promoters fused to the CATgene. In vivo competition experiments demonstrated thatDNA sequences containing the 84 bp element reducedaA-crystallin-CAT fusion gene expression. A nuclearfactor present exclusively in lens cells binds to the 84 bp

element in the region between positions —165 and -140.Southwestern blot analysis showed that 61000 MT(61xlO3Afr) lens nuclear protein exhibited DNA-bind-ing activity specific to the 84 bp element. Our datasuggested that the 61xlO3A/r nuclear protein, and the84 bp element that it interacts with, may be involved inregulating the aA-crystallin gene expression in vivo.

Key words: gene expression, transcriptional regulation,aA-crystallin, lens, enhancer, DNA-binding protein, CATassay.

Introduction

Crystallins are structural proteins specific to vertebratelens cells and their gene expression is regulated spatiallyand temporally during vertebrate lens development(Bloemendal, 1981; Clayton, 1974; Piatigorsky, 1989;Yasuda and Okada, 1986). Lens placode is inducedfrom ectoderm by a close interaction with the optic cup,resulting in initiation of <5-crystallin gene expression inthe lens placode (Shinohara and Piatigorsky, 1976).Invagination of the lens placode forms a lens consistingof lens epithelial and fiber cells. After this stage of lensdevelopment, the ar-crystallin gene is transcribed and itsmRNA accumulates in lens epithelial and fiber cells.

During very early stages of development, ectopicexpression of crystallin mRNAs is observed temporallyin non-lens tissues such as the neural retina, pigmentedepithelium (Agata etal. 1983; Eguchi and Okada, 1973;Yasuda et al. 1983) and pineal (Watanabe et al. 1985).When these tissues are cultured in vitro, they changetheir differentiated state into that of lens tissue, forminglentoid bodies and accumulating large amounts ofcrystallin gene transcripts in these structures (Yasuda etal. 1983, 1984; Okada, 1983; Eguchi, 1986). Thisprocess is called 'transdifferentiation', and lens forma-tion from chicken embryonic neural retina is a typicalexample of this process. This is a very attractive system

to study the molecular mechanisms by which lensdevelopment and the expression of crystallin genes areregulated, since it has been shown that cultureconditions determine whether neural retina and pig-mented epithelial cells differentiate into their originalstate or into lens (Yasuda, 1979; Itoh and Eguchi, 1986).

We have shown by transfection of the chicken aA-crystallin gene into mouse lens cells that the sequencefrom —242 to -189 upstream of the transcription startsite is responsible for lens-specific expression (Okazakiet al. 1985). The mouse, rat and human y-crystallingenes, which are not formed in chicken, were shown tobe expressed in a lens-specific manner in chicken lenscells and their regulatory regions have been identified(Lok et al. 1989; Peek et al. 1990; Yu et al. 1990). Thedistal region (—118 to -88) and the proximal region(—88 to +43) of the mouse aA-crystallin gene arerequired for lens-specific expression in chicken lenscells (Chepelinsky et al. 1987). However, sequences upto —88 are sufficient for lens-specific expression intransgenic mice (Wawrousek etal. 1990). Thus, species-specific differences exist in the regulatory sequencesused by the chicken and mouse, despite the apparentspecies independence of lens-specific expression ofcrystallin genes.

To reveal the molecular mechanisms by which lens-specific expression of the chicken aA-crystallin gene is

540 /. Matsuo and others

regulated in a homologous system, we examined whichregions of the aA-crystaltin gene are required andsufficient for specific expression in chicken lens culturesduring transient transfections (Yasuda etal. 1988). Thedata that we present here show that the sequence from-162 to -79 (the 84 bp element) of the aA-crystallingene exhibits lens-specific enhancer activity and that aDNA-binding protein that interacts specifically with thesequence —162 to —128 plays a key role in regulatinglens-specific expression.

Materials and methods

Plasmid constructionspBSOCAT and pBS0CAT2 were used as reporter genes(Fig. 1). A short Xmnl-HindJH fragment of pSVOCAT(Gorman et al. 1982) was exchanged with a correspondingXmnl-Hindm fragment of pUC18 (pUSVOCAT). pBSOCAT

was constructed by exchanging a short Xmnl-Xbal fragmentof Bluescript with a corresponding Xmnl-Xbal fragment ofpUSVOCAT. pBS0CAT2 was constructed by cutting, bluntingand religating the BamHI site of pBSOCAT and then insertinga BamHI linker into the Xbal site. Thus, pBS0CAT2 has aBamHI site in front of the CAT gene. DNA fragmentscontaining the promoter sequences of the chicken crA-crystallin gene were obtained from pCrya4 containing theHindUl fragment spanning from —2.5X103 to +378 region ofthe chicken aA-crystallin gene (Okazaki et al. 1985).a373CAT, o242CAT, O-162CAT, and o82CAT contain thepromoter sequences -373 to +89, -242 to +89, -162 to +89and —82 to +89, respectively (Fig. IB). Basal promoters, a74,y355 and tkl97, contain the sequence of the chicken aA-crystallingene from —74 to +89, the sequence of the chicken /3-actin genefrom -55 to +53 and the sequence of the Herpes simplex virusthymidine kinase gene from —197 to +56, respectively. Toobtain plasmids containing from monomeric to tetramericrepeats of the 84 bp element upstream or downstream of the

A B

Amp

SV40Poly ApBSOCAT

(4715bp)Bluescript

MCS

'Sad BstXISacH EaglNotrXbal Sail PstlSphI Hindu'

(BamHI) [ "

-373 aA-Crystallin Promoter(MboU)Hin

+89linProm

(Hindi)

-197(PvuH)

tk PrmOter +56(B+gin)

-Actin Promoter =(SphI)-55(Mnll)

+53(Mnll)

-250CCTGGCAGCTCTTGTTCATCCAGATGATACCGATGCCCCT

-210GGGCAGAAACCGTCCCATGCATCACAGCCTGGCAGCATCC

-170CTCCAGGAGATCTGGCGCTGGTTCCCACCAGACTGTCATC

.-130CCCAGGTCAGTCTCCGCATTTCTGCTGACCACGTTGCCTT

-90CGTCGTGAGATCATGTCTTTCCAGAGAAATCCCACTAATG

-50CCTTCATTCTGCGAGTGCAGTATATATAGGGGCAGCCTTC

CCCGGGCTGCACTGTGCAGGCCAGCAAAGGCATCGCTGTC

+30CTCCGAGCGGTTGCGCGGCTCCCACGCTCTCCTGTTAGAA

Fig. 1. Schematic representation of expression vectors and sequence of the chicken aA-crystallin promoter. (A) Schematicrepresentation of expression vectors. The expression vectors were constructed from Bluescript (Stratagene) and pSVOCAT(Gorman et al. 1982) as described in Materials and methods. The CAT indicator gene and DNA fragment containing SV40poly(A) addition site are represented by open boxes. The portions derived from Bluescript and pSVOCAT are indicated bythick and thin lines, respectively. Ori, poly(A) and Amp show the replication origin, poly(A) addition site and ampicillinresistance-gene, respectively. To obtain pBS0CAT2, pBSOCAT was digested with BamHI, blunted and religated and then aBamYU linker was inserted into the Xbal site. Thus, pBS0CAT2 contains one BamHI site within multi cloning site (MCS).Basal promoters containing the Sacl-Hindlll fragment of the chicken aA-crystallin gene, the Pvull-BglQ fragment of thechicken /3-actin gene and the Mnll fragment of the Herpes simplex virus thymidine kinase genes were inserted between theSad and HindUl sites, between the Sail and HindUl sites and at the Sphl site of pBSOCAT, respectively, as shown belowthe map. (B) Sequence of the chicken aA-crystallin promoter. The arrow indicates the site of transcription initiation andthe TATA box is underlined.

