BIOCHEMISTRY OF HYPERTROPHYANDHEART FAILURE

Biochemistry of Hypertrophy and He art Failure

Edited by

LORRIEA. KIRSHENBAUM

Institute of Cardiovascular Sciences St. Boniface General Hospital Research Center 351 Tache Avenue Winnipeg, Manitoba R2H 2A6 Canada

PAWAN K. SINGAL

Institute of Cardiovascular Sciences St. Boniface General Hospital Research Center Faculty ofMedicine University of Manitoba Winnipeg, Manitoba R2H 2A6 Canada

Reprinted from Molecular and Cellular Biochemistry, Volume 25 I (2003)

Springer Science+Business Media, LLC

IAN M.C. DIXON

Institute of Cardiovascular Sciences St. Boniface General Hospital Research Center Room 3038 SBGH Research Center 351 Tache Avenue R2H 2A6, Winnipeg, Manitoba Canada

Library of Congress Cataloging-in-Publication Data

A c.I.P. Catalogue record for this book is available from the Library of Congres

ISBN 978-1-4613-4853-5 ISBN 978-1-4419-9238-3 (eBook) DOI 10.1007/978-1-4419-9238-3

Copyright © 2003 by Springer Science+Business Media New York Originally pub1ished by K1uwer Academic Publishers in 2003 Softcover reprint ofthe hardcover 1st edition 2003

All rights reserved. No part of the material may be re­produced, stored in a retrieval system or transmitted in any form or by any means, mechanical, photocopying, re­cording, or otherwise, without the prior written permission of the publisher, Kluwer Academic Publishers, 101 Philip Drive, Assinippi Park, Norwell, Massachusetts 02061

Printed on acid-free paper

Molecular and Cellular Biochemistry:An International Journal for Chemical Biology inHealth and DiseaseCONTENTS VOLUME 251, Nos. 1 & 2, September 2003

BIOCHEMISTRY OF HYPERTROPHY AND HEART FAILUREDrs. Lorrie A. Kirshenbaum, Ian M.e. Dixon and Pawan K. Singal

PrefaceD.P. Goel, D.A. Ford and GN. Pierce : Lysoph osphol ipids do not directly modulate NA +-W exchangeN. Khaper , K. Kaur, T. Li, F. Farahmand and P.K. Singal : Antioxidant enzyme gene expression in conge stive hear t failure following

myoc ardial infarctionF. Villarreal, S. Zimmerma nn, L. Makhsudova, A.C. Montag, M.D. Erion, D.A. Bullough and B.R. Ito: Modulation of cardiac remodeling

by adenosine : In vitro and in vivo effectsT.H.F. Peters , P.L. de Jong , L. Klompe, R.M.F. Berger, P.R. Saxena, H.S. Sharma and AJJ.C. Bogers : Right ventricu lar collagen and

fibro nec tin leve ls in patients with pulmonary atres ia and vent ricular septal defec tR. Prabhakar, N. Petrashev skaya, A. Schwartz, B. Aronow, GP. Boivin, J.D. Molkent in and D.F. Wieczorek : A mouse model of familial

hypertrophic cardiomyopathy caused by a a -tropomyosin mutationK. Kato, M. Kodama, S. Hirono, Y. Okura, H. Hanawa , T. Shio no, M. Ito, K. Fuse , K. Tsuchida, S. Maruyama, T. Yoshida, S. Abe, M.

Hayashi , A. Nasuno , T. Saiga wa, T. Ozawa , Y. Aizawa: Analysis of postextrasystolic relaxation response in the human heartJ.R. Pollack , R.C. Witt and J.T. Sugimo to: Differentia l effect s of calpain inhibitors on hypert rophy of cardiomyoc ytesA. Fenning , G Harrison, D. Dwyer, R. Rose 'Meyer and L. Brown: Cardiac adaptation to endurance exerc ise in ratsM.M. Lalu, C.Q. Gao and R. Schulz: Matrix metalloproteinase inhibitors attenuate endotoxemia induced cardiac dysfunction: A potential

role for MMP-9G Wallukat, S. Podlowski, E. Nissen , R. Morwinski, C. Csonka, A. Tosaki and I.E. Blasig : Functional and structural charac terization

of anti-B I -adrenoceptor autoantibodies of spontaneo usly hypertensive ratsW. Juan, M. Nakazawa, K. Watanabe, M. Ma, M.I.I. Wahed, G Hasegawa , M. Naito, T. Yamamoto, K. Fuse, K. Kato, M. Kodama and

Y. Aizawa : Quinapril inhibit s progression of heart failure and fibrosi s in rats with dilated cardiomyopathy after myocarditiesJ. Barta , A. Toth, K. Jaquet, A. Redlich, I. Edes and Z. Papp: Calpain-l -depende nt degradation of troponin I mutants found in familial

hypertrophic cardiomyopathyG L. Brower, J.D. Gardn er and J.S. Janicki: Gender media ted cardiac protection from adverse ventricular remodeling is abol ished by

ovariec tomyA. Sabri and S.F. Steinberg: Prot ein kinase C isoform-selective signals that lead to cardiac hypertrophy and the progression of heart

failureB. Chaudhri , F. del Monte, RJ . Hajjar and S.E. Harding: Contract ile effects of adenovirally-mediated increases in SERCA2a activity:

A comparison betwee n adult rat and rabb it ventricu lar myocytesM.L. Zhang , S. Elkas sem, A.W. Davidoff, K. Saito and H.E.DJ . ter Keurs: Losartan inhibits myosin isoform shift after myocardial

infarction in ratsM. Leic ht, G Marx , D. Karbach, M. Gekle , T. Kohler and H.-G. Zimmer: Mechanism of cell death of rat cardiac fibrob lasts induced

by serum depletionA. Deten, H.C. Volz, A. Holzl, W. Briest and H.-G Zimmer: Effec t of propranolol on cardiac cytoki ne exp ression after myocardia l

infarct ion in ratsC. Ocampo , P. Ingram, M. Ilbawi, R. Arcilla and M. Gupta : Revisiting the surgical creation of volume load by aorta-caval shunt in ratsN. Buscemi, A. Doherty-Kirby, M.A. Sussman, G Lajo ie and J.E. Van Eyk : Proteomic analy sis of Racl tran sgenic mice displaying

dilated car diomyo pathy reveals an increase in creatine kinase M-chain protein abund anceM. Donato and R.J. Gelpi: Adenosi ne and card ioprotect ion during repe rfusion - an overv iew

Ind ex to Volume 251

ii;wed/tJl1tJ&WWW.KLUWERONLINE.NL~Contact your librarian for more Information

I3- 7

9- 15

17-26

27-32

33-42

43-4647-505 1-59

61-66

67-75

77-82

83-88

89-95

97- 10 1

103- 109

1 11-11 7

119 -126

127-1 37139- 143

145- 151153- 159

161 -1 63

Molecular and Cellular Biochemistry 251: J. 2003 .© 2003 Kluwer Academic Publishers. Printed in the Netherlands .

Preface

Heart failure representsa major financialand socio-economicburden worldwide as patients diagnosed with this form ofheart disease require costly medical treatments and chroniclong-term care. Despite the substantial progress made dur­ing the past two decades of heart research, cardiac diseaseremains a prominent cause of death along with cancer andinfectious diseases. In North America heart disease accountsfor about 45% of all deaths. A chronic increase in cardiacworkload imposed by valvular defects, uncontrolled hyper­tension, and coronary artery disease is accompanied by car­diac and neurohumoral adjustments. One of the prominentfeatures ofchronicheartdiseaseis growthof cardiacmyocytes(both adaptive and aberrant) itself contributing directly toheart hypertrophy. Biochemical reprogramming of the myo­cardium occurs from altered gene expressionat the level ofthecardiacmyocyteandfibroblast/myofibroblast populations;the latterdirectlyinfluencesthe natureof cardiacextracellularmatrix. These molecular, cellular and subcellularchanges re-

suit in ventricularremodeling anddiminishedcardiacperform­ance. Thus chronic cardiac hypertrophy ultimately is closelyassociated with end-stage heart failure and death.

The manuscripts included in this volume present basic re­search that address the fundamental basis of heart hypertro­phy and heart failure.This work wascontributed by scientistswho had attended the XVII World Congress of the Interna­tional Society for Heart Research held in Winnipeg, CanadaJuly,200I. The focusof this issue is on the underlyingmecha­nismsthatregulatecardiacgrowth. Thisnewinformation couldultiinately be used for the design of new treatment modalitiesto reduce the incidence of cardiac failure, thereby improvingquality of life in patients with heart chronic heart disease.

LorrieA. Kirshenbaum, IanM.e. DixonandPawanK.SingalInstitute of Cardiovascular Sciences

St. Boniface General Hospital Research CentreWinnipeg, Manitoba

Canada

Molecular and Cellular Biochemistry 241: 3-7,2003 .© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Lysophospholipids do not directly modulate Na+-H+exchange

Danny P. Goel, l DavidA. Ford? and Grant N. Pierce1

'Cell Biology Laborato ry, Division ofStroke and Vascular Disease; The National Centre for Agri-fo od Research inMedicine, St. Boniface General Hospital Research Centre; Department ofPhysiology, Faculty ofMedicine,University ofManitoba, Winnipeg, Man itoba, Canada ; "Schaol ofMedical Biochemi stry, St. Louis Universi ty, St. Lou is,MO, USA

Abstract

Lysophosphatidylcholine (LPC) has been reported to stimu late Na+-H+ exchange in rat cardiomyocytes. This action may beimportant in pathological conditions like ischemic injury where LPC is generated and Na+-H+exchange activation is an impor­tant determinant of cardiac damage and dysfunction. It is unclear, however, if this stimulation of Na+-W exchange by LPCoccurs throu gh a direc t action on the exchanger or through stimulation of a second messenger pathway. The purpose of thepresent investigation was to determine iflysolipids could directly affect Na+-W exchange. Purified cardiac sarcolemmal mem­branes were isolated and Na+-H+exchange was measured by radioisotopic methods following addit ion of LPC. There were noeffect s of LPC on Na+-H+ exchange at LPC concentrations of s 100 flM at all reaction time s examined. Lysophosphatidyl­ethanolamine (LPE) , Iysopho sphatidylserine (LPS), Iysophosphatidylinositol (LPI) and Iysoplasmenylcholine (LPEC) also didnot alter Na+-H+ exchange at all conc entrations and reaction time s exam ined . We conclude that any stim ulatory effects oflysolipids on Na+-H+exchange do not occu r through a direct action on the exchanger or its membrane lipid envi ronment andmust occur through a second messenger pathway. (Mol Cell Biochem 241 : 3-7, 2003)

Key words: lysophosphatidylcholine, sarcolemma, ischemia, heart, sodium-proton exchange

Introduction

Lysopho sphatidylcholine (LPC) levels are elevated follow­ing cardiac ischemia [1-6] . This is important because LPCis thought to be a mediator of ischemia-induced arrhythmias[7-10]. LPC is known to affect the activity of a number ofion transporters. LPC affects cardiac Na' channels [11-13],K+channels [14, IS], and inhibits the Na+-K+ ATPase [16, 17]and the Na+-HC0

3- transporter [18] . The Na+-H+ exchanger

is another ion transporter in the heart that is a key modulatorof ischemic dam age and dysfunction [19-2 1]. Hoque et al.reported a stimulation of Na+-H+ exchange in rat cardio­myocyte s following LPC addition [19]. However, Yamaguch iet al. reported no effect of LPC on the Nat-H rexchanger incardiomyocytes [18]. Na+-W exch ange has been reported tobe unaffecte d by its pho spholipid environment [18, 22] al­though this has been contested by others [23, 24]. Therefore ,

it is uncle ar if LPC does alter Na+-H+exchange and if so,through what mechani sm. It is possible that lysolip ids maydirectly alter Na+-H+ exchange activity. Many of the ion trans­port proteins identified abo ve are altered via a direct actionof LPC on the protein or the phospholipid environment sur­rounding the transporter. Howe ver, Hoque et al. [19] hypoth­esized that LPC stimulation of Na+-H+exchange occurred viaa protein kinase pathway. This is a plausible proposal becauselysolipids are known to stimulate myocardial protein kinases[25].

The rationale for this study was, therefore , to determine ifthe addition of exogenous LPC would have a direct effect onNa+-H+ exch ange. We used purifi ed sarcolemmal vesicles toeliminate the possibility that a second messenger system (likea kina se) would have any effect on exchange. We also ex­amined the po tential for other lysol ipids like lysophos­phatidylethan olamine (LPE) , lysophosphatidylserine (LPS) ,

Address for offp rints: G N. Pierce, Division of Stroke and Vascular Disease, St. Boniface General Hospital Research Centre, 35\ Tache Avenue , Winnipeg,Manitoba, Canada, R2H 2A6 (E-mail: gpierce@sbrc.ca)

4

lysophosphatidylinositol (LPI) and lysoplasmenylcholine(LPEC) to alter Na+-H+exchange. This is presently unknown.

Materials and methods

Materials

The Millipore filters , thin layer chromatography plates andorganic solvents were supplied by Fisher Scientific. The 22Nawas purchased from NEN Life Sciences. Lysophosphatidyl­choline, lysophosphatidylethanolamine, lysophosphatidyl­serine and lysophosphatidylinositol were supplied by DoosanSerdary, Toronto, Ontario. Lysoplasmenylcholine was syn­thesized as described previously (reference).

Sarcolemmal membrane preparations

Pigs (65-85 kg) were anae sthetized with Telazol (20 mg/mL)using a dose of I mL/23 kg animal body weight. Hearts wereremoved and cardi ac sarcolemmal vesicles were harvestedfrom the left ventri cle as described previously [26] . Purity ofthese sarcolemmal vesicles was determined using specificmarker assays. The Kt-p-nitrophenyl phosphatase assay andthe Na+-K+ ATPase assay are described elsewhere in detail[26]. Kt-stimulated p-nitrophenyl phosphatase activity was12 ± 21lmol phenol/mg per h in the sarcolemmal fraction (n= 7). Similarly, Na+-K+ATPase activity in this sarcolemmalfraction was II ± 3 and 35 ± 10 umol Pi/mg per h in the ab­sence and presence of 12.5Ilg/mL alamethicin, respectively.These activities were enriched in the sarcolemmal vesicles- 100 fold when compared to homogenate. The sarcolemmalmembrane-enriched final fraction was diluted into a suspen­sion medium containing 200 mM sucrose , 25 mM Mes , 8 mMKOH , pH 5.5 and centrifuged for 2 h at 175,000 x g. Thepelleted membranes were resu spended in the same suspen­sion medium at a protein concentration of 1-3 mg/mL.Protein concentrations were determined using the methoddescribed previously [26, 27]. These samples were frozen inliquid N2, and stored at -80°C for subsequent analysis.

Measurement of Na: -H+ exchange

Ht-dependent Na" uptake was examined in control vesiclesand those treated with Iysophospholipids, as described else­where in detail [23,24,27,28]. Briefly, 5 ul, of 22Na (O.IIlCi)was added to the bottom of a polystyrene tube containing 25ul, uptake medium, 200 mM sucrose, 30 mM Ches, 40 mMKOH , 0.1 mM EGTA and 0.1 mM Na+ (pH 10.61) . A 20 ilLaliquot of sarcolemmal membrane protein (II ug) was placedon the side of the tube and Nat-Ht exchange was initiated by

vortexing the mixture. Final assay concentrations were 180 mMsucrose, 10mM Mes, 17.5 mM Ches, 17 mM KOH, 0.05 mMEGTA and 0.05 mM Na+at a final extravesicular pH of9.33.Calibration of all assa y media was done carefully using anOrion 82-10 pH electrode to ensure accuracy. Following apreset time (2-5 sec), 3 mL of stop solution (100 mM KCI,20 mM Hepes, pH 7.5) was added to the polystyrene tube toarrest the reaction. The reaction mixture was filtered rapidlythrough 0.45 11m Millipore filters, followed by an additional2 x 3 mL wash with the same stop solution. Filters were re­moved, placed in scintillation vial s, dried and radioactivityquantitated using scintillation spectroscopy. Blanks weretreated in a similar manner except 3 mL ice-cold stop solu­tion was added immediately prior to the inclu sion of 20 ul,sarcolemmal protein.

Treatment with lysophospholipids

Severallysophospholipids were incubated with sarcolemmalvesicle s between I and 11 min . Lysophospholipids were sus­pended in 200 mM sucrose, 25 mM Mes and 8 mM KOH (pH5.5) to yield a final concentration of 10 mM Iysophospholipid.This was diluted 100-1000 fold to yield final concentrationsof 10, 25, 50 and 100 11M Iysophospholipid. Pre-incubationof lysopho spholipids was carried out over 3 min with a subse­quent Na' uptake time of 2, 5 and 30 sec .

Statistics

Data are expressed as mean ± S.E. Statistical dete rminationwas done using a Students t- test and was considered signifi­cant at p < 0.05.

Results

The effect of LPC on the activity of the Na+-H+ exchangerwas examined. Different concentrations of LPC (10 , 25 50and 100 11M LPC) were incubated with sarcolemmal vesicles .Figure I shows no statistically significant difference in W­dependent Na' uptake at any concentration of LPC examined.When Na+-H+ exchange was examined over various reac­tion times (2-30 sec), no concentration ofLPC produced astatistically significant change in Na+-H+ exchange activ­ity (Fig . 2) .

The effects of plasmalogen LPC, LPEC, on Na+-H+ ex­change activity were also examined. At concentrations of 10,25,50 and 100 11M LPEC, there was no change in Na+-H+ex­change activity (Fig. 3). This finding was con sistent acro ssvariable reaction times (Fig. 4) .

5

Lysophosph utidylcholine (11 ;\1)

120

100

" SO

!±~

60Z"~:::

] ; -10:. -

-9:.. 20

0

control 10 25 50 100

120

100

"so

%-~~ 60

;.-:

"~ = -10~ ~:. -.;

20.±0

control to 25 50 100

Lysoph osphat idylcholi ne (11;\I )

Fig. 1. Hr-dependenr Na" uptake in LPC treated sarcolemmal vesicles .Sarco lemmal vesicles were pre-incub ated with 10, 25, 50 and 100 11M LPCfor 3 min. Ht-dependent Na" uptake was exami ned for 5 sec in pH 10.61 at25°C.

Fig. 3. Ht-dependeru Na' uptake in LpeC treated sarco lemmal vesicles.Sarcolemmal vesicles were pre-incubated with 10, 25, 50 and 100 11M ofLPeC for 3 min in pH 5.5 , T =25°C. Hr-dependent Na' uptake was exam ­ined for 5 sec in pH 10.6 1, [Na'] 0.05 mM.

Tofurtheranalyzethe dependence of the Na+-H+ exchangeron membrane phospholipids, a number of Iysophospholipidswereincubated with sarcolemmal vesicles. LPS, LPI andLPEwere pre-incubated with cardiac sarcolemmal vesicles for 2

min. Incubation with LPS, LPI and LPE produced no statis­tically significant changes in Na+-W exchange activity (Fig.5).When examined at variable reaction times, the results weresimilar (Fig. 6).

-It- control

-It-IOIIM-.t. - 25 11M

- T- 50 IlM

-+-IOOIlM

302520

-It- control

-It- 10 11M

-4- 25 11M

-T- 50 11M I-+- 100 11M

1510

1.4

1.2

<II..:.:S 1.0Cl.

=+ ~0.8'" CJl:z a

... ::::.= <:> 1<II a 0.6"0 = !'ii~

fe,<II

0.4"0

+:=0.2

"0.0

0 530252015105

2.4

2.2

2.0

.. 1.8..:.:'"Q.. 1.6=

+ on 1.4'"z S... ::::. 1.2=e<II S"0 1.0==<II~e, 0.8<II'9+ 0.6:=

0.4

0.2

0.0a

Reaction Time (seconds)Reaction Ti me (seconds)

Fig. 2. Hr-dependent Na" uptake in LPC treated vesicles as a funct ion ofreaction time . Sarco lemmal vesicles were pre-incubated with 50 11M LPCfor 3 min at pH 5.5, T =25°C. Reaction was carried out in pH 10.6 1 mediafor 2, 5 and 30 sec, [Na"], = 0.05 mM.

Fig. 4. W dependent Na" uptake in LpeC treated sarcolemmal vesicles as afunction of reaction time and [LpeC]. Sarcolemmal vesicles were pre-incubatedwith 10,25 ,50 and 100 11M LpeC for 3 min in pH 5.5, T =25°C. W-dependentNa' uptake was examined at 2, 5 and 30 sec in pH 10.61, [Na"] 0.05 mM.

6

Lysophuspholipid s

Discussion

at. [19] have shown that LPC stimulated NHE-1 in cardio­myocytes. However, Yamaguchi et at. reported no effec t ofLPC on the cardiac Na'-Htexchanger [18]. Therefore, it isunclear if LPC does alter Na"-W exchange. If it does stimu­late Na'- H+exchange, three potential mechanisms may ac­count for this action . LPC may alter Na+-H+ exchange via :(i) a direct effect on the exchanger or, (ii) through an indi­rect signa ling mechanism, or (iii) via some comb ination ofboth of these effects. Hoque et at. [19] hypothesized that LPCstimulation of Na+-H+exchange occurred via a protein kinasepathway. To address the direct effect oflysolipids on the Nat­H+ exchange r, we have examined the effects of LPC in iso­lated sarcolemmal membranes instead of cardiomyocytes.Using a sarco lemmal membrane preparation removes the in­fluence of kinases or other secon d messengers. In our study,there was no effect of LPC on the cardiac sarcolemmal Na"­H+exchanger. This finding was not restricted to only onespecies of Iyso lipid . Lyso phosphatidylcholine, Iysopl as­menylcholine, Iysophosphatidylserine, lyso phosphatidy l­inosi tol and lysophosphat idylethanolamine all had no effect.Furthermore, phospholipase A

2, which generates LPC, had

no effect on sarcolemmal Na+-H+exchange (data not shown).The concentrations of lyso lipids that were employed in thisstudy (up to 100 11M) are thought to be relevant to the patho­logical state [32, 33]. We can conclude, therefore, that ourdata strongly rule out Iysolipids as direct modul ators of car­diac sarcolemmal Na+-H+ exchange in both in vitroand in vivosettings.

The length of the fatty acid carbo n chain could contributeto the inabili ty of these Iysolipids to alter Na+-W exchangefunction. Long chain fatty acids (like eicosapentanoic acid,docosahexa noic acid and arachidonic acid) significa ntly al­ter NHE activity whereas shorter chain fatty acids (linolenicand linoleic acid) are ineffective [24]. LPC, LPE, LPEC, LPSand LPI all contain very short carbon chains. Thus, the re­sults shown here with the Iysolipids are consistent with thisstruc ture/function relationship .

Our study, there fore, is the first inves tigation to evaluatethe direct effects of individual pure Iysolipids on cardiac Na"­H+exchange. Our results clearly rule out a direct effec t ofthese lipids on Na+-H+ exch ange. Any stimu latory effectsmust occur through a second messenger-mediated pathway.It will be of interest in the future to identify if it is indeed akinase and if this stim ulation is specific for one part icularkinase.

30252015

- - cont rol-.- LPS-~ LPI

-...- LPE

105

100

so:..

1 60

Z..

= ::;

~<- -\0

~ t;":

f~()-

()

control LPS LI'J lY E

2.0

1.8

1.6..~ 1.4.se,=;:;- 1.2+ 0.. ..z -= 1.0-=

0

"....."0 0 0.85~~~

0.6'9+:: 0.4

0.2

0.00

Inhibitory effects of LPC have been reported on several iontransport pathways including Na+-Ca2+exchange [29], theNa+-K+ATPase [16, 17, 30], Na' channels [12, 13], K+chan­nels [14, 15,31 ] and the Na+-HC0

3- transporter [18]. The ef­

fect oflysolipids on Na+-H+exchange is less clear. Hoque et

Fig. 5 . Hr-dependent Na" uptake as a funct ion of variable lysophospho­lipids. Sarcolemmal vesicles were pre-incubated with 50 f.lM LPS, LPI andLPE for 2 min. Na" uptake was examined in a final solution consisting of0.05 mM Na", pH 9.33 for 5 sec. Data are represented as mean ± S.E. of 3separate experiments.

Reaction Time (seconds) AcknowledgementsFig. 6. Time course in Ht-dcpendent Na" uptake in LPS, LP I and LPEtreated sarcolemmal vesicles. Sarcolemmal vesicles were pre-incubated with50 f.lM LPS, LPI and LPE for 2 min at 25°C (pH 5.5). Na+uptake was ex­amined in a final solution consisting of 0.05 mM Na', pH 9.33. Data arerepresented a mean + S.E. of separate experimen ts.

This study was supported by a grant from the Heart and StrokeFoundation of Manitoba. GN Pierce is a Senior Scien tist ofthe Canadian Institutes for Health Research.

References

I. Chien KR, Han A, Sen A, Buja LM, Willerson JT: Accumulation ofunesterified arachidonic acid in ischemic canine myocardium. Rela­tionship to a phosphat idylcholine deacylation-reacylation cycle and thedeplet ion of membrane phospholipids. Circ Res 54: 313-322, 1984

2. Saffit z JE, Corr PB, Lee BI, Gross RW, Williamson EK, Sobel BE:Pathophysiologic concentrations of Iysophosphoglycerides quantifiedby electron microscopic autoradiography. Lab Invest 50: 278-286,1984

3. Katz AM, Messineo FC: Lipid-membrane interactions and the path­ogenesis of ischemic damage in the myocardium . Circ Res 48: 1- 16,1981

4. Prinzen FW, Van der Vusse GJ, Arts T, Roemen TH, Coumans WA,Reneman RS: Accumulation of noneste rified fatty acids in ischemiccanine myocardium . Am J Physiol247 : H264-H272, 1984

5. Steenbe rgen C, Jennings RB: Relationship between Iysophospho lipidaccum ulat ion and plasma membrane injur y during total in vitro is­chemia in dog heart. J Mol Cell Cardiol 16: 605-621, 1984

6. Weglicki WB, Low MG: Phospholipases of the myocardium. Basic ResCardio l82: 107-112,1987

7. Corr PB, Cain ME, Witkowski FX, Price DA, Sobel BE: Potentialarrhythmogenic electrophy siological derangements in canine Purkinjefibers induced by lysophosphoglycerides. Circ Res 44: 822-832, 1979

8. Arnsdorf MF, Sawicki GJ: The effect s of Iysophosphatidylcholine, atoxic metabolite of ischemia, on the components of cardiac excitabil­ity in sheep Purkinje fibers. Circ Res 49: 16-30, 1981

9. Pogwizd SM, Onufer JR, Kramer JB, Sobel BE, Corr PB: Induction ofdelayed after depolarizations and triggered activity in canine Purkinjefibers by lysophosphogl yceride s. Circ Res 59: 416-426, 1986

10. Nakaya H, Tohse N: Electrophysiological effect s of acetyl glycerylethe r phosphorylcholine on card iac tissue s: Comparison with lyso­phosphatidylcholine and long chain acyl carnit ine. Br 1Pharmacol89:749-757,1986

I I. Burnashev NA, Undrovinas AI, Fleidervi sh lA, Rosen shtraukh LV:Ischemic poison lysophosphatidylcholine modifies heart sodium chan­nels gating inducing long-lasting bursts of openings. Pflugers Arch 415:124- 126, 1989

12. Undrovinas AI, Fleidervish IA, Makiel ski JC: Inward sodium currentat resting potentials in single cardiac myocytes induced by the ischemicmetabolite Iysophosphatidylcholine. Circ Res 71: 1231-1241, 1992

13. Sato T, Kiyosue T,Arita M: Inhibitory effects of palmitoylcarnitine andIysophosphatidylcholine on the sodium current of cardiac ventricularcells. Pfluger s Arch 420: 94-100, 1992

14. Kiyosue T, Arita M: Effects of Iysophosphatidylchol ine on restingpotassium conductance of isolated guinea pig ventricular cells. PflugersArch 406: 296-302, 1986

15. Clarks on CW, Ten Eick RE: On the mechan ism of lysophosph atidyl­choline-induced depolarization of cat ventricular myocardium . CircRes 52: 543-556, 1983

16. Karli IN, Karikas GA, Hatzip avlou PK, Levis GM, Moulopou los SN:The inhibition of Na' and K+stimulated ATPase activity of rabbit and

7

dog heart sarcolemma by Iysophosphatidyl choline. Life Sci 24: 1869­1875, 1979

17. Pitt s BJ, Okhuysen CH: Effects of palmitoyI carnitine and LPC oncardiac sarcolemmal Na+-K+- ATPase. Am J Physiol247: H840-H846,1984

18. Yamaguchi S, Tamagawa M, Nakajima N, Nakaya H: Selective im­pairment of HC03(-j-dcpendent pHi regu lation by Iysophosphatidyl­choline in guinea pig ventricular myocardium. Cardiovasc Res 37:179-186,1998

19. Hoque AN, Haist lV, Karmazyn M: Na+-H+exchange inhibition pro­tects against mechanical , ultrastructural , and biochemical impairmentinduced by low concent rations of Iysophosphatidylcholine in isolatedrat hearts. Circ Res 80: 95-102, 1997

20. Meng HP, Pierce GN: Protective effects of 5-(N,N-dimeth yl)amilorideon ische rnia-reperfu sion injury in hearts . Am J Physiol 258: H16 15­H1619,1990

21. Pierce GN, Czubryt MP: The contributi on of ionic imbalance to is­chernia/reperfusion-induced injury.1Mol Cell Cardiol27: 53-63, 1995

22. Demareux N, Romanek R, Orlow ski r, Grinstein S: ATP dependenceof Na+-H+exchange: Nucleotide specificity and assessment of the roleof phospholipids. J Gen Physiol 109: 117-128 , 1997

23. Goel DP, Vecch ini A, Panagia V, Pierce GN: Altered cardiac Na+/Wexchange in phospholipase D-treated sarcolemmal vesicles. Am JPhysiol 279: HI I79-H1 184, 2000

24. Goel DP, Maddaford TO, Pierce GN: The effects of omega-3 polyun­saturated fatty acids on cardiac sarcolemmal Na+-H+exchange. Am JPhysiol283 : HI688-HI694, 2002

25. William s SD, Ford DA: Activation of myocardial cAMP -dependentprotein kinase by Iysoplasmenylcholine. FEBS Lett 420: 33-38, 1997

26. Pierce GN, Panagia V: Role of phosphat idylinositol in cardiac sar­colemmal memb rane sodium-calcium exchange. J Bioi Chern 264:15344-15350, 1989

27. Pierce GN, Philipson KD: Na+-H+exchange in cardiac sarcolemmalvesicles. Biochim Biophys Acta 818: 109-116, 1985

28. Pierce GN, Ramjia wan B, Dhalla NS, Ferrari R: Na+-H+exchange incardiac sarcolemmal vesicles isolated from diabetic rats. Am J Physiol258: H255-H26I , 1990

29. Golfman LHT, Netticadan T, Panag ia V, Dhalla NS: Modification ofcardiac sarcolemmal Nat-Ca" exchange by Iysophosphatidylcholineand palmito ylcarn itine. Cardiovasc Pathobio l2 : 181-185, 1998

30. Oish i K, Zheng B, Kuo JF: Inhibit ion of Na,K-ATPase and sodiumpump by protein kinase C regulators sphingosine , lysophosphatidyl­choline , and oleic acid . J BioI Chern. 265: 70-75, 1990

31. Eddlestone GT: ATP-sensitive K channel modulation by products ofPLA2 action in the insulin-secreting HIT cell line. Am J Physiol 268:CI81 -CI90,1995

32. Subba iah PV, Chen CH, Bagdade JD, Albers JJ: Substrate specificityof plasma lysolecithin acyltransferase and the molecul ar species oflecithin formed by the react ion. J BioI Chern 260: 5308-5314, 1985

33. Rabini RA, Galass i R, Fumelli P, Dousset N, Solera ML, Valdiguie P,Curatola 0, Ferretti G, Taus M, Mazzanti L: Reduced Na+-K+-ATPaseactivity and plasma Iysophosphatidylcholine concentrations in diabeticpatients. Diabetes 43: 915-919, 1994

Molecular and Cellular Biochemistry 251: 9-15, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands .

Antioxidant enzyme gene expression in congestiveheart failure following myocardial infarction

N. Khaper, K. Kaur, T. Li, F. Farahmand and P.K.SingalInstitute of Cardiovascular Sciences, St. Boniface General Hospital Research Centre and Department ofPhysiology,Faculty ofMedicine, University ofManitoba, Winnipeg, Canada

Abstract

Increased oxidative stress and reduction in antioxidant enzymes have been suggested to be involved in the pathophysiology ofcongestive heart failure subsequent to myocardial infarction (MI) . The objective of the present study was to characterize changesin the mRNA abundance and protein levels for the enzymatic antioxidants, superoxide dismutase (SOD), glutathione peroxi­dase (GSHPx) and catalase during the sequelae of congestive heart failure in rats . MI was produced by the ligation of the leftcoronary artery and hearts from controls and 1, 4 and 16 week PMI groups were analyzed. Losartan treatment (2 mg/ml indrinking water, daily) was started at 4 weeks and continued for 12 weeks. The mRNA levels for SOD were reduced by about40% at l-week PMI, were near to the control levels at 4-week PMI and at 16 weeks PMI, the levels were reduced by about73% below the controls. GSHPx mRNA levels remained unchanged at all time points . The mRNA levels for catalase remainedunchanged at 1 and 4 weeks PMI and were signi fican tly reduced by about 44% at 16 weeks PMI as compared to the controls.The protein levels for MnSOD, CuZnSOD, GSHPx at I and 16 weeks remained unchanged in treated and untreated PMI groups.However, the protein levels for catalase was significantly increased in the control and PMI groups treated with Losartan. It isconcluded that changes in the SOD and catalase activities during severe heart failure correlated with changes in mRNA forthese enzymes. The precise mechanismls for the improvement in antioxidant reserve and protein levels after Losartan treat­ment is/are unclear at this time. (Mol Cell Biochem 241: 9-15, 2003)

Key words: superoxide dismutase (SOD), glutathione peroxidase (GSHPx), catalase

Introduction

Blockage of the coronary artery initiates a remodeling proc­ess in the heart that leads to ventricular hypertrophy and mayeventually lead to heart failure . Despite the significant re­search in this area, the mechanisms involved in the trans itionfrom the compensatory phase to the failure stage are stillpoorly understood. Chronic activation of the sympathetic andrenin-angiotensin systems (RAS) appear to play some rolein this process [1]. Recent data obtained from clinical [2, 3]as well as animal studies [4,5] have provided strong evidencefor a link between increase in myocardial oxidative stress andthe development of heart failure.

Deficit of antioxidant reserve and an increase in oxygenfree radical flux have been reported in various pathophysiologi­cal conditions such as ischemia-reperfusion, adriamycin-car-

diomyopathy, diabetic-cardiomyopathy and heart failure [6].Based on clin ical experience a correlation between oxidativestress and heart failure has also been suggested [7]. In addi­tion, a strong relationship between antioxidant intake andreduced risk of coronary artery disease has also been reported[2]. In a recent study, adm inistration of antioxidant probucolto rats 24 h following mycocardial infarction (MI), a signifi­cant improvement in the post-MI survival rate was noted [8].Congestive heart failure subsequent to coronary artery ligationhas been shown to be associated with a deficit in the myo­cardial antioxidant reserve and an increase in oxidative stress[4, 5, 9]. However, there have been no studies examiningchanges in the mRNA and protein levels of antioxidant en­zymes at different stages of post-myocardial infarction (PMI).

The aim of this study was to characterize changes in anti ­oxidant enzymes (SOD, GSHPx and catalase) at the transcrip-

Address for offprints: K. Singal , Institute of Cardiovascular Sciences, St. Boniface General Hospital Research Centre , 351 Tache Avenue, Room 3022 , Win­nipeg, Manitoba , Canada , R2H 2A6 (E-mail: psingal @sbrc.ca)

10

tion (mRNA) and translation (protein) levels at variousdurations of PM1. Since Losartan has been shown to improvethe prognosis in heart failure patients [10] and since this drugalso improves the cardiac function subsequent to MI [ I I] ef­fects of Losartan treatment were also studied.

Materials and methods

Animal model

Male Sprague-Dawley rats weighing 150 ± 10 g were main­tained on standard rat chow and water ad libitum. Myocar­dial infarction (MI) was produced by occ lusion of the leftanterior descending coronary artery according to proceduredescribed earlier by Johns and Olson [12] and later modifiedby different investigators [4]. The animal s were anesthetizedwith 2% isoflurane and the skin was then incised along theleft sternal border. The third and fourth ribs were cut abovethe sternum and the heart was exteriorized through the inter­costal space. The left coronary artery was ligated with a 6-0silk thread. After the ligation, the heart was gently placedback in the chest. Excess air was drawn using a syringe afterwhich the che st was closed with a purse string suture. Therats were maintained on a positive pressure ventilation, de­livering 2% isoflurane. The entire surg ical procedure wascar ried out in sterile conditions. Sham control animals weresimilarly handled, except that the suture around the coro­nary artery was not tied, and the silk thread was passed onlythrough the muscle as described before [9]. Following thesurgery the animals were allowed to recover on the table .Theanimals were monitored on a regular basis for thei r food andwater intake, body weight, general behavior, mortality etc .

Study groups

Sham and Post-MI (PM I) animals were divided into eightgroups as follows: I -week sham control, I-week PMI ; 4­week sham control, 4 week PMI ; 16-week sham control ,16-week PMI ; 16-week sham + Losartan, 16 week PMI+ Losartan. Losartan (2 mg/ml) was given in drinking waterdaily. The treatment was started at 4 weeks PMI and wascontinued for 12 weeks. The animals were sacrificed at I, 4and 16 weeks PML

Northern blot analysis

Total RNA from the 1-,4- and 16-week sham control and MIrats was isolated by using the acid guanidium isothiocyanate­cesium-chloride extraction method [13]. The 00 of theRNA was assessed spectrophotometrically at a wavelength

of 260 nm. Fifty ug of the RNA was separated electro­phoreticallyon 1% agarose gel, 2.2 M formaldehyde gels andtransferred to a nitrocellulose filter by capillary blot. Themembranes were baked at 80°C for 2 hand prehybridizedat 42 °C for 2-4 h in a solution containing 50 % deionizedformamide , 20 mM/1 NaH2P04 (pH 7.0), 4 x SSC, 2 mM/1EDTA, 5 x Denhardts solution (l x = 0.02 % BSA ficol andpolyvinylpyrrolidane), 0.0 1% sodium dodecyl sulfate (SDS)and 100 flg/1l1 sonicated salmon sperm DNA. Hybridizationwas carried out in the same solution at 42°Cfor 16-18 h underthe standard conditions with 32P-labelled cDNA probes (spe­cific activity> 109 cpm/g DNA). Gel purified cDNA insertsof human GSHPx [14] , MnSOD [15] and Catalase [16] werepurchased from the ATCC (Bethesda, MD, USA) . ThesecDNA inserts were nick translated to a specific activ ity of 108

d/ min/ug DNA and used as probes. 28S ribosomal RNA wasused to confirm equal loading [17] . The membranes werewashed for 15 min at room temperature with a solution of2 x SSC/O.l % SDS , and followed by a wash at 42°C in 0.1 xSSC/O.I % SDS . The autoradiograph was established by ex­posing the filter for 24-48 h to X-ray film (X-OMAT") at-80°C with intensifying screens [18] . The band s were quanti­tatively evaluated by densitometric analysis (Bio-Rad imagingdensitometer GS 670). The mRNA message was presentedas the ratio of expression of enzyme vs . 28S rRNA. TheMnSOD scanning values represented the total den sities of3.8,2.7, 2.2, 1.3, 1.1 kb corresponding to polyadenylatedisoforms [19] . All the quantitative data were presented aspercentage of values in control group.

Western blot analysis

For protein isola tion , the tissue samp les were thawed in ice­cold Tris/EDTA buffer uoo mM Tris-HCI , 5 mM EDTA, pH7.4) and homogen ized with a Polytron homogeni zer. Aprotinin(10 ug/ml), Leupeptin (10 ug/ml), Pepstatin A (10 ug/ml),and phenylmethylsulfonyl fluoride (20 flM) were added tothe homogenizing buffer to avoid protein degradation. Pro­tein concentrations were determined according to the proce­dure described by Lowry et al. [20] and used to normalizethe protein loading. Twenty ug of protein were subjected toone-dimensional sodium dodecyl sulphate-polyacrylamidegel electrophoresis (SDS-PAGE) by using 15% separating geland 5% stacking gel [21]. The separated proteins were el­ectrophoretically transferred to nitrocellulose membranesusing a modified Towbin buffer (20 mM Tris , 150 mM gly­cine, 20% methanol, 0.02% SDS , pH 8.3) . After that thenonspecific protein-binding sites were blocked with 5% non­fat milk in Tris-buffered saline/a. I% Tween- 20 for about anhour and then the membranes were processed by using rab­bit an ti-human GSHPx antibody (kindly provided by Dr.1. Singh, Charleston, SC , USA), rabbit ant i-MnSOD and

II

- 408 kb

........- 3.8 kh

- 2.7 kb- 2.2 kb- 1.3 kh- 1.1 kh

I \\1-: ~Wl-: 16W";

-

c:::J coxrnoi. c:::J 1';\11

r-t- - r-r-

x

x

In. .

C I'~II C P~IIC I'~II'-----J '-----J '-----J

IW I( ~Wl( 16W I(

----A

B120

.s 100ez 80~..~ 60c:.=~

40v:~c..-

20"-c~ a

Results

General characteristics

CuZ nSOD antibodies (kindly provided by Dr. L.w. Oberley,Iowa City, lA, USA) and sheep anti-CAT polyclonal antibody(The Binding Site , Birmingham, UK) as primary antibody.The bound primary antibodies were detected using anti -rab­bit/sheep horse-radish peroxidase-conjugated secondary an­tibody and using an ECL Western blotting detection system(Amersham Inc., Arlington Heights, IL, USA). The molec u­lar weights of the protein bands were determined by compar­ing to the standard molecular weight markers obtained fromBio-Rad, CA, USA. The analysis for the GSHPx, MnSOD,CuZnSOD and CAT protein levels were done with a Bio-RadGS-670 image densitometer.