Expression of chicken aA-crystallin gene 541

CAT gene, these units were inserted into the SacTl or BamHlsites of a74CAT constructed from pBSOCAT2, respectively.

Cell culturesTissues were isolated from 15-day-old chick embryos. Lenseswere dissected from eyes and the pigmented cells adhered tothe lenses were removed by rolling them on Whatmann 3MMsheet. They were cut into pieces and incubated in Hanks'saline solution containing 0.1% collagenase for 15min at37°C. Cells were dispersed by gentle pipetting, collected by abrief centrifugation and suspended in a fresh medium[Dulbecco's modified Eagle's medium supplemented with10% fetal calf serum (Flow Laboratories)]. They werecultured in fresh medium at a density of 105 per 60 mm dish(Primaria; Falcon Co.). When the cells reached confluence,they were harvested with trypsin and cultured at a density of1.5 xlO5 per 30 mm dish to obtain secondary cultures. 3 daysafter establishment of the secondary cultures the cells weretransfected. Brains, lungs, kidneys and thighs were collectedseparately, cut into pieces with a razor blade and dispersedwith 0.25 % trypsin in calcium- and magnesium-free Hanks'saline for lOmin at 37 °C. After this time cells were collectedby centrifugation and cultured as described for lens cellsabove.

TransfectionThe DNA-calcium phosphate coprecipitation method ofWigler et al. (1979) was used for transfection. In a typicalassay, cultures per 30 mm Falcon dish were cotransfected with2 jig of test plasmid and 0.5 jig of pmiwZ, which contains thechicken £-actin promoter and the RSV LTR sequence(Suemori et al. 1990), and served as an internal control fornormalyzing transfection efficiencies. Fresh media was added6 h after transfection and the cultures were washed three timeswith, and harvested in, phosphate-buffered saline (PBS,pH7.4) 48 h later. The cells were collected by briefcentrifugation and resuspended in 50 /A of 250 HIM Tris-HCl(pH7.8). Extracts were prepared by freezing-thawing andgentle homogenization and cell debris was removed by briefcentrifugation. Aliquots of the lysate with or withoutincubation at 60 °C for 5min were assayed for CAT and/3-galactosidase activities, respectively.

CAT and fi-gal assaysCAT assays were performed essentially according to theprocedure of Gorman et al. (1982) as modified by Hayashi etal. (1987). /3-galactosidase activities were assayed by theprocedure of Edlund et al. (1985). Protein concentration wasmeasured by a Biorad protein assay (Biorad Co.).

In vivo competition experimentThe specific (pl6S) and unspecific (p20N) competitor plas-mids contain a 16-mer of the sequence -253 to -90 and a 20-mer of the sequence —373 to —162 at the BamHl site ofpUC18, respectively. A constant amount of plasmid ad62CAT(0.5 /ig per 30 mm dish) was transfected into lens culturesalong with a constant amount of pmiwZ (0.1 ng) andincreasing amounts of specific or unspecific competitor DNAsas shown in Fig. 4. By day 2 after transfection, the cultureswere harvested and the CAT activities of their lyzates wereassayed.

Preparation of nuclear extractsTissues were isolated from 1-day-old chickens and washedtwice with PBS. Nuclear extracts were prepared according tothe procedure of Dignam et al. (1983). The procedure isprincipally as follows. Minced tissues were homogenized in a

lysis buffer [20mM Hepes (pH7.9), 0.6M KC1, 1.5mM MgCl,0.2mM EDTA, lmM DTT, 0.2mM PAMSF and 25% (v/v)glycerol] by 10 strokes with a B-pestle in a Douncehomogenizer. Nuclei were pelleted by centrifugation, sus-pended in lysis buffer at a concentration of 108 nuclei ml"1

and extracted by a gentle stirring for 30min at 4°C. Nucleiwere pelleted by centrifugation and the supernatant wasdialyzed against a buffer containing 10mM Hepes (pH7.9),0.1 M KC1, 3mM MgCl, lmM DTT, 0.2mM EDTA, 0.2mMPAMSF and 10% (v/v) glycerol. Aliquots of the nuclearextract were quickly frozen in liquid nitrogen and stored at-80°C until use.

Gel mobility shift assayFragments to be used for gel mobility shift assay wereobtained by digesting Alul-Smal DNA fragment spanningfrom -243 to - 7 with one or two of the restrictionendonucleases Bg/II, Mval, and Sau3Al as shown in Fig. 3.The resulting DNA fragments were separated by agarose gelelectrophoresis, isolated and end-labelled with Klenowenzyme using [a--32P]dNTP. Probes (10000ctsmin"1ng"1

DNA) were reacted with nuclear extracts (10 ng) in 10 /d of abinding buffer containing 0.1M NaCl, 10 mM Tris-HCl(pH7.5), lmM EDTA, lmM DTT, poly dI:dC (lOOjigmr1)and 10% (v/v) glycerol for 30min at room temperature.These reaction mixtures were immediately loaded on a 4 %polyacrylamide gel, which had been prerun for 2 h at aconstant voltage of 180 V, and run for 2 h at room temperatureat a constant voltage of 150 V (10 V cm"l) with a circulation ofa buffer (1/4 TAE buffer). The gels were transferred toDEAE papers, dried and autoradiographed.

Southwestern blot analysisTo make the probes for southwestern analysis, specific (—162to —83) and non-specific sequences (—242 to -163) werelabelled using the Klenow fragment of E. coli DNApolymerase and [a--32P]dNTP. Nuclear proteins were separ-ated by 10% SDS-polyacrylamide gel electrophoresis andblotted electrophoretically onto nitrocellulose membranes(Schleicher & Schuell). The membranes were soaked in 5%skim milk solution containing 10 mM Tris-HCl (pH 7.4) for 1 hat a room temperature and then reacted with specific or non-specific DNA probes in the binding buffer used for gelmobility shift assay in the presence of competitor DNA (polydLdC, Pharmacia). Subsequently, the membranes werewashed 3 to 4 times in a binding buffer 10 min each at roomtemperature, dried and autoradiographed.

DNAase I footprinting analysispUaE/H (Okazaki et al. 1985) was cleaved with EcoRI andHindUl and the DNA was electrophoretically separated on anagarose gel. The DNA fragment containing the sequencesfrom —242 to +10 of the aA-crystallin gene was recoveredfrom the gel and endlabelled at both ends using Klenowenzyme. Endlabelled DNA fragments were obtained bycleaving either with Sail or Kpnl. The standard reactionconsisted of the following components in a final volume of10/A: 10mM Hepes (pH7.5), 100mM NaCl, lmM EDTA,1 mM DTT, 0.5 mM PMSF, 50 ng of carrier DNA (poly dI:dC),1-3 ng of end labelled DNA fragment and up to 5 jA of nuclearextracts. Extracts were preincubated with the carrier DNA inthe reaction mixture for 10 min at 0°C, after which time theend-labelled DNA fragment was added and the mixtureincubated for an additional 10 min at 20 °C. Freshly dilutedDNAase I (lOumT1; DPRF, Worthington Co.) was addedand incubated for 60 s at 37 °C. Reactions were stopped by theaddition of 2 volumes of 50mM EDTA, 0.2% SDS,

542 /. Matsuo and others

100fig m l L of yeast tRNA and 100 fig m l ' of proteinase Kand incubation for 30min at 37 °C. Nucleic acids wereextracted with an equal volume of phenol:chloroform (1:1),ethanol precipitated, dissolved in 99% formamide, 10mMEDTA, with tracking dyes and heated at 90°C for 3 min. TheDNA fragments were separated on 6 % polyacrylamide/7.5 Murea gels. The gels were transferred to Whatman 3MM paper,dried and exposed for autoradiography.

Results

Identification of a cis-element required for lens-specificexpression of the chicken aA-crystallin geneTo assess the role of the immediate 5' upstreamsequence of the chicken aA-crystallin gene in tissue-specific expression, the gene promoter (—373 to +89)was fused to the chloramphenicol acetyl transferasecoding region (CAT gene) of a bacterial gene. Thisrecombinant DNA (a373CAT) was cotransfected intocultures prepared from various tissues of 15-day-old

chick embryos with a plasmid pmiwZ, which served asan internal control for transaction efficiency. CATactivities were normalized to /3-galactosidase activity foreach transfection.

The CAT activity of lens cultures containing plasmido373CAT was about 50 times higher than in lung, liverand muscle cultures transfected with the same plasmid(Fig. 2A). However, it should be noted that CATactivity in brain cultures was about 5-10 % of that oflens cultures and was always much higher than in othernon-lens tissues. o373CAT was also efficiently ex-pressed in neural retina cultures (data not shown).These results demonstrate that expression of this fusiongene is controlled in a tissue-specific manner and thatthe DNA sequence from -373 to +89 is essential forthe regulation of lens-specific expression of the aA-crystallin gene.

To determine more precisely the DNA sequencerequired for lens-specific expression, we constructedmutant genes with a series of 5' upstream deletions

A -373ICAT CM

I

Lens

Brain

Lung

Liver

Muscle

B-2k -373 -242 -162 -82 -7

I CAT

Ac-CM

• •

Relative CAT Activity1 2 3 4 5

1 2 3 4 5

H I CAT

I CAT

I CAT

I CAT

•I I CAT

Fig. 2. Identification of a cis-element in the aA-crystallin gene promoter which is responsible for lens-specific expression.Tissue-specific expression of the aA-crystallin gene. a373CAT was cotransfected with a plasmid pmiwZ into primarycultures (lens, brain, lung, liver and muscle) by the calcium phosphate precipitation method. After 48h the cells wereharvested, and CAT activities in soluble fractions of transfectants were assayed using thin layer chromatography. Thepercentages of conversion of labeled chloramphenicol (CM) to its acetylated derivatives (Ac-CM) in CAT assays werecalculated directly by measuring the radio activities of spots corresponding to those of CM and Ac-CM on thin layerchromatpgrams using a Fuji Bioimage Analyzer BA-100. CAT activities were normalized to /3-galactosidase activities foreach transfection. Histograms show the relative levels of CAT activity in cultures. Each value represents the average fromtwo independent experiments. (B) 5' deletion analysis of the aA-crystallin promoter region responsible for lens-specificexpression. Deletion mutants were constructed using the restriction enzyme cleavage sites shown at the top. Transfectionsand detection of CAT activities were performed as described above. Histograms show the relative CAT activities of these5' deletion mutants in lens cultures. The values represent the average of two independent experiments.

Expression of chicken aA-crystallin gene 543

using restriction endonuclease cleavage sites. Fig. 2Bshows the CAT activities of these deletion mutants inlens cultures. A recombinant plasmid containing about2 kb upstream region was as efficiently expressed asa373CAT, indicating the absence of additional import-ant elements upstream nucleotide -374. Deletion ofnucleotides -242 to -162 gene did not diminishtranscription level significantly, whereas further de-letion to nucleotide -82 resulted in a 10-fold decreasein stimulating activity. These results suggested that theDNA sequence between positions —162 and —83(termed the 84 bp element, since filling in both ends ofthe BgHI-Sau3Al DNA sequence between -162 to-83 generates an 84 bp DNA sequence between —162and —79) is involved in regulating lens-specific ex-pression of the aA-crystallin gene.

Multimers of the 84 bp element synergistically enhancelens-specific expressionIn a wide range of cell types, tissue-specific geneexpression is regulated by enhancers that can activategenes independent of orientation and distance (Serflinget al. 1985). For crystallin genes, enhancers have beenfound for the mouse oA- (Chepelinsky et al. 1987) andyF-crystallin (Lok et al. 1989) and the chicken 81-crystallin genes (Hayashi et al. 1987; Goto et al. 1990).

To test for enhancer activity of the 84 bp element inlens cells, we inserted up to 4 copies of this sequence inits native or reverse orientation immediately 5' to anaA-crystallin basal promoter (-74 to +89) fused to theCAT gene and transfected the resulting constructs intolens or lung cells (Fig. 3). In this paper, lung cultureswere employed as a control culture representative ofnon-lens tissues. No74CAT and Ro74CAT, whichcontain one copy of the 84 bp sequence in normal andreverse orientations, respectively, showed a CATactivity comparable to that of arl62CAT in lens cells.However, they were inactive in lung cultures. Thus,these indicate that the 84 bp element exhibits lens-specific enhancer activity.

Increasing the number of copies of the 84 bp elementplaced immediately 5' to the crystallin basal promoterin either orientation synergistically activated transcrip-tional activity in lens cells. Multimerization to a trimeror tetramer of the 84 bp element led to a remarkableactivation, by a factor of 28 or 96, respectively, in lenscells, but only to a 2- to 3-fold activation in lung cells(Fig. 3A). An effect of the orientation of insertion wasfound. In lens cells, multimers in reverse orientationgave about 1.5-fold greater activation than those in thenormal one. In contrast, in lung cells multimers innormal orientation gave a basal level of expression butthose in reverse orientation completely inhibited CATactivities in this tissue.

To determine whether the 84 bp element can functionat a distance, a trimer of the 84 bp element was insertedin either orientation into the BamHl site of a74CAT,1.6 kb downstream of the transcription start site. Theseconstructs promoted transcription but only weakly,suggesting a distance-dependency of the enhanceractivity. However, a trimer of the 84 bp element

activated the transcriptional level in lens cells whenplaced in its normal orientation 2.0kb 5' of the aA-crystallin gene bearing -2.0kb of the 5' flankingregion, which contains one 84 bp element in the originalsite. These results suggest that a close association of atleast one 84 bp element 5' to TATA box is essential forthe 84 bp element to exhibit enhancer activity from adistance. To test this possibility, we inserted a trimer ofthe 84 bp element 1.6 kb downstream from the start siteat the BamHl site of O-162CAT, which contains one84 bp element close to the TATA box. The resultingconstruct a!62CATN3 showed an enhancing activity inlens cells comparable to that of N3a74CAT and a 30-fold greater activity than o74CATR3. al62CATN3 didnot function at all in lung cells. Taken together, theseresults indicate that the 84 bp element of the chickenaA-crystallin gene has an enhancer activity and must beinvolved in regulating lens-specific expression.