Data were expressed as the means ± S.E.M. For a statisti­cal analysis of the data , group means were compared by one­way analysis of variance (ANaYA) and Bonferroni ' s test wasused to identify differences between groups. Statistical sig­nificance was acceptable to a level of p < 0.05.

Sham contro l and post-myocardial infarction (PMI) rats fromthe untreated and Losartan-treated groups were monitoredperiodically for their general behavior and food and waterintake throughout the study. In terms of general appearanceand behavior, nothing unusual was noted in any of the ani­mals in the sham control group. However, the rats in the un­treated, 16-week coronary-ligated (PMI) group, appearedlethargic , wit h clear signs of heart failure indicated bydyspnea and cyanosis of the periphera l extremities. Mortal­ity in the coronary artery-ligated animals during or immedi­ately after the surgery was about 20%. Another - 15% of theanimals died within 24 h following the surgery.

Fig. I . (A) mRNA abundance for manganese superoxide dismuta se at 1,4and 16 weeks post surgery duration in the contro l and post myocardi al in­farcti on (PMI) rats. (8) Data expressed as % of control. Data are mean ± S.E. M. from 3 rats. *Significantly dif ferent (p < 0.05) from the respectivecontrol.

A• 1.2 kb

mRNA abundance

- ·408 kb

(' I'~II c 1'.\11 C I'~II'------' '------' '------'

1WI( ~WI( 16\\1(

In this animal model , myocardial enzyme activity for SOD,GSHPx and catalase are known to decrease in 4 weeks and16 weeks PMI groups [22] . In order to exami ne the molecu­lar changes underlying these differences in the enzyme ac­tivities, the mRNA abundance of SOD, GSHPx and catalasewere examined at I, 4 and 16 weeks in the sham control andPMI group and the data are presented in Figs 1-3 respec­tively. The mRNA levels for SOD showed a biphasic re­sponse, where it was reduced by about 40 % at I week PMIand at 4 weeks PMI, the levels returned back to the controllevel and at 16 weeks PMI, the levels in the PMI group werereduced by about 73% of the contro l (Fig. I) . GSHPx mRNAlevels remained unchanged at all time points (Fig. 2). ThemRNA levels for catalase remained unchanged at I and 4

B140 c:::J CO JloT IW L c:::J 1';\\1

=- 120e;: 100e; 80

~ 60

40

I W"; ~WK 16WK

Fig. 2. (A) mRNA abundance for glutath ione peroxidase at 1,4 and 16weeks post surgery duration in the contro l and infarcted (PMI) rats. (8 ) Dataexpre ssed as % of con trol. Data are mean ± S. E. M. from 3 rats .

12

A A

-2.4 Ii"

Iwe .\\ 1'.\11 \6"'<: I(,WI',\IIr-l r-l r-l r---o

lf1 --I.8I..hQON C P\II (' P\II ( " \11

"-----'"-----'"-----'1\\" ~w" 16W"

B

IW (' 16Wel \\'r~l1 16 \\' 1'. 11

c

B120

~ P'II= C()~l

~100 r-r- - r-

= 80ef.

60-.-

40~. 20-e..." 0

I W" ~W" 16\\ "

Fig. 3. (A) mRNA abundance for catalase at 1.4 and 16 weeks post sur­gery duration in the control and post myocardial infarction (PMI) rats. (B)Data exp ressed as % of control. Data are mean ± S. E. M. from 3 rats.*Significantly different (p < 0.05) as compared to the respective control.

weeks PMI and were significantly reduced by about 44% at16 wee ks PMI as comp ared to the control group (Fig. 3).

=

~ -:.:: ='~ ·c;- ~ -cv: =~ ,;~ ,,",; ~ ~~ e.".

Proteins

The protein levels for MnSOD. CuZnSOD, GSHPx and cata­lase at I and 16 week s PMI duration were also exam ined andthe result s are presented in Figs 4-7 . respecti vely. The pro­tein levels for MnSOD, CuZnSOD, GSHPx and catalase re­mained unchan ged in the 1- and 16-week PMI group at alltime points compared to their respec tive sham contro ls. Theprotein levels for catalase were significa ntly increased in theLosartan-treated control and MI groups (Fig . 8).

Discussion

Earl ier it has been shown by us that myocardial infa rction asinduced in this study result s in normal or hyperfunction at Iweek, mild failure at 4 weeks and seve re failure at 16 weeksPMI [22]. In the present study clin ical signs at 16 weeks con­firmed the prese nce of seve re heart failure. In this study, thedrug trea tment was starte d at 4 weeks post surgery durationbased on the fac t that the ea rly signs of heart failure wereevident at 4 weeks fo llowing the surgery. The dosage of

Fig. 4. (A) Western blot for MnSOD in the sham control (C) and infarcte d(PM!) rats at I week ( IW) and 16 weeks ( 16W) PMI duration. (B) Proteinloading control by Ponceau staining. (C) Quant ified data of MnSOD pro­tein concentration in C and PMI animals. Data arc expresse d as mean ±S.E.M. of 3 animals.

Losartan (2 mg/ml ) used by us in this study is based on ear­lier studies.

The study shows for the first time a correlation betweenthe decrease in the mRNA abundance for the antioxidant en­zymes superoxide dismutase (SOD) and catalase , and theiractivi ties . A decrease in catalase and SOD acti vities at 16weeks PMI has been reported by us [22] . Glutathione per­oxidase (GSHPx) activity was also depressed in the MI group[9], however, the mRNA abundance for this enzyme was notchanged.The protein content for MnSOD , CuZnSOD , GSHPxand catalase enzymes remained unchanged .

The upregulation of MnSOD mRNA at 4 weeks may bean adaptive response to an increase in oxidative stress. Therehave been very few studies to date studying the changes inantioxidant enzyme activity, mRNA abundance and proteincontent in heart failu re. In patients with end stage heart fail­ure , the enzyme activity, mRNA and protein content for cata-

B

c

1we 16\\'C1\\ 1':\11 16\\'1':\11

Fig. 5. (A) Western blot forCuZnSOD in the sham control (C) and infarcted(PMI) rats at I week (I W) and 16 weeks (l 6W) PMI duration . (B) Proteinloading control by Ponceau stainin g. (C) Quantifi ed data of CuZnSOD pro­tein concentration in C and MI animals. Data are expressed as mean ± S.E.M.of 3 animals.

lase were upregulated [23]. Howerer in another study, it wasfound that a significant decre ase in catalase enzyme activitywas associated with no change in mRNA and protein levels[24]. It is possible that change s in antioxid ants may be uniquenot only to the disease condition but also to the stage of myo­cardial dysfunction.

Although, act ivation of the RAS is a compensatory re­sponse, over a period of time this compensation becomesdetrimental to heart function . Thi s is the reason that angi ­otensin converting enzyme (ACE)-inhibitors have been suc­cessfully used in the management of heart failure patients.Numerous studies have documented the beneficial effects ofACE-inhibitors in reducing mortality [25, 26]. However, dueto the limited efficacy of ACE-inhibitors in blocking the RASas well as their effects on the bradykinin and prostaglandin

13

A

Iwe IWI'MI 16we 16WP;\1II I I II I I

B

c

°::2-N·0=_ e0:2 .0"' u0"e -0 0

~ ~ ~~~"0~ ,

rwc rswcIWP;\II 16WP;\11

Fig. 6. (A) Western blot for GSHP x in the sham control (C) and infarcted(PMI) rats at I week ( IW) and 16 weeks ( 16W) PMI duration . (B) Proteinloading control by Ponceau staining. (C) Quant ified data of GSHPx pro­tein concentration in C and MI animals. Data are expressed as mean ± S.E.M.of 3 animals.

metabolism [27-30], angiotensin II (AII)-receptor blockersLosartan, is considered as an attractive alternative to ACE­inhibitors. The evaluation of Losartan in the elderly heartfailure study (ELITE) indicated that Losartan had a betteroverall tolerability than captopril in elderl y patients with NewYork Heart Association classes II to IV failure [10] . A lowermortality with Losartan was also noted [10,31]. Some of thedeleterious effects on the myocardium could be the result ofoxidative stress contributed by the RAS. Role of angioten sinII as a source of free radicals has been suggested in recentl ypubli shed reports [32-34]. Losartan was shown to inhibitpressure induced angiotensin Il-rnediated oxidati ve stress incultured human coronary smooth muscle ceIls [35] . In ourstudy, Losartan treatment improved the protein levels forcatalase both in the sham control and MI groups. In additionit is possible that Losartan may have some antioxidant effectsof its own. In this regard, Losartan treatment has been re­ported to excrete uric acid in patients with hypertension [36].Furthermore, in diabetic cardiomyopathy in rats , increa sed

14

A A

iwc

B

IWI':\1I iswc 16W I'I\1IIwe 1 WI'I\ II 16 w e 16 WPMI

II II II ,

c

.~ "C:::l

"a> .-L-UI _

!: a>

~ E

'"0

u~ca>ClI W C I W I' M I 16\\' C 16WI'~11

~co

" "~..E.2 100;CO..Q

c

Fig. 7. (A) Western blot for Catalase in the sham control (C) and infarcted(PMI) rats at I week (I W) and 16 weeks (l6W) PMI duration. (B) Proteinloading control by Ponceau staining. (C) Quantified data of Catalase pro­tein concentration in C and MI animals. Data are expressed as mean ± S.E.M.of 3 animals .

MDA content and depressed SOD, catalase and GSHPx ac­tivities were prevented by Losartan [37]. In patients withcoronary artery disease, Losartan treatment improved en­dothelial function by increasing the bioavailability of nitricoxide [38] . It is possible that the reduction in antioxidantenzyme activity reported earlier [22] may also be due tosome direct effects of the radical species on the enzymeproteins.

In concl usion, the prese nt study shows that as heart fail­ure progresses, the depressed cardiac function is associatedwith a decrease in the mRNA abundance for superoxide dis­mutase and catalase. This study also documents for the firsttime that inhibition of the Af', receptors with Losartan causedan improvement in the catalase protein leve l suggesting anewer role for Losartan in the treatment of heart failure . Theprecise mechanism(s) for an overall improvement in the anti­oxidant reserve after Losartan treatme nt is/are unclear at thistime.

16W C 16WPM I 16WCI6WPl\1 1

Lo sa rtu n

Fig. 8. (A) Western blot for Catalase in the sham con trol (C) , infarcted(PM!) , Losartan treated sham contro l and Losartan treated infarcted rats 16weeks (16W) PMI duration. (B) Protein loading control by Ponceau stain­ing. (C) Quantified data of Cata lase protein concentration in C and MI ani­mals in Losartan treated and untreated animals . Data are expressed as mean± S.E.M . of 3 anima ls.

Acknowledgements

This study was supported by grants from the Canadian Insti­tute for Health Research (CIHR) and Merck Frosst Canada.PKS received career award from the MRC and NK was sup­porte d by a student fellows hip from the Heart and StrokeFoundation of Canada, FF received studentship from theFaculty of Graduate Studies, Universi ty of Medicine.

References

I . McAlpine HM, Cobbe SM: Neuroe ndocrine changes in acute myocar­dial infarction. Am J Med 84: 61-66.1988

2. Singh RB, Niaz MA, Rastogi SS, Rastogi S: Usefulnes s of antioxidant

vitamins in suspected acute myocardial infarction (The Indian Experi­ment of Infarct Survival-3). Am J Cardiol77: 232-236,1996

3. Keith M, Geranmayegan A, Sole MJ, Kurian R, Robinson A, OmranAS, Jeejeebhoy KN: Increased oxidative stress in patients with con­gestive heart failure . J Am Coli Cardiol31 : 1352-1356, 1998

4. Hill MF, Singal PK: Right and left myocardial antioxidant responsesduring heart failure subsequent to myocardial infarction . Circulation96: 2414-2420, 1997

5. Palace VP, Hill MF, Farahmand F, Singal PK: Mobilization of antioxi­dant vitamin pools and hemodynamic function following myocardialinfarction. Circulation 99: 121-126, 1999

6. Kaul N, Siveski-Iliskovic N, Hill M, Slezak J, Singal PK: Free radi­cals and the heart. J Pharmacol Toxicol Meth 30: 55-67, 1993

7. Serdar A, Yesilbursa D, Serdar Z, Dirican M, Turel B, Cordan J: Rela­tion of functional capacity with the oxidative stress and antioxidantsin chronic heart failure . Congest Heart Fail 7: 309-311, 2001

8. Sia YT, ParkerTG, Liu P, Tsoporis IN,AdamA, Rouleau JL: Improvedpost-myocardial infarction survival with probucol in rats : Effects onleft ventricular function , morphology, cardiac oxidative stress andcytokine expression. J Am Coli Cardiol39: 148-156,2002

9. Khaper N, Singal PK: Effects of afterload reducing drugs on thepathogenesis of antioxidant changes and congestive heart failure in rats.J Am Coli Cardiol 29: 856-861 , 1997

10. Pitt B, Segal R, Martinez FA, Meurers G, Cow ley AJ, Thomas I,Deedwania PC, Ney DE, Snavely DB, Chang PI: on behalf of ELITEInvestigators. Randomised trial of Losartan vs. captopril in patientsover 65 with heart failure (Evaluation of Losartan in the Elderly Study,ELITE). Lancet 349: 747-752, 1997

II. Schieffer B, Wirgner A, Meybrunn M, Seitz S, Holtz J, Riede UN,Drexler H: Comparative effects of chronic angiotensin convertingenzyme inhibition and angiotensin II type I receptor blockade on car­diac remodelling after myocardial infarction in the rat. Circulation 88:2273-2282, 1994

12. Johns TNP, Olson BJ: Experimental myocardial infarction: I. A methodof coronary occlusion in small animals. Ann Surg 140: 675-682, 1954

13. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ: Isolation ofbiologically active ribonucle ic acid from sources enriched in ribonu­clease . Biochemistry 18: 5294-5299, 1979

14. Cowan DB, Weisel RD, Williams WG, Mickle DA: The regulation ofglutathione peroxidase gene expression by oxygen tension in culturedhuman cardiomyocytes. J Mol Cell Cardiol 24: 423-433, 1992

15. Xiang K, Cox NJ, Hallewell RA, Bell GI: Multiple Taq I RFLPs at thehuman manganese superoxide dismutase (SOD2) locus on chromosome6. Nucleic Acids Res 15: 7654,1987

16. Quan F, Korneluk RG,Tropak MB, Gravel RA: Isolation and charac­terization of the human catalase gene. Nucleic Acids Res 14: 5321­5335, 1986

17. Tiemeier DC, Tilghman SM, Leder P: Purification and cloning of amouse ribosomal gene fragment in coliphage lambda. Gene 2: 173­191,1977

18. Khaper N, Rigatto C, Seneviratne C, Li T, Singal PK: Chronic treat­ment with propranolol induces antioxidant changes and protects againstischemia reperfusion injury. J Mol Cell Cardiol29: 3335-3344, 1997

19. Hurt J, Hsu JL, Dougall WC, Visner GA, Burr 1M,Nick HS: MultiplemRNA species generated by alternate polyadenylation from the ratmanganese superoxide dismutase gene. Nucleic Acids Res 20: 2985­2990 , 1992

20. Lowry OH, Rosenbrough NT, FaITAL et al. : Protein measurementswith the Folin phenol reagent. J BioI Chern 193: 265-275, 1951

21. Laemmli UK: Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227: 680-685 , 1970

15

22. Khaper N, Singal PK: Modulation of oxidative stress by a selectiveinhibition of angiotensin II type I receptors in MI rats. J Am ColiCardiol 37: 1461-1466,2001

23. Dieterich S, Bieligk U, Beulich K, Hasenfuss G, Prestle J: Gene ex­pression of antioxidative enzymes in the human heart: Increased ex­pression of catalase in the end stage failing heart. Circulation 101:33-39,2000

24. Baumer AT, Flesch M, Wang X, Shen Q, Feuerstein GZ, Bohm M:Antioxidative enzymes in human hearts with idiopathic dilated cardio­myopathy. J Mol Cell Cardiol32: 121-130,2000

25. Pfeffer MA, Braunwald E, Moye LA, Basta L, Brown EJ Jr, CuddyTE, Davis BR, Geltman EM, Goldman S, Flaker GC et al. on behalfof the SAVE Investigators: Effect of captopril on mortality and mor­bidity in patients with left ventricular dysfunction after myocardialinfarction: Results of the Survival and Ventricular Enlargement trial(SAVE). N Engl J Med 327: 669-677, 1992

26. Cohn IN, Johnson G, Ziesche S, Cobb F, Francis G, Tristani F, SmithR, Dunkman WB, Loeb H, Wong M et al .:A comparison of enalaprilwith hydralazine-isosorbide dinitrate in the treatment of chronic con­gestive heart failure . N Engl J Med 325: 303-310, 1991

27. Gohlke P, Linz W, Scholkens BA, Kuwer I, Bartenbach S, Schnell A,UngerT: Angiotensin-converting enzyme inhibition improves cardiacfunction : Role of bradykinin. Hypertension 23: 411-418,1994

28. Martorana PA, Linz W, Scholkens BA: Does bradykinin playa rolein the cardiac anti-ischemic effect of the ACE-inhibitors? Basic ResCardio!. 86: 293-296, 1991

29. Linz W, Scholkens BA: A specific B2-bradykinin receptor antago­nist HOE 140 abolishes the antihypertrophic effect of ramipri!. Br JPharmacoll05: 771-772,1992

30. Schror K: Role of prostaglandins in the cardiovascular effects of brady­kinin and angiotensin converting enzyme inhibitors in heart failure . JCardiovasc Pharmacol 20: 68-73, 1992

31. Rump LC, Oberhauser V,Schwertfeger E, Schollmeyer P: Experimen­tal evidence to support ELITE. Lancet 351: 644-645, 1998

32. Rajagopalan S, Kurz S, Muenzel T,Tarpey M, Freeman BA, GriendlingKK, Harrison DG: Angiotensin II-mediated hypertension in the ratincreases vascular superoxide production via membrane NADH/NADPH oxidase activation. Contribution to alterations of vasomotortone. J Clin Invest 97: 1916-1923, 1996

33. Griendling KK, Minieri CA, Ollerenshaw JD Alexander RW: Angi­otensin II stimulates NADH and NADPH oxidase activity in culturedvascular smooth muscle cells. Circ Res 74: 1141-1148 , 1994

34. Aizawa T, Ishizaka N, Usui S, Ohashi N, Ohno M, Nagai R: Angi­otensin II and catecholamines increase plasma levels of 8-epi-pros­taglandin F (2 alpha) with different pressor dependencies in rats .Hypertension 39: 149-154,2002

35. Yasunari K, Maeda K, Nakamura M, Yoshikawa J: Pressure promotesangiotensinII-mediatedmigrationof human coronarysmoothmusclecellsthrough increase in oxidative stress. Hypertension 39: 433-437, 2002

36. Puig JG, Mateos F, Buno A, Ortega R, Rodriguez F, Dal-Re R: Effectof eprosartan and Losartan on uric acid metabolism in patients withessential hypertens ion. J Hypertens 17: 1033-1039, 1999

37. Kedziora-Kornatowska K: Effects of angiotensin convertase inhibi­tors and AT1 angiotensin receptor antagonists on the development ofoxidative stress in the kidney of diabetic rats. Clin Chim Acta 287: 19­27, 1999

38. Hornig B, Landmesser U, Kohler C, Ahlersmann D, Spiekermann S,Christoph A, Tatge H, Drexler H: Comparative effects of ACE inhibi­tion and angiotensin II type I receptor antagonism on bioavailabilityof nitric oxide in patients with coronary artery disease : Role ofsuperoxide dismutase. Circulation 103: 799-805, 2001

Molecular and Cellular Biochemistry 251: 17-26, 2003.© 2003 Kluwer Academic Publishers. Primed in the Netherlands.

Modulation of cardiac remodeling by adenosine: Invitro and in vivo effects

Francisco Villarreal, Scott Zimmermann, Lala Makhsudova,Annika C. Montag, Mark D. Erion, DavidA. Bullough and Bruce R. ItoDepa rtment ofMedicine, University of California, San Diego and Departments of Pharmacology and Medicina l Chemistry,Metabasis Therapeutics Inc., La Jolla , CA, USA

Abstract

The increasing incidence of congestive heart failure has stimulated efforts to develop pharmacologic strategies to prevent orreverse the associated process of adverse cardiac remodeling. The possibility of utili zing endogenou sly generated factors thatare capable of inhibiting this process is beginning to be explored. Adeno sine, has been described as a retali atory autacoid withhomeostatic activities in the regul ation of myocardial blood flow, cate cholamine relea se, and reduction of injury resulting fromperiods of ischemia. Adenosine exerts a variety of action s that are con sistent with the concept that it can reduce or inhibit theprocess of cardiac remodeling . In this manu script, the basics of adenosine metabolism, its cell surface receptors and benefi cialactions on the cardio vascular sys tem are reviewed . In addition new, in vitro and ill vivo data will be presented supporting theconcept that adenosine exerts actions that may ameliorate adverse cardiac remodeling. (Mol Cell Biochem 251 : 17-26,2003)

Key words: adenosine, myocardial infarction, cardiac remodeling

Introduction

The increasi ng incidence of congestive heart failure has stim­ulated investigational efforts to develop pharmacologic strat­egie s to prevent or reverse the associated process of adversecardiac remodeling . Current therapies are mainly focu sed onblocking the action s of neurohormonal factor s known to stim­ulate the process of cardiac remod elin g. However, the pos­sibility of utilizing endogenously gen erated factors thatare capable of inhibiting this process is only beginning to beexplored. The nucleoside , adeno sine (ADO), has been de­scribed as a retaliatory autacoid with homeostatic activitie sin the regulation of myocardial blood flow, catecholaminestimulation, and reduction of injury resulting from periodsof relati ve ischemia. ADO exerts a variety of actions that areconsistent with the concept that it can reduce or inhibit theprocess of cardiac remodeling. In the first part of this manu­script, the basics of ADO metabolism, its cell surface receptorsand beneficial action s on the cardiovascular system will berevie wed . In the second part , in vitro and in vivo data will be

presented supporting the concept that ADO has activities thatmay ameliorate adverse cardi ac remodeling.

Adenosine, its metabolism and receptorsin the cardiovascular system

Adenosine is a ubiquitous, endogenous nucleoside that canmodulate physiological functions in various organs via itsinteraction with cell surface receptors [ I]. ADO is producedby all cell types and is known to play important roles withinthe cardiovascular sys tem. Several metabolic path ways forgenerating large amounts of ADO have been described for cellssuch as cardiac myocytes and fibroblasts, vascular smoothmuscle cell s and endothelial cell s [2-4 ].

Figure I presents an overview of the major metabolic path­ways known to be involved in the generation and metabo­lism of ADO . With ATP hydrolysis, ADP is formed which isdephosphorylated to AMP via the myokinase reaction . AMP

Address f or offprints: FJ. Villarreal, UCSD Med. Ctr., 200 West Arbor Street , San Diego, CA 92103-8412, USA (E-mail: fvillarr @ucsd.edu)

18

.\ TP

• 1:"0 ... lIYI'OX.-\......T IlI;'\E

il 5' -NT

PNP

.................\ () I'

~Ecto -PDE .\ ~ I I'

S,\ I\

AMPDA_ _ __• ni l'

I,. CELL MEMBRANE

.-\1'1' c.-\~I\·- S' -NTPDE-' AMP- -.ADO

Fig. I . Major biochemical pathways for intracellular and extracellular adenosine metabolism. Abbreviations: ADO - adenosine; INO - inosine ; A - adeno­sine deaminase ; AK - adenosine kinase ; SAH - S-adenosyl homocystein; SAHH - S-adenosyl homocysteine hydrolase; 5'-NT - 5'-nucleotidase; PDE ­phosphodiesterase.

is the primary source of ADO in the heart under both nor­moxie and hypoxic conditions. ADO is formed from ADPcatalyzed by cytosolic 5' nucleotidase and can be re-phos­phorylated back to AMP by the enzyme adenosine kinase(AK). Adenosine kinase has a low Km (1 !1M) and effec tivelysalvages any ADO formed intracellularly. This substrate cy­cle between AMP and ADO plays an important role in theregulation of ADO production in the heart. Under normoxicconditions> 95% of the ADO formed within the heart isrephosphorylated to AMP by AK. In the presence of ischemiaor hypoxia, cytosolic ADO concentrations increase markedlydue both to an increase in AMP and dephosphorylation, butalso secondary to inhibition of AK. ADO can also be formedby the transmethylation pathway involving the hydrolysis ofS-adenosyl-L-homocystein (SAH) catalyzed by SAH hydro ­lase, or formed extracellularly by ecto-nucleotidases whichare present in myocardial and vascular cells. ADO has highmembrane permeability and can exit the myocyte and inter­act with membrane receptors present on myocytes , fibro ­blasts, endothelial and vascular smooth muscle cells. ADOdeaminase present in myocytes but primarily local ized inendothelial cells, catalyzes the conversion of ADO to a rela­tively inactive metabolite, inosine. However, its relativelyhigh Km (70 j..lM) compared to AK suggest that flux throughthis pathway only becomes significant when ADO concen­trations rise substantially (i.e. during ischemia). Extracellu­lar ADO is rapidly taken up by endothelial cells mediated bynucleoside transporters.

The actions of ADO are known to be mediated by theirinteraction with four receptor subtypes (AI' A2a

, A2b and A3

)

[5]. All 4 receptors couple to guanine (0) nucleotide bind­ing proteins. The cardiac AI receptor and its anti-adrenergicactions are well characterized [6]. The AI receptor appears

coupled to the activation of an inhibitory guanine nucleotideregulatory protein (Gi) and as a result decreases cAMP pro­duction. ADO has protective effects against ischemia in themyocardium, and these effects are attributed at least in part,to AI receptors [6]. The existence of subtypes of A

2receptors

was suggested by Elfman et al. [7], who identified high andlow affinity A

2receptors. A

2aand A

2breceptors are known to

be coupled to Gs proteins, because both activate adenyl cy­clase in virtually every cell in which they are expressed [I].However, other intracellular signaling pathways have beenfound to be functionally coupled to A

2breceptors. In mast

cells, A2b

receptors stimulate phospholipase C via Gq whichcan result in the mobilization of calcium [8,9]. A

3receptors

appear to activate 00or Oq proteins and couple to phospholi­

pase C activity.ADO can modulate various cardiovascular functions [5].

Although ADO induced vasodilation has been traditionallyattributed to activation of A

2areceptors, the recent finding of

A2b

receptors in vascular beds raises the possibility that theyparticipate in the regulation of vascular tone. Indeed, thereare vascu lar beds in which the nonselective agonist 5'-N­ethylcarboxamidoadenosine (NECA) produces profound vas­odilation, but the selective A

2aagonist COS 21680 has little

effect [10]. It has been recently reported that myocytes iso­lated from fetal chick ventricles have functional A

2band A

2a

receptors [II]. The stimulation of both receptors can augmentmyocardial contractility. These effects, become evident onlyafter inhibitory Al receptor pathways are inactivated withpertussis toxin [11]. The presence of A

2receptors, capable

of stimulating cAMP, have been demonstrated in culturedadult rodent myocardial cells [12, 13]. However, it is unclearif these results are due to the contamination of myocardialpreparations with fibroblasts and endothelial cells which

Table I . Adenosine actions which may be considered benefi cial in the set­ting of heart failure

express A2b

receptors [1]. Thus, the role of myocardial A2

receptors in mediating a positive inotropic effect remainscontroversial and their physiological significance is unclear,given that their effects become evident only under blockadeof AI receptors [1]. Recent evidence suggests that ADO mayplaya role in smooth muscle growth. Exogenous ADO act­ing via A

2breceptors can inhibi t rat aortic smooth muscle cell

proliferation induced by serum [14] . Activation of adenylcyclase is postulated as the signaling pathway involved, be­cause this effect is mimicked by 8-bromo-cAMP [14]. It hasbeen suggested that this finding may establi sh a novel pro­tective effect of ADO, with relevance to vascular remodeling.A

2breceptors can also modulate gene expression and protein

synthesis . For example, stimulation of A2b

receptors decreasescollagenase gene expression in interleukin-l stimulated cul­tured fibroblast like synov iocyte s, an effect apparentl y me­diated by cAMP elevation [15]. The presence of A) recepto rson cardiomyocytes has also been reported and they appearto couple to protective actions during ischemia [16] . How­ever, their physiological role is currently undefined. The ac­tivation of ADO receptors in the heart results in a numbe r ofphysiologic effect s (summarized inTable 1) that can be con­sidered beneficial in acute settings of myocardial ischemia(i.e. myocardial infarction) as well as in more chroni c formsof cardiac pathology such as adve rse left ventricular (LV)remodel ing [17].

As outlined in the section below, the primary focus of in­vestigational studies in the acute setting has been on examin­ing the capacity of ADO to influence the extent of myocardialnecrosis resulting from coronary occlu sion, or contractiledysfunction following short transient ischemia.

Receptor subtype Possible beneficial effect

Attenuat es adrenoceptor stimulationInhibits catecholamine releaseAntagonizes Ca2• channelsProtective effect on myocytes

VasodilationInhibits platelet aggregationInhibits cytokine productionInhibits oxyge n free-radical formation

Inhibit mesenchymal cell growth andfunction (e.g. fibrobla sts)Stimulates endothelial cell prolifera tionInhibits mast cell activationVasodilation

Protective effect on myocytes

19

Adenosine and myocardial ischemia

Two basic pharmacologic strategies have been evaluated inexperimental animal models in an attempt to recruit the ben­eficial activities of ADO during myocardial ischemia andreperfusion . In the firs t, exogenous ADO or analogs havebeen given either prior to ischemia or during early reperfusionwith the goal of preserving contractile function and attenu ­ating myocellular necrosis . In the second strategy, agentswhich increase endogenous ADO production by influencingits formation or metabol ism have been employed. Adminis­tration of ADO or ADO receptor agonists prior to the onsetof ischemi a has been documented by several investigators toreduce infarct size and improve functional recovery [2, 17,18]. However, the cardioprotective activity of ADO whengiven only during reperfusion has been controversial withsome reports demonstrating reduction in infarct size andcontractile dysfunction [19- 21] and others find ing no ben­eficial effect on either infarction [22, 23] or myocardial stun­ning [24]. Nonetheles s, these data have supported the clinicalinvestigation of ADO as a cardioprotective agent for acutemyocardial infarction (MI) when given as an adjunct to re­perfusion therapy. Intravenou s infusion of ADO for 1 h dur­ing primary angioplasty for MIwas shown to reduce perfusiondefects consistent with a reduction in infarct injury [25]. In aplacebo controlled Phase II trial (AMISTAD), intravenousADO given over 3 h in conjunction with thrombolytic therapy,was shown to reduce infarct size in patients with anterior wallinfarction [26] . In a recen t report, intracoronary ADO wasgiven during primary angioplasty and documented to improveventricular function and myocardial perfusion [27].

Pharmacologically increasin g endogenous ADO formationhas emerged as an attractive option to attempt to recruit itscard ioprotective effect with several advantages over admin­istration of exogenous ADO. First, it is now understood thatthe vascular endothelium is a highly effective metabolic bar­rier to intravascular ADO [3, 28, 29] . Also, the half-life ofADO in blood is very short , on the order of 1-2 sec. Thus , itmay be expected that most of the ADO administered intra­venously would never actually reach the myocyte to exert apro tective effect. Second, due to the ubiquitous nature ofADO receptor distribution, intravascular administration ofADO or analogs produces a number of side effects counter­productive in cardiac ischemia including hypotension, andincreased sympathetic activity [2]. As mentioned above, in­creased levels of cardiac ADO can be achieved through anumber of pharmacologic mean s including inhibition of itsdegradation using ADO deaminase blockers such as EHNA,inhibition of its uptake into cells with nucleoside transportinhibitors such as dipyridamole or draflazine, or inhibitionof its rephosphorylation to AMP by blockers of adeno sinekinase. An allosteric enhancer (PD81723) which increasesADO interaction with its receptors has also been described.

Fig. 2. Infarct wall thickness (average ± S.D.) in rats sacrifi ced at 14 dayspost-MI. Permanent occlusion (Penn) resu lted in a signific ant decrease ininfarct wall thickness compared to sham animals. Reperfusion alone (Ve­hicle) after 2 h of occlusion resulted in a preservation of infarct wallthickness compared to perm anen t occlusion . Acadesine (AICAr) treat­ment enhanced the preservati on of infarct wall thickness.

infarct expansion and LV remodeling (wall thickness, LVcavity area, diameters) were measured in dias tolic-fixedhearts using standard morphometric methods. In initial ex­periments , we confirmed the observations [38] that late coro­nary reperfusion (2 h post-Ml) attenuated infarct expansion/LV remodeling even in the absence of myocardial salvage.Acadesine treatment initiated just prior to repe rfusion (10min) and continued for 2 h was associated with a further re­duction in infarct expansion/LV remodeling compared toreperfusion alone as reflected by thicker infarct walls (Fig. 2).These data were consistent with the idea that an adenosinergictreatment given as an adju nct to repe rfusion could have apositive effect on infarc t healing and ventricular geometryindependent of infarc t size.

To further investigate the hypothesis that increased endog­enous ADO during early reperfusion could attenuate infarctexpansion/LV remodeling, we employed an agent known toincrease tissue ADO . In card iac muscle, the enzyme adeno ­sine kinase (AK) which is responsib le for re-phosp horylat­ing ADO back to AMP, is highly active and is estimated tonormally recycle 80-90% offormed ADO back to AMP [39,40]. Because of this high activi ty, pharmacologic inhibitionof AK has been shown to increase cardiac levels of ADO manyfold in both normal and hypoxic conditions [39]. GP5 15 (4­amino-l -(5-amino-5-deoxy-l -b-D-ribofuranosyl)-3-bromo­pyrazolo [3,4-d] pyrimidine hydrochloride) is an analog oftubercidin, and is a potent inhibitor of AK with a Ki of 4 nMdetermined against human AK [41] . The effect of GP515 tomodify infarct expansion/LV remodeling when given as anadjunct to reperfusion was evaluated in comparison to ADO(intra-atrial infusion) in the rat MI model. Treatment withGP515 (I , 3 ug/kg/min, i.v.) or ADO (250 ug/kg/min) was

20

Using these agen ts , some studies have demonstrated thatincreasing endogenous ADO prior to the onset of ischemiacan attenuate contractile dysfunct ion and infarction size simi­lar to that reported with exogenous ADO [2, 30, 31] . How­ever, increasing endogenous ADO only during reperfusionhas not been widely successful in reducing infarct size, al­thoug h there are reports of cont racti le function benefits [32].

There are a number of clinical studies where pharmacol­ogic enhancers of endogenous ADO have been eva luated insettings of myocardial ischemia. Intracoronary dipyridamoleas a strategy to increase cardiac ADO was given prior tocoro nary angiop lasty and reported to preserve diastolic andsys tolic func tion [33, 34] . A second generation nucleosidetransport inhibitor, draflazine, was admi nistered intrave­nously in patients with unstable angina and acute non-Q waveinfarction, and reduced angina, but was not associated witheffects on cardiac enzyme release or ECG changes [35]. Themost comprehensive clinical evaluat ion of an adenosi nerg icagent for card ioprotective activity was done with the 'adeno­sine regulating agent' , acadesine (AICA riboside) .This agentwas evaluated for utility in reducing myocardial infarctionassociated with coronary artery bypass graft surgery in morethan 4000 patients. A recent meta -analysis of the data fromPhase II and III studies demonstrated that acadesine treatmentwas associated with a significant decrease in the incidenceof MI by 27% and cardiac death by 50% [36] . However, themost interes ting result was the observation that the greatestbenefit of acadesine was apparent in the sub-group of patientsexperiencing MI. In these patients, acadesine treatment wasassociated with an 89% reduction in card iac death at post­op day 4 and 79% at post-op day 28. This effect occurred inthe absence of significant differences in the extent of infarc­tion as reflected by serum creatine-kinase or Troponin T.These data indicated that acadesine conferred a degree ofmyocardial protection indepe ndent of infarct size , and sug­gested the possibility that events subsequent to infarction (i.e.remodeling) were involved. Post-Ml infarct expansion andLV dilation are known to be strong predictors of outcome afterMI and are positive ly modi fied by reperfusion even in theabsence of myocardial salvage [37]. We hypothes ized that thesurvival benefit of acadesine in patients experiencing MI dur­ing coronary bypass surgery may have involved effects on earlyinfarct expansion and LV remode ling, and evaluated this ex­perimentally as described below using an animal model ofMI.

In vivo effects of adenosine as adjunct toreperfusion on infarct expansion/LVremodeling

In groups of rats, the left coronary artery was ligated, eitherpermanently or for 1- 2 h. At 2 weeks of recovery, indices of

3.0......EE 2.5

I-.......(/)(/)

2.0Q)c~

*.~..c 1.5I-

ro 1.0S13"- 0.5ro'-c

0.0 -'--- -'-

Sham Vehicle AICAr Perm.

21

initiated 10 min prior to reperfusion following a 2 h coronaryocclusion. These doses of GP515 were chosen based on ac­tivity in models of inflammation [42, 43] and demonstratedto increase coronary flow in the absence of changes in arte­rial pressure. At 2 weeks of recovery, infarct expansion andLV remodeling were quantitated [38,44] and included meas­urements of infarct and non-infarct wall thickness, LV cavityarea, and ventricular size. Sham MI, vehicle treated animalsand animals with permane nt occlusion were included as con­trol groups .As shown in Fig. 3, permanent occlusion resultedin a marked degree of infarct expansion and LV remodelingwhich was attenuated in the vehicle group (reperfusion only) .Treatment with GP515 resulted in a further dose-dependentreduction in infarct expansion and LV remodeling beyondthat achieved by reperfusion alone . This effect could not be

mimicked by exogenous ADO administration. Infarc t sizewas not different between groups, nor was expected giventhe 2 h occlusion duration. This period is beyond the timewhere myocardial salvage occurs with reperfusion in thismodel. Left ventricular diastolic pressure-volume relation ­ships were determined in subgrou ps of animals treated withreperfusion alone or with GP5 15 (Fig. 4) . There was a clearrightward shift of the PV curve to larger volumes follow­ing infarction which was atten uated in animals treated withGP515 . In further confirmatory studies , groups of animalswere allowed to recover for 4-16 weeks before morphologi ­cal assessment. The effect of the GP515 treatment to preserveLV geometry at 2 weeks was sustained over 16 weeks (Fig.4). These are the first data indicating that an adenosinergicagent given as an adjunctive treatment to reperfusion can at-

Infarct Expansion

*

__ Sham

-e- Rep. Alone-T- + GP515(3)

50

~ 40E5 30~:::J

~ 20~n,

::i 10

0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6

LV Volume (ml/kg)

O.L--.---.----.----.--,....--......---,...---.

12

10XQ.l

"'C8c

c0 6(J)Cco 40-xW

2

0

LV Remodeling

16

I Perm.-------1Occlusion

--------1. Rep.Alone

Rep . +GP515

_----+---- ----"!!! S ham

2.0

xQ)"0E 1.5Ol.5Qi"00E 1.0Q)

a:::c:0'iiic: 0.5C1l *0-X I Iw

0.04 8 12

Weeks Post-MI

T,--L,

~

~*~

I~J-'i>"'~((' . c-\ C ....00 c,,\'\ c,,">'\ ,?C~(('

-I""" G'?c,\ G'?c,\

1.8

1.6

x 1.4<Il"0c: 1.2

Cl 1.0c:<Il 0 .8

"00

0.6E<Il

a:: 0.4

0.2

00 1

Fig. 3. Average (± S.D.) values for infarct expansion and remodeling in­dex in rats sacrificed at 14 days post-MI. Treatment with GP5l5 resultedin a decrease in infarct expansion (top panel) compared to the reperfusionalone group (*p < 0.05, GP515 vs. vehicle). There was also a significanteffect of GP5l5 at the higher dose (3 mg/kg) to attenuate remodeling (bot­tom) (*p < 0.05, GP515 vs. vehicle).

Fig. 4. Average (± S.D.) pressure-volume (PV) relationships (top) and ex­pansion/remodeling index (bottom) obtained in post-MI rats. PV relationshipsfor GP5l5 (3 mg/kg) treated rats were shifted rightward towards sham ani­mals. Reperfusion after 2 h of occlusion (Rep. alone) resulted in a sustainedreduction in expansion/remodeling compared to permanent occlusion . Ad­junctive treatment with GP5l5 was associated with a further attenuation ofexpansion/remodeling at all time points (*p < 0.05 compared to Rep. Alone).

22

Fig. 5. Effects of exogenous and endogenous adenosine on cardiac fibro­blast proliferation (top) , protein (middle) and collagen synthesis (bottom) .The capacity of 2-cholroadenosine (black circle) and GP5l5 (open circle)to inhibit cell functions was assessed at 3 incremental doses (low, mid andhigh) . All data (average ± S.D.) are normalized for control values.

We have recently assessed the capacity of 2-chloro­adenosine (2-CIADO) and the AKI, GP515 to inhibit adultrat CF proliferation. Primary cultures of CF were isolated,cultured and stimulated to proliferate using Dulbecco's modi­fied Eagle 's media (DMEM) supplemented with 2.5% fetalbovine serum (FBS) . Cell proliferation was assessed usingcell cou nts. The top panel of Fig . 5 illustrates the result sobtained. Results are normalized as a function of control(vehicle treated) values . As can be observed, 2-CIADO ex­erted a dose dependent inhibitory effect over cell pro lifera-

med highlow

Treatment Dose

co

120

100

80

e60'E

00;!. 40

20

0

120

100

80

'2c 600u~ 400

20

0

120

100

80

~ 60c0u~ 400

20

0

tenuate the deleterious effects of infarction on LV geometry.The mechanism responsible for this activity is not yet clear.One possibility may involve the described activity of ADOto reduce reperfusion no-reflow in animal models and man[27, 45]. The critical importance of microvascular perfusionin the preservation of contractile function and LV geometryfollowi ng reperfusion therapy has bee n established [46].Thus, adjunctive treatment with acadesine or GP515 mayhave reduced early infarc t expansion/LV remodeling by in­creasing microvascular perfusion.