The 84 bp element has a lens-specific enhancer activityTo determine whether the 84 bp element could activateexpression from a heterologous promoter and is alsosufficient for lens-specific expression from such apromoter, we constructed chimaeric genes containing atrimer of the 84 bp element upstream or downstream ofthe chicken /3-actin basal promoter (—55 to +53)coupled to the CAT coding region. This promotercontains a TATA element, a transcription start site, andis an equally very poor promoter in any cell type;fibroblasts, lung and lens cells (Fig. 3; /J55CAT). Asthree copies of the 84 bp element have shown a verystrong lens-specific activity in promoting transcriptionfrom the chicken aA-crystallin promoter, one would beexpected to be able to detect easily their effect on CATactivity from a heterologous promoter, the chicken/5-actin basal promoter. Thus, using constructs contain-ing a trimer of the 84 bp element, their enhancer activitywas examined. N3/355CAT and R3/355CAT, in whichthree copies of the 84 bp element were placed in normaland reverse orientation, respectively, immediately 5' tothe chicken /?-actin basal promoter showed an enhanc-ing activity comparable to those of N3o74CAT andR3o74CAT in lens cells. However, N3jS55CAT andR3/J55CAT showed no activation at all in lung cells.Insertion of a trimer of the 84 bp element 1.6 kbdownstream of the transcription initiation site(£55CATN3 and 055CATR3) led to a lower enhancingactivity in lens cells compared to N3/355CAT andR3/?55CAT. This tissue-specific enhancer activity of the84 bp element was also observed when a Herpes simplexvirus thymidine kinase promoter (-197 to +56;tkl97CAT) was used as the basal promoter (data notshown). Taken together, these results indicate that the84 bp element of the aA-crystallin gene confers lens-specific expression independent of orientation, distanceand promoters, indicating that the 84 bp elementfunctions as a lens-specific enhancer.

In vivo competition experimentThe results mentioned above suggest the presence of atrans-&c\.mg factor(s), which binds to the 84 bp element

544 /. Matsuo and others

-162

•7*

-74

a i62 CAT

(X74CAT

N1 0C74CAT

N20C74CAT

N3 O74CAT

N4O74CAT

R1 O74CAT

R2O74CAT

R3O74CAT

O74CATN3

a i62CATN3

] a 74CATR3

a2KCAT

N3 (X2KCAT

P55CAT

N3 P 55CAT

R3 P55CAT

> P55CATN3

3 P 55CATR3

'WVW/vVVWWWWA' IK197CAT

pBSOCAT

Lens Cell Lung Cell

CX162CAT

a 74CAT

N1 0C74CAT

N2a74CAT

N3a74CAT

N4O74CAT

R1a74CAT

R2a74CAT

R3a74CAT

a74CATN3

a162CATN3

a74CATR3

a 2KCAT

N3a2KCAT

P 55CAT

N3 P 55CAT

R3 p 55CAT

P 55CATN3

P 55CATR3

1 9 7 C A T

g pBSOCAT

0 09 0• 00 0

0 «

o i

9 0

0 0

• 09 0

o •• 09 0o 4

0 0

• 0• 4• 40 0

• 4

0 0

a

•

B

O

•

0

o

o

o

a

o

o

Relative CAT Activity1 2 3 4 $ g y^ 1.5 1.6

Lens cell

Lung cell

Fig. 3. Lens-specific enhancer activity of the 84 bp element.Enhancer activity of the 84 bp element was examined in lensand lung (as a control) cultures in transient transfections.(A) Schematic representation of plasmid constructs andhistograms showing the relative levels of their CAT activitiesin lens and lung cells. The thin line, thin open box andzigzag line represent basal promoters derived from thechicken aA-crystallin, chicken /3-actin and the Herpessimplex virus thymidine kinase genes, respectively. Numbersabove the lines represent the nucleotide positions relative tothe transcription initiation site (arrows). The open box witharrowhead represents the 84bp element (-162 to -79) andits relative orientation. The open box represents the CATgene. Plasmid construction, transfection and measurement ofCAT activity are described in Materials and methods section.Relative CAT activities of the various constructs in lens(open bar) and lung cells (closed bar) are shown with theCAT activities of tkl97CAT in lens and lung cells arbitrarilyassigned as 1. Each value represents the average from threeindependent experiments. (B) Autoradiograms of CATassays. DNA constructs correspond to those in the A.

Expression of chicken aA-crystaUin gene 545

thus activating aA-crystallin gene expression in a tissue-specific manner. In order to explore the nature of thefactor(s) that binds to the 84 bp element of the aA-crystallin gene, we carried out an in vivo competitionexperiment (Baldwin and Sharpe, 1987; Goto et al.1990). Plasmids a-162CATand o74CAT, which differ bythe presence or absence, respectively, of the 84 bpelement, were transfected separately into lens culturecells along with various amounts of a competitorplasmid. Two competitor plasmids were used in theexperiment. Plasmids pl6S and p20N contained 16tandem copies of the sequence -253 to -90 and 20tandem copies of the sequence -373 to -162,respectively, of the aA-crystallin promoter at theBamYQ. site of pUC18. To examine the effect of thecompetitor DNAs on CAT activity in lens cells, aconstant amount of arl62CAT was transfected into lenscells along with varying amounts of competitor plasmid.The amount of O-162CAT was fixed at 0.5 ng/dish andthat of competitor DNAs was increased up to 5 f/g/dish.Fig. 4 showed that an increasing amount of the non-

100r

80

C? 60

•>

o< 40

20

-253-90

50 100 150 300

Molar ratio of competitor DNAto reporter gene

Fig. 4. Competition in vivo for a factor that interacts withthe aA-crystallin promoter. Plasmids arl62CAT (0.5 ng perdish) and pmiwZ (0.1//g) were transfected into lenscultures alone or with 1 to 7 /xg of plasmids that contain aunidirectional 16-mer of DNA sequence —253 to —90(pl6S) or a unidirectional 20-mer of DNA sequence —373to -162 (p20N) at the BamHl site of pUC18 CATactivities were determined and normalized to/J-galactosidase activity as described in the Materials andmethods. The relative CAT activities of O-162CAT areshown with specific (closed circle) and unspecific (opencircle) competitors with the CAT activity of arl62CAT inthe absence of competitors assigned as 100 %. The molarratio represents the relative concentration of sequences—373 to —162 or -253 to -90 contained in competitors tothat of sequence —253 to —90 in the reporter gene.

specific competitor DNA had no effect on CAT activityeven when present at 300-fold molar excess over thereporter gene. In contrast, the levels of CAT activitywere proportionally reduced with an increasingamounts of the specific competitor DNA and wereinhibited to about 50% in 150-fold molar excess.Neither competitors, however, affected the expressionof o74CAT(data not shown). These results indicate thepresence of a trans-acting factor in lens cells, whichinteracts with the 84 bp element and stimulates the aA-crystallin promoter function in a lens-specific manner.

Binding of a factor to the 84 bp elementTo examine whether nuclear proteins in lens cells bindto the 84 bp element, we used an electrophoretic gelmobility shift assay. We reacted lens nuclear extractswith the endlabelled 84 bp element at 20 °C for 30minand then separated the DNA-protein complexes fromfree probes by agarose gel electrophoresis. Fig. 5Ashows that a major shifted band was observed with thisprobe, indicating the presence of lens nuclear proteinswhich specifically bind to the 84 bp element. Then, the84 bp element was cleaved into two fragments withMval to test whether either of them would yieldDNA-protein complex. Fig. 5A shows that only thesequence —162 to —128 showed the binding activity.These results indicate that a lens nuclear factor(s) bindsto the sequence from —162 to -128. To test thesequence-specificity of the DNA-protein complexformation with lens nuclear extracts, a 50-fold molarexcess of unlabelled specific or unspecific oligonucleo-tides were added to the reaction mixtures (Fig. 5B).The DNA-protein complex formation was competedaway efficiently by specific oligonucleotides containingthe sequence from -162 to -128 (Fig. 5B; a, b) but notby oligonucleotides that do not contain this sequence(Fig. 5B; c, d, e). These results confirm the hypothesisthat a lens cell nuclear protein specifically interacts withthe sequence from —162 to -128, which had previouslybeen shown to be essential for lens-specific expression.

To test whether the specific DNA-binding activityexhibits a tissue-specific distribution pattern, wereacted an equal amount of nuclear extracts fromdifferent tissues with a specific probe, sequence —162 to— 128, and examined the ability to form a DNA-proteincomplex by electrophoretic mobility shift assay(Fig. 5C). The specific DNA-protein complex wasformed efficiently with nuclear proteins from lens cells;however, no complex formation was observed withkidney and heart nuclear extracts, in which no crystallinexpression was detected. A weak shifted band was,however, detected with brain nuclear extracts. Theseresults indicate that levels of DNA-binding activityamongst nuclear extracts from various tissues correlateswell with the expression levels of the aA-crystallin genetransfected into these tissues (Fig. 2A).

Southwestern blot analysis of nuclear proteinsWe reacted lens nuclear protein blots with specific(-162 to -82) or unspecific probes (-242 to -163) todetermine if we could detect the protein responsible for

546 /. Matsuo and others

Aluli

-242

Bglll

-162

b —

Mval|

-127

Sau3AI

-82

Smal .i

-7 iE1

B

•

- +b

- + 50 50 50 50 50

a b c d e

L B K H

Fig. 5. Analyses of DNA-binding activity by gel mobility shift assay. DNA fragments (a: -162 to -83; b: -162 to -128;c: -127 to -83) were obtained by cleaving a242CAT at the restriction enzyme sites shown at the top and labelling byfilling in the ends using Klenow fragment. Nuclear extracts were prepared from various tissues of 1-day-old chickensaccording to the procedure of Dignam et al. (1984). The formation of DNA-protein complexes was carried out asdescribed in Materials and methods. After incubation for 30min at 20°C, the complexes were separated from the freeDNA probe by electrophoresis in a low ionic buffer. The gels were dried and autoradiographed. (A) Nuclear proteins fromlens cells bind to the 84 bp element. Probes (b, c and d) are shown at the top. Probes were reacted with (+) or without(—) lens nuclear extracts. The arrow shows specific DNA-protein complexes. (B) Competition of various promoter regionsfor specific DNA-protein complex formation. Sequence -162 to -128 (a) was used as a probe. Reactions were carried outin the absence (+) or presence of 50 molar excess of unlabelled competitor DNAs (a,b,c, d and e). Specific DNA-proteincomplex is shown by the arrow. (C) Tissue-specific distribution of a factor that interacts with the 84 bp element. Specificprobe -162 to -128 was reacted without (-) or with an equal amount of nuclear extracts from various tissues (L, lens; B,brain; K, kidney; H, heart) and the complexes were separated from free probe as described in Materials and methods. Thearrow shows specific DNA-protein complex.

the sequence-specific DNA-binding activity observedby the gel mobility shift assays. We prepared nuclearprotein gel blots separated by SDS-polyacrylamide gelelectrophoresis and then reacted them with the specificor unspecific probes. Fig. 6A shows the results obtainedwith lens, brain, heart and lung nuclear extracts. In lensnuclear extracts, the specific probe binds to 110x 103 Mrand 61xlO3Mr proteins, even in the presence of largeamounts of carrier DNAs. In other nuclear extracts, thespecific probe binds only to the HOxlCPM,- protein andnot to the 61xlO3Mr protein, even if under less-stringent conditions. The non-specific DNA probesinteracted with HOxlC^ M,. protein in all nuclearextracts, suggesting that this HOxlCPA/r protein maybe a non-specific DNA-binding protein. Together,these results indicate that the 61 x 103 MT protein might

be a candidate for the 84 bp element-specific DNA-binding protein, since this is the only protein that hastissue and DNA-sequence specificities similar to thoserevealed by gel retardation assay. This is also supportedby our recent results using DNA affinity chromatogra-phy, by which an 84 bp element DNA-binding proteinwas purified to homogeneity from brain nuclear extractsand appeared to be consist of 61-63xlC^M,. proteins(Kitamura and Yasuda, unpublished observations).

Identification of binding sites by DNAase IfootprintingTo determine more precisely the binding sites, DNAaseI footprinting assays were used. For this experiment, weobtained EcoRI-Hindlll fragment of pUaE/H con-

Expression of chicken cxA-crystallin gene 547

B

110-

6 1 - ,

L B K H L B K H

D

I5;!

a-164

-140

-155 i .

- * - "Ti4i

taining aA-crystalUn DNA, from the Alul site at - 242to the Haelll site at +10, labelled them by filling in theends and then obtained endlabelled probes by digestingthem with Sail or Kpnl. We reacted the end-labelledDNA fragments with lens nuclear proteins or bovineserum albumin, as a control, for 30min at 20°C andthen treated them with DNAase I at 37°C for l min.Fig. 6B shows the results of running these digestedDNA fragments separately on a sequencing gelcontaining 10% acrylamide and 7.5 M urea. On thecoding sequence, a region stretching from —165 to —140was protected from DNAase I cleavage. Weak protec-tion was also observed between -60 and -80 and this issupported by the appearance of a hypersensitive site atposition —70. On the other hand, on the non-codingsequence the only protected region stretched from

Fig. 6. Southwestern and DNAase I footprinting analysesof binding sites of a factor present in lens nuclear extract.(A, B) Southwestern analysis. Proteins in nuclear extractsfrom various tissues (L, lens; B, brain; K, kidney; and H,heart) were separated on SDS-polyacrylamide gelelectrophoresis and blotted electrophoretically ontonitrocellulose membranes. The filters were treated with5% non-fat skim milk and then reacted with double-stranded DNA probes -162 to -83 (A) or -242 to -163(B) in the presence of carrier DNA (sonicated salmonsperm DNA). Fragments were labelled at both ends byfilling in the ends with Klenow fragment. Molecular massare indicated in xlO3 at the left. (C, D) DNAase Ifootprinting analysis. DNA fragment containing thesequence —242 to +10 at the BamHl site of pUC18 wascleaved at both the EcoBl and Hindlll sites. Thefragments were labelled by filling in the ends and cleavingat the Sail or Kpnl sites to obtain one end-labeled probes.The probe was incubated with lens nuclear extracts (+) orBSA (-) as a control at 20°C for 30min and then treatedwith DNAase I at 37°C for lmin. The resulting DNAfragments were extracted with phenol-chloroform,precipitated, resolved and then separated on sequencinggel in the presence of 7.5M urea. The gels were dried andthen auto radio graphed. Regions protected from DNAase Icleavage of the coding (C) and noncoding (D) strands areshown as the open boxes at the right side of the panel andthe numbers represent the nucleotide positions from thetranscription start site.

-164 to -141. These results confirm those of gelmobility shift assay, which revealed the presence of lensnuclear protein binding to the sequence —162 to —128.