The effects of ADO on ameliorating adverse cardiac re­modeling may also follow actions (Table 1) on specific cellfunctions over extended periods of time. The excess deposi ­tion of extracellular matrix (ECM) proteins in the myocar­dium has gained recog nition as an important contributor toadverse remodeling and ventricular dysfunction [47]. Thecardiac fibroblast is the cell type ultimately responsible forthe development of cardiac fibrosis [48]. The followi ng sec­tions highlight the capacity of ADO to modulate cardiac fibro­blast function in the in vivo and in vitro settings .

3T3 fibrob lasts express A2b

receptors when stimulated yieldincreases in cAMP [49]. Increases in cAMP leve ls in fibro­blasts is known to couple to the inhibition of various cellfunctions associated with ECM protein production/laydown.It has been demonstrated that the stimulation of cardiac fibro­blasts (CF) with ADO also elevates cAMP levels [4]. In CFthe elevation of cAMP, nitric oxide and cGMP levels has alsobeen associated with the inhibition of collagen production[50,51 ]. Indeed, ADO has recently been reported to be ableto inhibit various CF functions. This observation is of inter­est since an important component of patholog ical card iacremodeling is the excess deposition of ECM protei ns (i.e.fibrosis) in the myocardium. Furthermore, CF are gainingrecog nition as an important source for paracrine factors suchas endothelin and angiotensin II in the heart [48]. Results froma study by Dubey et al., indicated that the treatment of CFwith ADO analogues and with agents that elevate endogenousADO levels can inhibit cell proliferation [52]. Data derivedfrom the use of various selective and nonselective ADO ana­logs/blockers indicated that the effects were likely mediatedvia A

2breceptors [52]. Dubey et al. also reporte d that treat­

ment of CF with ADO analogs and with agents that elevateendogenous ADO (EHNA, iodotubercidin, dipyridamole)inhibited serum induced proline and leucine incorporation[53]. ADO analogs also inhibited collagen and protein syn­thesis by 50% at approximately 10 11M thus, ADO potencyis consistent with an A

2breceptor-like respo nse.

In vitro effects of adenosine on cardiacfibroblast function

23

control lOuM ADO 100uM ADO

Fig. 6. Effects of 2-chloroadenosine on adult rat cardiac fibroblast TNF-arelease under basal and lipopolysaccharide (LPS) stimulated conditions . ND- not detec table.

NO NO

Ir-t-t

1000 '

800 .

::::J 600E

<;0> 400 ~.,e;

-.:u,ZI-

0

-200 .

In vivo effects of adenosine on post-MIremodeling and scarring

The above described effects on CF function and cytokinerelease have led us to propose that the enhancement of ADOlevels in the remodeling myocardium may lead to an inhibi­tion in local ECM synthesis and deposition (i.e. scarring/fi­brosis). In addition, the inhibition ofCF function and cytokinerelease from local sources by ADO may also serve to amel­iorate cardiac remodeling. A suitable model to test this hy-

cate that ADO is a potent inhibitor of lipopolysaccharide(LPS) induced TNF-a production and associated release [61,62]. The inhibitory effects of ADO on LPS induced TNF-arelease are dose dependent and could also be mimicke d byforskolin and 8-bromo-cAMP [61]. Furthermore, results alsoindicated that ADO uptake inhibitors such as dipyridamoleand the AKI idodotubercidin can also effectively suppressLPS induced TNF-a release [61,62]. These effects could beblocked by the addition of Azantagonists but not by Al or A

3

antagonis ts. We have also examined the capacity of2Cl-ADOto inhibit LPS induced release of TNF-a from adult andneo natal rat CF. For this purpose rat CF were cultured toconfluency, serum deprived and subsequently exposed to100 ng/ml of media LPS. Media was then assayed for TNF­a release. As observed in Fig. 6, when left untreated, a ba­sal, unstimulated release of TNF -a occurs from CF. LPStreatment yields an increase in TNF-a release which wassuppressed to undetectable leve ls by pretreatment with 2Cl­ADO. Thus, results from recent studies support the conceptthat ADO may serve to ameliorate the process of cardiacremodeling through its abili ty to inhibit the synthesis andrelease of pro-inflammatory cytokines such as TNF-a .

tion. To assess for the uniformity of responses across CF iso­lated form different species , parallel experiments using dogand mouse CF were performed yielding similar results (datanot shown). Using a [3H]-leucine incorporation assay, wehave also examined for the capacity of 2-ClADO and GP5 l5to inhibit adult rat CF protein synthesis. Results are shownin the middle panel of Fig. 5. As can be observed, a dosedependent inhibition in leucine incorporation was observedin CF treated with either 2-ClADO or GP515. Parallel experi­ments were performed using a PH]-proline incorporationassay (bottom panel of Fig. 5) as an indicator of CF collagensynthesis yielding comparable results (i.e. dose -dependentinhibition of collagen synthesis with ADO) . Thus, resu ltsfrom recent studies support the concept that ADO derivedfrom either exogenous or endogenous sources can exert in­hibitory actions on CF functions independently of the spe­cies used. We also performed experiments using adult rat CF,to assess for the capacity of 2-CIADO to induce increases inintracell ular levels of cAMP. Treatment of cells with isopro­terenol was used as a positive control. Results indicated that2-ClADO was capable of inducing a - 3 fold increase incAMP over basal levels (vs. 4 fold for isoproterenol) thus,supporti ng a possible role for this intracellular 2nd messen ­ger in mediating functional responses in CF.

TNF-a is a member of the pro-inflammatory cytokine fam­ily, a group of pleiotropic factors that playa major role in theresponse to injury and wound healing [54, 55] . In respo nseto inflammatory stimuli, TNF-a transcription, translation andrelease are increased [56]. TNF-a can regulate the expres­sion of a variety of humoral factors such as interleukin- I,interle ukin-6, TNF-a and catecho lamines [54,55]. Increasedlevels of this TNF-a have been detected in heart tissue fol­lowing MI [56-59] and can also be found with myocarditis,organ rejection and heart failure [56, 59]. TNF-a is knownto be importantly involved in tissue remodeling. TNF-a hasthe capacity of modulating metalloproteinase (MMP) expres­sion, inhibitors of metalloproteinases (TIMP) and collagensynthesis [54, 55] . In the setting of ongoi ng wound healingor fibrosis it is thought that TNF-a is responsible for the pro­healing activation of fibrob lasts . These actions have led tothe hypothesis that TNF-a may importantly modulate cardiacremodeling and fibrosis. Indeed, when TNF-a is overexpressedin the heart of mice, these animals develop transmural myo­carditis, systolic dysfunction, ventricular hypertrophy, dila­tation and fibrosis, ultimately leading to heart failure andpremature death [60].

Recent studies performed in strips of failing human myo­cardium, rat papillary muscles and isolated myocytes indi-

In vitro effects of adenosine on tumornecrosis factor-a. (TNF-a.) release

24

pothesis is in the setting of a permanent coronary occl usion(MI). In this setting, an aggress ive laydown ofECM proteinsoccurs over a short period of time. A group of studies waspursued in rats in which the left anterior descending coronaryartery was permanently ligated. To enhance tissue levels ofADO, the AKI compound GP5l5 was administered subcu­taneously using a miniosmotic pump. The pump was im­planted at the time of infarction for the duration of the study(2 weeks) . Results generated from this study are summarizedin Fig . 7. As can be observed, the treatment of infarcted ratswith GP5l5 led to the presence of thicker anterior (infarcted)and septal walls . These results were independent of MI sizeand were accompanied by a significant inhibition of colla­gen deposition (as assessed through picrosirius red staining)in the infarcted area . Recent similar studies conducted in ourlaboratory in which treatmen t with GP5 l5 is initiated 48 hafter MI further supports the inhibitory actio ns of ADO onmyocardial ECM synthesis and deposition (fibro sis). Thu s,these results suggest that the enhancement of endogenouslevels of ADO in the setting of ongoing myocardial ECMsynthesis and deposition may lead to ameliorated levels ofcardiac fibrosis and assoc iated remodeling.

There are clinical data that are cons istent with the hypoth­esis that enhance d endogenous ADO may attenuate the proc­ess of ventricular remodeling in heart failure . Recently, Lohand colleagues reported on a corre lation between the muta­tion in a gene encoding for AMP deaminase (AMP DA) andclinical outcome in the setting of heart failure [63] . AMPDAis an enzyme that catalyzes conversion of AMP to IMP, there­by decreasing the amount of AMP available for conversioninto ADO. Since AMPDA is located at a central position in

adenine nucleotide catabolism, reduced activity of this en­zyme would be expected to enhance ADO production [631­Loh et al. had observed that congestive heart failure patientsthat inherited a mutant AMPD1 (adenosine monophosphatedeaminase 1) gene experienced a significantly greater chanceof survival without cardiac transplantation [63]. The authorsspec ula ted that inheritance of this mutant alle le might beadvantageous to patien ts with congestive heart failure wherethe reductio n of AMPDA activity leads to enhanced prod uc­tion of ADO in muscle tissues with possible beneficial effects[63]. Further support for the beneficial role of ADO in LVremodeling is prov ided by a report that plasma ADO levelsare increased in patients with ischemic and non-ischemicCHF consistent with stimulation of a compensatory mecha­nism [64]. To note, is the observation that further elevat ionsof plasma ADO by treatment with dipyridamole or dilazepin these patients was associated with an amelioration of CHFseverity and improvement in contractile function [17].

Conclusions

There are an increasing number of data from both animalmode ls and clinical studies supporting the concept that en­hancing cardiac ADO leve ls may be a viable strategy to at­tenuate adverse myoca rdial remodeling associated with heartfailure . The use of agents which increase ADO levels by al­tering its metabolism or which selectively activate ADOreceptors appears promising and deserves further considera­tion .

40 1.0E

5> .s *..J 30 '"0.8 . -

~ '"ww z 0.6N '"iii 20 U

3:... ... 0.4o ..J

'"-c ..JU. 10 ~~ 0.2

,.;z

0 < 0.0 '- - --J

E 3~

100

.s'" * < 80 ''" ww a::z <'" z 60 'o3: w

o...j..J 40..J ..J< 0;: o

::;: a:: 20 .:::> <... (,JQ.

'"W

'"Fig. 7. Effects of a continuous infusion of GP515 on 2 week post-Ml scarring and remodeling. Data for control MI rats is shown in black bars whereasGP515 treated are in gray . GP5l5 treatment yielded a significant preservation of infarct and septal wall thickness accompanied by a decrease in infarct edwall collage n area fraction (as assessed through picrosirius red histology) .

Acknowledgements

This research was supported by funds from the CaliforniaTobacco-Related Disease Research Program, Grant Number3KT0709, AHA Grant-In-Aid Award and NIH HL-03160 toDr. Francisco Villarreal.

References1. Feoktistov I, Biaggioni I: Adenosine A2B receptor s. Pharm Rev 49:

381-402,19972. Mullane K, Bullough D: Harness ing an endogenous cardioprotective

mechanism : Cellular sources and sites of action of adenosine. 1 MolCell Cardiol27: 1041-1054, 1995

3. Schrader1, Decking U:Adenosine metabolism, transport, and energetics.Drug Dev Res 45: 288-294, 1998

4. Dubey R, Gillespie D, Mi Z, Jackson E: Cardiac fibroblasts metabo­lize cyclic-AMP to generate adenosine . Hypertension 28: 7,1996

5. Olsson R: Adenosine receptors in the cardiovascular system. Drug DevRes 39: 301-307,1996

6. Olsson R, Pearson 1: Cardiovascular purinoceptors. Phys Rev 70: 761­845, 1990

7. Elfman L, Lindgren E, Waium E, Fredholm B: Adenosine analoguesstimulate cyclic AMP-accumulation in cultured neuroblastoma andglioma cells. Acta Pharma Toxicol55: 297-302, 1984

8. Feoktistov I, Biaggioni I: Adenosine A2b receptors evoke interleukin­8 secretion in human mast cells . An enprofylline-sensitive mechanismwith implications for asthma. J Clin Invest 96: 1979-86, 1995

9. Marquardt D, Walker L, Heinemann S: Cloning of two adenosinereceptor subtypes from mouse bone marrow-derived mast cells. 1Immunol 152: 4508-4515, 1994

10. Webb R, Sills M, Chovan J, Balwierczak J, Francis J: CGS 21680: Apotent selective adenosine A2 receptor agonist. Cardiovasc Drug Rev10: 26-53, 1992

II . Liang B, Haltiwanger B: AdenosineA2a andA2b receptors in culturedfetal chick heart cells . High- and low-affinity coupling to stimulationof myocyte contractility and cAMP accumulation. Circ Res 76: 242­251,1995

12. Stein B, Mende U, Neumann J, Schmitz W, Scholz H: Pertussis toxinunmasks stimulatory myocardial A2-adenosine receptors on ventricu­lar cardiornyocytes. J Mol Cell Cardiol 25: 655-659, 1993

13. Xu H, Stein B, Liang B: Characterization of a stimulatory adenosineA2a receptor in adult rat ventricular myocyte . Am J Physiol 270:HI655-HI661, 1996

14. Dubey R, Gillespie D, Osaka K, Suzuki F, lackson E: Adenosine in­hibits growth of rat aortic smooth muscle cells . Possible role of A2breceptor. Hypertension, 27: 786-793, 1996

15. Boyle D, Sajjadi F, Firestein G: Inhibition of synoviocyte collagenasegene expression by adenosine receptor stimulation. Arthr Rheum 39:923-930, 1996

16. Tucker A, Linden J: Cloned receptors and cardiovascular responses toadenosine. Cardiovasc Res 27: 62-67, 1993

17. Kitakaze M, Hori M: Adenosine therapy : A new approach to chronicheart failure . Exp Opin Invest Drugs 9: 2519-2535, 2000

18. Sommerschild H, Kirkeboen K: Adenosine and cardioprotection dur­ing ischaemia and reperfusion - an overview. Acta Anaesthesiol Scand44: 1038-1055,2000

19. Pitarys C, Virmani R, Vildibill H, Jackson E, Forman M: Reduction ofmyocardial reperfusion injury by intravenous adenosine administeredduring the early reperfusion period . Circula tion 83: 237-247, 1991

25

20. Todd 1, Zhao Z, Williams M, Sato H, Van Wylen D, Vinten-lohansenJ: Intravascular adenosine at reperfusion reduces infarct size and neu­trophil adherence. Ann Thorac Surg 62: 1364-1372, 1996

21. Zhao,Z, Nakamura M, Wang N, Wilcox 1, Shearer S, Guyton R, Vinten­Johansen J: Administration of adenosine during reperfusion reducesinjury of vascular endothelium and death of myocytes. Coron ArteryDis 10: 617-628, 1999

22. Vander Heide R, Reimer K: Effect of adenosine therapy at reperfusionon myocardial infarct size in dogs. Cardiovasc Res 31: 711-718, 1996

23. Baxter G, Hale S, Miki T, Kioner R, Cohen M, Downey J, Yellon D:Adenosine A I agonist at reperfusion trial (AART): Results of a three­center, blinded , randomized, controlled experimental infarct study.Cardiovasc Drugs Ther 14: 607-614, 2000

24. Sekili S, leroudi M, Tang X, Zughaib M, Sun J, Bolli R: Effect ofadenosine on myocardial 'stunning' in the dog . Circ Res 76: 82-94,1995

25. Garratt K, Holmes D, MolinaViamonte V, Reeder G, Hodge D, BaileyK, Lobi J, Laudon D, Gibbons R: Intravenous adenosine and lidocainein patients with acute myocardial infarction . Am Heart 1 136:196-204,1998

26. Mahaffey K, Puma J, Barbagelata N, DiCarli M, Leesar M, BrowneK, Eisenberg P, Bolli R, Casas A, Molina -Viamonte V, Orlandi C,Blevins R, Gibbons, R Califf R, Granger C: Adenosine as an adjunctto thrombo lytic therapy for acute myocardial infarction: Results of amulticenter, randomized, placebo-controlled trial : The Acute Myo­cardial lnfarction Study of Adenosine (AMISTAD) trial. 1 Am CoilCardiol 34: 1711-1720, 1999

27. Marzilli M, Orsini E, Marraccini P, Testa R: Beneficial effects ofintracoronary adenosine as an adjunct to primary angioplasty in acutemyocardial infarction. Circulation 101: 2154-2159, 2000

28. Nees S, Herzog V, Becker B, Bock M, Des Rosiers C, Gerlach E: Thecoronary endothelium: A highly active metabolic barrier for adenos­ine. Basic Res Cardiol 80: 515-529, 1985

29. Sparks H, Bardenheuer H: Regulation of adenosine formation by theheart. Circ Res 58: 193-201, 1986

30. Martin B, McClanahan T, Van Wylen D, Gallagher K: Effects of is­chemia, preconditioning, and adenosine deaminase inhibition on inter­stitial adenosine levels and infarct size. Basic Res Cardiol 92: 240-25 1,1997

31. Zughaib M, Abd-Elfattah A, leroudi M, Sun 1, Sekili S, Tang X, BolliR: Augmentation of endogenous adenosine attenuates myocardial'stunning' independently of coronary flow or hemodynamic effects .Circulation 88: 2359-2369, 1993

32. Abd-Elfattah A, lessen M, Wechsler A: Nucleoside trapping duringreperfusion prevents ventricular dysfunction , 'stunning,' in absence ofadenosine. Possible separation between ischemic and reperfusion in­j ury. 1 Thorac Cardiovasc Surg 108: 269-278, 1994

33. Strauer B, Heidland U, Heintzen M, Schwartzkopff B: Pharmacologicmyocardial protection during percutaneous trans luminal coronaryangiop lasty by intracoronary application of dipyridamole: Impact onhemodynamic function and left ventricular performance. 1 Am CoilCardiol 28: 1119- 1126, 1996

34. Heidland U, Heintzen M, Michel C, Strauer B: Intracoro nary admin­istration of dipyridamole prior to percutaneous transluminal coronaryangioplasty provides a protective effect exceeding that of ischemic pre­conditioning. Coron Artery Dis II: 607-613, 2000

35. Andersen K, Dellborg M, Swedberg K: Nucleoside transport inhibi­tion by draflazine in unstable coronary disease . Eur 1 Clin Pharmacol51: 7-13,1996

36. Mangano D: Effects of acadesine on myocardial infarction, stroke,and death following surgery. A meta-analysis of the 5 internationalrandomized trials. The Multicenter Study of Perioperative Ischemia(McSPI) Research Group . Jama 277: 325-332, 1997

26

37. Pfeffer M, Braunwald E: Ventricular remodeling after myocardial in­farction. Experimental observations and clinical implica tions . Circu­lation81 : 1161-1172, 1990

38. Boyle M, Weisman H: Limitation of infarct expansion and ventricularremodel ing by late reperfusion. Study of time course and mechanismin a rat model. Circulation 88: 2872- 2883, 1993

39. Kroll K, Decking UK, Dreikorn K, Schrader J: Rapid turnover of theAMP-adenosine metabolic cycle in the guinea pig heart. Circ Res 73:846-856, 1993

40. Wagner D, Bontemp s F, van de n Berghe G: Existence and role ofsubstrate cycl ing betw een AMP and adenos ine in isolated rabbitcardiomyocytes under control conditions and in ATP depletion . Cir­culation 90: 1343-1349, 1994

41. Ugarkar B, DaRe J, Kopcho J, Browne C, Schanzer J, Wiesner J, ErionM: Adenosine kinase inhibitors. I. Synthesis, enzyme inhibition, andantiseizure activity of 5-iodotub ercidin analogues. J Med Chern 43:2883- 2893,2000

42. Firestein G, Boyle, D, Bullough D, Gruber H, Sajjadi F, Montag A,Sambol B, Mullane K: Protective effect of an adenosine kinase inhibitorin septic shock. J Immunol 152: 5853-5859, 1994

43. Bauer , Bouma M, Herrmann I, van den Wildenberg F, Firestein G,Marzi I, Buurman W: Adenosine kinase inhibitor GP515 atten uateshepatic leukocyt e adhesion after hemo rrhagic hypoten sion. Am JPhysiol 273: G I297-G1303, 1997

44. Alhaddad I, Kazimuddin M, Brown E: Late coronary artery reperfusion:Benefits and mechanisms. Can J Cardiol 16: 463--466, 2000

45. Olafsson B, Forman M, Puett D, Pou A, Cates C, Friesinger G,VirmaniR: Reduction of reperfusion injury in the canine preparation by intra­coronary adenosine: Importance of the endothelium and the no- reflowphenomenon. Circulation 76: 1135-1145 , 1987

46. Ito H, Maruyama A, Iwakura K, Takiuchi S, Masuyama T, Hori M,Higashino Y, Fuj ii K, Minamino T: Clinical implications of the 'noreflow ' phenomenon. A predictor of complication s and left ventricu­lar remodeling in reperfused anterior wall myocardi al infarction. Cir­culation 93: 223-228, 1996

47. Weber K: Extrace llular matrix remodeling in heart failure: A role forde novo angiotensin II generation. Circul ation 96: 4065--4082, 1997

48. Villarreal F, Kim N: Modul ation of cardiac fibroblast function bygrowth factors and mechanical stimuli. Cardio vasc Pathol 7:145-151 ,1998

49. Brackett L, Daly J: Functional characte rization of the A2b adenosinereceptor in NIH 3T3 fibroblasts. Biochem Pharm 4: 801- 814, 1994

50. Berg R, Moss J, Baum B, Crystal R: Regulation of collagen produc­tion by the beta-adrenergic system. J Clin Invest 67: 1457-1462, 1981

51. Kim N, Villegas S, Summerour S, Villarreal F: Regulation of cardiacfibroblast extracellul ar matrix production by bradykinin and nitricoxide. J Mol Cell Cardiol 31: 457--466, 1999

52. Dubey R, Gille spie D, Mi Z, Jackson E: Exoge nous and endoge nousadenosine inhibits fetal calf serum-induced growth of rat cardiac fibro­blasts: Role of A2B receptors. Circulation 96: 2656-2666, 1997

53. Dubey R, Gi llespie D, Jackson E: Adenosine inhibit s coll agen andprotein synthesis in cardiac fibroblasts: Role of A2B receptors. Hyper­tension I: 943-994, 1998

54. Kovacs E, DiPietro L: Fibrogenic cytokines and connective tissue pro­duction. Faseb J 8: 854- 861,1 994

55. Witte M, Barbul A: General principles of wound healing. Surg ClinNorth Am 77: 509-5281 997

56. Meldrum D: Tumor necrosis factor in the heart. Am J Phys, 274: R577­R595, 1998

57. Basaran Y, Basaran M, Babacan K, Ener B, Okay T, Gok H, OzdemirM: Serum tumor necrosis factor levels in acute myocardial infarctionand unstable angina pectoris. Angiology 44: 332-337, 1993

58. Yue P, Massie B, Simpson P, Long C: Cytokine expression increasesin non-rnyocytes from rats with postinfarction heart failure. Am JPhysiol275 : H250-H258, 1998

59. Feldm an A, Co mbes A, Wagner D, Kadakomi T, Kubota T, Li Y,McTiernan , C: The role of tumor necrosi s factor in the pathoph ysiol­ogy of heart failure. J Am Coli Cardiol 35: 537--44, 2000

60. Kubota T, McTiernan C, Frye C, Slawson S, Lemster B, Koret sky A,Demetris A, Feldman A: Dilated cardiomyopathy in transgenic micewith cardiac-specific overexpression of tumor necrosis factor-alpha.Circ Res 81: 627- 635, 1997

6 1. Wagner D, Combes A, McTiernan C, Sande rs V, Lemster B, FeldmanA: Adenosine inhibits lipopolysaccharide-induc ed cardiac expressionof tumor necrosis factor-alpha. Circ Res 82: 47-56, 1998

62. Wagner D, McTiernan C, Sanders V, Feldman A: Adenosine inhibitslipopolysacchar ide-induced secretion of tumor necrosis factor-alphain the failing human heart. Circulation 97: 521-5 24, 1998

63. Loh E, Rebbeck T, Mahoney P,DeNofrio D, Swain J, Holmes E: Com­mon variant in AMPD I gene predicts improved clinical outcome inpatients with heart failure. Circulation 99: 1422-1425 ,1999

64. Funaya H, Kitakaze M, Node K, Minamino T, Komamura K, Hori M:Plasma adenosine levels increase in patients with chronic heart fail­ure. Circulation 95: 1363- 1365, 1997

Molecular and Cellular Biochemistry 251: 27- 32, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Right ventricular collagen and fibronectin levels inpatients with pulmonary atresia and ventricularseptal defect

Theodorus H.F. Peters.'? Peter L. de Jong,' Lennart Klompe,' ?Rolf M.F. Berger,' Pramod R. Saxena," Hari S. Sharma' andAd J.J.C. Bogers'Departments of 'Cardiothoracic Surgery; "Pharmacology; 3pediatrics, Erasmus MC, University Medical Center,Rotterdam, The Neth erlands

Abstract

Pulmonary atresia (PA) with ventricular septal defect (YSD) is an extreme form of tetralogy of Fallot with characteristic rightventricular hypertrophy. To reduce the right ventricular overload, these children have to undergo staged correcti ve surgery torestore physiological pulmonary perfusion . We studied the degree of fibro sis by analysing the myocardial expre ssion pattern(at mRNA and protein level) of the extracellular matrix proteins, collagen and fibronectin in biopsies taken at correcti ve sur­gery from 14 patients affected by PA,YSD. Expre ssion analysis by RT-PCR showed significantly higher levels for collagen III(p = 0.03), whereas collagen Ia (p = 0.31) and fibronectin (p = 0.47) mRNA levels remained unaltered in PA, YSD patients ascompared to age matched control s. Video image analysi s of immunohistochemical staining showed unchanged interstitial lev­els for total collagen (p =0.17) as well as for fibronectin (p =0.13 ) in the patients with PA, YSD. However, peri-vascular stain­ing for collagen (p < 0.01) and fibronectin (p = 0.02) represented as the peri-vascul ar stained area corrected for the vessel lumenarea showed significantly decrea sed levels in the PA,YSD group as compared to controls. Our results indicate that the patientswith PA, YSD have inadequate extracellular matrix support for their coronary blood vessels and perhaps due to an alteredbiosynthesis of collagen and fibronectin network. (Mol Cell Biochem 251: 27-32,2003)

Key words: collagen, fibronectin , gene expression, right ventricle, pulmonary atresia, tetralogy of Fallot

Introduction

Pulmonary atre sia with ventricular septal defec t (PA, YSD)is an ext reme form of tetralogy of Fallot where antegradeblood flow to the pulmonary artery is completely obstructed[1, 2]. Some PA, YSD patients have a normal central pul­monary arterial system with a duct -dependent pulmonarycirculation, whereas others have either partial or completeabsence of the nati ve pulmonary arteries and their pulm o­nary circulation depends on systemic-pulmonary collateralarteries (SPCAs) [2]. SPCAs are highl y variable in numberand usually arise from the aortic arch , descending aorta orfrom the side branches.

At the Erasmus Medical Centre Rotterdam, the correctionfor PA, YSD with or without SPCA s, is performed in stages.The patients with a duct-dependent pulmonary circulation areinitially palliated with a modified Blalock-Taussig (MBT)shunt. The patients with SPCA-dependent pulmonary circu­lation are initially palliated by unifocalization of the pulmo­nary vasculature in either lung, combined with a MBT-shunt.In both group s corrective surgery consists of closure of theMBT-shunts, closure of the YSD and installing a pulmonaryhomograft between the right ventricle and the (unifocalized)pulmonary arterial system. At correction, the right ventriclein patients with PA, YSD shows without exception hypertro­phy as an adaptive response to the increased pressure overload.

Address for offprints: H.S. Sharma, Institute of Pharmacology, Erasmus MC, University Medical Center, Dr. Molewaterplein 50, 3015 GE Rotterdam, TheNetherlands (E-mail: H.Sharma@Erasmusmc.nl)

28

This response could lead to remodelling of the myocardiumand to the development of interstitial fibrosis [3-5].

In experimental models cardiac hypertrophy by pressureoverload has been shown to accompany myocardial collagendeposition contributing to the increased stiffness of the car­diac muscle [6, 7]. Most collagen subtypes in the heart areexclusively produced by cardiac fibroblasts, with the excep­tion of type IV, which also is produced by other cell typesincluding cardiac myocytes [8]. The collagen I and III sub­types are the most abundant forms in the heart . Collagen typeI represents 80% of the total cardiac collagen content and isimportant for the cardiac stiffness [8, 9]. Collagen type IIIrepresents about 12% of the total cardiac collagen content andis important for tissue elasticity [8, 9]. Collagen type I andIII are widely distributed between myocytes and amongmuscle fibres and morphologic studies have defined the spa­tial distribution of these collagen types in normal and hyper­trophic hearts [7, 9-1 I].

Myocardial fibronectin is homogeneously localised through­out the extracellular space and is closely associated withcollagen fibres [12]. It is a glycoprotein and serves as a bridgebetween cardiac myocytes to the interstitial collagen network[3]. Fibronectin binds collagen and modulates the collagenfibrillogenesis, consequently resulting in higher contents ofcollagen type I and a lower collagen type III concentration [13].Furthermore, fibronectin influences several processes, includ­ing cell growth, adhesion, migration and wound repair [14].

The present study was undertaken to describe the degreeof myocardial fibrosis in patients with PA, VSD by investi­gating the expression of collagens and fibronectin (both atmRNA and protein level) in right ventricular biopsies ob­tained from patients undergoing surgery for PA, VSD. Sec­ondly, we attempted to correlate the expression data withclinical data.

Materials and methods

Patients

The present study was approved by the Medical Ethical Com­mittee of the University Hospital Rotterdam (MECI53 . 268/1996/ 119). Biopsies from the right ventricular outflow tractwere taken at corrective surgery for PA, VSD in 14 patients .Mean age of the patients at the time of surgery was 2.54 ±0.32 years (ranging 0.76-5.51 yrs). Age-matched control bi­opsies (Control) were taken from 4 heart valve donors who dieddue to non-cardiac cause (mean age 2.84 ± 1.22 years (rang­ing 0.01-5.70 yrs). Part of the myocardial biopsy was imme­diately frozen in liquid nitrogen for mRNA expression studies,and the other part was fixed in 4% paraformaldehyde in phos­phate buffered saline (PBS) for at least 24 h and further proc­essed for histological and immunohistochemical studies .

Total RNA isolation and RT-PCR

Right ventricular tissue biopsies (50-60 mg) were homog­enised in 500 111 guanidinium thiocyanate (GTC) buffer andprocessed for the extraction of total cellular RNA [15]. TheRNA concentration was estimated by optical density meas­urements at 260 nm and a RNA/protein ratio of ~ 1.8 was ac­cepted. The quality of total RNA was further verified on a1% agarose gel.

Reverse transcriptase polymerase chain reaction (RT-PCR)analysis was used to asses the mRNA expression levels ofcollagen Ia, collagen III and fibronectin. For RT-PCR, firststrand of cDNA was synthesised from total cellular RNAusing Promega's Universal RiboClone cDNA Synthesis Sys­tem (Promega, BNL, Leiden, The Netherlands) . Appropriateoligonucleotide primers for the PCR were designed from therespective published human sequences for collagen Ia [16],collagen III [17] and fibronectin [18] and ~-actin [19] cDNAs.Oligonucleotide primers were procured commercially (LifeTechnologies BV, Breda, The Netherlands) (Table I) .

The PCR amplified products were analysed on the same1.5% agarose gel and digitally photographed. Quantificationwas done by measuring the intensity of the bands with a Mo­lecular Analist (V 1.5) image analysis program (Biorad Labo­ratories, Hercules, CA, USA) running under Windows 98.The measurements of the intensity of the bands were cor­rected for background. The intensity of the ~-actin band ofeach patient was set to the value of one as the internal stand­ard and the values of the collagen la, collagen III and fibro­nectin bands were divided by the ~-actin band values of therespective patient.

(Immuno thistochemistry

Immunohistochemical staining was performed using the avi­din-biotin complex (ABC) method strictly following suppli­er's instructions (BioGenex, San Ramon, CA, USA). Sectionsof 5 11m thickness were deparaffinised, rehydrated, mountedon pre-coated glass and pre-treated in citrate buffer for anti­gen retrieval. The background was blocked by 10% normalgoat serum diluted in 5% bovine serum albumin in PBS .Specific antibodies against human fibronectin (Clone Ab­3, Neomarkers, Fremont, CA, USA) in I :150 dilution wereapplied as primary antiserum. Color was developed usingNew Fuchsine as chromogen, while endogenous alkalinephosphatase activity was inhibited by 0.01 M levamisole andthe sections were counter stained with haematoxylin. Slideswere mounted and visualised under a light microscope. Nega­tive controls were performed by omission of the primaryantibodies.

For total collagen staining, myocardial tissue specimenswere incubated in a specific dye, Sirius Red F3BA. Tissue

29

Table I. Sequences of various oligonucleotide primers

Primer Bases

CollagenIa-F 20Collagen Ia-R 20

Collagen III-F 20Collagen III-R 20

Fibronectin-F 20Fibronectin-R 19

p-actin-F 30p -actin-R 28

Sequence

GATGCCAATGTGGTTCGTGAGCTGTAGGTGAAGCGGCTGT

CAGTGGACCTCCTGGCAAAGTGTCCACCAGTGTTTCCGTG

CACCATCCAACCTGCGTTTCTGTCCTACATTCGGCGGGT

TGACGGGGTCACCCACACTGTGCCCATCTAACTCGTCATACTCCTGCTTGCTGATCCA

Size of PCR product

569 bp

5l9bp

531+ 456 bp(splicing variants)

625 bp

sections (5 11m thick) were treated with 0.2% aqueous phos­phomolybdic acid and then incubated in 0.1% Sirius RedF3BA solution [21]. Before dehydration, the slides were treatedwith 0.01 N HCl and mounted. The slides were mounted andvisuali sed under light microscope.

Video image analysis

Video image analy sis was used to quantify the expressionlevels of collagen and fibronectin .Twelve digital images weretaken from a representative area of each tissue specimen. Theimages were analysed for positive staining using an auto­mated computer Leica Qwin Standard (V 2.2) image analysissoftware package (Leica Imaging Systems Ltd., Cambridge,UK) . Distribution of the stained fibres in the interstitial spaceas well as in the peri-vascular region was measured as a posi­tive area. Interstitial expression was represented as ratio stain­ing per total tissue area, excluding vascular area s, whereasperi-vascular locali sation was depicted as staining per peri­vascular area. Since the Peri-Vascular Collagen Area (PVCA)and vessel Luminal Area (LA) are positively correlated, thestained PVCA was normalised to the LA and represented asPVCA/LA ratio [20]. The Peri -Vascular Fibronect in Area(PVFA) was normali sed in the same way for the LA and rep­resented as PVFAlLA ratio .

Statistical analysis

Results were expres sed as mean ± S.E.M. Statistical probabil­ity was assessed by (non-parametric) Kruskal-Wallis one wayanalysis of variance. Results were considered stati sticallysignificant with p < 0.05 . Regression analysis of clinical datawith collagen and fibronectin expression data was performedusing SPSS software. The correlation coefficient and signifi­cance level were calculated using linear (Pearson's) regre s­sion.

Results

Employing RT-PCR, the myocardial expression of collagenIu, collagen III and fibronectin mRNAs were assessed in 9patients who underwent surgery for PA, VSD and the mRNAlevels were compared with 3 age matched controls. The dataobtained are reported in Figs 1 and 2. Quantitative analysisusing optical density of band s obtained for collagen III genein relation to l3-actin band showed significantly higher (p =0.03) mRNA levels in patients with PA, VSD (0.96 ± 0.11)as compared to the controls (0.61 ± 0.07). No significantdifferences in collagen la (0.65 ± 0.10 vs. 0.85 ± 0.13, P =0.31) and fibronectin (0.11 ± 0.02 vs. 0.15 ± 0.04, P =0.47)mRNA levels betwe en PA, VSD patient and control groupswere observed (Fig. 2).

Total collagen staining using picro-sirius red depicts thatcollagen bundles are localised in the interstitium as well asin the peri-vascular areas in the right ventricular tissue ob­tained from both groups. However, the expression pattern inpatients with PA, VSD was different than in control as thecollagen bundles were disarrayed and irregul ar in shape andsize. Video image analy sis of total collagen showed no sig­nificant differences in expression level s in patients with PA,VSD as compared to control (9.42 ± 1. 44 vs. 13.02 ± 2.48,P = 0.14) (Fig. 3). The values of the interstitial collagen re­mained statistically unaltered (8.92 ± 1.47 vs. 11.24 ± 2. 02,P = 0.17) in the PA, VSD group as compared to control (Fig .3, panel A). However, for the normalised peri-vascular col­lagen area, the PVCAlLA ratio was significantly lower in thePA, VSD group as compared to control (3.24 ± 0.32 vs. 8.23± 1.56, P < 0.01) (Fig . 3, panel C).

The pattern of fibronectin locali sation was similar to thatof coll agens as it was localised in the interstitial spaces andaround the blood vessels . Video image analy sis of total fi­bronectin showed that the expre ssion levels in the PA, VSDgroup were not significantly changed as compared to control(7.32 ± I . 02 vs. 14.72 ± 4.26, P =0.06) (Fig . 3). The expres­sion pattern of interstitial fibronectin also remained unaltered

30

B

D

~.o

, .0

0.0 .J......-'-_ _ -""""""'='----_Fibronecti n

0.10

10.0

O.2~

0.::0

O.l~

0.0.<

o.oo.J......-'----=~=1--

c

A

I ] Cont rol~ PA·VSD

'*

c o.zs0'!:j 0- 0.::0

~ ~w '"

0.l.S.k.. c 0.10

~.~

~§.

D.~E

000

c10.00

]I Ci~

c ,.0-ee ..w ;:; 6.0.. «g :l u

(J)

!: > ~.o.~ ~<>. 0.0

tricular pressure as well as with 0 2-saturation showed nosignificant regression values.

Discussion

The present study investigated the expression of fibrosismarkers in the right ventricular biopsies obtained from pa­tients with PA, VSD and this expression pattern was com­pared with that of right ventricular tissue obtained from agematched control individuals. Analysing the expression pat­tern of two fibrosis markers in the myocardium, we found atendency for decreased collagen and fibronectin contentswithout statistically significant differences when the studygroup of PA, VSD patients was compared to the controlgroup. However, the peri-vascular stained area, corrected forlumen area, levels for collagen as well as for fibronectin weresignificantly lower in the patient group . This suggests thatthere was a small amount of accumulation for collagen andfibronectin around the vessels. Additionally, it can be empha­sised that the collagen and fibronectin deposition in the inter­stitial areas showed an altered pattern, depicting irregularitiesin the network of collagen and fibronectin fibres . Our resultsindicate that the patients with PA,VSD may have an impairedextracellular matrix support for their coronary blood vessels .

The expression of collagen and fibronectin was also evalu­ated at mRNA level by RT-PCR analysis, where we foundsignificantly increased levels for collagen type III and un­changed levels for collagen Ia and fibronectin in patients with

Fig. 3. Quantitat ive analys is of interstitial and peri-vascular collagens andfibronectin in patients with PA, VSD using video image anal ysis . Totalcollage ns as well as fibronectin levels in the different myocardial tissuespecimens were quantified using a video image analysis system . Bar dia­grams depict , in panels A and B the ratio of interstitial stained area withtotal tissue area whereas, in panels C and D the peri-vascular stained areanormalised to the vascular lumen area (PVSA/LA). Values are shown asmean ± S.E.M. and p values that were lower than 0.05 were accepted assignificant.

ControlPA , VSD

/>- actin --..

flbr nneetln -.{

/>- actin --..collagen Ia. -.collagen II I ...

t.J! '.J! 1.2

CA B C

~ t.o ~ 1.0 ~ 1.0'i' 'i' ..'" '" eO~ O~ 0.8 0.8

~ c.. c ..~ 0.6 ~ 0.6 - E 0.6.c .!!

8'" '02.. o_~ u

0.' 0 0.'0£ £

0 .21; 0.2 ,=. g 0.2 ... 0.2II: .. II:II:

0.0 0.0 0.0

(7.11 ± 1.08vs.14.l8±4.1O,p=0.13)whenpatientswithPA, VSD were compared to respective controls (Fig. 3, panelB). However, for the normalised peri-vascular fibronectinarea the PVFA/LA ratio showed a significantly decreasedlevels in the PA, VSD group as compared to control (1.37 ±0.10 vs. 2.78 ± 0.93, p = 0.02) (Fig. 3, panel D).

Pearson's correlation and regression analysis was performedon several clinical parameters such as, right ventricular pres­sure and transcutaneous 0 2-saturation with the expressionlevels of collagens and fibronectin in both interstitium andperi-vascular area . The data on correlation with right ven-

c:::J Contro l ~ PA, V SD

Fig. 2. Quantitative analysis of mRNA expression for fibronectin, colla­gen Iu and collagen III in patients with PA, VSD in relation to age matchedcontrol. RT-PCR products for fibronectin , collagen la and collagen III inPA, VSD patients and contro ls were separated on agarose gels and visual­ised by ethidium bromide staining and photographed. The optical densityvalues of the bands were corrected for background and the intensity of themyocardial ~-actinband of each patient was used as an internal standard tonormalise the collagen In , collagen III and fibronectin bands as describedin 'Materials and methods ' . Values are shown as mean ± S.E.M. and p val­ues that were lower than 0.05 were accepted as significant.

Fig. 1. RT-PCR analysis of fibronectin, collagen Io., collagen III and ~­

actin in human right ventricular tissue . Known aliquots of total RNA fromvarious right ventricular biopsies were processed for reverse transcriptionreaction to synthesise cDNA. An aliquot of 50 ng cDNA was further usedin PCR amplification with specific primers for fibronect in, collagen In, col­lagen III and ~-actin. The PCR produc ts were separated on an agarose geland visualised by ethidium bromide staining. Co-amplification of an inter­nal control, ~-actinwas included to quantitatively assess the mRNA levelsof various extracellul ar matrix protein . Fibronectin is represented by twoPCR product bands due to alternate splicing of the mRNA.

PA, VSD. Enhanced levels for collagen III could be attrib­uted to the altered myocardial architecture due to hypoxemiaas well as hypertrophy. Furthermore, the enhanced levels ofcollagen III mRNA in the patients with PA, VSD may be at­tributed to the decreased degradation of this mRNA. Inter­estingly, enhanced levels of collagen III mRNA did not resultin an increased biosynthesis and accumulation of total col­lagen as we observed unchanged values for total collagen.Perhaps an altered biosynthesis and an inadequate collagenand fibronectin fibres network around the coronary bloodvessels could contribute to the existing cardiac pathology.

Limited research has been done so far on PA, VSD patients .This study contributes in the understanding of myocardialarchitecture in patients with PA, VSD . In a study on colla­gen and fibronectin content in patients with tetralogy of Fal­lot, also no significant changes in the interstitial collagen orfibronectin expression were found [21], whereas only theperi-vascular collagen area corrected for lumen area was sig­nificantly altered, resulting in a higher expression of totalcollagen in the peri-vascular area in adult patients with te­tralogy of Fallot. In the present study we found an increasedexpression of collagen type III in the myocardium, whereasthe collagen type 1expression was not changed. Other stud­ies also show that cardiac collagen expression in normal andhypertrophied myocardium differs qualitatively [22].

We realise the limitations posed in our human study basedon myocardial biopsies obtained during surgical correctionof the congenital anomaly. We are dealing with hypertrophiedmyocytes which result in changes in the ratio of cells perdigital image. This may influence the staining data . Hencethe interpretation of the obtained results should be cautiouslytaken. Yet not much is known about patients with PA, VSDat a cellular level, so any available new data for this group istaken along in the understanding of this disease. As men­tioned earlier, we studied limited numbers of patients andcontrols. Therefore the conclusions can only be drawn withcaution. It may be added here that the limited clinical dataon normal myocardium in young healthy children is a limi­tation of our study as well. We are currently accumulatingappropriate tissue biopsies to increase the number of contro ls.

In conclusion, our data suggest that in patients with PA,VSD an inappropriate state of the extracellular matrix sup­port for their coronary blood vessels is evident. Speculationscan be made whether or not this is due to an altered biosyn­thesis of collagen and fibronectin in the extracellular network .As yet , no correlation with clinical parameters or outcomecould be established.

Acknowledgement

This study was supported by the Dutch Heart Foundation,grant number 96. 082 .

31

References

1. Kirklin JW, Barrat-Boyes BG: Ventricular Septal Defect and Pulmo­nary Stenosis or Atresia, 2nd edn . Churchill-Livingstone, New York,1993, pp 816-1012

2. Tchervenkov CI, Roy N: Congenital Heart Surgery Nomenclature andDatabase Project: Pulmonary atresia-ventricular septal defect. AnnThorac Surg 69: S97-S I05, 2000

3. Pelouch V, Dixon 1M, Golfman L, Beamish RE, Dhalla NS: Role ofextracellular matrix proteins in heart function . Mol Cell Biochem 129:101-120, 1994

4. van Bilsen M, Chien KR: Growth and hypertrophy of the heart : To­wards an understanding of card iac specific and inducible gene expres­sion. Cardiovasc Res 27: 1140-1149, 1993

5. Schwartz K, Carrier L, Mercadier JJ, Lompre AM: Molecular pheno­type of hypertrophied and failing myocardium. Circulation 87: VII 5­10,1993

6. Samuel JL, Barrieux A, Dufour S, Dubus I, Contard F, Koteliansky V,Farhadian F, Marotte F, Thiery JP, Rappaport L: Accumulation of fe­tal fibronectin mRNAs during the development of rat cardiac hyper­trophy induced by pressure overload. J Clin Invest 88: 1737-1746,1991

7. Bishop JE, Rhodes S, Laurent GJ, Low RB, Stirewalt WS: Increasedcollagen synthesis and decreased collagen degradation in right ven­tricular hypertrophy induced by pressure overload. Cardiovasc Res 28:1581-1585, 1994

8. Chapman D, Weber KT, Eghbali M: Regulation of fibrillar collagentypes 1and III and basement membrane type IV collagen gene expres­sion in pressure overloaded rat myocardium. Circ Res 67: 787-794,1990

9. Bashey RI, Martinez-Hernandez A, Jiminez SA : Isolation, charac­terization, and local ization of cardiac collagen type VI. Associationswith other extracellular matrix components. Circ Res 70: 1006­1017,1992

10. Factor SM, Robinson TF, Dominitz R, Cho S: Alterations of the myo­cardial skeletal framework in acute myocardial infarction with andwithout ventricular rupture. Am J Cardiovasc Pathol1 : 91-97, 1986

11. Takahashi T, Schunkert H, Isoyama S, Wei JY, Nadal-Ginard B,Grossman W, Izumo S: Age-related differences in the expression ofproto -oncogene and contractile protein genes in response to pressureoverload in the rat myocardium. J Clin Invest 89: 939-946, 1992

12. Speiser B, Weihrauch D, Reiss CF, J S: The extracellular matrix inhuman cardiac tissue part II: Vimentin, laminin, and fibronectin .Cardioscience 3: 41-49, 1992

13. Speranza ML, Valentini G, Calligaro A: Influence of fibronectin on thefibrillogenesis of type I and type III collagen. Coll Relat Res 7: 115­123, 1987

14. Farhadian F, Contard F, Corbier A, Barrieux A, Rappaport L, SamuelJL: Fibronectin expression during physiological and pathological car­diac growth . J Mol Cell Cardiol27: 981-990,1995

15. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acidguanidinium thiocyanate-phenol-chloroform extraction .Anal Biochem162: 156-159, 1987

16. Bernard MP, Chu ML, Myers JC, Ramirez F, Eikenberry EF, ProckopDJ: Nucleot ide sequence of complementary deoxyribonucleic acids forthe pro alpha I chain of human type 1 procollagen. Statistical evalua­tion of structures that are conserved during evolution. Biochem 22:5213-5223, 1983

17. Ala-Kokko L, Kontusaari S, Baldwin CT, Kuivaniemi H, Prockop DJ:Structure of eDNA clones coding for the entire prepro alpha I chainof human type III procollagen. Differences in protein structure fromtype I procollagen and conservation of codon preferences. Biochem J260: 509-516, 1989

32

18. KomblihttAR, Vibe-Peter sen K, Baralle FE: Isolation and characteri­zation of cDNA clones for human and bovine fibronect ins. Proc Nat!Acad Sci USA 80: 3218-3222, 1983

19. Yamaguchi T, Iwano M, Kubo A, Hirayama T, Akai Y, Horii Y, Fu­jimoto T, Hamagu chi T, Kurumatan i N, Motomiya Y, Dohi K: IL-6mRNA synthes is by peripheral blood mononuclear cells (PBMC) inpatients with chronic renal failure . Clin Exp lmmunol 103: 279-328,1996

20. Brilla Co. Janicki JS, Weber KT: Impaired diastolic function and coro-

nary reserve in genetic hypertens ion. Role of interstit ial fibrosi s andmedial thickening of intrarnyocardial coronary arteries. Circ Res 69:107-115, 1991

21. Peters THF, Sharma HS, Yilmaz E, Bogers AJJC: Quantitative analy­sis of collagen s and fibronectin expression in human right ventricularhypertrophy. Ann NY Acad Sci 874: 278-285 ,1999

22. limoto OS, Covell JW, Harper E: Increase in crosslinking of type I andtype III collagens associated with volume-overloaded hypertrophy. CircRes 63: 399-408,1988

Molecular and Cellular Biochemistry 251: 33-42, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

A mouse model of familial hypertrophiccardiomyopathy caused by a a-tropomyosinmutation

Rethinasarny Prabhakar,' Natalia Petrashevskaya,' Arnold Schwartz,'BruceAronow,' Greg P. Boivin," Jeffery D. Molkentin' andDavid F. Wieczorek''Department ofMolecular Genetics, Biochemistry, and Microbiology; 2lnstitute ofMolecular Pharmacology andBiophysics; "Department ofPathology and Laboratory Medi cine, University of Cincinnati College ofMedicine, Cincinnati,OH; 3Department ofDevelopm ental Biology; 5Department ofMolecular Cardiovascular Biology, Children's HospitalResearch Center, Cincinnati, OR, USA

Abstract

Familial hypertrophic cardiomyopathy, a disease caused by mutations in cardiac contractile protein s, is characterized by leftand/or right ventricular hypertrophy, myocyte disarray, fibrosis, and cardiac arrhythmias that may lead to premature suddendeath . Five distinct point mutation s within a-tropomyosin are associated with the developmen t of familial hyper trophic car­diomyopathy. Two of these mutations are found within a troponin T binding site, located at amino acids 175 and 180. In thisstudy, we analyze a transgenic mouse model for one of the mutations that occur at codon 180: a substitution of a glutami c acidfor a glycine. These mice develop severe cardiac hypertrophy, substantial interstitial fibrosis, and have an increased heart weight!body weight ratio . Results show that calcium-handling proteins associated with the sarcoplasmic reticulum exhibit decreasedexpres sion. These alterations in gene expression, coupled with the structurally-altered tropomyosin, may contribute to the dem­onstrated decrea sed physiological performance exhibited by these transgenic mice . A DNA hybridization microarray analysisof the transgenic vs. control ventr icular RNAs shows that 50 transcripts are differentially expressed by more than 100% duringthe onset of the hypertrophic process, many of which are associated with the extracellular matrix. This study demon strates thatmutat ions within tropomyosin can be severely disruptive of sarcomeric function, triggering a hypertrophic response coupledwith a cascade of alterations in gene expression. (Mol Cell Biochem 241: 33-42, 2003)

Key words: tropomyosin, cardiac hypertrophy, familial hypertrophic cardiomyopathy, transgenic mice, cardiac function

Introduction

Familial Hypertrophic Cardiomyopathy (FHC ), a leadingcause of natural deaths among athletes in their late teens/early20's, results from mutations in cardiac sarcomeric proteins.The disease is characterized by concentric hypertrophy inthe left ventricular wall and/or intraventricular septum, withmyofiber disarray, increased fibrosis, and an increased heartweight :body weight ratio . The severity of these commonsymptoms varies considerably dependent upon which gene

is mutated, modifier gene s, and environmental influences.The mutations responsible for FHC occur in many of thecardiac contractile proteins, including myosin heavy and lightchains, actin, troponin T, myosin binding protein C, and a­tropomyosin (TM). Five mutation s in tropomyosin have beenassociated with the development of hypertrophic cardiomy­opathy [1- 3J; two of these mutation s occur in the tropomy­osin-troponin T binding region:Asp175Asn and Glul80Gly.Both of these TM amino acid substitutions result in a changein the charge of the amino acid, thereby potentially disrupt-

Address f or offp rints: D.E Wieczorek, Department of Molecular Genetics, Biochemistry and Microbiology, University of Cincinnati College of Medicine,Cinc innati, OH 45267-0524, USA (E-mail: david.wieczorek @uc.edu)

34

ing the coil-coiled structure of the TM dimer or its interac­tion with actin or troponin T.

Tropomyosin is a 284 amino acid a-helical coil-coiled pro­tein that displays a 100% nucleotide and amino acid sequenceidentity between human and murine wildtype sequences. Assuch, FHC mutations that are present in humans can be ge­netically modified in the mouse sequence and represent thesole amino acid difference in the protein from wildtype hu­man or mouse a-TM. In recently published studies [4,5], wegenerated transgenic (TG) mouse models for both FHC a­TM mutations that affect the TM-TnT binding region . His­tological analyses of the FHC a -TM 175 transgenic mousehearts show patchy areas of mild ventricular myocyte disor­ganization and hypertrophy, with occasional thrombi forma­tion in the left atria. In vivo physiological analyses showimpairment of both contractility and relaxation in hearts ofthe FHC a-TM 175 mice, with a significant change in leftventricular fractional shortening. Cardiac myofilaments inthese mice demonstrate an increased activation of the thinfilament through enhanced Ca2+ sensitivity of steady-stateforce . The increase in the Ca2+ sensitivity of FHC myo­filaments could be due to the changes in the cooperative acti­vation of thin filaments by altering the interaction of TM andactin, by affecting the TnT binding, or through both mecha­nisms. Also, during ~-adrenergic stimulation, impaired relaxa­tion is exacerbated in the FHC a-TM 180 mice, and bothcontractility and pressure development are diminished [6].

We recently developed a second in vivo model system forthe examination of cardiomyopathic mutations that occur ina-TM [5]. We generated transgenic mice that overexpress theFHC a -TM Glu 180Gly mutation specifically in the heart .These mice express - 50% mutant protein in the affectedhearts, with a reciprocal decrease in the endogenous wildtypea-TM so that total TM levels remain unchanged. The mostnotable phenotypic features of these mice is the progressivedevelopment of severe cardiac hypertrophy over a period of6 months, and a significant amount of fibrosis which is evi­dent in the ventricular tissue . In this current study, we extendour previous findings on these mice and show that expres­sion of cardiac hypertrophic marker genes, including atrialnaturietic factor, are clearly evident early in the disease proc­ess . Functional analysis of the FHC a-TM 180 hearts by iso­lated perfused heart preparations demonstrate pronouncedimpairment in calcium cycling, coupled with a slow speedof cardiac relaxation. Also, inotropic stimulation with isopro­terenol was impaired in these hearts. To obtain a greater un­derstanding of the molecular changes that are activated bythe hypertrophic process, we conducted a gene expressionmatrix analysis on ventricular RNA from 2-month-old TGand control mice . Results show that 38 transcripts were in­creased over 2 fold levels when compared with controls, withmany of these transcripts associated with extracellular ma­trix proteins. These results are in agreement with the histopa-

thology of the hearts showing increased levels of fibrosis atthis stage of the disease.

Materials and methods

Generation ofFHC a-TM 175 and 180 transgenic mice

A comprehensive description of the generation of the FHCa-TM 175 transgenic mice has been presented [4]. To gen­erate the FHC a-TM 180 transgenic mice, murine wild-typestriated specific a-TM eDNA was cloned into the pBluescriptvector, and the single point mutation (GAG ~ GGG) cor­responding to amino acid 180 was generated using PCR­mediated mutagenesis . The murine a-myosin heavy chaincardiac-specific promoter was ligated to the 5' end of the TM,and the human growth hormone poly(A) signal and termina­tion region was linked at the 3' end of the construct. The se­quence of the construct was verified by nucleotide sequencing.Transgenic mice using the FVBIN strain were produced asdescribed [6], and four FHC a-TM 180 transgenic lines (33,52,57, and 58) were established.

RNA and protein analysis

Total RNA (10 ug) from transgenic and control ventricles wasisolated, purified, and separated by agarose gel electrophore­sis. Northern blot analysis of the RNAs was conducted us­ing 32p radio-labeled purified eDNA probes which werespecific for ANF, phospholamban, SERCA 2A, and GAPDH.The GAPDH levels were used for normalization of the RNAlevels.

Myofibrillar proteins were prepared from control and FHCa-TM 180 mouse ventricular myocardium as described [7].Equivalent amounts of protein (25 ug) were run on 10% so­dium dodecyl sulfate (SDS)-polyacrylarnidegels (PAGE). Gelswere stained with Coomassie blue to ensure equal loading ofthe proteins and assessment of contractile protein levels.

Histological analysis

Heart tissue was fixed in 10% neutral buffered formalin. De­hydration was through alcohol and xylene gradients, followedby embedding in paraffin . Sections (5 urn) were prepared andstained with hematoxylin and eosin, or trichrome stain.

Isolated retrograde perfused heart preparation

Control and transgenic mice were anesthetized intraperiton­eally with 100 mg/kg sodium Nembutal and 1.5 U heparinto prevent intracoronary microthrombi. The heart was rap-

idly excised, and the aorta cannulated with a 20 gauge nee­dle, followed by retrograde perfusion with a modified Krebs­Henseleit solution containing 118 rnM NaCl, 4.7 mK KCl, 2.5rnM CaCI2, 1.2 mM MgS04, 1.2 KHl04, 25 mM NaHC03,

0.5 EDTA, and 11 mM glucose. The buffer was equilibratedwith 95% 02 and 5% CO2, with a pH of 7.4. Hearts werebathed in the perfusate in a water-jacketed bath and main­tained at 37.4°C.

A PE-50 catheter was inserted into the left atrium, advancedinto the left ventricle, and forced through the ventricular apex.The proximal end of the catheter remained in the left ventri­cle ' with the distal end connected to a pressure transducer.Heart rate, left ventricular pressure (LVP), and the mean cor­onary perfusion pressure were continuously monitored. Thepressure curve was used to calculate the rate of pressure de­velopment (+dP/dt) and decline (-<iP/dt), time to peak pres­sure (TPP) and time to half relaxation (RTI12) . TPP and RTI12

were normalized with respect to peak LVP since they aredependent upon the extent of pressure development.

DNA microarray hybridization and analysis

Poly A+ RNA was isolated and prepared from ventricular tis­sue of 4-5 mice for FHC a-TM 180 mice and their controllittermates. All RNAs were obtained from mice that were 2months old, which is after initiation of the hypertrophic proc­ess, but prior to severe impairment of cardiac function. DNAmicroarray hybridizations were performed using Incyte mousegene expression microarray (GEM) version 1.12 (GenomeSystems, Inc., St. Louis, MO, USA). Cy3 and Cy5 derivatizedcDNA was prepared using random primers and reverse tran­scriptase . Fluorescent cDNAs were competitively hybridizedto the DNA chips, and the primary data was examined usingIncyte Gemtools software and SiliconGenetics GeneSpringsoftware. Defective cDNA spots (signal/noise ratio < 2.5, ir­regular geometry, or < 40% spot area compared to average)were eliminated from the data set of 8,799 sequence tags. Theselection criterion was gene expression greater than 2.0-foldinduced or repressed from the mean of genes within that re­gion of the scattergram, equaling> 2 S.D. removed fromthe mean. The high correlation value for the bulk of the un­changed genes allowed for relat ively fine differences to bedetected.

Results

Expression ofmutant a- TM induces cardiac hypertrophy

Transgenic mice were generated which express a a-tropomy­osin protein that corresponds to a mutation found in humanfamilial hypertrophic cardiomyopathy (FHC) . This mutation

35

is located at amino acid 180 (Glu 180Gly), which is a regionthat interacts with troponin T. A notable feature of FHC issevere ventricular hypertrophy, often associated with myo­cyte disarray, interstitial fibrosis, and sudden cardiac death .Because the FHC phenotype in human patients carrying a­TM mutations is associated with a variable hypertrophicresponse, it was important to determine whether cardiacmorphology is altered in these a-TM mutant mice . Heartswere isolated from TG and control mice to assess whetherthe expression of the trans gene resulted in morphologicalchanges. As seen in Fig. lA, by three months of age, expre s­sion of the mutated a -TM protein caused a significant in­crease in the size of the hearts, particularly in the left and rightatria. Measurements show that by this time, there are signifi­cant differences in the percentage heart weight:body weightratio (mg/g x 100) fortheFHC a-TM 180 mice vs.littermatecontrols: 7.7 ± 0.3 vs. 4.9 ± 0.2, respectively. Increases in fi­brosis and connective tissue are common features in patientswith FHC . To assess whether such pathological changes oc­cur in the hearts of the TG mice, we stained thin sections withtrichrome stain . As seen in Figs 1Band 1C, there is signifi­cant fibrosis in the left ventricular walls of the FHC a-TM180 mice, whereas this is at a minimum in littermate controlanimals; this fibrosis involves 5-10% of the ventricular walls.Myofibrillar disorganization occurs in up to 25% of the ven­tricular walls. These morphological characteristics on theFHC a-TM 180 hearts strongly indicate that pathologicalchanges occur in the TG mice that are similar to those occur­ring in FHC patients.

RNA and protein expression in the FHC a-TM 180hypertrophic hearts

The pathological alterations that occur in the FHC a-TM 180TG heart s strongly indicates that the transgene which incor­porates the Glu 180Gly mutation in a-TM is being expre ssedat significant levels in the myocardium of the transgenic mice.To assess the level of expression of the mutant a-TM pro­tein, we isolated myofibrillar proteins from the hearts of con­trollittermate and FHC mice . These proteins were subject toSDS-PAGE and stained with Coomassie blue to visualizeprotein content. The results show that each of the TG linesproduces and incorporates a substantial amount of mutant 180TM in the myofibrils (Fig. 2A) . There is increased expres­sion of the mutant protein in TG lines 33, 52, and 57, whichcorrelates with an increased copy number of the incorporatedtransgene in these lines (data not shown). Also , in resultssimilar to previous studies with transgenic TM expression [4,7], there is a concomitant decrease in the expression of theendogenous wildtype TM protein when the FHC a-TM 180transgene is expres sed. Interestingly, the change in TM ex­pression in these hearts does not lead to any alterations in the

36

A

c

Fig. 1. Morphology and histopathology of cont rol and FHC u-TM 180 hearts. (A) Control and FHC u-TM 180 hearts at 3 months of age. Note the increasedsize of the entire heart , especia lly the atrial chambers in the mutan t heart. (B) Left ventr icle of an FHC mutant heart with extensive fibro sis, as seen with theblue color. (C) Non-transgenic cont rol region of the left ventricle. Panels B and C are stained with trichrome. Original magnification was lOx for panel s Band C.

quantitative expression of other cardiac contractile proteins.As such, changes in cardiac sarcomeric performance are afunction of mutant TM expression, or secondary/tertiary altera­tions that resulted from abnormal TM production or function .

Calcium is a key regulator of sarcomeric function in bothskeletal and cardiac musculature. To ascertain whether cal­cium regulatory proteins exhibited altered gene expressionin response to FHC a-TM 180 expres sion and its associatedhypertrophy, we isolated tota l RNA from the left ventriclesof 3 month old, non-transgenic control and FHC 180 hearts .In this experiment, we also isolated RNA from 3 month oldFHC a-TM 175 hearts which exhibit a mild hypertrophic phe­notype in - 5% of the myocardium [4]. The se RNA s wererun on agaro se gel s and subject to Northern blot analysisusing 32p radiolabeled isoform specific probes. As seen in Fig .2B, the expression of phospholamban and SERCA 2A is dra-

matically decreased in the FHC a -TM 180 mice; also , ANFproduction is significantly increased in the left ventricles ofthese TG animals. Thi s gene expression profile is in agree­ment with result s from numerous stud ies showing similaralterations in phospholamban, SERCA 2A, and ANF expres­sion in cardiac hypertrophy. Interestingly, there is very littlechange in the expression levels of these cardiac hypertrophicmarker gene s in the FHC a-TM 175 mice , which probablyreflects the lack of a dramatic hypertrophic phenotype in thesemice. In addition to measuring the levels of these sarcoplas­mic reticulum proteins, we also assayed levels of activatedcalc ineurin and calmodulin in FHC a-TM 180 and controlhearts. Surprisingly, we saw no significant change in eitherof these calcium regul atory proteins in these hearts, resul tsthat differ con siderably from cardiac hypertrophic mice ex­pressing P-TM in their hearts [8] (Fig . 2e).

37

A TG TG TGNTG 33 52 57

TG58 Marker

My.HC '"

Actin "-.

TnT '"Trop omyos in ...

Tnl '"MLC z'"

.,/Wild type TM

~ Mutant 180 TM

B NTG a-I75 a-ISO C TG NTGActivated

IP CalcineurinANF

Calmodulin

"1.00 X 1.19 X

Phospholamban

SERCA

GAPDH

Fig. 2. Protein and Northern blo t analyses from control and FHC a -T1\! 180hea rts . (A ) Cardiac myofibrillar contractile pro tei ns from an SDS-PAGEge l arc shown: the ir quanti tative leve ls rema in uncha nged in the transgenicmice. (B) Nort hern blo t autoradiog ram of non -transgenic control. FHC a­T M 175 and 180 left ve ntricular RNAs hybr id ized to Atria l Natriure ticFac tor (AN F). phospholamban. SE RCA 2A. and GAPDH eDNA probes.(C) Imm unoprec ipitat ion of activated calc iucu rin and ca lmod ulin in FHea-T l\ l 180 and nontransgen ic control hea rts.

38

Assessment of FHC 0,-TM 180 cardiac function

With the development of severe cardiac hypertrophy and thealterations in TM, phospholamban, and SERCA gene expres ­sion, we hypothesized that there would be significant altera­tions in cardiac performance in the TG mice . To address thisarea, we used an isolated retrograde perfused heart prepara­tion for functional analysis of the FHC 0,-TM 180 hearts . Thismodel allows a comparison of myocardial contractile param­eters under identical afterload conditions (50 mmHG meanaortic pressure). Under baseline conditions (no pacing , 37°C,2.0 mM calcium in the perfusion solution, 50 mmHG meanaortic pressure), isolated TG and control hearts showed simi­lar heart rates, end diastolic and systolic pressures comparedwith age-matched non-transgenic (NTG) control hearts (Ta­ble 1). The maximal rate of pressure development for con­traction (+dP/dt) was significantly increased: 3150 ± 150mmHG/sec in the controls vs. 4267 ± 259 mmHG/sec in theTGs. Despite the increased contractility, the maximal rate ofpressure decline (-dP/dt) was decreased from 2928 ± 261mmHg/sec in wildtype to 2232 ± 110 mmHg/sec (p < 0.05)in the TG heart. Moreover, the TG heart showed increaseddiastolic pressure. The impairment in the relaxation param­eters may be a direct consequence of the mutation sincerelaxation is somewhat dependent upon extent of peak in­traventricular pressure (IVP) and in a hyper dynamic heart,-dP/dt is also higher. The data show that left ventricular re­laxation is severely compromised in the FHC a-TM 180mice. When contraction rate is increased and relaxation rateis impaired in the human heart, the latter begins to fail and ifuntreated, the heart will stop in systolic contracture. The otherparameters of cardiac function (time to peak pressure - TPP,and the half time of relaxation - RTliZ) were derived from IVPtracings. TPP is defined as the time between the beginningof systole and the peak development of pressure. RT

I/zis the

time from the peak IVP to the point of 50% ventricular re-

laxation. Both parameters were normalized with respect topeak IVP, since they are dependent upon the extent of pres­sure development. As seen in Fig. 3, the TPP was similarbetween the two genotypes of mice, whereas, the RT1/2of theFHC a-TM 180 hearts was significantly longer than that ofthe control mice.

We and others have found that inotropic stimulation with~-adrenergic agonists, such as isoproterenol, is generally im­paired in TG animals with cardiac hypertrophy and failure .In fact, a hallmark of dilated cardiomyopathy is decreasedgeneration of cAMP by cardiac myocytes in response to ~­

adrenergic receptor stimulation. Possible reasons for theimpaired inotropic effect include a down regulation of ~­

adrenergic receptors , an increased level of Gi>',and a reducedbasal cAMP level. Other candidates may be located on thepost receptor level, for example on the contractile apparatusitself or its regulation. Our working hypothesis is that the el­evated intracellular Ca" in hypertrophied heart may be amajor cause in the impairment of ~-adrenergic receptorinotropism through inhibition of adenyl ate cyclase by freecytosolic calcium or through calciurn/calmodulin/calcineurininteraction. During the normal relaxation-contraction cycle,calcium can reach a concentration sufficient to inhibit ade­nylate cyclase. The purpose of this experiment was to deter­mine the possible regulation of ~-adrenergic receptor signaltransduction by Ca" mobilized from the extracellular spacein the isolated heart preparation. Lowering the free extracel­lular calcium concentration and thereby calcium influx wasused as a means to decrease intracellular calcium concentra­tion and basal contractility.

Results show that inotropic stimulation with isoproterenolwas impaired in the FHC a-TM 180 hearts (Fig. 3). We as­sessed left ventricular +dP/dt and -dP/dt to evaluate contrac­tile and lusitrophic effects to incremental concentrations ofisoproterenol. The latter produced a concentration-depend­ent increase in left ventricular peak +dP/dt and -dP/dt, ac-

Table 1. Cardiac parameters of FHC a-TM 180 vs. controls

Parameter Control n = 5 a-TM 180n=5 p value

Intraventricular pressurePeak LV systolic pressure, mm Hg 77.3 ± 4.5 89.2 ± 5.3 >0.05Peak LV diastolic pressure , mm Hg -11.7 ± 2.3 0.73 ± 1.5 <0.05LV end-diastolic pressure, mm Hg 3.8 ± 0.9 6.1 ± 1.5 >0.05

Maximal rate of pressure developmentPeak +dP/dt, mmHg/sec 3150 ± 111 4267 ± 259 <0.05

Maximal rate of relaxationPeak -dP/dt, mmHg/sec 2928 ± 261 2232 ± 261 <0.05

Heart rate, beat/min 443 ± 16 434 ± 23 >0.05

TTP, msec/mm Hg 0.46 ± 0.006 0.44 ± 0.05 >0.05

RT112' msec/mm Hg 0.58 ± 0.078 0.85 ± 0.07 <0.05

39

a DNA microarray analysis. Poly A+RNA was isolated andprepared from left ventricular tissue for the FHC a-TM 180TO and control littermate mice. RNAs were obtained frommice that were 2 months old, which is during the early stageof the hypertrophic process in the TO mice. The RNAs weredifferentially labeled with Cy3 or Cy5 fluorescent indicatorsand competitively hybridized against mouse gene expressionarrays comprised of 8370 genes/ESTs. The signal intensityof the hybridized microarray chips was quantified and nor­malized against internal and external controls. Differentialhybridization and analysis was conducted in replicate to en­hance reproducibility and validity of the data. Results inTable 2 show that only 37 of the 8734 genes/ESTs aretranscriptionally up-regulated more than 2 fold (100%), in­cluding ANF. Only 13 genes/ESTs are transcriptionallydown -regulated by 50% . These differentially regulated tran­scripts can be classified as belonging to four known and oneunclassified group : (1) apoptosis/differentiation; (2) inflam ­mation and defense; (3) membrane; and (4) secreted/extra­cellular matrix. The classified group with the greatest numberof genes is secreted/extracellular matrix, which may reflectthe increased fibrosis that is readily apparent in the FHC a­TM 180 hearts . The number of differentially transcribedgenes in this TO model is similar to numbers found in othermodels of cardiomyopathy [9]. Interestingly, this study found9 genes/ESTs are increased over 3 fold (1000%), with manyof these being associated with the extracellular matrix (i.e.procollagen, fibronectin), which also supports the morpho­logical analysis demonstrating substantial increases in fibro­sis in the mice .·7C .10 .. ..

log(lI]1soproterenol co_trIItlon

C -10

10000MJIsoproterenoiconcentration

.-11tGn=5

• Z.' ---o--ofiI11tG n=5:5

1.'••• 1..~

E 1.70.:: 1..•• 1.5..c:• 1A.c:U.. 1.1I

:!!Go 1.2

"+ 1.1

1.'

•••

• :rRG n=5

• Z.1 ---o--ofiITRG n=5:5 Z.I /1•• 1.'•~1..

E,g 1.7 ,,'• 1.1 f•..

1.5c:II.c: 1A """"",U.. 1.2:!!L

1.2l s-:!............1.1

1.1 a-'" .'I.'

Fig . 3. Isoproterenol dose response curves in FHC a-TM 180 and non­transgenic hearts. Five (n = 5) TO and five NTO hearts were evaluated at2.0 mM Ca2+ concentration in a perfusion solution. *Designates a statisti­cal significant value of p < 0.05 using an unpaired r-test, The values repre­sent the mean ± S.E.M. 'C' represents the unstimulated control state .

companied by an increase in left ventricular systolic pressure .The percent increase in peak +dP/dt was significantly reducedin the TO mice: 1.93 ± 0.04 vs. 1.40 ± 0.10 for control vs.TO, respectively (p < 0.05) . Also, altering the level of cal­cium in the perfusate to 1.0 mM allowed a complete restora­tion of the ~-adrenergic receptor response in the FHC a-TM180 hearts (data not shown). We conclude that inhibition ofcAMP production by a calcium-dependent mechanism maybe physiologically relevant in producing the ~-adrenergic

receptor hypo responsiveness in hypertrophied myocardium.

DNA microarray analysis of the FHC a-TM 180 hearts

To obtain a full understanding of gene activation and repres­sion during the cardiac hypertrophic process, we conducted

Discussion

Familial Hypertrophic Cardiomyopathy (FHC) is a complexdisease eliciting a multitude of symptoms that are variablein humans depending upon the specific mutation within acontractile protein, modifier genes, and environmental in­fluences . Animal model systems, especially transgenic andknockout mice, have provided substantial insight into the ba­sic mechanisms of this disease and the complicated signalingpathways associated with the development of cardiac hyper­trophy [10, 11]. The results from this study demonstrate thata single point mutation in tropomyosin can trigger dramaticchanges in gene expression that culminate in severe cardiachypertrophy. The amino acid that is altered, a substitution ofa glycine for a glutamic acid at codon 180, results in a chargechange in a troponin T binding site of TM. This amino acidsubstitution potentially destabilizes the coil-coiled a-helicalstructure by increasing flexibility in this region [12, 13].Actinaffinity may also be decreased with this mutation [14]. Sar­comeric performance is also dramatically altered by theOlul800ly mutation in a-TM [5, 15], without altering the

40

Table 2.

Access ion #

Up regulated genes/ESTsApoptosis/different iationAA242611.I

Inflammation defenseAA 145458.1AA098196 .1AA I772 18.1AA003452.1AA272807

Membrane proteinsAA002481.1

Secreted extracellularAA030805.1W89883.1A023549.1AA073604AA218279.1W54287. 1AA239 171.IW63981.1W80177.1AA 108928.1W I622 1.1W 14325.1AA34564.1AA03799 5.1AA268082 .1A1322694WI 4837AA033050

Unclassifi edW83609.1W18828.1AA461746.1W14353.1AA175226.1AA000799.JW81878.1AA26 1393.3W64296.1W89502WI 8828AA048878.1

Down regulated genes/ESTsAI322278AA l40 114AA509566W29607AA 178037AI390820AA048675AA222567AA286024AAOl4305W09719WI1 965AI322262

Fold increase/decrease

2.41

5.612.884.582.852.40

2.11

2.592.913.154.152.262.953.042.582.339.832.004.413.522.742.842.082.082.37

2.862.002.362.452.182.794.132.142.022.122.322.35

0.270.290.330.340.430.430.430.460.470.470.490.490.49

Description

Follistatin-like

Mouse fibronectin mRNAIG alpha chain C regionIG alpha chain C regionMouse thrombospondin-4 mRNAHistocompatibility 2, class I antigen A

Mouse beta5A integrin mRNA

Natriuretic peptide precursor type BProcollagen, type III, alpha IMouse procollagen type V alpha 2Procollagen, type I, alpha ISerine protease inhibitor 4BiglycanElastinMouse mRNA for fibromodulinMatrix metalloproteinase 2Secreted phosphoprotein IProcollagen, type VI, alpha INatriuretic pept ide precursor type AMouse procollagen type V alphaEST - similar to microfibril assoc . glycoproteinLumicanEST - similar to bone morphogenic protein 3 precursorProtease, cysteine, ISerine protease inhibitor 4

Retinol binding protein I, cellul arMouse mRNA for Ulip proteinESTEST - similar to trabecular meshwork glucocorticoidEST - similar to complement C 1R componentESTOsteoblast specific factor 2ESTESTMesenchyme homeobox IDihydropyrimidinase-like 3EST

Pyruvate dehydrog. kinasePhenylalanine hydroxylaseEsterase IEnoyl coenzyme A hydrataseEphrin B3Esterase IESTCa2+ ATPase, cardiac muscleESTESTRNA polymerase I assoc . factorEnolase 3, beta muscleEST

quantitative levels ofTM or other contractile proteins in themyofibrils. Although sarcomeric function is altered, the pre­cise signal ing mechanism by which a single point muta tionin contractile protein genes can trigger the cardiac hyper­trophic response is an area of intense research in many labo­ratories studying FHC .

The enhancement of the force of contraction at increasingstimulation frequency in non-failing myocardium and its ab­sence in the failing hearts is a well-known phenomenon anda characteristic of cardiac regulation. The relationship be­tween force of contraction and heart rate is one of the basicmechanisms that modulate intrinsic myocardial contractility.Dysfunction of the cardiac force-frequency relationship canlead to a limited cardiovascular reserve and contribute to theclinical symptoms of exertional intolerance. Thus, heart rateis one of the ways the heart can compensate when cardiacoutput is compromised. Heart rate dependence of cardiaccontractility reflects the basic cycling kinetics of calcium andis critically dependent on sarcoplasmic reticulum (SR) func­tion , as well as other systems. The positive force-frequencyrelation (ascending limb of the force-frequency relationship)in the myocardium is associated with a parallel increase inintracellular calcium transients. Increase trans-sarcolemmalCa-influx per beat and per unit of time leads to an increasedSR Ca-Ioad, which is then available for release during subse­quent contraction. The frequency potentiation of contractileforce critically depends on the ability of the SR to re-seques­ter calcium. In the isolated NTG mouse heart, there is a biphasicforce-frequency relationship with both ascending and descend­ing limb and critical heart rate at which maximal rate contrac­tion and relaxation reaches maximum. Incremental pacing from4-13 Hz produces an average increase in +dP/dt in wildtypehearts from 3371 ± 147 mmHg/sec at 4 Hz to 3740 ± 184mmHg at 9 Hz, which in the case of the FHC a-TM 180 hearts,the same pacing paradigm showed a decrease from 5430 ± 614to 4191 ± 203 mmHg/sec (data not shown). The force fre­quency relationship was monophas ic in the TG hearts with thedescending (negative) limb; essentially, the FHC a-TM 180hearts have no frequency dependent contractile reserve.

Decreased preload, atrioventricular asynchrony, and im­paired augmentation of peak systolic calcium may contrib­ute to the depressed frequency dependent contractile reservein mammalian heart.The TG heart demonstrates a pronouncedimpairment in the timing of calcium cycling and in the slowspeed of cardiac relaxation. Changes in intracellular calciummobilization kinetics and longer calcium-myofilament in­teraction may compensate for contractile failure at low stimu­lation frequencies, but slowed dynamics of SR calcium cyclingand myofilament calcium interaction may fail to increase peaksystolic calcium at higher stimulation rates. Results showingdecreased expression of phospholamban and SERCA 2A inthe FHC a-TM 180 hearts strongly indicates that calciumcycling is dramatically altered in these hearts .

41

Recent technological innovations have lead to the devel­opment of gene expression matrices that allow the simultane­ous assessment of thousands of transcripts from competitivelyhybridized RNA samples .To ascertain the differences in geneexpression between the FHC a-TM 180 hearts which areinitiating the hypertrophic process and NTG controls, weconducted the gene expression matrix analysis. The resultsshow that 37 of the 8734 geneslESTs are transcriptionally up­regulated more than 2 fold (100 %) and 13 genes/ESTs aredown-regulated by 50%. A comparison of these differentiallyregulated genes with those of other TG mouse models ofcardiac hypertrophy (calsequenstrin, calcineurin, MEK1,Gaq) [16-19] reveals that there is considerable divergence inthe transcriptional response to hypertrophy (data not shown).Only 8 genes/cDNAs are transcriptionally increased over 3fold in more than 2 of the models (natriuretic peptide precur­sor types A and B, osteoblast specific factor 2, four and ahalf LIM domains 1, IGG protein, and 3 ESTs) . Thirty-threegeneslESTs are increased more than 100 fold in at least 2models. Interestingly, the FHC a-TM 180 model has the high­est number and level of transcriptional up-regulation in se­creted extracellular matrix proteins than the other models, andalso exhib its the most fibrosis in the myocardium among themodel systems. Combined, these results indicate that mul­tiple pathways lead to the development of cardiac hypertro­phy ; deciphering which, if any, common mechanisms areactivated during this process is a significant challenge in thework ahead.

Acknowledgements

We thank Drs E. Kranias, M. Periasamy, and J. Robbins forvarious eDNA probes and vectors. This work was funded bygrants (HL549 12 and HL22619) from the NIH NHLBI toDFW.