Discussion

The study of the regulation of eucaryotic geneexpression has focused on both the sequences requiredfor gene expression and the nuclear factors that interactspecifically with these regulatory elements. In thisstudy, we have identified a regulatory element betweennucleotides —162 and -79 (the 84 bp element) of the 5'flanking sequence of the chicken aA-crystallin genethat is required for lens-specific expression (Fig. 2A).We have also demonstrated that this element canfunction to stimulate transcription from a heterologouspromoter. Insertion of three copies of the 84 bp elementimmediately 5' of the chicken /3-actin basal promoterstimulated expression from this promoter (Fig. 3).Furthermore, we have identified a nuclear factor thatbinds to the 84bp element (Fig. 5 and 6). Recognitionof this sequence is important for gene expression in vivosince cotransfection with an excess of plasmids contain-ing multiple copies of the binding site effectivelyreduced the CAT activity of a reporter gene whoseexpression is under the control of the binding site(Fig. 4). The DNA-binding protein exists exclusively inlens cells (Fig. 5C), suggesting that the binding proteinidentified here is a lens-specific transcription factor.This factor is a polypeptide with a relative molecularmass of 61xl(r and binds to the region betweennucleotides —165 and -140 (Fig. 6). These results show

548 /. Matsuo and others

that the 61xlO3Mr lens nuclear protein and the 84 bpelement that it interacts with have a direct role inregulating the lens-specific expression of the chickenaA-crystallin gene.

Regulatory regionsDeletion mutations of the aA-crystallin gene promoterdefine a sequence element between —162 and —79 (the84 bp element) that directs lens-specific gene expression(Fig. 2B). We have also demonstrated that this 84 bpelement can stimulate a heterologous promoter. Fusionof this element to the chicken /3-actin basal promoter(—55 to +53) stimulated expression from this promoterbut only in lens cells, therefore the 84 bp element issufficient for lens-specific expression (Fig. 3). In aprevious paper, by transfecting mouse lens cells with 5'deletions of the chicken aA-crystallin gene, we re-vealed that lens-specific expression required a sequencebetween nucleotides -242 and —189 (Okazaki et al.1985). These results show that different, non-overlap-ping regions of the chicken aA-crystallin gene contrib-ute to lens-specificity of gene expression in chick andmouse lens cells. Thus, the regulatory regions requiredfor lens specificity in a homologous and a heterologoussystem differ.

This difference in regulatory mechanisms is inagreement with previous findings with other crystallingenes. A regulatory region of the mouse aA-crystallingene was located between positions -118 and +46when tested in explanted chicken lens epithelia (Chepe-linsky et al. 1987) but the sequence between —88 and+46 was sufficient for lens specificity in transgenic mice(Wawrousek et al. 1990). The 5' flanking regions of thesix rat y-crystallin genes that confer lens specificity havebeen examined in transdifferentiating chicken neuralretina cells and mouse lens cells (Peek et al. 1990).Deletion mapping of the most active y-crystallin gene,the yD region, showed that at least three elements, aregion between -200 and —106, and two GC richregions around -75 and -15, were required formaximal expression in mouse lens cells. However, theregion between —200 and —106 was dispensable intransdifferentiating chicken neural retina cells, whichrequired the region between —106 and -78 instead.

It is interesting that these crystallin genes arespecifically expressed even in chicken lens cells that donot have endogenous orthologs. Many crystallin genesshow lens specificity even when introduced into the lenscells of species lacking that particular crystallin.Examples of lens-preferred expression of such foreigncrystallin genes include the expression of the chicken(5l-crystallin gene when introduced into mouse lenscells (Hayashi et al. 1985) or transgenic mice (Kondoh etal. 1987a) and that of the mouse (Chepelinsky et al.1988) or human y-crystallin promoters (Lok et al. 1989)in cultured chicken lens cells. These results suggest thatcrystallin genes probably contain one or more elementspreferentially recognized in lens cells. The presence ofthese multiple elements might explain the differencesobserved for regulatory regions mentioned above. Oneor some of the multiple elements could be recognized

preferentially by lens-specific and/or ubiquitous tran-scription factors in lens cell nuclei. It seems that theseinteractions between cis- and trans-acting elementsdiffer in the lens tissues of each different species.

EnhancersEnhancers are found in many genes and their functionsin activating gene expression are independent oforientation and position (Serfling et al. 1985). Somefunction in any types of cells, whilst others only inspecialized tissues. The results in this paper demon-strated that the 84 bp element of the chicken aA-crystallin gene exhibits a lens-specific enhancer activity,since it is able to stimulate CAT gene expression from aheterologous promoter, the chicken /3-actin basalpromoter, and functioned in either orientation whenplaced immediately 5' to the basal promoter (Fig. 3).Multiple copies of this element synergistically activateexpression at the same site. Three copies of thiselement, however, fail to enhance transcription from aposition far downstream of the gene (Fig. 3). Distance-dependency of tissue-specific enhancers has also beenobserved for an enhancer of the murine gene encodingthe delta-subunit of the acetylcholine receptor (Baldwinand Burden, 1989). Nucleotides -148 to -95 from thedelta-subunit gene were sufficient to confer musclespecificity. This 54 bp element activated transcriptionequally well in either orientation when positionedimmediately 5' of the c-fos basal promoter (FBP). ThisFBP contains nucleotides —107 to +24 and is composedof a TATA element and a transcription initiation siteand on its own shows no activity in any cells. A trimer ofthe 54 bp element failed to promote transcription fromthe FBP when positioned about 1.7kb 3' to the FBP.The /3-actin basal promoter used in the present study issimilar to the FBP in that it also contains a TATAelement and a transcription initiation site and no otherbinding sites. These are in agreement with previousfindings that in mammalian cells an enhancer cannotinduce substantial transcription from a promoter thatonly contains a TATA box and no other upstream factorbinding site (Kuhl et al. 1987; Schatt et al. 1990; Westinand Schaffner, 1988).

The situation for the activation by downstream 84 bpelements is dramatically improved, however, if onecopy of the 84 bp element is placed immediately 5' tothe promoter (Fig. 3). It is likely that enhancing activityfrom a distance requires at least one enhancer motif orfactor binding site close to a TATA element to mediateinteractions of the TATA element with the distantenhancers (Schatt et al. 1990).

Enhancer or enhancer-like elements are also foundamongst other crystallin genes. The distal element ofthe mouse aA-crystallin gene functioned in eitherorientation only when linked to the proximal element asa basal promoter (Chepelinsky et al. 1987). Twoenhancer-like elements were found in the 5' flankingsequence of the mouse yF-crystallin gene (Lok et al.1989). These functioned independently in chick lensexplants when fused to the SV40 early promoter. Anenhancer activity of the BamHl-Hindlll DNA frag-

Expression of chicken aA-crystallin gene 549

ment from the third intron of the chicken 51-crystallingene has been well characterized (Hayashi et al. 1987;Goto et al. 1990). The enhancer is about 1 kbp long andits activity is mediated through two elements. One is a120 bp core segment which does not function by itself,but can function in a lens-specific fashion whenmultimerized. The other is an adjoining segment thatfunctions in any type of cells but only when multimer-ized. This is in agreement with previous findings thatthe SV40 enhancer is composed of multiple distinctelements (Fromental et al. 1988; Ondek et al. 1988).

DNA-binding proteinThe regulation of differential gene expression ismediated through interactions of sequence-specificbinding proteins and their target sites located within thepromoter and enhancer sequences (Mitchell and Tjian,1989). In the present study, we have demonstrated thepresence of a lens nuclear factor that binds to the 84 bpelement required for the lens-specific expression of thechicken oA-crystallin gene (Fig. 5). Use of DNAfragments of the 84 bp element as probes limited thebinding site to a region nucleotides -165 and —128(Fig. 5A). It appeared from DNAase I footprintinganalysis that the binding site is located between —165and -140 (Fig. 6C and D). The binding is sequence-specific, since an unlabelled competitor DNA fragmentcontaining nucleotides -162 to -128 competed with alabelled version of this sequence for factor binding(Fig. 5B).

The factor that binds to the 84 bp element of thechicken aA-crystallin promoter is cell type specific as itis found exclusively in lens cells, and not in othertissues; kidney, heart (Fig. 5C), liver and lung cells(data not shown). The tissue-specificity of the bindingactivity was confirmed by southwestern blot exper-iments (Jofuku et al. 1987), in which a double-strandedprobe (—162 to -79) specifically bound to a polypep-tide with a relative molecular mass of 61 x 103 which waspresent only in lens cells. Recently our studies alsoconfirmed that the relative molecular mass of thebinding protein is 61-63 xlO3 (Kitamura and Yasuda,unpublished observations). As brain cells contain the84 bp element DNA-binding protein, although at lowabundance (Fig. 5C), and it is much easier to obtainlarge amounts of nuclear extracts from brain tissuesthan from lenses, we have attempted to purify the 84 bpelement binding protein from brain nuclear extracts byDNA affinity chromatography using a synthetic oligo-nucleotide corresponding to nucleotides -165 to —130.Silver staining showed that the binding protein purifiedto homogeneity corresponds to a3 band with a relativemolecular mass of 61-63xlO.

TransdifferentiationTransient transfection experiments in this papershowed that the aA-crystallin promoter (o373CAT)functioned in lens cells and also in brain cells thoughwith less activity (Fig. 2A). This is intriguing, since theendogenous aA-crystallin gene is not active in chickenbrain tissues. The ectopic expression of the aA-

crystallin gene in brain and neural retina cells might beexplained by the following observations. During theearly stages of normal development very low levels ofthe aA- and <51-crystallin gene transcripts are detectedin neural retinal, pigmented epithelial and brain cells(Agata et al. 1983; Takagi, 1986). Immunological andnorthern blot analyses indicated that levels of crystallintranscripts increased up to 10 days in brain cell culturesand subsequently decreased. Therefore, crystallingenes must be transiently expressed in these cultures,indicating the presence of their transcription factors orDNA-binding proteins. This observation was confirmedby gel retardation experiments (Fig. 5C). These resultsshow that a nuclear factor from brain cells binds to the84 bp element, although the binding activity in brainwas much lower than in lens cells. Neural retina alsopossessed this DNA-binding activity (data not shown).No binding activity was detected in kidney and heartnuclear extracts (Fig. 5C).

These results support the notion that the tissuespecificity of crystallin expression correlates well withthe capacity to transdifferentiate into lens cells (Agataet al. 1983; Clayton et al. 1979). It has been wellestablished that several embryonic non-lens tissuestransdifferentiate into lens cells (Okada, 1983). Theseinclude chick embryonic neural retina cells (Itoh andEguchi, 1986), retinal pigmented epithelial cells (Egu-chi and Okada, 1973; Yasuda et al. 1984), brain cells andpineal body cells (Watanabe et al. 1985). All of thesecells are derived from the neuroectoderm. In all cases,transdifferentiation is accompanied by the formation oflentoid bodies (Moscona and Degenstein, 1980), whichare morphologically and biochemically identical toauthentic lens (Eguchi and Okada, 1973; Yasuda et al.1983, 1984). Recently, Eguchi (1986) establishedconditions by modifying culture media that eithermaintain the original state of the pigmented epithelialcells or cause them to completely differentiate into lenscells. Therefore, these culture systems are suitable onesin which to study lens development and crystallin geneexpression (Kondoh et al. 1987b; Peek et al. 1990). Themolecular mechanisms behind such transdifferentiationremains to be revealed before the regulation ofcrystallin gene expression can be clarified.

We thank Professor Y. Shimura for encouraging this study.This work was supported by research grants to K.Y. from theNaito Foundation, from the Ministry of Education, Science,and Culture of Japan and from the Science and TechnologyAgency of Japan.

References

AGATA, K., YASUDA, K. AND OKADA, T. S. (1983). Gene codingfor a lens-specific protein, 6-crystallin, is transcribed in nonlenstissues of chicken embryos. Devi Biol. 100, 222-226.

BALDWIN, A. S., JR AND SHARPE, P. A. (1987). Binding of anuclear factor to a regulatory sequence in the promoter of themouse H-2Kb class I major histocompatibility gene. Molec. cell.Biol. 7, 305-313.

BALDWIN, T. J. AND BURDEN, S. J. (1989). Muscle-specific geneexpression controlled by a regulatory element lacking a MyoDl-binding site. Nature 341, 716-720.

550 /. Matsuo and others

BLOEMENDAL, H., ed. (1981). Molecular and Cellular Biology ofthe Eye Lens, pp. 1-469, Wiley, New York.

CHEPELINSKY, A. B., SOMMER, B. AND PIATIGORSKY, J. (1987).Interaction between two different regulatory elements activatesthe murine a-A-crystallin gene promoter in explanted lensepithelia. Molec. cell. Biol. 7, 1807-1814.

CHEPELINSKY, A. B., SOMMER, B., WAWROUSEK, E. F. ANDPIATIGORSKY, J. (1988). Activation of the murine alpha A-crystallin gene promoter in the lens. In Molecular Biology of theEye: Genes, Vision and Ocular Diseases (ed. J. Piatigorsky, T.Shinohara and P. Zelenka) pp. 215-227. New York: Alan R.Liss, Inc.

CLAYTON, R. M. (1974). Comparative aspects of lens protein. InThe Eye, vol. 5 (ed. H. Davson and L.T. Graham), pp.399-494. New York, London: Academic Press.

CLAYTON, R. M., THOMSON, I. AND DEPOMERAI, D. I. (1979).Relationship between crystallin mRNA expression in retina cellsand their capacity to re-differentiate into lens cells. Nature 282,628-629.

DIGNAM, J. D., LEBOVTTZ, R. M. AND ROEDER, R. G. (1983).Accurate transcription initiation by RNA polymerase II in asoluble extract from isolated mammalian nuclei. Nucl. AcidsRes. 11, 1475-1489.

EDLUND, T., WALKER, M. D., BARR, P. J. AND RUTTER, W. J.(1985). Cell-specific expression of the rat insulin gene: Evidencefor role of two distinct 5' flanking elements. Science 230, 912-916.

EGUCHI, G. (1986). Instability in cell commitment of vertebratepigmented epithelial cells and their transdifferentiation into lenscells. In Current Topics in Developmental Biology (ed. M. M.Moscona and A. Monroy), pp. 21-37. Tokyo: Academic PressJapan, Inc.

EGUCHI, G. AND OKADA, T. S. (1973). Differentiation of lenstissue from the progeny of chick retinal pigmented cells culturedin vitro: a demonstration of a switch of cell types in clonal cellculture. Proc. natn. Acad Sci U.S.A. 70, 1495-1499.

FROMENTAL, C , KANNO, M., NOMIYAMA, H. AND CHAMBON, P.(1988). Cooperativity and hierarchial levels of functionorganization in the SV40 enhancer. Cell 54, 943-953.

GORMAN, C. M., MOFFAT, L. F. AND HOWARD, B. H. (1982).Recombinant genomes which express chloramphenicolacetyltransferase in mammalian cells. Molec. cell. Biol. 2,1044-1051.