References

I. Thierfe lder L, Watkins H, MacRae C, Lamas R, McKenna W, VosbergH, Seidman J, Seidman C: a-Tropomyosin and cardiac troponin T mu­tations cause familial hypertrophic cardiomyopathy: A disease of thesarcomere. Cell 77: 701-712, 1994

2. Nakajima-Tan iguchi C, Matsue H, Kishimoto T, Yamachi-Takihara K:Novel missense mutat ion in a-tropomyosin gene found in Japanesepatients with hypertrophic card iomyopathy. J Mol Cell Card iol 27:2053-2058, 1995

3. KaribeA, Tobacman L, Strand J, Butlers C, Back N, Bachinski L, AraiA, Ortiz A, Roberts R, Homsher E, Fananapazir L: Hypertrophic car­diomyopathy caused by a novel ail-tropomyosin mutation (V95A) isassociated with mild cardiac phenotype, abnormal calcium binding totroponin , abnormal myosin cycling , and poor prognosis. Circulation103: 65-71,2001

42

4. Muthuchamy M, Pieples K, Rethinasamy P, Hoit B, Grupp I, BoivinG, Wolska B, Evans C, Solaro JR, Wieczorek DF: Mouse model of afamilial hypertrophic cardiomyopathy mutation in a-tropomyosinmanifests cardiac dysfunction . Circ Res 85: 47-56, 1999

5. Prabhakar R, Boivin G, Grupp I, Hoit B, Arte aga G, Solaro RJ,Wieczorek DF: A familial hypertrophic cardiomyopathy a-tropomy­osin mutation causes severe cardiac hypertrophy and death in mice. JMol Cell Cardiol33 : 1815-1828,2001

6. Evans C, Pena J, Phillips R, Muthuchamy M, Wieczorek D, Solaro R,Wolska B: Altered hemodyn amics in transgenic mice harboring a mu­tant tropomyosin (Asp175Asn) linked to hypertrophic cardiomyopa­thy. Am J Physiol Circ Physiol 279: H2414-H2423, 2000

7. Muthuchamy M, Grupp I, Grupp G, O'Toole B, Kier A, Boiv in G,Neumann J, Wieczorek DF: Molecular and physiolog ical effects ofoverexpressing striated muscle l3-tropomyosin in the adult murine heart.J BioI Chern 270: 30593-30603, 1995

8. Sussman M, Lim H, Gude N, Taigen T, Olson E, Robbins J, Colbert M,Gualberto A, Wieczorek D, Molkentin J: Prevention of cardiac hyper­trophy in mice by calcineurin inhibition Science 281: 1690-1693, 1998

9. Aronow B, Toyokawa T, Canning A, Haghighi K, Delling U, KraniasE, Molkentin J, Dorn G: Divergent transcriptional responses to inde­pendent genetic causes of cardiac hypertrophy. Physiol Genomic s 6:19-28,2001

10. Maas A, Leinwand L: Animal models of hypertrophic cardiomyopa­thy. Curr Opin Cardiol 15: 189-196,2000

II . Farza H, Watkins H: Animal models of familial hypertrophic cardio­myopathy. Mol Med Today 5: 544-545,1999

12. Michele D, Metzger J: Physiological consequences of tropomyosin

mutations associated with cardiac and skeletal myopathies . J Mol Med78:543-553,2000

13. Chou P, Fasman G: Conformational parameters for amino acids inhelical, l3-sheet, and random coil regions calculated from proteins .Biochem 13: 211-222,1974

14. Golitsina N, An Y, Greenfield N, Thierfelder L, Seidman J, SeidmanC, Lehrer S, Hitchcock -DeGregori S: Effects of two familial hyper­trophic cardiomyopathy-causing mutatio s on a -tropomyosin structureand function . Biochem 36: 4637-4642,1997

15. Bing W, Knott A, Redwood C, Esposito G, Purcell I, Watk ins H,Marston S: Effect of hypertrophic cardiomyopathy mutations in humancardiac muscle alpha-tropomyosin (aspl75asn and glu180gl y) on theregulatory properties of human cardiac troponin determined by in vitromotility assay. J Mol Cell Cardiol32: 1489-1498,2000

16. Molkentin J, Lu J, Antos C, Markham B, Richardson J, Robbins J,Grant S, Olson E, a calcineurin-dependent transcr iptional pathway forcardiac hypertrophy. Cell 93: 215-228,1998

17. Sato Y, Ferguson D, Sako H, Dorn G, Kadambi V, Yatani A, Hoit B,Walsh R, Kranias E: Cardiac-specific overexpression of mouse cardiaccalsequestrin is associated with depressed cardiovascular function andhypertrophy in transgen ic mice. J Bioi Chern 273: 28470-28477, 1998

18. D'Angelo D, Sakata Y, Lorenz J, Boivin G, Walsh R, Liggett S, DornG: Transgenic Gaq overexpression induces cardiac contractile failurein mice. Proc Nat! Acad Sci USA 94: 8121-8126,1997

19. Bueno L, DeWindt L, Tymitz K, Witt S, Kimball T, Klevitsky R, HewettT, Jones S, Lefer D, Peng C, Kitsis R, Molkentin J: The MEK1ERKl/2 signaling pathway promotes compen sated cardiac hypertrophy intransgenic mice. The EMBO J 19: 6341-6350, 2000

Molecular and Cellular Biochemistry 251: 43-46, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Analysis of postextrasystolic relaxation response inthe human heart

Kiminori Kato, Makoto Kodama, Satoru Hirono, Yuji Okura,Haruo Hanawa, Takaaki Shiono, Masahiro Ito, Koichi Fuse, KeiichiTsuchida, Seitaro Maruyama, Tsuyoshi Yoshida, Satoru Abe, ManabuHayashi, Akimitsu Nasuno, Takashi Saigawa, Takuya Ozawa andYoshifusa AizawaFirst Department of Internal Medicine, Niigata University School ofMedi cine, Niigata , Japan

Abstract

Postextrasystoli c potentiation is the phenomenon in which ventri cular contractile force is strengthened by a preceding prema­ture beat. However, the response of diastol ic function after an extrasystole is unknown. We studied 58 patients with chroni cheart failure (CHF) and two control subjects to evaluate the response of relaxation following extrasystole. At cardiac catheteri­zation, from the derivative of the left ventricular (LV) pressure, the ratio of LVpeak negative dP/dt (-dP/ dt) of a postextrasystoleto a basal beat was calculated and defined as the postextrasystolic relaxation response (PRR) . PRR was compared with param ­eters of left ventriculography: LV end-d iastolic volume index (EDVI), LV end-systolic volume index (ESVI) , and LV ejectionfraction (EF). The PRRs of the two control subjects were 0.80 and 0.84. The mean PRR of the CHF patients was 0.99 ± 0.15.In all subjects, including patients and controls, correlation analysis between (EDVI, ESVI, and EF) and PRR yielded the fol­lowing: (a) ED VI vs. PRR : R =0.273, P =0.036 ; (b) ESVI vs. PRR : R =0.446, P < 0.001; and (c) EF vs. PRR: R =-0.520, P< 0.001 . Thus, normal or non-fai ling human hearts showed a decl ine of -dP/dt in postextrasystole compared with the basalbeats, but failing hearts had potentiated relaxation following an extrasystole . (Mol Cell Biochem 251 : 43-46, 2003)

Key words: postextrasystolic relaxation respon se, chronic heart failure, relaxation restitutio n, postextrasystolic potentiation

Introduction

A force-interval relation, the so-called mechanical restitution,is a principal phenomenon of the contractile property of aheart. For about 100 years, postextrasystoli c potentiation(PESP) has been known as the phenomenon in which ven­tricular contract ile force is strengthened by a preceding beat[1]. PESP depends on both the pre-p receding and precedingintervals of the beat. PESP has been considered a useful in­dex for eval uating myocardial viability in the presence ofmyocardial stunning or hibernat ion. In contrast to ischemia,the role of PESP in heart failure has not been fully investi­gated . Although it might be expected that there would be apoor PESP response in card iomyo pathy, the most carefullycontrolled study performed so far showed that failing ven-

tricles have greater potentiation of postextrasystole [2]. In thisrespect, PESP is well understood, but the response of diastolicfunction after an extra systo le has not been fully investigated,probably because of difficulties in assessing the diastolic prop­erties of the ventricle. Usually, the time constant of isovoIumicrelaxation (r) is used, and peak negative dP/dt (-dP/dt ) hasalso been used. Left ventricular (LV) - dP/dt is influenced bysystolic pressure and reflects the ratio of dec line of pressureat only a brief instant near aortic valve closure [3]. In contrast,t is derived from multiple pressure measurements throughoutthe enti re period of isovolumic relaxation and does not ap­pear to be directly influenced by events near the time of aor­tic valve closure [4]. However, t and-xllvdt have been shownto change in the same direct ion in analyses of the relaxationrestitution and the effect of PESP [3, 5] .

Address f or offprints: K. Kato , First Department of Internal Medicine, Niigata University School of Medicine, Asahimachi 1-754, Niigata 95 1-8510, Japan(E-mail: kkato48@med.niigata-u.ae.jp)

44

There has been only one study that analyzed postextra­systo lic diasto lic properties of the whole heart in humans [5].The study showed slowed relaxation following an extrasys­tole in the non-failing hea rt, but involved only 17 subjects.The postextrasystolic diastolic properties of the fai ling hu­man heart have not yet been examined.

In this article , we propose a new concept, postextrasystolicrelaxation respon se (PRR), which is defined as the ratio of-dP/dt of a postextrasystole to that of a basal beat. Our aimwas to confirm the clinical significance of PRR in patientswith chronic heart failu re (CHF).

Materials and methods

Patients

Fifty-eight patients with CHF and two control subjects wereinvolved. The CHF patients included 47 with dilated cardio­myopathy, five with LV dysfunction with renal failure, twowith sarcoidosis, two with chronic myocarditis, one with oldmyocardial infarction, and one with LV dysfunction withpheochromocytoma. Patients with active myocarditis, hyper­trophic cardiomyopathy, or ischemic heart disease were ex­cluded. The mean age of patients with CHF was 46.8 ± 13.2years and the male/female ratio was 43/15. The control sub­jects were 55 and 62 years old, and both were men.All patientshad an LVEF < 40% based on left ventriculography with con­trast medium or echocardiography on first admission. Afteradmission to our hospital , congestive heart failure was control­led using diuretics (n = 46), digital is (n = 31), and angiotensin­converting enzyme inhibitors (n =44), and/or b-blockers (n =12). Cardiac catheterization was performed after written in­formed consent had been obtained from each patient.

Hemodynamic assessment

All subject s underwent a routine left and right diagnosticcatheterization, which included pressure studies , coronary ar­teriography and left ventriculography.A 7 Fr micromanometer­tipped pigtail catheter (Miller Industries, Houston, TX, USA)was introduced into the left ventricle to obtain the LV pres­sure and dP/dt. Basal data were obtained from five consecu­tive sinus beats . No calcul ation was performed when multipleextrasystoles were present. All subjects had both basal andsing le postextrasystole hemodynamic recordings . All post­extrasystolic beats were sinus in origin. From continuousrecording for about 30 min , the longest R-R interval follow­ing an extrasysto le, either ventricular or atrial, was chosenfor analy sis of PRR. Ifpatients had no spontaneous extrasys­tole , atrial premature stimuli at a couple intervals of 300-400msec were given and PRR was calculated.

The end-diastol ic volume index (EDVI), end-systolic vol­ume index (ESVI), and ejection fraction (EF) were comparedwith PRR.

Statistics

Data were expressed as mean ± S.D. Pearson's correlationcoefficient and Fisher's Z-transformation were used to assessthe relationship between the PRR and parameters ofLVG. Allanalyses were performed using StatView 5.0 (SAS Institute,Cary, NC) . A P value of < 0.05 was considered statisticallysignificant.

Results

Response of-dP/dt

Figure 1 shows a typical trace of dP/dt for a control subjectand a patient with CHF. PRR was 0.80 in the control subjectand 1.12 in the patient with CHF. As shown in Table I, CHFpatients showed a wide distribution of EDVI, ESVI andEF. The PRRs of control subjects were less than 1.0, andpotentiation of diastolic properties was not observed follow­ing extrasystole in the non-failing heart. In CHF patients, themean PRR was 0.99 ± 0.15. The mean PRR in patients withCHF was higher than the PRRs in control subjects. There wasa significant number of patients (n = 21) with CHF whosePRR s were higher than 1.0. This indicates potentiation ofrelaxation after extrasystole.

(B)CHFEDV' = 152mIlm'.J irttl l ' i IESVI ", 98ml/fT12 ' ' . , .. - , I j .

~~H : :~=tr- I ~. ' .. ~,.tT.. I .-j-.t~r-r-~~~-H-LVP ,..J l ! ,,'.!I \,- · · ~l \,(fluid-filled) ' . ~:~. ". .

j' , ..• ",

~~~_oF-J\--~ .---..ftr-.'\. -)~ .,---1- -- -. A.','::-'~ \r \' \; ,\(

J-.:.':Ji - ·······.V----.

Fig. 1. A typical trace of dP/dt of (A) a control subject and (B) a patientwith CHF. LVP - left ventricular pressur e, EDVI : left ventricular end­diastolic volume index, ESVI - left ventricular end-sy stolic volume index,EF - left ventricul ar ejection fraction .

45

Discussion

Table 1. Hemodynamics parameters in control and patients of chronic heartfailure

Our two control subjects showed no potenti ation in -dP/dtof postextrasystole. In our patients with CHF, PRR was in­creased in accordance with LV dysfunction. In other words,

The correlations between parameters of LVG and PRR areshown in Fig. 2. PRR was significantly correlated with EDVIand ESVI and inversely correlated with increased EF. PRR ofthe patients with relatively good LVfunction was less than 1.0.

the relaxation of postextrasystole was not potentiated in non­failing hearts , even if patients had been diagnosed as havingchronic heart failure .

In a study in humans, diastolic properties after extra sys­tole were reported by Carroll et al. [5] in the whole heart , andnot isolat ed muscle. They found that -dP/dt and T of a post­extrasystole declined compared with that of a basal beat. Inexperiments using canine whole heart s, Karliner et al. [3] alsoreported that -dP/dt and T following the extrasystole declined.Prabhu and Freeman examined the restitution curve of -dPIdt again st the preceding interval, which was termed relaxa­tion restitution, in an animal expe riment [7]. In their report,the relaxation restitution curve appeared monoexponentialaround a short R-R interval, which was similar to mechani­cal restitution ofcontraction. However, relaxation restitutionof non-failing animal heart s showed decl ine of -dP/dt at longR-R intervals. The authors concluded that the relaxation res­titution curve of non-failing hearts is biphasic. Both -dP/dtand T increa se monoexponentially with a rapid time constantat a short R-R interval, then decrease monoexponentially witha slow time constant at a longer R-R interval. Prabhu andFreeman also investigated relaxat ion restitution of the fail­ing canine heart indu ced by tachy cardia [8]. In the failingheart , the late-ph ase monoexponential nature of the rest itu­tion curve disappeared, producing a monophasic curve. Wehave also reported relaxation restitution in humans with atrialfibrillation [9]. The relaxation restitution curve had a biphasicnature in the non-failing heart , but the late phase with a slow

86.9 ± 18.7105.7 ± 17.8105.3 ± 30.567.2 ± 27.837.4 ± 13.60.99 ± 0.151014 ± 285993 ± 270

Chronic heartfailure

Cont rol

70, 80144,11052,668,1 685, 750.80,0.842500, 19002000, 1600

PRR vs. hemodynamic variables

- dP/dt - left ventricular peak negative dP/dt.

Heart rate (beats/min)Left ventricular pressure (mmHg)End-diastolic volume index (ml/m -)End-systolic volume index (rnl/rn-)

Ejection fraction (%)Postextrasystolic relaxat ion response- dP/dt of basal beat (mmHg/sec)-dP/dt of postextrasystole (mmHg/sec)

500 1000 1500 2000 2500Preceding RRinterval(ms)

500 1000 1500 2000 2500Preceding RRinterval(ms)

Ol+----'---~---I-~--+-~o

[AI IB)2500 2500

2000

.,2000

J1500j 1500r ~

E EE E-1000 - 1000~ ~"I "I

500 A B 500 A B

o

ooo

o 20 40 ~ 00 100 120 140 1MESVI("''''''I

PM .. 0.84 + 0.002·ESVI;R .. 0.446, P<0.001

I .'

I.'1.2

~ 11

I .o

.s

.e

o

ooo

(e)

I.'I.'1.2

a:~ 1.1

I.o.....7 +--~r-r~~~-'--'~---T-+

40 60 00 100 120 140 160 180200EOVl(""'""1

PRR- 0.853 + 0.001 • EDVl; R- 0.Z73, p .. 0.036

Fig. 2. Analyses of correla tions between parameters of LVG and PRR. (A)End-diastolic volume index vs. PRR, (B) End-systolic volume index vs.PRR, (C) Ejection fraction vs. PRR. The solid circles indicate controls. PRR- postextrasystolic relaxation response; EDVI- Ieft ventricular end-diastolicvolume index; ESVI -Ieft ventricular end- systolic volume index; EF -leftventricular ejection fraction; R - correlation coefficient.

I.'

I.'

1.2

~ 11

1.o.s..

oo 0

o

'0o •0 0 •

20 30 40 50 60 70 80 90EFt%)

PRR.. , .184 - 0.005 • EF;R.. -0.520. P< 0.001

Fig. 3. Schema of the relaxation restitut ion curves of [AI non-failing and[B] failing human hearts. From reports of both animal experiments [7, 81and human atria l fibri llation [9], the curv e of relax ation restitution isbiphas ic in the non- fail ing heart (Fig. 3A). The relaxation restituti on hasa monoexponential relationship around short R-R intervals, similar to me­chanical restitut ion on contraction, but shows a decline of -dP/dt at longerR-R interval s. -dP/dt increases monoexponentially with a rapid time con­stant at short R-R intervals, then decreases monoexponentially with a slowtime constant at longer R-R interval s. On the other hand, the late phasemonoexponential nature of the restitution curve disappeared in the failingheart, producing a monophasic curve. If the basal beat interval is 1000 msec(line A), the height of this line shows -dP/dt at rest. If the R-R intervalfollowing extrasystole is 2000 msec (line B), the length of this line shows- dP/dt of the postextrasystole beat. Accordingl y, the ratio of B/A would be> 1.0 in the failing heart and < 1.0 in the non-failing heart.

46

time constant was abolished in the failing heart, as reportedabove . Figure 3 shows a schema of the relaxation restitu tioncurves ofthe non-failing and failing human hearts. If the basalbeat interva l is 1000 msec, which is indicated as line A in Fig.3, the height of this line shows -dP/dt at rest. If the R-R in­terval following extrasystole (called the preceding interval)is 2000 msec, which is indicated as line B, the length of thisline shows -dP/dt of the postextrasystole beat. Accordingly,the ratio ofB/A would be > 1.0 in failing hearts and < 1.0 innon-failing hearts.

In our study, the PRR increased in accord with enlargementof the left ventricle in patients with chronic heart failure, andwas inversely correlated with left ventricular EF.These resultsfit well with the relaxation restitution theory of the failing andnon-failing hearts, but the correlation indices are relativelyweak and there was significant depression of PRR amongpatients as if they showed similar LV function. One poss ibleexplanation for PRR depress ion is that failing or non-failingmyocardium depends on LV geometry or global LV function .The fourth-interval relationship and PESP on contractile prop­erty has been explained by calcium handling, in which thesarcoplasmic reticulum may playa central role (see review [6]).The phenomenon of PRR might also be explained by calciumhandling . It might be possible to obtain additional informationfrom analysis of PRR to understand the pathoph ysiology ofheart failure. Another reason for PRR depression is that PRRmight depend on the pre-preceding R-R interval, similar toPESP of contractility. We could not control the pre-precedinginterval in this study. Further investigation of the effect of thepre-preceding interval on diastolic property is warranted.

In summary, no potentiation of PRR was recognized in thenormal human heart. On the other hand , potentiation of PRRwas evident in patients with severe LV dysfunction, especiallyin those with severely failing hearts . We proposed a newconcept of 'postextrasystolic relaxation response'. This newindex might be useful for understanding the pathophysiologyof heart failure .

Acknowledgement

Thi s study was supported in part by grants for scientific re­search from the Ministry of Education, Science, and Cultureof Japan (No. 12670653) and for Rese arch on Specific Dis­eases of Ministry of Health , Labor and Welfare .

References

1. Langendorf 0 : entersuchungen am berlebenden Sugethierherzen .III . Abhandlung, Vorubergehende Unregelmssigke iten des Herz­schlages und ihre Ausgleichung . Pfluge rs Arch Physiol 70: 473­486 . 1898

2. Seed WA, Noble MI, Walker JM, Miller GA, Pidgeon J, Redwood 0 ,Wanless R, Franz MR, Schoettler M, Schaefer J: Relationships betweenbeat-to-beat interval and the strength of contraction in the healthy anddiseased human heart. Circulation 70: 799-805, 1984

3. Karliner JS, LeWinter MM, Mahler F, Engler R, O'Rourke RA: Phar­macologic and hemodynamic influences on the rate of isovolumic leftventricular relaxation in the normal conscious dog. J Clin Invest 60:511-521,1977

4. Gaasch WH, Blaustein AS, Andri as CW, Donahue RP, Avitall B:Myocardial relaxat ion. II. Hemod ynamic determinants of rate of leftventricular isovolumi c pressure decline. Am J Physiol 239: HI-H6,1980

5. Carroll JO, Widmer R, Hess OM, Hirzel HO, Krayenbuehl HP: Leftventricular isovolumic pressure decay and diastol ic mechanics afterpostextrasysto lic potentiation and during exercise. Am J Cardiol 51:583-590, 1983

6. Cooper MW: Postextrasystolic potentiation. Do we really know whatit means and how to use it? Circulation 88: 2962-2971 , 1993

7. Prabhu SO, Freeman GL: Kinetics of restitution of left ventricularrelaxation. Circ Res 70: 29-38,1992

8. Prabhu SO, Freeman GL: Effect of tachycardia heart failure on therestitution of left ventricular function in closed-chest dogs . Circula­tion 91: 176-185. 1995

9. Hirono S, Kodama M, Kato K, Hanawa H, Shiono T, Ito M, Fuse K,Aizawa Y:Kinetics ofl eft ventricular relaxation restitution during atrialfibrillation in patients with chronic heart failure. Jpn Circ J 65S: 543,2001

Molecular and Cellular Biochemistry 251: 47-50, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Differential effects of calpain inhibitors onhypertrophy of cardiomyocytes

Jay R. Pollack, Richard C. Witt and Jeffrey T. SugimotoDepartment ofSurgery, Creighton University School ofMedicine, Omaha. NE, USA

Abstract

Two inhibitors of the calcium-dependent cysteine protease, calpain, have markedly different effects on the extent of hypertro­phy induced by the alpha-adrenergic agonist, phenylephrine, of cultured neonatal rat ventricular myocytes. E64c, an inhibitorof calpain and other cysteine proteases, stimulated the hypertrophy by 59%. PD 150606, a specific calpain inhibitor, reducedthe hypertrophy by 38%. Phenylephrine decreased the proteolysis of a ca1pain substrate by the cells 1-2 h after its addition butnot at 24 h. PD 150606 inhibited proteolytic activity at all times, and the combination of phenylephrine and PD 150606 did notgive greater inhibition. This suggests that cysteine proteases of the papain sub-family are involved with the hypertrophic re­sponse at two points, promoting hypertrophy at the first and limiting it at the second. Calpain appears to be the protease in­volved at the first point, and there may be another cysteine protease acting at the second site. (Mol Cell Biochem 251: 47-50,2003)

Key words: calpain, cardiomyocyte, heart, hypertrophy, protease, rat

Introduction

Calpains are universally distributed cysteine proteases thatrequire Ca2+ for activity. Recently, relationships have beenfound between calpain activity and ventricular hypertrophy.During ~-agonist-induced cardiac hypertrophy in adult ratscalpain activity in homogenates of the heart increased sig­nificantly. E64c, an inhibitor of calpain and other papain sub­family cysteine proteases, reduced the extent of hypertrophy[1]. In untreated human hypertensives there was an inverserelationship between the calpa in activity of a patient's eryth­rocytes and the extent of left ventricular hypertrophy [2].Reduced levels of calpain have been found in hypertrophichearts from hypertensive rats [3].

a-Adrenergic agonists such as phenylephrine induce hyper­trophy in cultured neonatal rat ventricular myocytes. This invitro model demonstrates a number of similarities with in vivomodels of hypertrophy such as an increase in cell size andprotein content without proliferation, up-regulation of con­tractile proteins and atrial natriuretic factor gene expressionand activation of immediate early gene and proto-oncogeneexpression [4].

This investigation employs cultured neonatal rat cardio­myocytes to test the effect of calpain inhibitors on phenyle­phrine-induced hypertrophy. Several inhibitors of differentmechanism are used to differentiate effects among calpain andother cysteine proteases.

Materials and methods

Isolation and culture ofcardiomyocytes

The ventricular myocytes from 1-2 day-old rat pups wereprepared by collagenase digestion to give a 5-7 x 105 cells/mlsuspension in digestion buffer - 5 mM EDTA [5]. Twenty mlof suspension was layered over a 10 ml layer of 1.06 g/mlPercoll and a 10 ml layer of 1.086 g/ml Percoll. Th is wascentrifuged for 30 min @ 2000 g. The band of cells at theinterface between the two Percoll layers was collected anddiluted to 40 ml with Dulbecco's Modified Eagle 's Medium(DMEM): M 199 (4: I) . The suspension was centrifuged@ 600 g for 10 min and the pellet was resuspended inDMEM:M199 (4:1) with 5% horse serum and 5% feta l bo­vine serum to give 3 x 105 cells/m!. 12-well collagen-coated

Addressfor offprints:J.T. Sugimoto, Department of Surgery, Creighton University School of Medicin e, 601 North 30th Street , Suite 3740 , Omaha , NE 68131,USA (E-mail : jsugi23 @creighton.edu)

48

plates [5J were seeded with I ml/well. The plates were incu­bated at 37°C for 24 h, then the medium was changed to se­rum-free DMEM: MI99 (4: I) for 24 h. The cells were thenfed wit h fresh medium containing phenylephrine and /orcalpain inhibitor for 48 h unless otherwise noted . The me­dium and agents were replenished at 24 h of the incubationperiod. Preparation s were> 90% myocytes based upon theextent of spontaneous beating of confluent cultures.

Protein content of cardiomyocytes

Cultures were washed twice with cold PBS , then I ml of0.25% SDS - 0.125 M Na citrate, pH 6.8 was added to eachwell, and the attached cells were suspended by scraping. Thesuspensio n was stored at -80°C overnight to lyse any intactcells. Following thawing and warming to dissolve the SDS, theprotein in the lysate was determined by the Lowry method [6J.

Peptidase activity of cardiomyocytes

After the 24 h on serum-free DMEM:M I99, the cells weregrown on 1 ml/well of phenol red-free M199 for 24 h withsome of the wells supplemented with phenylephrine. At 0,0.5, 1, 2 and 24 h of this 24 h incubation 0.5 ml of 240 flMcalpain substrate, N-succinyl-leucy l-leucyl-valyl -tyrosyl-7­amido-4-methylcoumarin, (LLVY-AMC) was added [7]. Cer­tain of these wells also received 25 fll of the calpain inhibitor,PD 150606,60 min before the addition of the calpain substrate.The fluorescence of the conditioned media was determined30 min after the addition of the substrate using an excitationwavelength of 365 urn and an emission wavelength of 460 urn.

Statistical analyses

Blocked and unblocked one-way ANOVA with Newman­Keuls contrasts were performed using the PROPHET soft­ware package from NIH.

increased the phenylephrine-induced hypertrophy of cardio­myocytes by an addi tiona l 59% (p < 0.01) as measured byprotein content (Fig . I) . E64c by itse lf did not affect cellprotein content. The specific calpai n inhibitor, PD 150606,at 25 flM significantly lowered the phenylephrine -inducedhypertrophy by 38% (p < 0.05) when the PD 150606 waspresent during the entire 48 h incubation (Fig . 2), whereasits presence just only during the first three h after the addi ­tion of phenylephrine did not modify the extent of hypertro­phy.

Effect ofphenylephrine and PD150606 on proteaseactivity

Phenylephrine at the same concentration (100 flM) that causeshypertrophy in culture inhibited the hydrolysis of the calpainsubstrate, LLVY-AMC, by 30% (p < 0.05) at I and 2 h afterthe addition of phenylephrine. The effect was not seen at 24 h(Fig . 3). PD 150606 decreased the hydrolysis ofLLVY-AMCby 45-67% (p < 0.05) at 1,2 and 24 h (Fig . 3). The combi­nation of pheny lephrine and PD 150606 did not increase theextent of inhibition compared to the agents alone.

Discussion

E64c inhibits members of the papain sub-fami ly of cysteineproteases including cathepsins as well as calpain by interact­ing with their active sites [8]. PD 150606 is a rather specificcalpain inhibitor which interacts with calpain's Ca/t-bind­ing regulatory sites . Because calpain's Ca2+-binding sites aresimilar to those of calmodulin, PD 150606 also interferes withcalmodulin-dependent processes, but at much higher conce n­trations [9]. Inhibition of calmodulin-dependent calcineurin

Animal care

The animal care comp lied with relevan t university, state andfede ral regulations.

Results

31)()

;; 2S0

"C.~ 21)()l::c..

" ISO,.:':;;::t: )()()

SOCo ntrol

**

*

PE ECl·k PI' + 64c

Effect ofprotease inhibitors on hypertrophy

Pheny lephrine at 100 flM caused a 56% increase in cell pro ­tein content. The cysteine protease inhibitor, E64c , at 10 flM

Fig. I . Effect of 10~M E64c on phen ylephrine (PE)-induced hypertrophy.' Significantly differen t (p < 0.0 I) from control. **Significantly differentfrom both control (p < 0.01) and 100 ~M phen yleph rine (p < 0.05). Valuesarc means of 2-3 expe riments . Control equals 32 ~g prote in per well.

49

Hours

hypertrophy. At the second point a cys teine protease otherthan calpain most likely takes part. Inhibition of this proteaseincreases the degree of hypertroph y. Presumably E64c wouldinhibit calpain at point one and the other protease at point twowith inhibition at point two being the predom inate effect. Itwould be possible for ca lpain to be the protease at point twoif PD 150606 inhib its calpain more effective ly at point onethan point two. This could potentiall y happen if point one andpoint two occurred at two different locations within the myo­cyte.

There are a number of potential substrates for calpain withinthe cardi omyoc yte that have been imp licated in a-agonist­induced hypertrophy. Protein kinase C isoform £ is activated/translocated in response to phenylephrine in cultured neonatalrat cardiomyocytes [12]. Protein kina se isoforms includings are substrates for calp ain [13, 14]. Calpain can also cleavea variety of cytoskeletal and focal adhesion compl ex protein ssuch as foca l adhe sion kinase, paxillin , talin and fodrin dur­ing physiologi cal proc esses [15, 16]. The cytoskeleton un­dergoes considerabl e modification during hypert roph y [17,18] and this reorganization is believed to affect the functionof the hypertrophied heart. Integrin s in the cell membranelink the extrace llular matrix with the cytoskel eton. Integr inligation and signa ling are also involved in the responses ofcultured neonatal cardiomyocytes to phenylephrine [19].However, there is no evidence for any particular protein be­ing cleaved by calpain as part of a hypert roph ic response.The cleav age produ cts of ca lpain are ofte n dete ctabl e byimm unoblotting and character istic becau se of the limit ed ,spec ific proteolysis.

Thi s study and another [I] sugges t the involvement of cal­pain in the hypertrophic response of cardiomyocytes to bothalpha and beta adrenergic agonists. In the ~-agonist modelhypertrophy was associated with an increase in calpain ac­tivi ty, whereas with the use of an a -agoni st there is no evi ­dence of an increase in ca lpain activ ity, but rather a decreasein protease activity that may involve calpain. There are otherproteases in the cell besides ca lpain that hydrol yze LLVY­AMC, such as the proteasome (20) . However, none is knownto be inhibited by PD 150606. E64c inhibited the develop­ment of left ventricular hypertrophy in the ~-agon i st model.In the ~-agonist model calpain activity was determined us­ing a homogenate of the ce lls prepared 3 days after the in­jecti on of ago nist. The observed in vitro activi ty may notreflect the activity in intact cells because calpain activity ishighly regul ated , reflecting local ca lpain, Ca2+, calpasta tin (anative calpain inhibitor) and possibly phospholipid concen­trations [21] . Phenyleph rine causes increased Ca2

+ transientsin neonatal rat cardi omyocytes [22], which, since Ca2+ acti­vates calpain, would favor increased calpain activity. Severalphosphoinositol s have been shown to promote calpain acti­vation by Ca2+ in vitro [21] though the significance of thiseffec t in intact cells is uncertain. a -Adrenergic stimulation

PE PE· ' 0- 3 .'0- 43

PD-3 PO-4'

*

PE

300

"i; 250!'j 2000..a.II 150>

.~

&! 100

50Conlrol

150?;-

• comrol:f; 1250CI(I) 100 • PE(I)Cl"0'g 75

_ POa.a , .

. '(I) 50.E; o PE+PDCl 25Qiex:

00 0.5 2 24

Fig. 3. Effec t of 100 11M phen ylephr ine (PE) , 25 11M PO 150606 and theirco mbination on calpain-like protease activity in cardiomyocy tes . *Signifi ­ca ntly different (p < 0.05) from contro l for that time period .

Fig. 2. Effect of 25 11M PO 150606 (PO) on phenylephrine (PE)-inducedhypertrophy. Cel ls were treated with PO for either the first 3 h or all 48 hof the incub ation period . *Significantly different from control (p < 0.0 I).**Significantly different from control (p < 0.0 I) and PE (p < 0.05). Value sare means of 3-5 experi ments. Control equals 22 I1g protein per well.

is known to decrease phenylephrine-induced hypertrophy[10] so there is a slight possibility that the effect of PD 150606is due to the inhibition of calcineurin and not calpain . Pre­sumably the differences in the effects of E64c and PD 150606on hypertrophy are due eith er to differin g extents of calpaininhibition or to the latter agent inhibiting ca lpain and theformer inhibiting calpain and an additional protease(s). Thecathepsins, in general, have a non-specific, degradative func­tion within the Iysosomes so they are not especially attrac­tive candidates for the additional protease(s). Others membersof the papain sub-family of cys teine proteases such as stra­tum corneum thiol prote ase [II ] are more suitable possibili ­ties.

The effects ofPD 150606 and E64c on phenylephrine-in­duced hypertrophy suggest that cysteine proteases affect theproc ess at two stages. At the first point the cysteine proteasepromotes the development of hypertrophy, whereas at thesecond stage the protease limits the extent of hypertrophy.The first of these would involve ca lpain , where inhibitingcalpain such as with PD 150606 decreases the extent of

50

increases total inositolphosphates in the cardiomyocytes [23].Thus, phenylephrine would be expected to increase calpainactivity rather than decrease it. The apparent reduction inprotease activity observed with phenylephrine does not nec­essarily mean that it is directly inhibiting or preventing theactivation of some proteases. Phen ylephrine could be ham­pering the substrate from penetrating into cell and reachingthe proteases. Howe ver, if phenylephrine were interferingwith substrate penetration, one would expect an additive ef­fect of epinephrine and PD 150606 on protease inhibition,which was not observed, although that might reflect insuffi­cient precision in the methodology.

Acknowledgements

The authors thank JoAnn Bauer for secretarial assistance.This work was presented in part at the XVII World Congressof the International Society for Heart Research, Winnipeg,MB, Canada, July 6-11 , 2001.

References

I. Arthur GD , Belcastro AN: A ca lci um stimulated cyste ine prot ea seinvol ved in isop roterenol indu ced ca rd iac hypertrophy. Mol CellBiochem 176: 241-248,1 997

2. Stella P, Sold ati L, Ciurlino D, Vezzoli G, Cusi D, Bianchi G: Erythro­cyte calpain activity and left ventricular mass in esse ntial hyperten sion.J. Hypertension 15: 1775 -1778, 1997

3. Cicilini MA, Resendi MM , Bissoli NS, Vasquez EC, Cabral AM : Cal­pain acti vity of hypertrophic hearts from hypert ensive rats. Braz J MedBioi 28:621-625,1995

4. Knowlton KU, Michel ML, Itani M, Shubeita HE, Ishih ara K, BrownJH , Chien KR: The al A-adrenergic receptor subtype mediates bio­chemical, molecular and morphological features of cultured myocar­dial cell hypertrophy. J Bioi Chern 268 : 15374-15380,1993

5. Enge lmann GL , McTi ern an C, Gerrity RG, Sam arel AM : Serum-freeprimary cultures of neon atal rat cardiomyocytes . Technique 2: 279­291.1 990

6. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ: Protein measurementwith the Fol in phenol reagent. J BioI Chern 193: 265-275, 195 1

7. Wang KKW, Nath R, Roser KJ , Hajimokammadr eza I: Mait otoxinindu ces ca lpa in ac tivatio n in SH-SY5Y neuroblastom a cells andcerebrocortica l cultures. Arch Biochem Bioph ys 33 1: 208-214, 1996

8. Barrett AJ, Kembhavi AA , Brown MA , Kirsche H, Knight CG, TamgiM. Hanada K: L-trans-epoxysuccinyl-Ieuc ylamido (4-guanido) butane(E64 ) and its analogues as inh ibitors of cysteine proteinasis incl udingca thepsins B, Hand L. Biochem J 20 I : 189- 198, 1982

9. Wang KK, Nath R, Posner A, Raser KJ. Buroker-Kilgor M, Hajimo­hammadreza I, ProbertAW Jr, Marcoux FW, Ye Q, Takano E. HatanakaM, Maki M, Caner H, Coll ins JL, Fergus A. Lee KS, Luney EA , HaysSJ, Juen P: An alpha-mercaptoac rylic acid derivative is a selective non­peptide cell-permeable calpain inhibitor and is neuroprotect ive. ProcNatl Acad Sci USA 93: 6687 -6692, 1996

10. Taige n T, DeW indt LJ, Lim HW. Molkentin JD : Target inhibition ofcalci neurin prevent s agonist-induced cardiomyocy te hypert rophy. ProcNat Acad Sci USA 97 : 1196- 200 I, 2000

II . Watkinson A: Stratum corneum thiol protease (SCTP): A novel cysteineprotease of late epidermal differentiation. Arch Dermat ol Res 29 1: 260­268, 1999

12. Eskildsen-Helmond YEG, Bezstaro sti K, Dek kers DHK , Van HeuztenHAA, Lamers JMJ : Cro ss-talk between receptor-mediated phospholi­pase C, B and D via protein kina se C as an intracellular signal possi­bly leading to hypertrophy in serum-free cultured cardiomyocytes. JMol Cell Cardiol 29: 2545-2559, 1997

13. Kishimoto A, Mikawa K, Hasim oto K, Yasuda 1. Tanaka S, TominagaM, Kuroda T, Nishizuka Y: Limited proteolysis of protein kinase C sub­spec ies by calcium-dependent neutral protease (calpain). J Bioi Chern264:4088-4092,1989

14. Urthaler F. Wolk owi cz PE, Digern ess SB , Harri s KD, Walker AA:MD L-28170, a membrane-permeant ca lpain inh ibitor. attenuatesstunning and PKC eps ilon proteol ysis in rep erfused ferret heart s.Cardiovasc Res 35: 60-67, 1997

15. Croall DE. Martino GN: Ca lcium-activa ted neutral prot ease (calpain)system: Stru cture , function and regul ation . Physiol Rev 7 1: 8 13-847 ,1991

16. Coo ray P, Juan Y, Sch oen waelder SM , Mitchell CA, Salem HH, Jack­son SP : Focal adhe sion kinase (pp 125 FAK) clea vage and reg ulationby ca lpain. Biochem J 318 : 4 1-47, 1996

17. Wang, X, Li, F, Campb ell , SE. Gerdes, AM: Chronic pressure over­load cardiac hypertrophy and failur e in guinea pigs: II. Cyto skeletalremodeling. J Mol Cell Cardi ol 3 1: 319-33 1, 1999

18. Tagawa H. Koidi M, Sato H, Zile MR, Carabello BA, Cooper G: Cyto­skeleta l role in the transiti on from compensa ted to decomp ensatedhypert rophy durin g adult canine left ventricular pressure overloading.Circ Res 82: 75 1-76 1, 1998

19. Ross RS, Pham C, Shai SY, Goldhaber JI, Fenc zik C. Glembotski CC ,Gin sburg MH , Loftu s JC: Beta I integrins participate in the hyper­trophic response of rat ventricular myocytes. Circ Res 82: 1160-1172,1998

20. Andersson M, Sjo strand J, Karl son JO : Differential inhibition of thre epeptidase activit ies of the proteasome in human lens epithelium by heatand ox idation. Exp Eye Res 69: 129-1 38, 1999

2 1. Cara foli E, Molinari M: Ca lpain: A protease in search of a functi on .Biochem Biophys Res Commun 247 : 193-203. 1998

22. Eble DM, Qi M, Waldschmidt S, Lucchesi PA, Byron KL, Samarel AM:Contrac tile activity is required for sarcomeric assembly in phenyle­phrine-induced ca rd iac myocyte hypertroph y. Am J Physiol 274 :C I226- 1237, 1998

23. De Jonge HW, Van Heugten HA, Bezstarosti K. Lamers JM : Distinctalpha- I adrenergic ago nist-and endothelin- I-evoked phosphoinositidecyc le responses in cultured neonatal rat cardiomyo cy tes . BiochemBioph ys Res Commun 203: 422-429, 1994

Mole cular and Cellular Biochemistry 251: 51-59, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Cardiac adaptation to endurance exercise in rats

Andrew Fenning,' Glenn Harrison,' Dan Dwyer,'Roselyn Rose'Meyer' and Lindsay Brown'(Department of Physiology and Pharmacology, School ofBiomedical Sciences, The University of Queensland;ZHeart Foundation Research Centre, Griffith University, Gold Coast, Australia

Abstract

Endurance exercise is widely assumed to improve cardiac function in humans. This project has determined cardiac functionfollowing endurance exercise for 6 (n = 30) or 12 (n = 25) weeks in male Wistar rats (8 weeks old) . The exercise protocol was30 min/day at 0.8 km/h for 5 days/week with an endurance test on the 6th day by running at 1.2 km/h until exhaustion. Exerciseendurance increased by 318% after 6 weeks and 609 % after 12 weeks. Heart weight/kg body weight increased by 10.2% after6 weeks and 24.1% after 12 weeks. Echocardiography after 12 weeks showed increases in left vent ricular internal diameter indiastole (6.39 ± 0.32 to 7.90 ± 0.17 mm) , systolic volume (49 ± 7 to 83 ± II Ill) and cardiac output (75 ± 3 to 107 ± 8 ml/min)but not left wall thickness in diastole (1.74 ± 0.07 to 1.80 ± 0.06 mm). Isolated Langendorff hearts from trained rats displayeddecreased left ventricular myocardial stiffness (22 ± 1.1 to 19.1 ± 0.3) and reduced purine efflux during pacing-induced work­load increases. 3

IP_NMR spectroscopy in isolated hearts from trained rats showed decreased PCr and PCr/ATP ratios with in­creased creatine, AMP and ADP concentration s. Thus, this endurance exe rcise protocol resulted in phys iolog ical hypertrophywhile maintaining or improving cardiac function . (Mol Cel1 Biochem 251: 51-59, 2003)

Key words : physiological hypertrophy, rat, endurance exercise, myocardial energy metabolism

Introduction

Left ventricular hypertrophy and remodelling can result fromboth exercise training and chronic cardiovascular diseases,especially hypertension. Exe rcise-induced remodel1ing iscons idered to be phys iological and beneficial to the heart, im­proving cellular metabolism, left ventricular structure, coro­nary blood flow and ultimately function [1-4] in contrast tothe maladaptive changes following hypertension. In chroniccardiovascular disease, cardiac remodelling is consideredpathological being characterised by changes in cel1 size,metabolism, collagen deposition and loss offunction in bothhumans and experimental animal models [5-8] .

There have been extensive studies investigating the cardiacadaptations after exercise on the laboratory rat [9-11] . How­ever, an important distinction must be made on the type andqual ity of exercise undertaken during these studies. In severalcases, the exerc ise protocol has been of a sprint or voluntarynature [3, 10, II] . Whilst these studies have still induced leftventricular hypertrophy, they do not mimic the more rigid andstruc tured training regime of the endurance athlete.

Some of the molecular mechanisms believed to be involvedin myocardial adaptation to chronic exercise and the conse­quent improvement in cardiovascular function include reducedoxygen free radical production [12], improved intracellularCa" handling [13] , enhanced nitric oxide release [14], in­creased concentrations of regulatory enzymes [15], increasedexpression of a-myosin heavy chain [9], reversal of ageing­associated declines in myocardial fibroblast expression forprocollagen types I and III and decreased ECM col1agencross-linking [3], altered creatine phosphokinase kinetics[16], improved myocardial lipid oxidation [4] and elevatednoradrenaline release [17]. Myocardial compliance increasedwith voluntary exercise although collagen did not change[10]. Structurally, endurance exercise in humans leads toincreases in left ventricular wall thickness, left ventricularinternal diameter and left ventricu lar mass [1,2]. These struc­tural changes have translated into clear functional improve­ments, especial1y with regard to left ventricular diastolicfunction and mitral blood flow dynamics [18] .

Therefore, the aims of this study were : ( I) to design a re­prod ucible treadmil1 protocol for the deve lopment of endur-

Addressforoffprints:L. Brown , Department of Physiology and Pharmacology, University of Queensland , 4072 , Australia (E-mail: I.brown @mailbox .uq.edu.au)

52

ance-induced physiological cardiac hypertrophy in normo­tensive rats and (2) to use both in vivo and ex vivo techniquesto examine myocardial adaptation to 6 and 12 weeks of en­durance exercise training in rats to further extend our under­standing of physiological cardiac hypertrophy.

Materials and methods

Male Wistar rats (8 weeks of age) were obtained from theCentral Animal Breeding House of the University of Queens­land, with all procedures approved by The University ofQueensland and Griffith University Animal ExperimentationEthics Committees under the guidelines of the NationalHealth and Medical Research Council of Aust ralia. The ani­mals were acclimatised to the facility for at least I week priorto initiation of experimentation, fed a pelleted rat chow andwater ad libitum and housed under light- and temperature­control.

Endurance exercise training

Rats were randomised into four groups: the exercise groups(6 weeks, n = 30; 12 weeks, n = 25) and the age-matchedsedentary controls (6 weeks, n =30; 12 weeks, n =25). Thetrained animals were endurance exercised for 30 min/day at0.8 km/h at 0% grade for 5 days per week on a modified hu­man treadmill as described previously [19]. The treadmillconsisted of six well-ventilated perspex lanes of 600 mm (L)x 120 mm (W) x 140 mm (H) with an electric, copper gridshock plate at the rear of each lane providing the stimulus torun with both voltage and current remaining constant. Anendurance test was performed on the sixth day each weekat 1.2 km/h at 0% grade until exhaustion, both to improveperformance and assess the extent of the rats ' physical fitness .The age-matched sedentary controls were acclimatised to thetreadmill twice in the first week by running for 5 min at0.8 km/h and also undertook the endurance test once per weekto establish the genuine training effect in the exercising ani­mals . Exhaustion was established when the rat would acceptthe electric shock three consecutive times as opposed to run­ning. Endurance day performance times were recorded inminutes . Rats were selected for the desire to run; however,this included> 90% of male 8 week old Wistar rats . The elec­tric shock plates were rarely needed during training days afterthe first week.

Assessment ofsystolic blood pressure and heart rate

Systolic blood pressure and heart rate were measured usinga tail pulse transducer (MLT I0 10) and an inflatable tail cuff

connected to a Statham P23 force transducer in selected ratslightly anaesthetised with intraperitoneal Zoletil" (tiletamine15 mg/kg with zolazepam 15 mg/kg) via connection to aPowerLab data acquisition unit (ADInstruments, Sydney,Australia) .

Echocardiography

Serial, in vivo left parasternal and left apical echocardio­graphic images of rats were obtained using the HewlettPackard Sonos 5500 (12 MHz frequency fetal transducer) atan image depth of 3 em using two focal zones [20]. Rats wereanaesthetised with intraperitoneal Zoletil" (tiletamine 25 mg/kg with zolazepam 25 mg/kg) together with Rornpun" (xy­lazine 10 mg/kg) which produces general anaesthesia in ratsfor 2-3 h without evidence of cardiac depression. Left ven­tricular M-mode measurements at the level of the papillarymuscles included left ventricular end-diastolic dimensions,left ventricular end-systolic dimensions, interventricular sep­tum and posterior wall thicknesses and fractional Shortening.Pulsed-wave Doppler analysis of mitral valve inflows wereused as estimates of diastolic function. Cardiac output, sys­tolic and diastolic volumes and left ventricular mass werederived from these values [21].

Isolated heart preparations

The non-recirculating Langendorff heart preparation wasused for isolated myocardial experiments [5, 22]. Briefly, ratswere anaesthetised with pentobarbitone sodium (100 mg/kgintraperitoneal). The right leg femoral vein was exposed andheparin (1000 IV) administered as an intravenous injection.The hearts were rapidly excised and placed in ice-cold modi­fied Krebs-Henseleit solution, the aorta isolated and cannu­lated via the dorsal root. Retrograde perfusion was initiatedat constant pressure (100 em HP) with modified Krebs­Henseleit buffer containing (in mM): NaCI 119.1, KCI4.75,MgS0

41.19, KHl04 1.19, NaHC0

325.0 , glucose 11.0 and

CaCI2 2. 16 maintained at 37°C and bubbled with 95%0/5%C02• A latex balloon catheter was inserted into the leftventricle for measurement of isovolumic left ventricularfunction via connection to a disposable pressure transducer(MLTlOIO) linked to a PowerLab system. Hearts were pacedat 250 bpm by attaching two electrodes to the surface of theright atria. End diasto lic pressure was initially set to 5 mmHgby balloon inflation and all hearts received an equilibrationperiod of approximately 25 min. Hearts from each test groupunderwent one only of the following experimental protocols.

Diastolic stiffnessEnd-diastolic pressure was measured for 3 min at 5 mmHgincrementsbeginningat0 mmHg up toa maximum of30 mmHg .

Measurements of diastolic pressure and sys tolic pressurewere made after 2 min of each 3 min recording for furthercalculation of diastolic stiffness and left ventricular devel­oped pressure. Myocardial diastolic stiffness was defined bythe stiffness constant (k, dimensionless) which is the slopeof the linear relation between the tangent elastic modulus (E,dyne/ern' ) and stress (o, dyne/em' ) [5]. At the end of theexperiment, the atria were removed and the weight of theventricles plus septum was recorded.

Purine effluxFollowing equilibration, hearts were subjected to increasedcardi ac workloads via bi-pol ar atrial pacing for five minut eintervals at 6, 7,8 and 9 Hz (360- 540 bpm). Contractile func­tion and coronary venou s effluent (from the cannulated pul­monary artery) were sampled prior to, and at 4 min into the5-min pacing episodes [22] . Effluent samples were immedi ­ately frozen and stored at -80"C. HPLC (reverse phase) analy­sis of samples was performed on a Waters Alliance HPLCusing Waters Millenium software . Purines (adenosine, inos­ine and hypoxanthin e) were eluted using a gradient compris­ing 50 mM KHlO/3% MeOH (buffer A) and 50% MeOH/Hp (buffer B) at a constant flow rate of I mUmin and pu-rine efflux calculated as nmole/min/g h . ht "

wet eart wetg t

Cardiac energeticsHearts were perfused with phosphate-free modified Krebs­Henseleit perfusate which contained (in mM); NaCI 11 8,KCI4.7 , MgS0

41.2, NaHC0

325.0, EDTA O.5, glucose 11.0,

CaCI2

1.75. Hearts were then located inside a 20 mm NMRtube and introduced into the center of a 56 mm bore Oxford400 (9.39T) magnet. A lO-min equilibration followed, priorto the acquisition of two consecut ive IO-min 3

IP-NMR spec­tra (220 free induction decay s) at the resting (unpaced) heartrate. Twenty Hz line broadening functions were applied priorto Fourier Transformation. Spectral intensities for PCr, ~-ATPand Pi were determined by computer integration using resi­dent VNMR software. The two spectra for each heart wereaveraged and corrected for partial saturation and heart weight.Calculations of myocardial phosphorus metabolites, pH, andt'1.GATP were performed as described previously [22]. Briefly,saturation-corrected spec tral intensities were con verted tointracellular concentrations by calibration against myocardialATP determined in a group of freeze -clamped control heartsstabilised for 60 min (n = 6). Thi s tissue ATP concentrationwas then assigned to the saturation corrected ~-ATP inten­sity in baseline spectra, and all other satura tion correctedintensities were normali sed against the baseline [ATP]/~-ATP

intensity ratio. Intracellular pH (pHi) was calculated from thechemical shift of P, relati ve to PCr. Free cytosolic [5' -AMP]was determined from the adenylate kina se equilibrium: [5'­AMP] = K'ak.[ADP]2/[ATP]. Free cytosolic [ADP] is es­timated from the creatine kin ase equilibrium : [ADP] =

53

[Cr].[ATP)/[PC r).K'ck . The free energy of ATP hydrol ysis(t'1.GATP) was calculated as: t'1.GATP = t'1.Go

ATP+R.T.ln([ADP).[Py

[ATP]).

Collagen distribution by picrosirius red staining and laserconfocal microscopy

All experimental animal s had the major organs remov ed andweighed. From the organs removed, the left ventricle andseptum underwent histological analysis. Tissues were initiallyfixed for three days in Telly's Fixative (100 ml of 70% etha­nol, 5 ml of glaci al acetic acid and 10 ml of 40% formalde­hyde) and then transferred into a pre-stain/fixati ve known asModified Bouin's Fluid (85 ml of saturated picric acid , 5 mlglacial acetic acid and 10 ml of 40 % form aldehyde) for 2days. The samples were then dehydrated and embedded inparaffin wax. Thi ck sections (15 11m) were cut and placed onglass slides coated with Mayer 's albumin solution (I g pow­dered egg albumin, 50 ml glycero l, 50 ml distilled water), leftto air dry for 2 days and then heated in an oven at 56°C forI h. Phosphomolybdic acid (0.2% in distilled water, 5 min)was then applied to reduce non-specifi c bindin g of the stainto the section and then washed in distilled water. The colla­gen-selective picrosirius red stain (0. 1% sirius red F3BA insaturated picric acid) was then used and allo wed to incubatefor 90 min . The sections were then washed, dehydrated andmounted in Depex with a cove rslip. Image anal ysis of thestained sections took place on the Laser Scanning ConfocalMicro scope (BioRad MRC-I024 - Rhodamine/Texas redfilter, 568 nm, emission 609 OF 32 by green excit ation). Ran­domly assigned slides and sections were scanned represent­ing the perivascular areas of the left ventricle. The image swere taken with an objective lens of 40x magnification andanalysed for pixel inten sity in a specified area of the section.Thi s data was compiled by a software image rendering pro­gram (IA-IP-Lab, Scanal ytics Inc ., Australi a) .

Statistical analysis

Data are presented as mean ± S.E.M . The effect of trainingover time was analysed using one-way ANOVA with post­hoc comparisons of group means at 6 or 12 weeks via un­paired Student 's r-tests: p < 0.05 was considered statisticallysignificant.

Results

The test day performance of rats undergoing endurance ex­ercise steadily increased over the 12 weeks of training withsignificant increases as early as week 2 (Fig . I) . This im-

54

250

200

,-..tilQ,/-150::lc

Os'-'Q,/

e 100~

50

* * 1.2

0.4

*

w.. ..,g." ~ ----::

~~_---_---""'II*

Echocardiography

o o 3 6 9 12

o 3 6 9 12 Training (weeks)

Training (weeks)

Fig. J. Week ly endurance exercise training times for young male Wistarrats undergoing 5 sessions of 30 min each week at 0.8 kmlh (closed circles)or no traini ng protocol (open squares); *p < 0.05.

provement was accompanied by a smaller gain in body weightbut no changes in sys tolic blood pressure or food or waterintake (Table I ). Left ventricular wet weig hts were selec­tively increased indi catin g mild cardiac hypertrophy (Ta­ble I , Fig. 2).

Non- invasive evalu ation of cardiac parameters and func­tion using echocardiography showed a significant increasein left ventricular intern al dimension after 12 weeks trainin gwithout changes in left ventricular wall thickness, in frac­tional shortening as a measure of systolic function or in mi-

Fig. 2. Post-mortem left ventricular wet weights and the estimation of leftventricular mass from echocardiographic assessment of left ventricular di­mensions [201 in rats trained for 0, 6 or 12 weeks (closed circles) or age­matched untrained rats (open squares); *p < 0.05.

tral valve EIA flow ratios as a measure of diastolic function(Table I, Figs 3a and 3b). Thi s selective increase in internaldimension produ ced significant increases in the derived pa­rameters of systolic volume and cardiac output after both 6and 12 weeks (Table I).

In the isolated Langendorff heart , the training protocolfailed to alter contracti le indices (+maximal dP/dt in mmHgIsec: 1870 ± 90, untrained 6 weeks; 1950 ± 90, trained 6

Table I . Characteristics of animals, cardiac function and weights in untrained and trained rats

Parameter Initial Untrained Trained Untrained Trainedoweek 6 week 6 week 12 week 12 week

n 10 10 10 10 10Body weight (g) 336 ± 9 499 ± 15 448 ± 16* 524 ± 25 484 ± II *Water intake (mllday) 49.5 ± 6.5 53.2 ± 5.4 45.8 ± 7.2 47.3 ± 3.2 44.6 ± 3.6Food intake (g/day) 25.8 ± 2.4 28.3 ± 2.1 26.8 ± 1.9 27.8 ± 3.2 30.8 ± 2.8Systolic BP (mmHg) 121 ± 8 119 ± 4 1l 2± 3 115 ± I I 114 ± 8LV weight (mg/g bwt) 1.72 ± 0.08 1.87 ± 0.06 2.06 ± 0.06* 1.74 ± 0.04 2. 16 ± 0.06*Kidney weight (mg/g bwt) 5.58 ± 0.7 5.62 ± 0.3 5.63 ± 0.2 6.27 ± 0.3 5.99 ± 0.4LVPWd (mm) 1.67 ± 0.05 1.79 ± 0.09 1.85 ± 0.07 1.74 ± 0.07 1.80 ± 0.06LVIDd (mm) 6.35 ± 0.14 6.68 ± 0.26 7.08 ± 0.24 6.39 ± 0.32 7.90 ± 0.17*FS (%) 54.1 ± 1.9 57.5 ± 3.2 54.2 ± 5.1 57.2 ± 2.2 53.2 ± 3.5E/A 1.84 ± 0.09 1.69 ± 0.3 2.24 ± 0.33 1.55 ± 0.09 1.64 ± 0.11LV mass (g) 0.715 ± 0.02 0.697 ± 0.08 0.880 ± 0.05* 0.716 ± 0.09 0.922 ± 0.03*LV systolic volume (ml) 0.039 ± 0.052 0.046 ± 0.011 0.054 ± 0.020* 0.049 ± 0.0066 0.083 ± 0.0 11*CO (ml/min) 65.4 ± 3.9 72.6 ± 4.5 85.1 ± 3.9* 74.9 ± 3.3 106.6 ± 8.0*

BP - blood pressure; LV - left ventricle; LVPWd -left ventricular posterior wall thickness in diastole; LVIDd - left ventricular interna l diameter in diastole;FS - fractional shortening; E/A - mitral valve flow rate ratio; CO - cardiac output; *p < 0.05 vs. respective untrained group (6, 12 weeks).

10

55

a 30

*~

25

'-'

c=b-~tiltilIlJ;5

~:=.... 20til

.:=Q *....tilC':l

Q15

12963

a 9.0-IlJ.... 8.5IlJ

SC':l:0 8.0

,-.

"asE S 7.51lJ'-'

.... 1lJc-

.- 0 7.0I. ....C':l~=:0 6.5(,J.- c.=--cQJ 6.0~

;:::IlJ 5.5...:l

5.0 ,0

Training (weeks) o 3 6 9 12

Training (weeks)

Training (weeks)

b 0.21

-"a,-. 0.20~ S~ S.- '-'

- IlJ 0.191lJ _.... 0til ....o tilQ. C':l

-:0 0.18~c=.-.:= ~_ til

0.17.... 1lJc c1lJ":'::~ (,J;::::=

0.161lJ .......:l

0.15I I I

0 3 6 9 12

Training (weeks)

b 2000

500

o 3 6 9 12

Fig. 3. (a) Echocardiographic assessment of left ventricu lar internal dimen­sions in rats trained for O. 6 or 12 weeks (closed circles) or age-matcheduntrained rats (open squares); *p < 0.05. (b) Echocardiograph ic assessmentoft eft ventricular posterior wall thickness in rats trained for 0.6 or 12 weeks(closed circles) or age-matched untrained rats (open squares); *p < 0.05.

Fig. 4. (a) Cardiac stiffness in the isolated Langendorff heart from ratstrained for 0.6 or 12 weeks (closed circ les) or age-matched untrainedrats (open squares); *p < 0.05. (b) Collage n estim ation by laser confoca lmicroscopy of picrosirius-stained left ventr icular sections from rats trainedfor 0. 6 or 12 weeks (closed circles) or age-matched untrained rats (opensquares); *p < 0.05.

weeks; 1900 ± 50, untrained 12 weeks; 1820 ± 130 trained12 weeks; n =6-9) but these trained hearts showed signifi­cant ly decreased cardiac stiffness compared with untrainedhearts (Fig. 4a) . However, this improved compliance of thetrained hearts was achieved without changes in the distribu­tion of collagen, a major determinant of cardiac stiffness, inthe left ventricle (Fig. 4b).

Purine efflux from isolated Langendorff hearts was used

as an indica tor of metabolic efficiency. An increase in heartrate from 360-540 bpm produced an approx imately 2.4-foldincrease in purine efflux in untrained hearts (Fig. 5). In con­trast, following 6 weeks of training, purine efflux was sig­nificantly lower at a heart rate of 360 bpm (2.24 ± 0.4 1nmolelmin/g . h ) and did not increa se when heart rate was in-

wet werg t

creased up to 540 bpm (1.66 ± 0.44 nmole/minlg . h; n =7)wet weig t

(Fig. 5).

Discussion

Chronic exercise in young, normotensive rats results in physi­ologicalleft ventricular hypertrophy which enhances cardiac

Fig. 5. Purine efflux at increasing heart rates in isolated Langendorffheartfrom rats trained for 6 weeks (closed circles) or age-matched untrained rats(open squares); *p < 0.05.

function [1- 4]. This left ventricular remodelling withoutchanges in collagen content [11] allows an improved myo­cardial compliance [10] with an increased cardiac index atrest [9]. Our results confirm that exercise induces left ven­tricular remodelling with mild hypertro phy and an increasedleft ventricu lar internal diameter, without an increased wallthickness, leading to an improved cardiac output at rest to­gether with a decrease in cardiac stiffness.

The reported studies on exercise-induced cardiac adapta­tions have used many differing protocols of chronic tread­mill or swim training regimes of exercise.Arguments remainover the training regimes , load intensity, myocardial mass in­creases, gender/age differences and clinical application offindings [9, 23]. The current study aimed to design a repro­ducible low-stress protocol of endurance treadmill exercisethat would induce mild cardiac hypertrophy in normotensiveadult rats .