GOTO, K., OKADA, T. S. AND KONDOH, H. (1990). Functionalcooperation of lens-specific and nonspecific elements in the 61-crystallin enhancer. Molec. cell. Biol. 10, 958-964.

HAYASHI, S., GOTO, K., OKADA, T. S. AND KONDOH, H. (1987).Lens-specific enhancer in the third intron regulates expression ofthe chicken (51-crystalhn gene. Genes Dev. 1, 818-828.

HAYASHI, S., KONDOH, H., YASUDA, K., SOMA, G., IKAWA, Y. ANDOKADA, T. S. (1985). Tissue-specific regulation of a chicken 8-crystallin gene in mouse cells: involvement of the 5' end region.EM BO J. 4, 2201-2207.

ITOH, Y. AND EGUCHI, G. (1986). In vitro analysis of cellularmetaplasia from pigmented epithelial cells to lens phenotypes: aunique model system for studying cellular and molecularmechanisms of 'transdifferentiation'. Devi Biol. 115, 353-362.

JOFUKU, K. D., OKAMOTO, J. K. AND GOLDBERG, R. B. (1987).Interaction of an embryo DNA binding protein with a soybeanlectin gene upstream region. Nature 328, 734-737.

KONDOH, H., KATOH, K., TAKAHASHI, Y., FUJISAWA, H.,YOKOYAMA, M., KIMURA, S., KATSUKI, M., SAITO, M., NOMURA,T., HJRAMOTO, Y. AND OKADA, T. S. (1987a). Specific expressionof the chicken 6-crystallin gene in the lens and the pyramidalneurons of the piriform cortex in transgenic mice. Devi Biol.120, 177-185.

KONDOH, H., UEDA, Y., HAYASHI, S., OKAZAKI, K., YASUDA, K.AND OKADA, T. S. (19876). An attempt to assay the state ofdetermination by using transfected genes as probes intransdifferentiation of neural retina into lens. Cell Differ. 20,203-207.

KUHL, D., FUENTE, J., CHATURVEDI, M., PARIMOO, S., RYALS, J.,MEYER, F. AND WEISSMAN, C. (1987). Reversible silencing ofenhancers by sequences derived from the human IFN-a'promoter. Cell 50, 1057-1069.

LOK, S., STEVENS, W., BREITMAN, M. L. AND TSUI, L.-C. (1989).Multiple regulatory elements of the murine y2-crystallinpromoter. Nucl. Acids Res. 17, 3563-3582.

MITCHELL, P. J. AND TJIAN, R. (1989). Transcriptional regulationin mammalian cells by sequence-specific DNA binding proteins.Science 245, 371-378.

MOSCONA, A. A. AND DEGENSTEIN, L. (1980). Lentoids inaggregates of embryonic neural retina cells. Cell Differ. 10,36-41.

OKADA, T. S. (1983). Recent progress in studies of thetransdifferentiation of eye tissue in vitro. Cell Differ. 13,177-183.

OKAZAH, K., YASUDA, K., KONDOH, H. AND OKADA, T. S. (1985).DNA sequences responsible for tissue-specific expression of achicken a^-crystallin gene in mouse lens cells. EMBO J. 4,2589-2595.

ONDEK, B., GLOSS, L. AND HERR, W. (1988). The SV40 enhancercontains two distinct levels of organization. Nature 333, 40-45.

PEEK, R., VAN DER LOKT, P., LUSBEN, N. H. AND SCHOENMAKERS,J. G. G. (1990). Tissue- and species-specific promoter elementsof rat >«<rystallin genes. Nucl. Acids Res. 18, 1189-1197.

PIATIGORSKY, J. (1989). Lens crystallins and their genes: diversityand tissue-specific expression. FASEB J. 3, 1930-1940.

SCHATT, M. D., RUSCONI, S. AND SCHAFFNER, W. (1990). A singleDNA-binding transcription factor is sufficient for activation froma distant enhancer and/or from a promoter position. EMBO J.9, 481-487.

SERFLING, E., JASIN, M. AND SCHAFFNER, W. (1985). Enhancersand eukaryotic gene expression. Trends Genet. 1, 224-230.

SHINOHARA, T. AND PIATIGORSKY, J. (1976). Quantitation of 6-crystallin messenger RNA during lens induction in chickembryos. Proc. natn. Acad. Set. U.S.A. 73, 2808-2812.

SUEMORI, H., KADOKAWA, Y., GOTO, K., A R A H , I., KONDOH, H.AND NAKATSUJI, N. (1990). A mouse embryonic stem cell lineshowing pluripotency of differentiation in early embryos andubiquitous /3-galactosidase expression. Cell Differ. Develop. 29,181-186.

TAKAGI, S. (1986). Stimulation of crystallin synthesis in embryonicbrain cells in culture. Roux's Arch, devl Biol. 195, 15-21.

WATANABE, K., AOYAMA, H., TAMAMAKI, N., YASUJIMA, M.,NOJYO, Y., UEDA, Y. AND OKADA, T. S. (1985). Oculopotencyof embryonic quail pineals as revealed by cell culture studies.Cell Differ. 10, 3-11.

WAWROUSEK, E. F., CHEPELINSKY, A. B., MCDERMONTT, J. B. ANDPIATIGORSKY, J. (1990). Regulation of the murine aA-crystallinpromoter in transgenic mice. Devi Biol. 137, 68-76.

WESTIN, G. AND SCHAFFNER, W. (1988). A zinc-responsive factorinteracts with a metal-regulated enhancer element (MRE) of themouse metallothionein I gene. EMBO J. 7, 3763-3770.

WIGLER, M., SWEET, R., SIM, G. K., WOLD, B., PELUCER, A.,LACY, E., MANIATIS, T., SILVERSTEIN, S. AND AXEL, R. (1979).Transformation'of mammalian cells with genes from procaryotesand eucaryotes.' Cell 16, 777-785.

YASUDA, K. (1979). Transdifferentiation of 'lentoid' structures incultures derived from pigmented epithelium was inhibited bycollagen. Devi Biol. 68, 618-623.

YASUDA, K., EGUCHI, G. AND OKADA, T. S. (1984). Age-dependent changes in the capacity of transdifferentiation ofretinal pigmented cells as revealed in clonal cell culture. CellDiffer. 10, 3-11.

YASUDA, K., KITAMURA, M., OKAZAKI, K. AND TAKEUCHI, M.(1988). Mechanism involved in regulating alpha-crystallin geneexpression. In Molecular Biology of the Eye - Genes, Vision andOcular Diseases (ed. J. Piatigorsky, T. Shinohara and P.Zelenka) pp. 205-213. New York: Alan R. Liss, Inc.

YASUDA, K. AND OKADA, T. S. (1986). Structure and expression ofthe chicken crystallin genes. In Oxford Surveys on Eukaryoticgenes, vol. 3 (ed. N. Maclean), pp. 183-209. Oxford: OxfordUniversity Press.

YASUDA, K., OKUYAMA, K. AND OKADA, T. S. (1983). Theaccumulation of 6-crystallin mRNA in transdetermination andtransdifferentiation of neural retina cells into lens. Cell Differ.12, 177-183.

Yu, C. C.-K., Tsui, L. C. AND BREITMAN, M. L. (1990).Homologous and heterologous enhancers modulates spatialexpression but not cell-type specificity of the murine yF-crystallin promoter. Development 110, 131-139.

{Accepted 26 June 1991)