The weekly training regime of 5 days of fixed low inten ­sity (speed and grade) followed by a test day of running toexhaustion plus a rest day was based on our previous study[19] which demonstrated endurance exercise to stimulate anadaptive response to the fatig uing effects of serotonin in thebrain. This previous study specifically aimed to reduce anyexogenous stress of running on the rats which may occur withswim train ing or high intensity runni ng [9, 23, 24]. Whiletrain ing day intensity was not altered throughout the study,it is obvio us from the test day endurance times that rats ac­tively improved their fitness by applying their own exerciseduration voluntarily on the test day. Rats were close ly moni­tored for fatigue and had the freedom to complete the test dayrun at any time. Interestingly, running the rats in groups ofsix in clear sight of each other may encourage higher per­formance as test day times were very similar within gro upsthroughout the trial. By the end of 12 weeks of training, ani­mals were routinely covering the equivalent of 5 km on thetest day, comparable to that reported in prev ious treadmillstudies [9, 19] but less than estimated in wild rats (8 km/night)[25].

9

*

8

*I

7

*..

Stimulation frequency (Hz)

56

12.5

---- 10.0.E...~

~ ~=E 5 7.5

~~

~ =C ••' ;: 8 5.0=-~.!!

08

*C'-' 2.5 ..

0.0I

6

Assessment of metabolic status of the hearts using 31p _

NMR spectroscopy showed that trained rats displayed analtered metabolic status at rest when compared to their un­trained controls . Significantly lower PCr availabi lity and un­changed ATP concentrations were combi ned with increasedconcentrations of the precursors, Cr, AMP and ADP.The PCr/ATP ratio was approximately 31% lower following 6 weekstraining and 23% lower after 12 weeks training (Table 2, Figs6a and 6b). Intracellular pH and overall free energy of ATPhydrolysis (llGATP) did not differ between the groups.

Table 2. 31 P_NMR derived metabol ite concentrations and indices in untrained and trained hearts during resting contractil e performance

Parameter Initial Untrained Trained Untrained Trainedoweek 6 week 6 week 12 week 12 week

n 9 5 7 4 3[ATP] (mmolll) 9.6 ± 0.3 8.80 ± 0.25 10.84 ± 0.89* 9.07 ± 0.74 9.06 ± 0.31[PCr] (mmolll) 16.7 ± 0.5 16.7±1.18 13.11 ± 0.89* 14.77 ± 0.93 11.78 ± 0.22*PCr/ATP ratio 1.74 ± 0.09 1.90 ±0.11 1.30 ± 0.18* 1.70 ± 0.24 1.32 ± 0.06*pHi 7.09 ± 0.03 7.07 ± 0.02 7.04 ± 0.01 7.04 ± 0.01 7.04 ± 0.01[Cr] (mmol/I) 10.25 ± 0.52 10.29 ± 1.18 13.89 ± 0.89* 12.23 ± 0.93 15.22 ± 0.22*[AMP] (mmol/I) 0.26 ± 0.05 0.22 ± 0.06 0.79±0.19* 0.37 ± 0.11 0.68 ± 0.06*[ADP] (mmolll) 0.054 ± 0.01 I 0.042 ± 0.007 0.090 ± 0.030* 0.057 ± 0.0 II 0.080 ± 0.005*flJ.GATP -59.3 ± 0.34 - 60.0 ± 0.61 -62.9 ± 1.66 - 64.6 ± 2.29 - 62.5 ± 1.56

n - number of heart s; ATP - adenosine triphosphate ; PCr - phosphocreatine ; Cr - creatine , AMP - 5'-adenosine monophosphate; ADP - adenosine diphos­phate. *p < 0.05 vs. respective untrained group (6, 12 weeks).

57

0.5

Physiological cardiac hypertrophy following run trainingin rats is distinct ly differen t from hypertension-inducedhypertrophy in that it improves diastolic function withoutaltering collagen content. Moderate exercise training in age­ing rats reversed ageing-assoc iated declines in myoca rdial

fibroblast expression for procollagen types I and III and de­crease ECM collagen cross-linking, without altering the over­all collagen concentration in the left ventricle [3]. Our studyhas extended these findings by showing a decrease in diastolicstiffness without altering left ventricular collagen depositionafter exercise training. Similar findings were presented in run­trained rats, with hearts from these animals having increasedmyocardial compliance whilst retaining normal myocardialcollage n charac teristics [10, 11]. In contras t, maladaptivecardiac hypertrophy is associated with initial diastolic func­tional impairment, intrinsically linked to increased diastolicstiffness and collagen deposition [6, 26].

The improvements in left ventricular struc ture and func­tion in exercise-trained rats were mirrored by our studiesusing echocardiography. Endurance exercise training pro­duced clear increases in left ventricular chamber size and masswhich was associated with improved diastolic and systo liccardiac function. Similar results were repo rted in humans,with endurance exercise increasing left ventricular internaldiameter and left ventricular mass but with also increasing leftventricular wall thickness [1,27]. These structural changes inhumans coincided with clear functional improvements , es­pecially with regard to left ventricular diastolic function andmitral blood flow dynamics [18].

Many mechanisms have been proposed for the cardiac ad­aptations to exercise . In particular, changes after enduranceexercise include improved intracellular Ca2+ handling, in­creased release of nitric oxide and improved metabolic sta­tus and bioenergetics [4, 13, 14, 25, 28]. Alterations of Ca2+

cycling have been highlighted as a potential mechanism forthe improved contractile responses of the heart followi ngintense run training in rats [24] . This study showed that ex­ercise training could increase myofilament Ca2+ sensitivity,enhance Ca2+ handl ing and improve cardiac cell pH regula­tion leading to increased cardiomyocyte contractility [24].This suggests that some ofthe increased systolic performanceseen in our study may be attributed to these mechanisms butthis would requi re further investigation.

There is increas ing evidence that nitric oxide plays a criti­cal role in the protective effects observe d after exercise onthe heart, suggesting that nitric oxide has a local regulatoryrole in normal diastolic function [29]. During physiolog icalincreases in cardiac performance (exercise), greater physi­cal deforming forces are present in the heart creating elevatedshear stresses on the coronary vessels causing an increasedrelease of nitric oxide [29]. Inhibition of nitric oxide produc­tion induced hypertension and maladaptive left ventricularhypertrophy leading to diastolic dysfunction and increaseddiastolic stiffness [6,29]. The release of nitric oxide duringexercise could provide the heart with improved blood flowand metabolite delivery, allowing for physiological hypertro­phy to occur without the usual mismatch in energy supply asin the pathologically hypertroph ied myocardium [14, 29].

12, , ,369

Training (weeks)

o

2.0

.:....~r...~

1.5~l:;u~

*1.0

a 20.0

til 17.5=.:....~r....... 15.0=Q,l("j

=Q("j 12.5~

~"t:l

=~r...U~ 7.5

5.0I I I I I

0 3 6 9 12

Training (weeks)

b 2.5

Fig. 6. (a) 3IP_NMR spectroscopic assessment of left ventricu lar ATP (cir­cles) and PCr (squares) concentrations from isolated Langendorffhearts ofrats trained for 6 or 12 weeks (closed symbol s) or age-matched untrai nedrats (open symbols); values at a weeks are taken from age-matched ratsreported in a previo us study [22] ; *p < 0.05 . (b) 3IP_NMR spectroscopic as­sessmen t of calcu lated PCrlATP ratios from isolated Langendorff hearts ofrats trained for 6 or 12 weeks (closed circles) or age-matc hed untrained rats(open squares) ; values at aweeks are taken from age-matc hed rats reportedin a previous study [22]; *p < 0.05.

58

This provides a potential mechanism of induction of physi­ological hypertrophy following training in our rats with im­provement in diastolic and systolic cardiac function . This isfurther supported by findings showing that nitric oxide re­lease during extended bouts of exercise has the ability toimprove cardiac cell metabolism and structure [14, 28, 29].Therefore, an increased nitric oxide may play an importantrole regulating physiological left ventricular hypertrophy intrained rats.

The metabolic status of the myocardium was markedlyimproved by training, as shown by the reduced purine effluxduring increased workloads in hearts from trained rats . Theseresults suggest that exercise training promotes intracellularsalvage rather than loss of purine nucleosides in the myocar­dium, therefore potentiating an improved metabolic stateduring an increased workload. Loss of adenosine and otherpurines reduces the available pool for adenine nucleotide re­synthesis during recovery from exercise or ischaemic stress .We have previously reported lower interstitial purine levelsduring, and decreased purine efflux after ischemia in isolatedrat hearts subjected to preconditioning [22]. The purine-spar­ing effect of preconditioning led to improved post-ischaemiccontractile function and enhanced cellular energy metabolismduring reperfusion as assessed by 3

1P_NMR. A recent studyshowed that 6 weeks of graduated swim training restored thefunctional benefits of ischaemic preconditioning to the heartsof aged rats [I7J .

The structural and functional adaptation to chronic exer­cise appears to impart bioenergetic benefits to the myo­cardium. At resting cardiac workloads, the myocardium ofexercise-trained rats may operate to the right of the creat­ine kinase equilibrium equation yet maintain adequate if nothigher ATP producing potential by having elevated ATP pre­cursors . Declines in phosphocreatine to ATP ratio as observedin the trained hearts have typically been observed in the hyper­trophied or failing human heart [30, 31Jor in animal modelsof severe left ventricular hypertrophy [32J, usually with re­duced intracellular creatine levels . These diminished high­energy phosphate concentrations are linked to abnormalmechanical performance particularly during exercise or is­chaemic stress [33]. A reduced PCr and total creatine signalin the spontaneously hypertensive rat (SHR) model of car­diomyopathy may signal the transition from compensated todecompensated hypertrophy [34] . The effect of training-in­duced left ventricular hypertrophy on myocardial bioenergeticshas been studied previously using magnetic resonance spectro­scopy in athletes [33] and rats [16], with neither study findingany differences in high energy phosphate levels vs. untrainedcontrols at resting heart rates . Results showed a trend towardlower PCr/ATP ratios in trained rats, however net ATP syn­thesis flux calculated using saturation transfer was the samein trained and untrained hearts [16]. The difference betweenthese results and our study may reflect the swim vs. run train-

ing regime used or enzymatic changes to the bioenergeticmachinery. Treadmill training in dogs increased the concen­tration of regulatory enzymes of glycolytic and oxidativemetabolism [IS], while hearts from 8-10 week swim trainedrats displayed significantly higher forward creatine kinase(CK) rate constant at resting heart rates and increased mito­chondrial CK to citrate synthase activity ratio [16]. This sug­gests that chronic exercise training may instill subtle adaptivechanges to myocardial energy production and transfer sys­tems which when combined with eccentric myocyte hyper­trophy can augment function at higher workloads.

The role of exercise in human cardiovascular disease hasgenerated much discussion but remarkably few controlledclinical trials [35-38]. Cardiac adaptation to exercise in hu­mans appears to be similar to that in rat models but there aremany factors which may influence the outcome in humanssuch as the exercise protocol and compliance. The similarityof responses following exercise in rats and humans indicatesthat endurance exercise in rats may be a valid model to de­termine cardiovascular changes in humans.

In summary, endurance exercise in normotensive rats in­duces mild physiological hypertrophy which improves cardiacperformance and bioenergetics. Future studies will determinewhether this protocol also leads to an improved cardiac struc­ture and function in rat models of pathological hypertrophy,for example in acute and chronic hypertension.

Acknowledgement

This work was presented in abstract form at the XVII WorldCongress of the International Society for Heart Research, July6-11,200 I, Winnipeg, Canada (J Mol Cell Cardiol33: A34,2001) .

References

I . Fagard R: Athlete's heart: A meta-analysis of the echocardiographicexperience. Int J Sports Med 17: S 140-S 144, 1996

2. Douglas P,O'Toole M, Katz S, Ginsburg G, Hiller D, Laird R: Left ven­tricular hypertrophy in athlete s. Am J Cardiol 80: 1384-1388,1997 .

3. Thomas D, Zimmerman S, Hansen T, Martin D, McMormick R: Col­lagen gene expression in rat left ventricle : Interactive effect of age andexerci se training . J Appl Physiol89: 1462-1468,2000.

4. Moore R: Cellular adaptations of the heart muscle to exercise train­ing. Ann Med 30(suppl I) : 46-53, 1998

5. Brown L, Duce B, Miric G, Sernia C: Reversal of cardi ac fibrosis indeoxycorticosterone acetate-salt hyperten sive rats by inhibition of therenin-angiotensin system. J Am Soc Nephrol 10: S 143-S 148, 1999

6. Brown L, Fenning A, Shek A, Burstow D: Reversal of cardiovascularremodelling with candesartan . J Renin-angiotensin-aldosterone Syst2(suppll): SI41 -SI47, 2001.

7. Doggrell S, Brown L: Rat models of hypertension, cardiac hypertro­phy and failure . Cardiovasc Res 39: 89-105, 1998.

8. Aeschbacher B, Hutter D, Fuhrer J, Weidmann, P,DelacretazE, AllemannY: Diasto lic dysfunction precedes myocardial hypertrophy in the de­velopment of hyper tension . Am J Hyper 14: 106-113,2001.

9. Jin H, Yang R, Li W, Lu H, Ryan A, Ogasawara A, Peborgh J, PaoniN: Effect s of exercise training on cardiac function , gene expression,and apo ptosis in rats. Am J Physiol 279: H2994-H3002, 2000 .

10. Woodiwiss AJ, Norton GR: Exerc ise-induced cardiac hypertrophy isassociated with an increased myocard ial com pliance. J Appl Physiol78: 1303-1 311, 1995.

I I . Woodiw iss A, Oosthuyse T, Norton G: Reduced cardiac stiffness fol­lowing exercise is associated with preserved myocard ial collagen char­acte ristics in the rat. Eur J Appl Physio l78 : 148- 154, 1998.

12. Yamashita N, Hoshida S, Otsu K, Asahi M, Kuzuya T, Hori M: Exer­cise provides direct biphasic cardioprotection via manganese super­oxide dismuta se activation. J Exp Med 189: 1699-1 706, 1999.

13. Lebine SN, Kinasewi tz GT: Exercise conditioning increases rat myo­cardial calc ium uptake. J Appl Physiol60: 1673-1679, 1986

14. Kingwell BA: Nitric oxide as a metabolic regulator during exercise:Effects of training in health and disease . Clin Exp Pharmacol Phys iol27: 239-250,2000

15. Stuewe SR, Gwirtz PA, Agrawal N, Mallet RT: Exerci se training en­hances glycolytic and oxidat ive enzymes in canine ventric ular myo­cardium. J Mol Cell Cardio l 32: 903-913, 2000

16. Spencer RG, Buttrick PM, 1ngwall JS : Function and bioenergetics inisolated perfused trained rat hearts. Am J Physiol 272: H409-H4 17,1997

17. Abete P, Calabrese C, Ferrara N, Cioppa A, Pisane lli P, Cacciato re F,Longob ardi G, Napoli C, Rengo F: Exercise training restores ischemicprecond itioning in the aging heart. J Am Coil Card iol 36: 643-650,2000

18. Claessens P, Claessens C, Claesse ns M, Claessens M, Claessens J: Su­pernormal left ventricu lar diastolic function in triath letes. Tex HeartInst J 28: 102-110,2001

19. Dwyer D, Browning J: Endurance training in Wistar rats decreasesreceptor sensitivity to a sero tonin agonist. Acta Physiol Scand 170:2 11-2 16,2000

20. Brown L, Fenning A, Chan V, Loch D, Wilson K, Anderson B, BurstowD: Echocardiographic assessment of cardiac structure and function inrats. Heart Lung Circ I I : 167-1 73, 2002

2 1. Litwin SE, Katz SE, Morgan JP, Douglas PS: Serial echocardiog raphicassessment of left ventricu lar geome try and function after large myo­cardial infarctio n in the rat. Circulation 89: 345-354, 1994

22. Harrison GJ, Willis RJ, Headrick JP: Extracellular adenosine levels andcellular energy metabolism in ischemically preconditioned rat heart .Cardiovasc Res 40: 74-87, 1998.

23. Wisloff U, Helgerud J, Kemi OJ, Elling sen 0 : Inten sity-controlledtreadmill running in rats : V02m" and cardiac hypertrophy. Am J Physio l280 : H I301-HI3 10, 200 1

24. Wisloff U, Loen neche n JP, Falck G, Beisvag V, Currie S, Smith G,

59

Ellingsen 0 : Increased contractility and calcium sensitivity in cardiacmyocytes isolated from endu rance trained rats. Cardiovasc Res 50:495- 508, 2001

25. Rodnick KJ, Reaven GM, Smaldone PG, Riedy M, Zelis R: Variationsin running activity and enzymatic adaptations in voluntary running rats.J Apply Physiol 66: 1250- 1257, 1989

26. Guazzi M, Brenner DA, Apstein CS, Saupe KW: Exercise intolerancein rats with hypertensive heart disease is associated with impaireddiasto lic relaxation. Hypertension 37: 204-208, 200 1

27. Claessens C, Claesse ns P, Bloemen H, Claessens M, Verbanck M,Fagard R, Clae ssens J: Structural heart adap tations in triathletes. ActaCardio l 54: 317-325, 1999

28. Jons dottir I, Lungersten L, Johansson C, Wennmalm A, Thoren P,Hoffmann P: Increase in nitric oxide formation after chronic volun­tary exerc ise in spontaneously hypertensive rats. Acta Physiol Scand162: 149-153, 1998

29. MacCarthy PA, Shah AM: The role of nitric oxide in the regulation ofmyocardial relaxation and diasto lic function. Asia Pacific Heart J 7:29-37, 1998

30. Neubauer S, Hom M, Pabst T, Harre K, Stromer H, Bertsch G, SandstedeJ, Ertl G, Hahn D, Kochsiek K: Cardiac high-energy phosphate metabo­lism in patients with aortic valve disease assessed by 31 P-magneticresonance spectrosco py. J Invest Med 45: 453-62, 1997

31. Conw ay MA, Allis J, Ouwe rkerk R, Niioka T, Rajagopalan B, RaddaGK: Detect ion of low phosphocreatine to ATP ratio in failing hyper­trophied human myocardium by 31 p magnetic resonance spectroscopy.Lancet 338: 973-6, 1991

32. Zhang J, Merkle H, Hendrich K, Garwood M, From AH, Ugurbil K,Bache RJ: Bioenergetic abnormalities associated with severe ventricu­lar hypertrophy. J Clin Invest 92: 993-1003, 1993

33. Zhang J, Toher C, Erhard M, Zhang Y, Ugurbil K, Bache RJ, Lange T,Homans DC: Relationships between myocardial bioenergetics and leftventricular function in hear ts with volume-overloaded hypertrophy.Circulation 96: 334-343, 1997

34. O'Donnell MJ, Narayan P, Bailey MQ, Abduljalil AM, Altsc huld RA,McCune SA, Robitai lle PM: 3IP_NMR analysis of congestive heart fail­ure in the SHHF/Mcc-facp rat heart: J Mol Cell Cardiol 30: 235-24 1,1998

35. Coa tes AJS : Exe rcise trai ning in heart fail ure . Curr Control TrialsCardiovasc Med I: 155-1 60,2000

36. Belardinelli R, Georgiou D, Cianci G, Purcaro A: Randomized, con­trolled trial of long-term modera te exercise train ing in chro nic heartfailure. Circulation 99: 1173-1182, 1999

37. Shephard RJ, Balad y GJ: Exerci se as cardiovascular therapy. Circula­tion 99: 963-972, 1999

38. Willenheimer R, Rydverg E, Cline C, Broms K, Hillberger B, ObergL, Erhardt L: Effects on quality of life, symptoms and daily activity 6months after termination of an exerc ise training program me in heartfailure. Int J Cardio l 77: 25-3 1, 200 1

Molecular and Cellular Biochemistry 251: 61-66, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Matrix metalloproteinase inhibitors attenuateendotoxemia induced cardiac dysfunction:A potential role for MMP-9

Manoj M. Lalu,' Cindy Q. Gao2 and Richard Schulz' :'Departments of 'Pharmacology; 2pediatrics, Cardiovascular Research Group, University ofAlberta, Edmonton, Alberta,Canada

Abstract

Enhanced cardiac generation of peroxynitrite contributes to septic cardiomyopathy. Since matrix metalloproteinases (MMPs)are activated in vitro by perox ynitrite, we hypothezised that MMP s may contribute to cardiac mechanical dysfunction in sep­sis. Rat s were injected (i .p.) with either lipopolysacch aride (LPS, 4 mg/kg) or vehicle . MMP inhibitors, either Ro 3 1-9790(20 mg/kg), doxycycline (4 mg/kg), or vehicle were administered i.p. 30 min after LPS . At 6 h, when the symptoms of endo­toxemia peak, heart s were excised and perfused as working hearts with Krebs-Hen seleit buffer at 37°C. Card iac work (cardiacoutput x peak systol ic pressure product) was measured. Perfusate and ventricle samples were analyzed by gelatin zymographyto quantify MMP activity.

Cardiac function was significantly depressed in LPS-treated rats compared to control rats (control: 55 ± 4, LPS : 26 ± 6mmHg *mL*min-1

) . LPS also caused a loss of 72 kDa MMP-2 activity in the ventricles and the perfu sate . Although MMP -9activity was not detected in the ventricles, LPS resulted in an increa se in perfu sate 92 kDa MMP -9 activity. The MMP inhibi­tors significantly impro ved cardiac function of LPS-treated rats (Ro 31-9790: 38 ± 3, doxycycline: 51 ± 3 mmHg *mL*min-'),had no effect on the loss of MMP-2 acti vity, and significantly reduced the MMP-9 activity in the perfusate. These results dem­onstrate , for the first time, that LPS induced cardiac dysfunction is associated with a loss in ventricular MMP -2 activity and therelea se of MMP-9 from the heart. MMP inhibitors can significantly preserve cardiac mec hanical function during septic shock.(Mol Cell Biochem 251: 61-66, 2003)

Key words: endotoxemia, matrix metalloproteinases, myocardium, plasma

Introduction

Septi c shock is a condition caused by massive microbial in­fection and is characterized by hypoten sion and cardi ac dys­function (septic cardiom yopathy) [I] . Septic patients haveseve rely redu ced card iac ejection fractions and depressedmeasures of the Frank-Starling relat ionship [2]. A large bodyof evidence has suggested that this cardiac dysfunction iscau sed by pro-inflammatory cytokines which are ele vatedduring sepsis and which enhance myocardial production ofnitric oxide and superoxide [3]. These two molecules com­bine to form the highly toxic oxidant peroxynitrite at a diffu­sion-limited rate [4]. Peroxynitrite exerts its cytotoxic effects

through the nitration of free tyrosine residues and oxidationof sulfhydryl moieties. Evidence of perox ynitrite formati onhas been found in the heart [5] and lungs [6] of septic patients,and in the heart [7] and plasma of endotoxemic rats [8]. De­spite these advance s in our understanding of septic shock,mortality remains high . Thu s, new factors and potential tar­gets for therapeutic s need to be sought out. We speculatethat matrix metalloproteinases (MMPs) are potential media­tors of sepsis-related pathologies.

MMPs are a large family of zinc dependent endopeptidaseswhich have been recogni zed for their ability to degrade com­ponents of the extracellular matrix. Increased MMP activityhas been associated with a wide variety of long-term cardio-

Addressfor offprints: R. Schul z, Cardiovascular Research Group , 4-62 Heritage Medical Research Centre, University of Alberta, Edmonton, Alberta, Canada,T6G 2S2 (E-mail: richard.schu lz@ualberta.ca)

62

vascular pathologies, including heart failure and atheroscle­rosis [9, 10]. Recently, we have demonstrated that MMP -2activation and release mediates acute cardiac failure follow­ing ischernia-reperfusion injury through the cleavage oftroponin I [11, 12]. The latter study and a number of otherinvestigations have demonstrated that MMPs can act acutelyon a variety of non-extracellular matrix substrates [13-15].

Interestingly, peroxynitrite activates MMPs in a concen­tration dependent manner in vitro [16]. Thus, MMPs may beactivated in the septic heart through an increased productionof peroxynitrite and ultimately contribute to acute cardiacdysfunction. In order to examine the potential role of MMPsin septic cardiomyopathy, we used a well established rodentmodel of endotoxemia and coadministered MMP inhibitors.At the height of endotoxemic symptoms the hearts were ex­cised and perfused ex vivo in order to assess cardiac mechani­cal function and MMP activities in both the ventricles andthe perfusate.

Materials and methods

This investigation conforms to the Guide to the Care and Useof Laboratory Animals published by the Canadian Councilon Animal Care (revised 1993).

Rat model ofendotoxemia and isolated heart perfusion

Male Sprague-Dawley rats (250-300 g) were given either abolus intraperitoneal injection of a non-lethal dose of lipo­polysaccharide (LPS; Salmonella typhosa 0901, Difco, 4 mgtkg) or pyrogen-free water (control, n = 7). 0.5 h later, ratswere admini stered i.p. with the MMP inhibitors Roche 31­9790 (20 mg/kg , n =10), or doxycycline (4 mg/kg, n =6), ora volume matched amount of their respective vehicles (poly­ethylene glycol , n =6, or pyrogen-free water, n =10).

Six hours post LPS injection , when the symptoms of endo­toxemia peak in this model [7, 17], animals were sacrificedby sodium pentobarbital overdose (100 mg/kg, i.p.). Heart swere rapidly excised and perfused as working hearts with 110mL of recirculating Krebs-Henseleit buffer containing 11 mMgluco se, 5 mM pyruvate, 100 IlU/mL insulin, 1.75 mM Ca",0.5 mM EDTA, and 0.1% bovine serum albumin [18,19] .This buffer was delivered from the oxygenator (supplied with95% 0/5% COz) into the left atrium at a preload hydrostaticpressure equivalent to 9.5 mmHg . The perfusate was thenejected by the heart into a compliance chamber (containingI mL of air) and into the aortic outflow line. The hydro staticafterload pressure was set at 70 mmHg .

Heart rate and peak systolic pressure were measured by aGould P21 pressure transducer in the aortic flow line. Aorticflow and cardiac output were monitored using Transonic flow

probes in the afterload and preload lines respectively. Car­diac work, the product of cardiac output (mL*min-1

) and peaksystolic pressure (mmHg), was noted after 20 min of equili­bration in working mode .At this time, 2 mL of perfusate wascollected and stored for future processing. The ventricleswere snap frozen in liquid nitrogen and stored at -80°C forlater processing.

Preparation of ventricular homogenates

Frozen ventricular tissue was crushed by mortar and pestlecooled to the temperature of liquid nitrogen. The resultingpowder was diluted 1:4 w/v in 50 mM Tris-HCl (pH 7.4)buffer containing 3.1 mM sucrose, I mM dithiothreitol, 10 Ilg/mL leupeptin, 10 ug/ml. soybean trypsin inhibitor, 2 ug/ml,aprotinin and 0.1% Triton X-I 00. This solution was then ho­mogenized with an Ultra-Turrex disperser using four strokesof 4 sec duration.The homogenate was centrifuged at 10,000 gfor 5 min at 4°C and the supernatant was kept on ice for im­mediate assay of MMP activities.

Ventricular homogenate and perfusate protein contentswere determined by the bicinchoninic acid method (BCA kit,Sigma), using bovine serum albumin as a standard.

Measurement ofMMP activity by zymography

Gelatinolytic activities of MMPs were examined as previ­ously described [20] . Eight percent polyacrylamide gelscopolymerized with gelatin (2 mg/mL , type A from porcineskin , Sigma) were prepared. Non-heated samples were di­luted with water in order to load a constant amount of pro­tein per lane (perfusate, I51lg;ventricular homogenate, 40 ug).A standard was loaded into each gel (supernatant ofphorbolester activated HT-1080 cells, American Type Culture Col­lection) in order to normalize activities between gels. Follow­ing 1.5 h of electrophoresis, the gels were washed with 2.5%Triton X-I 00 for I h at room temperature (with three changesof solution) to remove sodium dodecyl sulphate. Gels werethen incubated for 38-48 h at 37°C in incubation buffer(50 mM Tris-HCI, 150 mM NaCI, 5 mM CaClz' and 0.05%NaN

3) . After incubation the gels were stained with 0.05%

Coomassie Brilliant Blue (G-250, Sigma) in a mixture ofmethanol:acetic acid:water (2.5:1:6.5, v/v) and destained inaqueous 4% methanol :8% acetic acid (v/v). Gelatinolytic ac­tivities were detected as transparent bands against the darkblue background. All gelatinolytic activities reported couldbe inhibited by addition of the matrix metalloproteinase in­hibitor o-phenanthroline (100 11M) to the incubation buffer.Zymograms were digitally scanned and band intensitieswere quantified using SigmaGel softw are (Jandel Corpora­tion).

63

Statistical analysis Ventricular MMP -2 activity is decreased duringendotoxemia

Results are expressed as the mean ± S.E.M. for n animals.The results were analy zed by using SPSS 11.0 (SPSS Incor­porated). One way analy sis of variance followed by Fisher'sleast significant difference post-hoc test was used to evalu­ate differences between groups . Differences were consideredsignificant at p < 0.05.

Results

MMP inhibitors ameliorate endotoxemia induced cardiacdysfunction

Zymographic analysis of control ventricular tissue revealeda robust gelatinolytic band at 72 kDa and a fainter band at75 kDa (data not shown) . The 72 kDa band was identified asMMP-2 by comparison to the HT-1080 standard, and the75 kDa band is considered to be a rat/murine specific glyco­sylated form of MMP-2 (Chri s Overall , University of Brit­ish Columbia, personal communication).The 72 kDa MMP-2activi ty was quantified by densi tometric analysis . This activ­ity became significantly depressed with LPS injection (Fig. 2).The administration of MMP inhibitors had no effect on theLPS induced decrease in 72 kDa MMP activity.

Symptoms of endotoxemia were evident in the LPS + vehi­cle treated animals at the time of sacrifice. These includedpilorerection , lethargy, and porphyrin secretion from the eyes.Heart s isolated from these animals exhibited significantlydepressed aortic flow, peak systolic pressure, and cardiac out­put compared to heart s taken from control animals (p < 0.05for all measurements vs. control, data not shown) . As a re­sult, cardiac mechanical function was significantly decreasedin hearts taken from LPS-treated animals (Fig. I ).

The admini stration of MMP inhibitors (either doxycyclineor Roche 31-9790) after LPS administration significantly im­proved aortic flow, peak systolic pressure , and cardiac out­put compared to their respective LPS + drug vehicle treatedgroups (p < 0.05, data not shown). This resulted in signifi­cantly improved cardiac mechani cal function (Fig. I) .

Perfusate MMP-2 activities are decreased duringendotoxemia

Perfusate samples from an hearts revealed MMP-2 gel­atinolytic bands at 72 and 75 kDa. The pattern of reducedmyocardial 72 kDa MMP-2 activity was mirrored in the per­fusate of hearts taken from LPS treated animals (Fig. 3A).Theadmini stration of MMP inhibitors had no effect on the LPSinduced decrease in 72 kDa MMP-2 activity in the perfusate.

MMP inhibitors attenuate the LPS induced increase inperfusate MMP-9 activity

MMP-9 activit y was not detect able within the control myo­cardium [I I], nor was it found after LPS treatment (data notshown). In contrast, perfusate samples taken from control ani-

+60

LPS LPS+ +

PEG Ro

*

Control

>--:~ -1501:) .5<!~eD.D.:E 0)100:E.,¢I'll~Q'­.¥c

:J~ ~ 50~ ~-­:::l'-.~€E~ 0 .&.........__....._-

m LPS LPS> + +

H20 Doxy

LPS LPS+ +

PEG Ro

Control

_ 50....¥·co'E 40~:.CJ E 30I'll iC:eOl~ ~ 20

.§. 10

Fig. I . Cardiac work in hearts isolated from control or LPS treated rats withor without MMP inhibitors. Cardiac mechanica l function was measuredfollowing 20 min of equilibration in working mode. LPS - lipopolysaccha­ride; Doxy - doxycycline; PEG - polyethylene glycol; Ro - Roche 31-9790.N =7-10 animals/group. *p < 0.05 vs. control, +p < 0.05 vs. respective LPS+ vehicle treated group, one-way ANOVA.

Fig. 2. Vent ricular 72 kDa MMP activity in control and experimentalgroups. Seventy-two kDa MMP activi ty, the primary gelat inolytic activ­ity in rat myocardium , was measured at the end of perfusion by gelatinzymography and quantified by densitometric analysis. n =7- 10 animals/group. "p < 0.05 vs. control, one-way ANOVA.

64

A B

~_150~

*.; - 60,_ l:.- l: ....-ti 'Qj OCll« ....« ... C')2Ne' 0. c:.o..~ 01100 :Eel 40:E.2- :E.2-C'll~ ns.l!lc·-Cl: ~l:~:::J :::J

~~50 ~~ 20

eIlf!! .sf!!...... C'll~C'll '- l/l.Ql/l.Q::::lL. ::::l L.

t~ 0 t« 0eIl-ell Control LPS LPS LPS LPS 0. Control LPS LPS LPS LPS0. + + + + + + + +

H20 Doxy PEG Ro H20 Doxy PEG Ro

Fig. 3. Perfusate MMP activities in contro l and experime ntal groups. (A) 72 kDa MMP-2 and (B) 92 kDa MMP-9 activ ities were measured by gelatinzymography and analyzed by densitometric analysis in perfusate samples collected after 20 min of stabilization in working mode. N = 7-10 animals/group.*p < 0.05 vs. control, +p< 0.05 vs. respective LPS + vehicle treated group , one-way ANOV A.

mals revealed a 92 kDa gelatinolytic activity in zymography.This band was identified as 92 kDa MMP-9 by comparisonto the HT 1080 standa rd. LPS administration significantlyincreased this activi ty in the perfusate (Fig . 3B). The admin­istration of either doxycycline or Roche 31-9790 significantlydecreased perfusate 92 kDa MMP-9 activity compared totheir respec tive LPS + vehicle treated groups.

Discussion

We have demonstrated, for the first time, that administratio nof MMP inhibitors in vivo ameliora tes LPS induced cardiacdysfunction. LPS administration was associated with a lossof myocardia l MMP-2 activity and an increased release ofMMP-9.

MMP-2 and MMP-9 in cardiomyopathies

The gelatinases were chosen as the focus of this investigationas MMP-2 is ubiquitously expressed throughout body [21]andMMP-9 is a cytokine inducible MMP [22J. These two MMPshave been also been implicated in wide variety of chronic car­diac pathologies [10]. Peterson et al. [23] demonstrated thatMMP-2 activity is increased in a progressive model of heartfailure in rats, and that administration of an MMP inhibitor pre­vents remodeling and improves cardiac function.An elevationin myocardial MMP-9 activity has also been noted in dilatedcardiomyopathy in human patients [24, 25].

The loss of myocardial MMP- 2 activity was expected, es­pecially in light of our recent inves tigat ion which demon-

strated that activation and release of MMP -2 is involved inacute mechanical dysfunction following ischemia-reperfusioninjury [11], another cardiac injury associated with eleva tedperoxynitrite generation [26J. In this previous study [11], lossof myocardial MMP -2 activity was associ ated with activa­tion of this enzyme and release into the coronary effl uentduring reperfusion. However, in the present investigation aloss of activi ty was noted in both the heart tissue and per­fusate. It is likely that MMP- 2 activation and release mayhave already occurred in vivo prior to the cardiac dysfunc­tion noted ex vivo at 6 h post LPS injection . Indeed , in iso­lated rat hearts perfused with proinfl ammatory cytokines wehave noted that MMP-2 is activated and released into theperfusate within the first 30 min of exposure and that MMP ­2 mRNA expression is subsequently downregulated [27].Regardless of the exact mechanism of loss of MMP-2 activ­ity, the demonstration that MMP-2 activity is regulated acutelyin vivo is novel, and opposes the notion that MMP-2 is merelya ubiquitous 'house-keeping' protein [28].

LPS induced activation of MMP -9

As previously reported, MMP-9 activity could not be detectedby zymography in rat myocardial tissue [I I] . Other investi­gations have shown that MMP -9 activity could be detectedin rat heart tissue by zymography after treatment of the sam­ples with 4-am inophenylmercuric acetate to chemically ac­tivate latent gelatinase activity. This suggests that myocardialMMP -9 may be tightly complexed with an inhibitor whichis not dissociated in zymography. Kjeldsen et at. have shown

that a 25 kDa lipocalin protein can form a complex with MMP­9 which remains stable in zymography [29].

In hearts taken from LPS treated rats 92 kDa MMP-9 activ­ity could be detected in the cardiac perfusate . The mechanismof MMP-9 activation and release may be related to increasedperoxynitrite formation in the myocardium of this model [7].In vitro peroxynitrite activates MMPs by disrupting the in­hibitory cysteinyl sulfhydryl bond between the propeptideand the zinc catalytic site [16]. As well, peroxynitrite infu­sion ex vivo into isolated perfused rat hearts can activateMMPs without proteolytic cleavage [30]. Thus, the increasedrelease and activity of 92 kDa ('pro') MMP-9 in our modelof endotoxemia may represent a peroxynitrite induced re­lease ofMMP-9. It has been noted that septic patients haveelevated levels of circulating MMP-9 protein which corre­late directly with mortality [31] . The release of activatedMMP-9 from the heart may contribute to this systemic in­crease in MMP-9 and the increased proteolytic state of sep­tic pat ients [32].

Inhibition ofMMPs

The inhibitors used in this study were structurally unrelatedand inh ibit MMPs through different mechanisms. Doxy­cylcine is a tetracycline antibiotic which inhibits activeMMPs through chelation ofthe catalytic zinc site [33], whileRoche 31-9790 is a hydroxamate inhibitor which acts aspseudosubstrate [34] . The specificity of these drugs wasmaintained by administering in vivo doses lower than anyprevious report [35-38]. However, since doxycycline andRoche 31-9790 are both broad spectrum inhibitors of MMPs,we cannot exclude the possibility that the beneficial effectsnoted in this study were related to inhibition of other MMPswhich were not analyzed by gelatin zymography.

Targets ofMMP activity

The majority of studies examining chron ic heart failure havesuggested that MMPs exert their effects through actions onthe extracellular matrix [24, 39, 40]. Collagen in the extra­cellular matrix is the major determinant of myocardial struc­tural integrity, and MMP-9 has the ability to cleave type IVcollagen. In our model of acute endotoxernia, cleavage of fi­brillar collagen tethers may have contributed to myocardialdysfunction by allowing myocyte slippage [41].

Interestingly, MTI-MMP, MMP-2, and MMP-9 have allbeen localized to the sarcomeres [12,24,42] . This presentsthe possibility that elements of the contractile machinery maybe potential targets of MMP proteolytic cleavage. Myosinheavy chain and troponin I are susceptible to cleavage byMMPs in vitro, and we have previously demonstrated that

65

troponin I degradation in ischemia reperfusion injury is medi­ated by MMP-2 [12]. Increased circulating levels oftroponinI have been noted in septic patients, indicating that proteo­lytic cleavage of the contractile machinery occurs in this in­flammatory state [43,44]. Together, these studies suggest thatmyocardial MMPs may be activated intracellularly duringsepsis, cleave elements of the contractile machinery, and ul­timately contribute to cardiac mechanical dysfunction.

Conclusion

In conclusion, we have demonstrated that MMP inhibitorsprevent LPS induced cardiac dysfunction and the associatedincrease in perfusate MMP-9 activity. Although MMP inhi­bition has been touted as a potential therapy in preventingcardiac remodeling, our results suggest that MMP inhibitionmay also prevent acute septic cardiac dysfunction.

Acknowledgements

This study was funded by a grant from the Heart and StrokeFoundation of Alberta, Northwest Territories, and Nunavut.Manoj Lalu is a graduate trainee supported by the AlbertaHeritage Foundation for Medical Research. Richard Schulzis a Senior Scholar of the Alberta Heritage Foundation forMedical Research.

References

1. American College of Chest Physicians/Society of Critical Care Medi­cine Consensus Conference: Definitions for sepsis and organ failureand guidelines for the use of innovative therapies in sepsis. Crit CareMed 20 : 864-874, 1992

2. Groeott-Mason RM, Shah AM: Cardiac dysfunction in sepsis: New theo­ries and clinical implications. Intensive Care Med 24: 286-295, 1998

3. Titheradge MA : Nitric oxide in septic shock. Biochim Biophys Acta14 11: 437-455,1999

4. Beckman JS, Koppenol WH : Nitric oxide, superoxide, and peroxy­nitrite: The good the bad , and the ugly. Am J Physiol 271: C 1424­C1437, 1996

5. Kooy NW, Lewis SJ, Royall JA, Ye YZ, Kelly DR, Beckman JS: Ex­tensive tyrosine nitration in human myocardial inflammation: Evidencefor the presence of peroxynitrite. Crit Care Med 25 : 812-819, 1997

6. Kooy NW, Royall JA, Ye YZ, Kelly DR, Beckman JS: Evidence for illvivo peroxynitrite production in human acute lung injury . Am J RespirCrit Care Med 151: 1250-1254,1995

7. Khadour FH, Pana s DL, Ferdinandy P, Schulze CJ, Csont T, Lalu MM,Wildhirt SM, Schulz R: Enhanced NO and superoxide generation indysfunctional hearts from endotoxemic rats. Am J Physiol283 : H II 08­H1115,2002

8. Kamisaki Y, Wada K, Ataka M, Yamada Y, Nakamoto K, Ashida K,Kishimoto Y: Lipopolysaccharide-induced increase in plasma nitro­tyrosine concentration s in rats. Biochim BiophysActa 1362: 24-28, 1997

66

9. Galis ZS, Khatri JJ : Matrix metalloproteinases in vascu lar remodelingand atherogenesis : The good , the bad, and the ugly. Circ Res 90 : 251­262 ,2002

10. Creemers EE, Cleutjens JP, Smits JF, Daemen MJ: Matrix me tallo­proteinase inhib ition after myocardial infarction: A new approach toprevent heart failure? Circ Res 89: 201-210, 200 1

II . Che ung P-Y,Sawicki G, Wozniak M, Wang W, Radomski MW, SchulzR: Matr ix meta lloproteinase-2 contributes to ischemia-reperfusion in­jury in the heart. Circulation 101: 1833- 1839, 2000

12. Wang W, Schu lze CJ, Suarez-Pinzon WL, Dyck JR, Sawicki G, SchulzR: Intracell ular action of matrix meta lloproteinase-2 accounts for acutemyocardial ischemia and reperfusion injury . Cir culation 106: 1543­1549,2002

13. Fernandez-Patro n C, Radomski MW, Dav idge SM : Vascu lar matrixmetalloproteinase-2 cleaves big endothelin-I yielding a nove l vasocon­stric tor. Circ Res 85: 906 -911 , 1999

14. Fernandez-Patron C, Stewart KG, Zhang Y, Koivunen E, RadomskiMW, Davidge ST: Vascu lar matrix metalloproteinase-2-dependentcleavage of calcitonin gene -related peptide promotes vasoconstriction.Circ Res 87: 670 -676, 2000

15. Sawicki G, Salas E, Murat J, Mis zta-Lane H, Radomski MW : Releaseof gelatina se A during platelet activation mediates aggregation. Nature386 : 616-6 19, 1997

16. Okamoto T, Akaike T, Sawa T, Miyamoto Y, van de r Vliet A, MaedaH: Activation of matrix metalloproteinases by perox ynitrite-inducedprote in S-glutathiolation via disulfide S-oxide formation . J Bioi Chem276 : 29596-29602,200 1

17. Schulz R, Nava E, Moncada S: Induction and potential biological rel­eva nce of Ca' t -independent nitric oxide synthase in the myocardium.Br J Pharmacoll05: 575-580, 1992

18. Ferdi nandy P, Panas D, Schulz R: Peroxynitrite contribu tes to sponta­neous loss of cardiac efficiency in isolated working rat hearts. Am JPhysiol276: HI861 -HI867, 1999

19. Ferdin and y P, Daniel H, Ambrus I, Roth ery R, Schulz R: Peroxynitriteis a major contributor to cytokine-induced myocardial contractile fai l­ure. Circ Res 87: 241-247,2000

20. Keliner DE, Stet ler-Stevenson WG : Quantit ative zymography: Detec­tion of picogram quantities of gela tinases . Ana l Biochem 218 : 325­329 , 1994

21. Yu AE, Murphy AN, Stetler-Stevenson WG : 72-kDa gelatinase (gel ­atina se A): Structure, activation, regulation, and substrate specificity .In : W. Parks, R. Mec ham (eds) . Matrix Met alloproteinases . AcademicPress, San Diego, 1998, pp 85-114

22. Most afa Mtairag E, Chollet-Martin S, Oudghiri M, Laquay N, JacobMP, Miche l JB, Feldman LJ: Effects of interleukin-IO on monocyte/endothelial ce ll adhe sion and MMP- 9/TIMP-l secretion . CardiovascRes 49 : 882-890, 2001

23. Peter son JT, Hallak H, Johnson L, Li H, O'B rien PM, Sliskovi c DR,Bocan TM , Coke r ML, Etoh T, Spina le FG: Matrix metalloproteinaseinhibition attenuates left ventric ular remode ling and dysfunction in a ratmodel of progr essive heart failure. Circu lation 103: 2303-2309, 2001

24. Spinale FG, Coker ML, Heung LJ, Bond BR, Gunasinghe HR, Etoh T,

Go ldberg AT, Zellner JL , Cru mbley AJ: A matr ix metalloproteinaseinduction/act ivation system exi sts in the human left ventricular myo­cardi um and is upregulated in hea rt fai lure . Circulation 102: 1944­1949, 2000

25. Li YY, Fe ldman AM , Sun Y, McTiernan CF : Differe ntia l expressionof tissue inhib itors of meta lloproteinases in the failing human heart.Circulation 98: 1728-1734, 1998

26. Yasmin W, Strynadka KD, Schulz R: Generation of peroxynitrite con ­tribute s to ischemia-repe rfusion inju ry in isolated rat hearts . CardiovascRes 33:422-432, 1997

27. Qun Gao C, Sawicki G, Suarez-Pinzon WL, Csont T, Wozni ak M,

Ferdinandy P, Schulz R: Matrix metalloproteinase-2 mediates cytokine ­induc ed myoc ard ial contractile dysfunction. Cardiovasc Res 57 : 426 ­433 ,2002

28. Huhtala P, Chow LT, Tryggvason K: Structure of the hum an type IVcollagenase gene. J Bioi Chem 265 : 11077-11082, 1990

29. Kjeldsen L, Joh nsen AH, Sengelov H, Borregaard N: Isolation andprimary structu re of NGAL, a novel protein associated wit h humanneutrophil gelatinase. J BioI Chem 268 : 10425- 10432, 1993

30. Wang W, Sawicki G, Schulz R: Peroxynitrite-induced myocardial in­jury is mediated through matrix metalloproteina se-2 . Card iova sc Res53: 165-174,2002

31. Nakamura T, Ebihara I, Shimada N, Shoji H, Koide H: Modul ation ofplasma metalloproteinase-9 concentrations and peripheral blood mono­cyte mR NA levels in patients with septic shock : Effect of fiber-immo­bil ized polymyxin B treatment. Am J Med Sci 316 : 355-360, 1998

32. Balduyck M, Alban i D, Jourdain M, Mizon C, Tournoys A, DrobecqH, Fourrier F, Mizo n J: Inflammation-induced systemic proteolysis ofinter-alpha-inh ibitor in plasma from pati ents with sepsis. J Lab ClinMed 135: 188- 198,2000

33. Smit h GN Jr, Mickler EA, Hasty KA, Brandt KD : Specificity of inhi­bition of matrix metalloproteinase activ ity by doxycycl ine : Relation­ship to structure of the enzyme . Arthritis Rheum 42 : 1140-1146, 1999

34. Yamamoto M, Tsuj ishita H, Hori N, Ohi shi Y, Inoue S, Ikeda S,Okada Y: Inhibit ion of membrane-type I matrix metalloproteinaseby hydroxamate inhibitors: An examination of the subsite pocket. J MedChem 41 : 1209-121 7, 1998

35. Vieillard-Baron A, Frisdal E, Edd ahibi S, Deprez I, Baker AH, NewbyAC, Berger P, Leva me M, Raffestin B, Adnot S, d 'Ortho MP : Inhibi­tion of matrix metalloproteinases by lung TIMP-I ge ne tran sfer ordoxycycline aggravates pulmonary hypertension in rats . Circ Res 87:4 18-425,2000

36. Trone F, Mallat Z, Lehoux S, Wassef M, Esposito B, Tedgui A: Roleof matrix metalloproteinases in blood flow-induced arterial en large ­ment: Interaction with NO. Arte rioscler Thromb Vase BioI 20: E 120­E 126,2000

37. Hew son AK , Smith T, Leonard JP, Cuzner ML : Suppression of ex­perime ntal a llergic encephalomyelit is in the Lewis rat by the matrixmetalloproteinase inhibitor R031-9790. Inflamm Res 44: 345-349, 1995

38. Sieb ert H, Dippel N, Mader M, Weber F, Bruck W: Mat rix metallo­proteinase expression and inhibition after sciatic nerve axotomy. JNeuropatho l Exp Neurol60: 85-93,2001

39. Rohde LE, Duc harme A, Arroyo LH, Aikawa M, Sukhova GH, Lopez­AnayaA, McCl ure KF, Mitc hell PG, Libby P, Lee RT: Matrix metallo­proteinase inhibition attenuates early left ventricular enla rgement afterexperimental myocardial infarction in mice . Circulation 99 : 3063­3070 , 1999

40 . Lindsey ML, Gannon J, Aikawa M, Schoen FJ, Rabk in E, Lopresti­Morrow L, Crawford J, Black S, Libby P, Mitche ll PG, Lee RT: Se ­lective mat rix metalloprotei nase inhibition reduces left ventricularremodeling but doe s not inhibit angiogenesi s afte r myocardial infarc­tion . Circu lation 105: 753-758, 2002

41 . Weber KT, Sun Y, Tyagi SC, Cleutjens JP : Coll agen network of themyocardium : Function, structural remodeling and regulatory mecha­nisms . J Mol Cell Cardiol 26: 279-292, 1994

42. Rouet-Benzineb P, Buhler JM , Dreyfus P, Delcourt A, Dorent R,Perennec J, Crozatier B, Harf A, Lafum a C: Altered balance betweenmatrix gelatinases (MMP-2 and MMP-9) and the ir tiss ue inhibitors inhuman dilated cardiomyopathy : Potential role of MMP-9 in myosin­heavy chain degr adat ion . Eur J Heart Fail I : 337-352, 1999

43 . Ammann P,FehrT, Minder EI, Gunter C, Bertel 0 : Elevation of troponinI in sepsis and septic shock. Intensive Care Med 27: 965-969, 2001

44. Turner A, Tsamitros M, Bellomo R: Myocardial c.~11 injury in septicshock . Crit Care Med 27 : 1775-1780, 1999

Molecular and Cellular Biochemistry 251: 67-75, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Functional and structural characterization of anti­~ l-adrenoceptor autoantibodies of spontaneouslyhypertensive rats

Gerd Wallukat,' Svenia Podlowski,' Eberhard Nissen,' RosemarieMorwinski,' Csaba Csonka,' Arpad Tosaki? and IngolfE. Blasig?'Max Delbriick Centrumfiir Molekulare Medizin, Berlin ; 2Forschungsinstitut f iir Molekulare Pharmakologie, Berlin, Germany

Abstract

Eighteen month old spontaneously hypertensive rats (SHR-rats) showed myocardial dysfunction and autoantibodies directedagainst the ~I-adrenoceptor similarly as known in human dilated cardiomyopathy or Chagas ' disease. The agonist-like anti­bodies were able to activate the ~I-adrenoceptor mediated signal transduction cascade in cultured rat cardiomyocytes and in­duced a long-lasting stimulatory effect resulting in a harmful adrenergic overdrive. The antibodies recognized an epitope ofthe second extracellular loop of the ~I-adrenoceptor identical to that epitope identified in Chagas' disease. In conclusion, ourassumption is supported that old SHR-rat are an useful animal model for investigating the role of anti -Bi-adrenoceptor anti­bodies in the induction of human cardiomyopathy. (Moll Cell Biochem 251: 67-75, 2003)

Key words : ~I-adrenoceptor, autoantibodies, spontaneously hypertensive rats, heart failure, cardiomyocytes

Introduction

Some years ago Dzilac et al . [1,2] postulated that the immunesystem may playa role in the development and maintenanceof hypertension and hypertrophy in spontaneously hyperten­sive rats (SHR-rats). These rats develop cardiac failure andfibrosis with implications for heart insufficiency in human.In men , autoantibodies directed against the ~I-adrenoceptors

are reported in heart failure . The antibodies were observedin patients with dilated cardiomyopathy, myocarditis [3,4]and ischemic heart disease with reduced left ventricular func­tion [5]. These antibodies act as ~-adrenergic agonists andexert in cultured rat cardiomyocytes a positive chronotropiceffect selectively blocked by ~I-adrenergic antagonists, suchas bisoprolol or metropolol [6].

Similar anti-jl-adrenoceptor autoantibodies were also foundin the serum of 18-month-old SHR-rats, but not in the aged­matched control Wistar-Kyoto rats (WKY-rats) and normalWistar rat strains [7]. The autoantibodies prepared from the

rat sera recognize the ~I-adrenoceptor and exert a positivechronotropic effect in cultured neonatal rat cardiomyocyteswhich was blocked by the ~I-selective antagonist bisoprololbut not by the ~2-adrenergic antagonist ICI 118.551. Further­more, the antibody effect was augmented by a peptide cor­responding to amino acid sequences of the extracellular loopsof the ~ ,-adrenoceptor [7].

The aim of the present study was to characterize the func­tional effect of the ~I-adrenoceptor antibody more in detailto elucidate its relevance for the development of heart fail­ure in SHR-rats. Therefore, the time-course of the antibodywas studied in SHR- and WKY-rats during aging. Moreover,the epitopes recognized by the anti-Br-adrenoceptor antibod­ies directed against the second extracellular loop of the ~I­

adrenoceptor were identified. Finally, we investigated theexpression of ~,-adrenoceptorsby Western blot because itwas shown that human anti-~,-adrenoceptors are able to re­duce the expression of the ~,-adrenoceptor in vitro [8] .

Address for offprints: G.Wallukat , Max Delbrilck Centrum fur Molekulare Medizin, Robert-Ro ssle-Str asse 10, 13125 Berlin, German y(E-mail : gwalluk @mdc.berlin .de)

68

Materials and methods

Materials

(-)-Isoproterenol, sodium deoxycholate, ortho-vanadate andaprotinin were purchased from Sigma, and ICI 118.551 fromImperial Chemicals Industries Pic . (Macclesfield, UK), Bis­oprolol was a gift from E. Merck (Darmstadt, Germany). TheP?lyclonal rabbit antibodies against the ~I- and ~2-adrener­

gic receptors were received from Santa Cruz BiotechnologyInc. (Heidelberg, Germany), NP40 from Fluka Chemie AG(Deisenhofen, Germany), and PMSF, SDS from Serva (Heid­elberg, Germany).

Isolated heart preparation

18-month-old Wistar-Kyoto rats (WKY-rats, 450-500 g) andspontaneously hypertensive rats (SHR-rats, 350-380 g) wereanesthetized with diethylether and after injection of heparin(500 IV/kg), hearts were excised and placed immediately ina cold medium (4°C).Hearts were prepared in working modeaccording to Neely and perfused with Krebs-Henseleit bicar­bonate buffer containing (in mM) NaCI 118, KCI 4.3, CaCI22.4 , NaHC0

325, KHl04 1.2, MgS04 1.2 and glucose 11.1,

gassed with 95% 0/5% CO2 (pH 7.4 at 37°C). To removeany particle perfusion fluid was filtered (pore size 5 11m) [9].

Heart function

Pressure was measured in the origin of the aorta by a pres­sure transducer (W112 Biomonitor BMT 3111, Zwonitz, Ger­many) connected to a precalibrated multichannel physiograph(TA II, Gould Instrument System Inc ., Valley View, OH,USA) . Preload (1.7 kPa) and afterload (10 kPa) were keptconstant throughout the experiments. Heart functional param­eters were recorded after IS min stabilization in the workingmode. Heart rate (HR) derived from the aortic pressure curve.Coronary flow (CF) was measured by collect ing effluent fromthe right atrium in a measuring cylinder for a timed periodand aortic flow (AF) by a calibrated rotameter. Left ventricu­lar developed pressure (LVDP) was calculated as left ven­tricular peak systolic pressure (LVPP) minus left ventricularend-diastolic pressure (LVEDP). Maximum and minimum offirst derivatives of left ventricular pressure (LVdp/dt andLVdp/dt . ) were also registered. max

mm

Isolation and purification of immunoglobulins

The immunoglobulin fraction was isolated from serum sam­ples by ammonium sulfate precipitation at a saturation of

40%.After centrifugation the pellets were resuspended in thedialysis buffer (154 mM NaCI, 10 mM sodium phosphate, pH7.2) and precipitated again with 50% ammonium sulfate. Thisprocedure was repeated ones. Thereafter, the resuspendedimmonoglobulins were extensively dialysed against II of thedialysis buffer for 48 h. The buffer solution was changed fivetimes .The immunoglobulins were transferred into phosphatebuffered saline (pH 7.2) and kept frozen at --25°C until use .

For the purification of the antibodies directed against the~ ,-adrenoceptors, a portion of the immunoglobulin fractionwas subjected to affinity chromatography on a peptide cor­responding to the amino acid sequence of the second extra­cellular loop and being covalently linked to Sepharose 4BCNBr gel. The immunoglobulin fraction was adsorbed on theaffinity column and autoantibodies were eluted with 3 MKSCN (pH 7.0). The antibodies were dialysed against phos­phate-buffered saline (pH 7.2) and stored at -25°C until use[10]. Ifhas stated otherwise antibodies have to be consideredas non-purified (IgG fraction).

Cell culture and functional characterization

Isolation and culture of neonatal heart cells were performedas described [10]. Briefly, single cells were dissociated fromthe minced ventricles of 1- 2 day-old Wistar rats with a 0.25%solution of crude tryps in and were cultured as monolayerswith a density of 800 cells/rum! in Halle SM20-I medium [I I]equilibrated with humidified air. The medium was changeddaily, and contained 10% heat-inactivated bovine calf serumand 211M fluorodeoxyuridine (FUDR), the latter to preventproliferation of non-rnyocytes [12]. The beating frequencyof the cells were counted on the heated stage of an invertedmicroscope at 37°C. The basal pulsation rate of the cardio­myocytes was 162 ± 22 beats/min. Isoproterenol was addedfor 5 min and the beating rate was determined again. The ef­fect of the immunoglobulins was measured, if not stated oth­erwi se, I h after the addition of the antibodies. Before thesemeasurements, the cells were washed and the medium wasreplaced by 2 ml fresh pre-warmed serum-containing mediumwhen using 12.5 em' culture flasks and incubated at 37°CforI h.

Protein isolation. electrophoresis, and Western blotting

Heart tissue was homogenized in RIPA-buffer (PBS , 1%NP40, 0.5% sodium deoxycholate, 0.1% SDS) with freshlyadded protease inhibitors (10 ul/ml of 10 mg/ml PMSF, 30ul/ml aprotinin, 10 ul/rnl of 100 mM sodium ortho vanad­ate) . The samples were transferred into reaction tubes andpassed through a 21 gauge needle. After incubating on icefor I h the samples were centrifuged at maximal speed in a

Eppend orf microfuge for 30 min at 4°C. The supernatant wastransferred into a new reaction tube. The protein concentra­tion was measured according to a modified Lowry method[ 13].

Then, SDS-sample buffer (0.2 mM Tri s, pH 6.8 , 20% glyc­erine, 10% mercaptoethanol , 8% SDS, 0.0 I% bromophenolblue) was added to the samples in the equal volume. Afterheating at 95 °C for I min 7.5% SDS-polyacrylamide gel elec­trophoresis was carried out using minigel apparatus (Bio-RadLaboratories GmbH, Munchen, Germany) . The nitrocellulosewa s incubated with transfer buffer (20 mM Tri s, 160 mMglycin e, 0.15 % SDS , 20 % methanol) for 30 min . Th e sepa­rated proteins were tran sferred to a nitrocellulose membran eby semidry blotting (6 mAlcm2 for 0.8 h). To preven t the non­specific binding, the nitrocellulose was firstl y blocked byinc ubation with blocking buffer (5% skim-milk powder in asolution containing 10 mM Tris-HCI, 150 mM NaCI, 0.05 %Tween-20 at pH 8.0: TBST) for I h at room temperature. Th eblots were then incubated with I ug/ml ant i - ~ l - or anti- ~2­

adrenergig receptors polyclonal antibodies (Santa Cru z) inblocking buffer overnight at 4°C. Both antibodies were di­rected against the C-terminal sequence of the receptor. Af­terwards, the blots were washed twice for 7 min with TBSTand incubated with horseradish peroxidase conjugated anti ­rabbit IgG ant ibody (Sigma, Deisenhofen, Germany) in a di­lut ion of I: 12,000 for I h at room temperature. Finally, themembranes were washed 3-times with TBST and once withTBS for 5 min . Th e dete ction of the proteins wa s performedby ECL-Kit (Arnersharn, Pharmacia Biotech, Little Chalfont/UK) according to the producer ' s instructions . The opticalden sity of the protein bands (42 kD fo r the ~ l- and 65 kD forthe ~2-adrenoceptor) identified by the ant ibodies were meas­ured by densitrometric analysis.

Detection ofcyclic AMP

69

performed by means of Student's t-test for paired and un­paired groups.

Results

Table I demonstrates that the relative and absolute wet weightof the hearts in SHR-rats was significa ntly higher than tho seof the WKY group, indicating cardiac hypertrophy in 18month-old SHR-rats. Some animals of the SHR group diedafter the age of 15 months and showed signs ofcong estive heartfailure, such as hydrothorax, edema, ascites and tach ypnoe. InSHR-rats an increa se in the incidenc e of atrial thrombi wasfound to 57.1% co mpared to 8.3 % in WKY-rats. In the SHRgroup, AF, CF, LVDP, LVdp/dt

maxand LVdp/dt

minsignificantly

decreased and LVEDP significantly rose compared to thoseparameter s in the WKY group. Indications of ca rdiac insuf­ficienc y in the hypertrophic heart of SHR-rats were especiallygiven by reduction in contractility (LVdp/dt

ma) and ejection

rate of left ventricle (AF) , accompanied by enhanced end ­diastolic pre ssure (LVE DP).

Moreover, the sera of the old SHR-rats contain functionalagonist-like autoantibodies directed aga inst the ~l- adreno­ceptor. Figure I represents the effect of anti-B j-adrcno ceptorant ibodies purified by affinity chromatography from the se­rum o f SHR-rats on the pulsation rate of culti vat ed heartmyoc ytes. The effect was dose-dependent and reached a max­imum at concentrations of about 0 .7 nM purified antibody.Th e calculated ec., wa s 0.13 nM . Th e maximal po siti vechronotropic effect exert by the antibodies corresponded to79 % of the max imum stimulation cau sed by isoproterenol.Furthermore , the data sho w that the antibodies used in these

Table I. Functio n and weig ht of hearts iso lated from lS-moni h-c ld WK Y­and 18-month-old SHR-rat s, perfused in the working mode

Cyclic AMP (cAMP) accumulation in the cul tured cardio­myocyte s was estimated in the presence of 0.5 mM 3-iso­butyl-I-meth ylx anthine (IBMX) by a protein-binding assayaccording to Gilman [14] . The cultured cardiomyocytes werepretreated with the antibody for 30 min . Th an the IBMX wasadd ed for 5 min . Thereafter the culture med ium was removedand the cell s we re denaturated with 5% trichloro acetic acid(TCA). The cAMP of the cultured ca rdiomyocytes was meas­ured as described by Woll enberger and Irmler [15]. The cellprotein was determined according to Lowry et al. [13].

Paramet er

Heart rate (rnin" )Aortic flow (mlmin' )Coronary flow (mlmin'}LVPP(kPa)LVDP (kPa)LVEDP (kPa)

LVdp/d t""" (kl-as')LVdp/d tm;o(kPas" )Absolute heart weight (g)Relati ve heart weig ht (%)

WKY-rats

189.6 ± 12.925.3 1 ± 1.6422.22 ± 0.9717.36 ± 0.6710.98 ± 0.846.39 ± 0.27

606.3 ± 19.525 1.0 ± 26.2

1.43 ± 0.040.31 ± 0.010

SHR-rats

209.8 ± 17.616.36 ± 3.53"18.96 ± 1.50**14.41±0.906.84 ± 1.00 *7.57 ± 0.33*

35 1.4 ± 43.6**158.4 ± 19.8*2.01 ± 0.\1 **0.55 ± 0.033***

Statistical analysis

Values given are mean s ± S.E.M. of independent exper imentsbas ed on different cell cultures. Analysi s of significance was

Data represent mean ± S.E.M., n = 7 in each gro up. '.o p < 0.05, *'.o p < 0.01and ***p < 0.001 - significantly different comp ared to WKY-ra ts. LVPP,LVDP, LVEDP, LVdp/dt""" , LVdp/d tm;orepresent left ventricular peak pres­surc. Ieft ventricular developed pressure, left ventricular end-diastolic pres­sure, maximum and minimum of first derivative of left ventricular pressure,respectively. LVDP was calculated as LVPP minus LVEDP. For relative heartweight, abso lute heart weight was related to body weight.

70

•

••

18 20 months

18 20 mo nths

....

# .. #) * ....i11 .0:..1 .... ..

12

12

r.I....

8WKY

c:'E 40-...Cl>

~ 30:::>c:-; 20Cl>.c.=Cl> 10

'"'"l!!0 0

-= •·10

2 3

A

SHRc:'E 40-...Cl>.c 30E ..:::>c:-; 20 .... *Cl>.c .... I.!: -'t"'..Cl> 10

'" t 1 ..'"e0 ..-=

0 ..·10

2 3 5

1 nM

flow fhr ough-10 p ur if ied AS

0.1

purif ied ant ibody

o+-,......,.-,--.-,......,....,..-,-,....,....,..-,-T"""""l---r-.--"rT...,.--rT~0.01

40

30

c"E-rn-caQl.c-0...Ql.c 20E::lCC

QlrncaQl...U.=

10

Fig. I . Effect of anti-~, -adrenoceptorantibodies purified by affinity chro ­matography on the pulsation rate of cultured neonata l rat heart myocytes .The antibodies were isolated from the sera of two differen t 18 month-oldSHR-rats and induce a dose dependent effect. The inset shows the effect ofthe antibodies specific for the ~,-adrenoceptor(left) and the llow throughof the affinity chromatography column (right. immunoglobulins without ~ ,­

adrenoc eptor antibodies) representati ve for SHR -rat s. Data repre sent mean± S.E.M.

experiments recognize the second extracellular loop of the~ ,-adrenoceptor because the anti bodies were purified with anaffinity chromatography co lumn to which a peptide corre­spon ding to the second extracellular loop of this adrenergicreceptor was covalent ly linke d. The inse t in Fig . I shows thaton ly the affinity chromatography purified imm unog lobulins(antibodies) caused an ago nist-like effect in cultured spon­taneo usly beating cardiac myocytes. The non-bound immuno­glob ulins (the flow though of the column) did not show anyactivity. These data demonstrate that the affinity chromatog­raphy column used removes specifically the ~1 -adrenoceptor

autoan tibodies from the TgG preparat ion.Tn Fig . 2, the appearance of anti-~ I -adrenoceptorantibod­

ies in the serum of SHR -rats but not in tha t of WK Y-rats isdemonstrated during aging . The antibodies were significantly

Fig. 2. The appearance of anti-~ ,-adrenoceptor antibodies in WKY- (e)

and SHR -rat s ("') during aging . measured as increa se of the pulsation rateof cu ltivat ed neonatal rat heart myocytes. Data repre sent mean ± S.E.M .•*p < 0.05 . significantly different compared to the respective basal pulsa­tion rate after the addition of PBS used as solvent for the antibody.

detec tab le in the sera of SHR-rats older than 3 months andwere present in all older animals of this strain investigated.In the WKY strain these antibodies were not identified withexception of 4 rats out of 14, but only if WKY-rats become20 months old.

The addition of the anti-~ I-adrenoceptor antibodies to thecultured spontaneo usly bea ting rat cardiomyocytes ind uceda positive chronotropic effect. T his effect was selectivelyantagonized by the ~ 1-blocking agent bisoprolol. The ~2­

adrenergic antagonis t TeT 11 8.551 did not infl uence the an­tibody-induced effect (Fig . 3).

As reported ear lier [7] the antibodies are directed againstthe second extracellular loop of the ~ ,-adrenoceptor. To iden­tify the epitopes recognized by these antibodies overlappingpep tides corresponding to parts of the second extracellularloop were used. The epitope to the second extracellular loopwas identified by preincubation of the antibodies wit h the

71

l: 30'E-.:OJ..cE 20:::ll:-CllOJ..c.510QlCIlCllQl...0 *.5 0

AB +ICI 118.551 + Blso

1 :20

Fig. 3. Influence of the 132- and 13 ,-selective adre nocepto r antagonists lei118.551 and bisoprol ol, respectively, on the pulsation rate of cultured neo­natal rat heart myocytes incubated with the immunoglobulin fraction iso­lated from SHR-rats. Data represent mean ± S.E.M., *p < 0.05, significantlydifferent compared to the respective basal pulsation rate .

peptide R-A-E-S -D-E. This peptide was able to prevent theagonistic effec t of the antibodies directed against the secondextracellular loop. A partial effect was observed by using thepept ide H-W-W-R-A-E (Fig. 4) .

The incubation of the cultured heart myocy tes with theanti-Bj-adrenergic antibodies resulted in a non-significant

increase of the cAMP content from 42.3 ± 4.8 in the controlsto 51.1 ± 1.5 pmollmg protein in the cells treated with theantibody. However, the specific inhibitor of the cAMP-de­pendent protein kinase Rp-cAMP S was able to block theagonistic effect of the antibodies time dependently (Fig. 5).

To characterize the mode of action of the agonistic effectof the antibodies more in detail we studied the time-course,the effect of washing and the influence of ~-adrenergic an­tagonists, in comparison to that of isoproterenol (Fig. 6). Twoh after the exposure to isoproterenol a pronounced reductionof the ~-adrenergic response was observed. In contrast, the~ I -adrenoceptor antibodies prepared from the SHR-rat seradid not show any down-regulati on within 4 h. Furthermore,contrary to isoproterenol, it was not possible to wash out theantibody effect. Both the effec t of the antibodies and that ofisoproterenol was inhibited by the ~-adrenergic antagonistbisoprolol.

As it was shown that in human dilated cardiomyopathy thecardiac ~1-adrenoceptor but not ~2-adrenoceptor is down ­regulated on mRNA and protein level, we investigated the ex­pression of both adrenoceptors on the prot ein level in thehearts ofWKY- and SHR-rats of different ages (Fig. 7). Theamount of the ~2-receptor protein did not change consider­ably in both groups within 24 weeks. In contrast, the amountof the ~I-receptor protein was diminished after 8 weeks andwas significantly reduced after 24 weeks after birth of the

c·s-.::~ 20E:::lC

AS AS + Rp cAMPS 5 x 10 .5 M

30 t (min)1551:20

*

* *

I

30e'E-...Gl.c 20E:JC..IIIGl.c

.5 10

GlIIIIIIGl...u.5 0

HWWRAERAESDE

DEARRCYARRCYND

PKCCDFDFVTNR

10

-CllQl.c

.5

IIICll~o.5

Peptide

Fig. 4. Influence of overlapping peptide sequences corres ponding to thesecon d extrace llular loop of the 13,-adrenocepto r on anti-13 ,-adrenoce ptoranti body agonist-like effect. The antibodies were pretreated for 2 h with thepeptide and the peptide-antibody-complex was then added to the sponta­neously beating cardiomyocytes . The figure shows the effect of peptideson two diffe rent SHR-rat immunoglobulins. Data represent mean ± S.E.M.in each group.

Fig. 5. Inhibition of the positive chronotropic effect of the 13 ,-adrenoceptorantibodies by the inhibitor of the cAMP-dependent protein kinase Rp-cAMP­S in cultured neonatal rat heart myocytes, antibody (AB) dilution I:20. Afterthe registration of the basal beating rate the myocytes were treated with theAB for 60 min. Then the change of the beating rate was meas ured followedby the addition of the inhibitor of protein kinase A Rp-cAMP S. Data repre­sent mea n ± S.E.M., n =30 in eac h gro up. *p < 0.05 significantly differ­ent compared to the value obtained 60 min after the addi tion of AB (attime 0).

Discussion

SHR-rats. WKY-rats investigated revealed no changes of the~ 1- and ~2-adrenoceptor proteins.

concluded that the effect of the SHR-rat anti-~ I-adrenoceptorautoantibodies is also realized via the ~I-adrenoceptor me­diated cascade.

The spec ificity of the antibodies was demonstrated afteraffinity puri fication usi ng a peptide corresponding to thesecond extracellular loop of the receptor. These purified an­tibodies induce in the cultured cardiomyocytes a dose-de­pendent agonist-like effect. The flow through of the columnwas without any activity. Another evidence that the antibod­ies recognize epitopes of the ~I-receptor was shown by theselective inhibition of the effect by ~I-adrenoceptor but notby ~2-adrenoceptor antagonists. Moreover, the agonist-likeeffect of the antibodies was prevented by peptides corre­sponding to second extracellular loop of the ~ ,-adrenoceptor.Similar agonist-like antibodies directed against the ~I-adreno­

ceptor were identified in the sera of patients suffering fromdilated cardiomyopathy [3,4,24] or Chagas' disease [21, 25] .

In earlier reports SHR-rats ~ I-adrenoceptorantibodieswere observed recognizing an epitope on the second extra­cellular loop. However, in contrast to the human antibodiesprepared from the sera of patients with dilated cardiomyopa­thy which recognize the amino acid sequence ARRCYN asthe main epitope on the second extracellular loop of the ~,­

adrenoceptor the antibody prepared from SHR-rat binds to theepitope RAESDE of the second extracellular loop . The latterincludes the identified epitope (AESDE) of f3 1-adrenoceptorantibody in Chagas' disease, an endemic cardiac disease inCentral and South America [26]. In Chagas' cardiomyopathyautoantibodies were observed recognizing the ~1-'~2-adreno­ceptor, and muscarinic M

2-receptor[21, 25, 27]. The epitope

AESDE of the second extracellular loop of the ~,-adrenoceptor

shows a functional homology to the epitope ADSDE of theribosomal protein PO~ in the hemoflagellate Trypanosomacruzi causing Chagas ' disease [25, 28] . The epitopeAESDEwas also detected in the immunodominant protein EBNA-3Bof Epstein-Barr virus [29]. Moreover, indications are giventhat retroviral genes are included in the SHR-rat genome ex­pressed in cardiomyocytes [30].

The agonist-like effect of the anti-Bj-adrenocepror anti­body did not desensitize the ~I -adrenoceptor within 4 h, cannot be washed out but was completely abolished by ~ I-adren­

ergic antagonists. In contrast, classical p-adrenergic agonistslead to desensitization of the p-adrenergic response after 1­2 h. This lack oftachyphylaxia was also observed with anti­P,-adrenoceptor antibodies from sera of patients with dilatedcardiomyopathy [24, 31].

Concerning to missing down -regulation it is worth to notethat the anti-adrenoceptor antibodies and the biogenic aminesrecognize distinct structures on the PJ-adrenoceptor. The an­tibodies occupy epitopes localized on the first or secondextracellular loop of the ~ I-adrenoceptor. Isoproterenol,however, binds in a pocket formed by the seven membranespanning domains of the ~,-adrenoceptor. However, both the

-I'llQl 20.c

.5Ql 10 ....... ISOUlI'll --~1 ABQl...o.5 ,

0 , i i i I'0 30 60 120 130 250255

SHR-rats constitute an experimental model of hypertensionsimilar to human hypertrophy. Hypertension results in leftventricular hypertrophy, a well known adaptation to stress­induced processes. Thus, myocardial hypertrophy in responseto chronic pressure overload may compensate cardiac stresstemporary [16]. During the transition from compensated stateto cardiac failure, numerous pathological changes, includingleft ventricular dilation [7], cardiac pump dysfunction [17],cardiac depression [18], fibrosis [19], and apoptosis [20] havebeen observed. The SHR-rats investigated in this study alsoshow typical signs of cardiac failure, such as reduction ofpressure development, aortic flow, contractility and increasedleft-ventricular end-diastolic pressure at cardiac hypertrophy.

In this study it was found that , in agreement with earlierobservations [7], SHR-rats generate antibodies selectivelydirected against the ~I-adrenoceptor. The mode of action ap­pears to be comparable to anti-B i-adrenoceptor antibodiesfound in human dilated cardiomyopathy and Chagas' disease[21]. It is assumed that the agonistic effect of the human ~ ,­adrenoceptor antibodies is mediated via ~-adrenoceptor, ade­nylate cyclase cascade, resulting in a moderate increase ofcyclic AMP [22, 23]. In the case of the SHR-rat generated~ ,-adrenoceptor autoantibody the elevation of cAMP was notsignificant. However, the inhibitor of the cyclic AMP-de­pendent protein kinase R -cAMP S was able to abolish the

p

agonist-l ike effect of the antibody. From this observation we

Fig. 6. Time-course of the positive chronotropi c effect of the purified anti­PI-adrenoceptor antibodie s (_, dilution 1:100) and the p-adrenergic ago­nist isoproterenol (e, 10 f.IM). After a washing procedure the registrationof beating ra te was repeated. In contrast to isoproterenol the anti-P I­adrenoceptor antibody did not desensitized the adrenerg ic response. Datarepresent mean ± S.E.M., n =30 in each group .

72

+150

c 40 3x wash

E"i:::Ql.cE 30::sc

73

Aa) 1 day old rats b) 4 weeks old rats

100

~ 80

~ 60orfl 40

20

T ,..1 J..

(4) (2)

100

~ 80

~ 60o#. 40

20

T ,..1 J.

(4) (4)

f-

wky shr wky shr

c) 8 weeks old rats D d) 6 months old rats 1__ _ --

shrwky

i- T

T..L

i- (S)J..

i-(6)

--

f- T.L

f- (6)

f- Tf- 1

(6)'-20

100

>. 80"'"~0 60#.

40

20

40

100

~ 80~

o 60#.

b) 8 weeks old rats

shrwky

T1

(S) -r--L.

f-(6)

f-

~T

(4)T

(4)

40

20

100

~ 80~

060#.

100'>,

"'" 80~

0 60#.

40

20

8a) 4 weeks old rats

wky shr wky shr

c) 6 months old rats

100

~ 80~o 60

rfl 40

20

TJ.

T{6l 1

(6l

wky shr

Fig. 7. Expression of ~ , - (A) and ~2-adrenoceptors (B) in the hearts ofWKY- and SHR-rats with different age , measured by Western blott ing (inset s). Thecolumns represent the values obtained by analysis of the density of the protein bands specific for the receptors . Data are mean ± S.E.M., data in bracketsrepresent the number of hearts investigated. *p < 0.05, significantly different compared to WKY-rats.

antibodyand isoproterenol cause an agonist-likeeffectwhichis, in the case of isoproterenol, down-regulated within two

h. In contrast, the antibodyreveals a long-lastingstimulationwhichcannotbe washedout. From thesedata we hypothesize

74

that the anti-Bj-adrenoceptor antibodies realize their agonis­tic effect by cross-linking and, hence, stabilizing the activeconformation of the ~ j-adrenoceptor, similar as described formonoclonal antibodies against the ~2-adrenoceptor, [32] or themuscarinic M

2receptor, [33]. The latter realize their ago­

nist-like effect via stabi lization of the agonistic dimericconformation of the receptors .

In SHR-rats the antibodies were detectable before myocar­dial dysfunction occurred may be contributing to functionaldisturbances observed later. The functional disturbancescould result from a long-lasting stimulatory effect of the anti­~I-adrenoceptor antibodies. This assumption agrees with ob­servations that a ~ I-adrenergic receptor overstimulation mightbe a reason for the development of heart failure [34]. Reportsin humans indicate that anti-B j-adrenoceptor antibodies mayplaya pathogenic role in dilative cardiomyopathy [10,24],and Chagas' disease [5]. This hypothesis was underlined bya new therapeutic approach in patients with dilated cardio­myopathy. Those patients carrying ~I-adrenoceptorauto­antibodies were treated by immunoadsorption therapy. Bythis treatment all IgG including the ~I-adrenoceptor auto­antibodies were removed resulting in improvement of thecontractile parameters of the heart, normalization of the car­diac size [35-37] and reduction of oxidative stress [38].

The proposed pathogenic role of ~j-adrenoceptorantibod­ies in heart failure is supported by experiments with rabbitsimmunized with peptides corresponding to the second extra­cellular loop of the human ~j-adrenoceptor[39]. These stud­ies demonstrate that a long-term immunization causes cardiacfailure similar as observed in patients with dilated cardiomy­opathy [39,40]. However, cardiac hypertrophy and morpho­logical alterations were prevented when the animals wereimmunized in the presence of the ~I-adrenergic antagonistbisoprolol [40, 41]. These findings further underlines thehypothesis that anti-Bj-adrenoceptor antibodies may playarole in the pathogenesis of heart failure [17, 19].

As shown in this paper the antibodies became detectablealready in 12 weeks-old SHR-rats for the whole life. How­ever, the expression of the ~I-adrenoceptors was significantlydecreased in 20 week-old animals only as shown by West­ern blotting. The ~2-adrenoceptor expression was not changedduring the same time studied. A similar, subtype-specificdown-regulation of the ~I-adrenoceptor was observed in pa­tients with dilated cardiomyopathy [42-44] and in experi­ments with cultured cardiomyocytes exposed to humananti-~,-adrenoceptorautoantibodies as demonstrated onmRNA- and protein level [8]. Therefore, it is possible thatthe sub-type speci fic down-regulation of the ~ I-adrenoceptoris induced by the ~ j-adrenoceptor autoantibodies.

As mentioned above the antibodies appeared in the age of12 weeks and reduced receptor numbers after 20 weeks; af­ter 48 weeks first functional and morphological alterationswere registered leading to dilated cardiomyopathy after 72

weeks. That means aging SHR-rats represent a chronic ani­mal model of dilated cardiomyopathy. One explanation forthe pathogenesis in this particular model is that autoantibodiescause adrenergic overstimulation accompanied by distur­bances of the calcium homeostasis. This seems to be the case.The addition of anti-B i-adrenoceptor autoantibodies cause inisolated human and rat cardiomyocytes a prolongation of theaction potential and an activation of the L-type Ca2+-channel[45]. The antibody-induced adrenergic overdrive may be thecause for the deterioration of the cardiac function . This stresscan be compensated for a certain time but, finally, the endog­enous compensation capacity is exhausted resulting in a de­compensated state .

Acknowledgements

We thank Monika Wegener, Holle Schmidt, and Karin Kar­czewski for valuable technical assistance. The studies weresupported by the Biomed project of the European Commu­nity and the Volkswagen-Stiftung 1/71 193.

References

I . Dzielak OJ: Immune mechanisms in experimental and essential hyper­tension. Am J Physiol260: R459-R467, 1992

2. Dzielak OJ : The immune system and hypertension . Hypertension19(suppl I): 36-44, 1992b

3. Wallukat G, Wollenberger A: Effects of serum gamma globulin frac­tion of patients with allergic asthma and dilat ed cardiomyopathy onchronotropic ~-adrenoceptorfunction in cultured rat heart myocytes.Biomed Biochim Acta 78: 634-639, 1987

4. Limas CJ, Goldenberg IF, Limas C: Autoantibodies against ~,-adreno­

ceptors in idiopathic dilated cardiomyopathy. Circ Res 64: 97-103,1989

5. Ferrari I, Levin NJ, Mahler E, Kalman J, Fuster V. Franco A, ElizariMV, Rosenbaum M, Chiale PA: High prevalence of arui-Bvadrene rgicrecep tor ant ibodies with agonist like activity in patients with severeleft ventricular dysfunction and ischaemic heart disease. Eur H J18(suppl): 1701, 1997

6. Wallukat G,Boewer V, Forster A, Wollenberger A:Anti-l3-adrenoceptorautoantibodies with l3-adrenergic agonistic activity from patients withmyocarditis and dilated cardiomyopathy. In: B.S. Lewis , A. Kimchi(eds). Heart Failure Mechani sms and Management. Springer Verlag,Heidelberg, 1991, pp 21-29

7. Wallukat G, Blasig IE, Morwinski R, Herrmann H-J, Rhode E: The seraof spontaneously hypertensive rats contain agonistic auto-antibodiesagains t the 13 ,-adrenoceptor. J Hypertens 13: 1031-1036,1995

8. Podlow ski S, Luther HP, Morwinski R, Muller J, Wallukat G: Agonis­tic anti-~,-adrenergicreceptor autoantibodies from cardiomyopathypatients reduce the 13,-adrenergic receptor expression in neonatal ratcardiomyocytes. Circulation 98: 2470-2476,1998

9. Csonka C, Pataki T, Kovacs P, Muller SL, Schroeter ML, Tosaki A,Blasig IE: Effects of oxidative stress on the expression of antioxidativedefense enzymes in spontaneously hyperten sive rat hearts. Free RadicBioI Med 29: 612-619, 2000

10. Wallukat G, Wollenberger A, Morwinski R, Pitschner WF: Anti-f3 ,­adrenoceptor autoantibodies with chronotropic activity from the serumof patients with dilated cardiomyopathy: Mapping of epitopes in thefirst and second extracellular loops. J Mol Cell Cardiol 27: 397-406,1995

II . Halle W, Wollenberger A: Differentiation and beha vior of isolatedembryonic and neonatal heart cells in a chemica lly defined medium.Am J Cardiol 25: 292-299,1 970

12. Kossler A: Myosingehalt und Aktivitat der Kreatin-Phosphokinase inRatten-Herzzellkulturen. Acta Bioi Med Germ 29: 119-134, 1972

13. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ: Protein measurementwith folin phenol reagent s. J Bioi Chern 193: 265-275, 1951

14. Gilman AG: A prote in bind ing assay for adenosine-3'5'-monophos­phate. Proc Nat! Acad Sci USA 67: 305-312, 1970

15. Wollenberge r A, Irmler R: Effect of adrenaline and methyl-i sobutyl­xanthine on adenosine-3'5' -.monophosphate levels in cultures ofbeatin g heart cells of newborn rat. Rec Adv Cardiol Struct Metab 12:689-695, 1978

16. Bing OH, Brooks WW, Robinson KG, Slawsky MT, Hayes JA, LitwinSE, Sen S, Conrad CH: The spontaneously hyperten sive rat as a modelof the transition from compensated left ventricular hypertroph y to fail­ure. J Mol Cell Cardiol27 : 383-396, 1995

17. Walford GD, Spurgeon HA, Lakatta EG: Diminished cardiac hyper­trophy and muscle performance in older compared with younger adultrats with chronic atrioventricular block. Circ Res 63: 502-511, 1988

18. Conrad CH, Brooks WW, Robinson KG, Bing OHL: Impaired myo­cardial function in spontaneously hypertensive rats with heart failure.Am J Physiol 260: H136-HI 45, 1991

19. Conrad CH, Brooks WW, Hayes JA, Sen S, Robinson KG,Bing OHL:Myocardial fibrosis and stiffness with hypertrophy and heart failurein the spontaneously hypertensive rat. Circulation 91: 161-1 70, 1995

20. Bing OHL: Hypothesis: Apoptosis may be a mechanism for the tran­sition to heart failure with chronic pressure overload. J Mol Cell Cardiol26: 943-948, 1994

21. Sterin-Borda L, Perez-Leiros C, Storino R, Borda ES: Antibodies tobeta-I and beta-2 adrenoceptors in Chagas' disease. Clin Exp Immunol74: 349-355, 1988

22. Wallukat G, Wollenberger A: Agonistic anti-f3 \- adreno ceptor auto­antibodies in the serum of patient s with dilated cardiomyopathy. In:R. Hetzer, E. Hennig , M. Loebe (eds) . Mechanical Circulatory Sup­port. Darmstadt, 1997, pp 83-91

23. Jahn s R, Boivin V, KrapfT, Wallukat G, Boege F, Lohse M: Modula­tion of beta I-adrenoceptor activity by Domain- specific antibodies andheart failure-ass ociated autoantibodies. J Am Coil Cardiol 36: 1280­1287,2000

24. Magnusson Y, Wallukat G, Waagstein F, Hjalmarson A, Hoebeke J:Autoimmunity in idiopathic dilated cardiomyopathy. Characteri zationof antibodies against the f3 \-adrenoceptor with positive chronotropiceffect. Circulation 89: 2760-2767, 1994

25. Ferrari I, Levin MJ, Wallukat G, Elies R, Lebesgue D, Chiale P, ElizariM, Rosenbaum M, Hoebeke J: Molecular mimic ry between the im­munodominant ribosomal protein PO of Trypanosoma cruzi and a func­tional epitope on the human f3 ,-adrenergic receptor. J Exp Med 182:59-65, 1995

26. Rosenbaum M: Chagasic myocardiopathy. Prog Cardiovasc Dis 7: 199­222, 1994

27. Goin JC, Borda E, Perez-Leiros C, Storino R, Sterin-Bord a ES: Iden­tification of autoantibodies with muscarinic cholinergic activity in hu­man Chagas' disease. J Auton Nerv Syst 47: 45- 51,1994

28. Elies R, Ferrari I, Wallukat G, Lebesgue D, Chiale P, Elizari M, Rosen­baum M, Hoebeke J, Levin MJ: Structural and functional analysis ofthe B cell epitopes recognized by anti-receptor autoantibodies in pa­tients with Chagas ' disease. J Immunol 157: 4203-4211 , 1996

75

29. Baer R, Bankier AT, Biggin MD, Deininger PL, Farrell PJ, Gibson ri,Hatfull G, Hudson GS, Satchwell SC, Seguin C, Tuffnell PS, BarrellBG: DNA sequence and expressio n of the B95-8 Epstein-Barr virusgenome. Nature 310: 207-211, 1984

30. Sirokman G, Humphr ies DE, Bing OH: Endogenous retroviral tran­scripts in myocytes from spontaneous hypertensive rats. Hypertension30:88-93, 1997

31. Wallukat G, Fu MLX, Magnu sson Y, Hjalmarson A, Hoebeke J,Wollenberger A: Agonistic effects of anti-peptide antibodies andautoantibodies against adrenergic and cholinergic receptors: Absenceof desensitization . Blood Press 5: 31-36,1996

32. Mijares A, Lebesgue D, Wallukat G, Hoebeke J: From agonist to an­tagonist: Fab fragments of agonist-like monoclonal anti-beta(2)-adren­ergic antibody behave as antagonist. Mol Pharmacol58: 373-379, 2000

33. E1 ies R, Fu MLX, Eftekh ari P, Wallukat G, Schulze W, Granier C,Hjalmarson A,Hoebeke J: Immunochemic al and functional characteri­zation of an agonist-like monoclonal antibody against the M2 acetyl­choline receptor. Eur J Biochem 251: 659-666, 1998

34. Engelhardt S, Hein L, Wiesmann F, Lohse MJ: Progressive hypertro­phy and heart failure in beta l-adrenergic receptor transgenic mice. ProcNatl Acad Sci USA 96: 7059-7064, 1999

35. Wallukat G, Reinke P, Dorffel WV, Luther HP, Bestvater K, Felix SB,Baumann G: Removal of autoantibodies in dilated cardiomyopathy byimmunoadsorption. Int J Cardiol54: 191-1 95, 1996

36. Dorffel, WV, Felix SB, Wallukat G, Brehme S, Bestvater K, HofmannT, Kleber FX, Baumann G, Reinke P: Short term hemodynamic effectsof immunoadsorption in dilated cardiomyopathy. Circulation 95: 1944­1947, 1997

37. MUllerJ, Wallukat G, Dandel M, Bieda H, Brandes K, SpiegelsbergerS, Nissen E, Kunze R, Hetzer R: Immunoglobulin adsorption in patientswith idiopathic dilated cardiomyopathy. Circulation 101: 385-391,2000

38. Schimke I, MUller J, Priem F, Kruse I, Schon B, Stein J, Kunze R,Wallukat G, Hetzer R: Decreased oxidative stress in patients with di­lated cardiomyopathy I year after immunoglobulin adsorption. JAmCoil Cardiol 38: 178-1 83,2001

39. Matsui S, Fu MLX, Katsuda S, Hayase M, Yamaguchi N, Teraoka K,Kurihar a T, Takekoshi N, Murakami E, Hoebeke J, Hjalmarson A:Peptides derived from cardiov ascular G-protein-coupled recept orsinduce morphological cardiomyopathic changes in immunized rabbits.J Mol Cell Cardiol29: 641-655, 1997

40. Iwata M, Yoshikawa T, Baba A, Anzai T, Nakamura I, Wainai Y, Tak­ahashi T, Ogawa S:Autoimmunity against the second extracellular loopof f3\ -adrenergic receptor induces f3-adrenergic receptor desensitizationand myocardial hypertrophy in vivo. Circ Res 88: 578-586, 200 1

41. Matsui S, Persson N, Fu HM, Katsuda S, Hayase M, Teraoka K,Kurikara T, Fu ML: Protective effect of bisoprolol on f3 ,-adrenoceptorpeptide-induced myocardial damage in rabbits. Herz 25: 267-270, 2000

42. Bristow MR, Ginsburg R, Umans V, Fowler MB, Minobe WA, Ras­mussen R, Zera P, Menlove R, Shah P, Jamieson S, Stinson EB: 13 \- and132- adrenergic receptor subpopulations in non-failing and failing hu­man ventricular myocardium: coupling of both receptors to muscle con­traction and selective 13 ,-receptor down-regulation in heart failure. CircRes 59: 297-309, 1986

43. Bristow MR, Minobe WA, Raynold WV, Port JD, Rasmussen R, RayPE, Feldmann AM: Reduced beta ( I) receptor messenger-RNA in fail­ing human heart. J Clin Invest 92: 2737-2745, 1993

44. Brodde OE: Beta-adrenoceptors in cardiac disease. Pharmacol Ther 60:405-430, 1993

45. Chr ist T, Wettwer E, Dobrev D, Adolph E, Knaut M, Wallukat G,Ravens U: Autoantibodies against the f3 ,-adrenoceptor from patientswith dilated cardiomyopathy prolong action potential durat ion and en­hance contract ility in isolated cardiomyocytes. J Mol Cell Cardiol 33:1515-1525,2001

Molecular and Cellular Biochemistry 251: 77- 82, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Quinapril inhibits progression of heart failure andfibrosis in rats with dilated cardiomyopathy aftermyocarditis

Wen Juan,' Mikio Nakazawa,' Kenichi Watanabe,1

Meilei Ma,'Mir I I Wahed,1 Go Hasegawa,' Makoto Naito,3 Tadashi Yamamoto,"Koichi Fuse,' Kiminori Kato,' Makoto Kodama' and Yoshifusa Aizawa'IDepartment of Clinical Pharmacology, Niigata University ofPharmacy and Applied Life Sciences, Niigata; 2DepartmentofMedi cal Technology, School ofHealth Sciences, Faculty ofMedicine; 3Second Department ofPathology; "Department ofStructural Pathology, Inst itute ofNephrology; 5First Department ofMedicine, School ofMed icine, Faculty ofMedicine,Niigata University, Niigata , Japan

Abstract

The cardioprotective properties of quinapril, an angiotensin-converting enzyme inhibitor, were studied in a rat model of di­lated cardiomyopathy. Twenty-e ight days after immuni zation of pig cardiac myosin, four groups rats were given 0.2 mg/kg(QO.2, n = 11), 2 mg/kg (Q2, n = 11)or 20 mg/kg (Q20, n = 11)of quinapril or vehicle (V, n = 15) orally once a day.After 1 month,left ventricular end-diastolic pressure (LVEDP), ±dP/dt, area of myocardial fibrosis, and myocardial mRNA expres sion of trans­forming growth factor (TGF)-P I, collagen-Ill and fibronectin were measured . Four of 15 (27%) rats in V and two of 11 (18%)in QO.2died. None of the animals in Q2 or Q20 died . The LVEDP was higher and ±dP/dt was lower in V (14.1 ± 2.0 mmHg and+2409 ± 150/-2318 ± 235 mmHg/sec) than in age-matched normal rats (5.0±0.6 mmHg and +6173 ± 191/-7120 ± 74 mmHg/sec; all p < 0.01).After quinap ril treatment, LVEDP was decreased and ±dP/dt was increased in a dose-dependent manne r (10.8± 1.8 mmHg and +3211 ± 307/-2928 ± 390 mmHg/sec in QO.2, 9.4 ± 1.5 mmHg and +2871 ± 270/-2966 ± 366 mmHg/sec inQ2, and 6.6 ± 1.5 mmHg, and +3569 ± 169/-3960 ± 203 mmHg/sec in Q20) . Increased expre ssion levels of TGlt-B 1, collagen­III and fibron ectin mRNA in V were reduced in Q20 . Quinapril improved survival rate and cardiac function in rats with dilatedcardiomyopathy after myocarditis. Furthermore, myocardial fibrosis was regressed and myocardial structure returned to nearlynormal in animal s treated with quinapril. (Mol Cell Biochem 251: 77-82, 2003)

Key words: angiotensin-converting enzyme inhibitor, dilated cardiomyopathy, collagen, heart failure , fibros is, quinapril

Introduction

Idiopathic dilated cardiomyopathy is a group of heterogene­ous diseases of left ventricular dysfunction [I , 2]. Left ven­tricular remodeling after inflammatory myocardial injury isconsidered to be a possible major cause of this type of disor­der. Inflammatory myocardial injury is observed not only inviral myocarditis but also in autoimmune myocarditis and invariou s other diseases with cytokine imbalance [3-6]. It is

still unknown whether the best therap eutic strategy for myo­cardial remodeling associated with myocarditi s is the sameas that for remodeling after myocardial infarction [3-6].

Angiotensin-converting enzyme (ACE) inhibitors havebeen shown to reduce morbidity and mortality in patients andmodel s with heart failure after myocardial infarction , but itseffects in model s of dilated cardiomyopathy after myocardi­tis are unknown [7-11]. This favorable effect could be ex­plained by the regression of hyp ertrophy and improved

Address for offprints : K. Watanabe, Department of Clinical Pharmacology, Niiga ta College of Pharmacy, Niigata 950-2081, Japan(E-mail : watanabe@niigata-pharm.ac.jp)

78

sys tolic and diastolic function due to inhibition of the intra­cardiac renin-angiotensin system as well as myocardial me­taboli sm due to elevated kinin s [12, 13].

The transition from compensated to failing cardiac hyper­trophy has been attributed to a reversion to a fetal pattern ofcardiomyocyte gene expre ssion and adverse remodeling ofthe ventricular connective tissue matrix [14, 15]. Many kindsof growth factors and cytokines, such as ba sic fibroblastgrowth factor, angiotensin-II and transforming growth fac­tor (TGF)-~ l, have been suggested to play important rolesin structura l remo deling of the non-myocyte compartmentof myocardium following heart failure . Angiotensin-Il is agrowth-promoting factor, and several previous studie s haveindicated that angio tensin-Il generation might be elevated inthe impaired myocardium [16, 17]. These observations sug­gest that changes in mRNA expression of TGF-~ 1, a multi­functional cytokine that plays a major role in the regulationof extracellular matrix depo sition , and of collagen-III andfibronectin , assessment of the effects of ACE inhibitors onfibrotic responses is very important. Therefore, it is impor­tant to determine whether ACE inhibitors have any effect onfetal gene expression or extracellular matrix remodeling inmodel s not only with heart failure after myocardial infarc­tion but also with dilated cardiomyopathy after myocarditis.

In the present study, the effects of quinapril, an ACE in­hibitor, on the development of myocardial damage wereexamined in a rat model of dilated card iomyopathy inducedby autoimmune giant cell myocarditis [4-6] . We found thatquinapril had in dose -dependent beneficial effects on dilatedcardiomyopathy after myocarditis.

Materials and methods

Animals and medication

Sixty -five 9-week-old male Lewi s rats (Charles River JapanInc ., Kanagawa, Japan) were immunized with pig cardiacmyosin according to the procedure described previously [4­6]. The morbidity of experimental autoimmune myocarditiswas 100% in the immunized rats when using this protocol [4­6]. The age-matched normal control group (N) was compri sedof ten norma l Lewis rats.

Rats of the myosin-immunized group became ill and im­mobile on day 14, but their acti vity gradually recovered be­ginning from the fourth week . Seventeen (26%) of the 65myosin-immunized rats died between day 19 and 28. Twenty­eight days after immunization, the 48 remaining rats weredivided into four groups for oral administration of quinapril,0.2 mg/kg (QO.2, n = 11),2 mg/kg (Q2, n = 11) and 20 mgtkg (Q20, n =11) or vehicle (0.5% methylcellulose, V, n =15)for 1 month once a day.

Throughout the studies, all animals were treated in accord­ance with the guidelines for animal experimentation of ourinstitute.

Hemodynamic study

Rats were anesthetized with 2% halo thane in 0 2during thesurgical procedures to measure the hemodynamic parameters,and then the concentration was reduced to 0.5% to minimizehemodynamic effects of halothane. Mean arterial blood pres­sure (mean BP), central venou s pressure (CVP), peak leftventricular pressure (LVP), left ventricular end-diastolic pres­sure (LVEDP) and the first derivatives of LVP (±dP/dt) wererecorded as described previously [6].

Heart weight and histopathology

After measurement of the hemodynamic parameters, the heartwas removed and cleaned of the surrounding tissue s. Theheart weight (HW) was measured and the ratio of HW to bodyweight (H/B (g/kg)) was calculated. The removed hearts werecut into 2 mm transverse slices and fixed in 10% formalin forhistological examination. The preparations were stained withhematoxylin-eosin and Azan-Mallory. Using Azan-Mallorystained preparation, the area of myocardial fibrosis was quan­tified and the results were presented as the ratio of the fibroticarea to the area of myocardium [6].

Ribonuclease (RNase) protection assay

Apical left ventricles from N, V and Q20 were quickly ex­cised, frozen in liquid nitrogen, and stored at -80°C. TotalRNA was extracted from the tissues by the acid guanidinium­isothiocyanate-phenol-chloroform method.

The RNase protection assay for quantification of TGF-~ 1,collagen-III and fibronectin mRNA levels was performedaccording to the methods described previously [18, 19]. Re­sults for each mRNA were normalized to those for GAP DHmRNA in each sample.

Statistical analysis

Data are presented as the means ± S.E.M. Statistical asse ss­men t of the gro ups was performed by one-way ANOVA,followed by Tukey's method. Differences were consideredsignificant at p < 0.05.

79

Results Myocardial mRNA expression of TGF-f31, collagen-Ill andfi bronectin

Clinical course

Four of 15 (27%) rats in V and two of 11 (18%) in QO.2 diedbetween day 30 and 56. None of the animals in Q2, Q20 orN died. Although pericardial effusion was observed in mostof the rats in V, little effusion was observed in QO.2, Q2 andQ20, and no effusion was detected in N.

As shown in Fig. 3, the left ventricular mRNA expression ofTGF-p1,collagen-III andfibronectin weremarkedly up-regu­lated in V (17.1 ± 6.2, 41.1 ± 5.5 and 4.50 ± 0.07) as com­pared to those in N (2.78 ± 0.01,7 .87 ± 0.64and not detected;all p < 0.01). Quinapril treatment (Q20) significantly sup­pressed the increase in expression of TGF-p 1 mRNA (9.00± 2.40, p < 0.05), while it also reduced collagen-Ill andfibronectin mRNA expression albeit to a lesser extent (34.6± 5.0, NS; and 3.17 ± 0.69, NS).

Body and heart weights

150

~ooE5c,ellc~

~ 50

0

8 -8

a a86 -2 0

0~ ~x xU UQl Ql~ ~

:F4 -4 C>:c

E E5 515 15C::2 -6 c::"0 "9+

0 -8

500 5

4004

'2 -a 3! 300 :c"' EOJ 5 2Ql

e 200o,>c:: o:c

1000

0 -1

150 20

.. 15

100 '11 " II' 0>-a J::c EE E

5 Q:loCl

o, LJJ> >...J 50 ..J

5

0 0

Hemodynamic parameters

Hemodynamic parameters were measuredrandomly selectedrats (8 rats in N and V, and 7 rats in QO.2, Q2 and Q20). Asshown in Fig. 1, the CVP was lower in N and Q20 than in V,QO.2 and Q2. Mean BP and LVPwere lower in V, QO.2, Q2and Q20 than in N. LVEDPwas higher and ± dP/dt was lowerinV (14.1 ± 2.0mmHg and +2409± 150/-2318 ±235 mmHg/sec) than in N (5.0 ± 0.6 mmHg and +6173 ± 191/-7120 ± 74mmHg/sec; all p < 0.01 ). After quinapril treatment, LVEDPwas decreased and ±dP/dt was increased in a dose-depend­ent manner (l 0.8 ± 1.8 mmHg and +3211± 307/-2928 ± 390mmHg/sec in QO.2, 9.4 ± 1.5 mmHg and +2871 ± 270/-2966± 366 mmHg/sec in Q2, and 6.6 ± 1.5 mmHg and +3569 ±169/-3960 ± 203 mmHg/sec in Q20).

Although the body weight in Q20 was small, it did not differamong other three groups with heart failure. The HW and H/B weresignificantly largerin V (1.28 ± 0.05g and 4.38 ± 0.22g/kg) than N (0.84 ± 0.03 g and 2.49 ± 0.04 g/kg; both p <0.01). After quinapril treatment, the HW and HIB were de­creased in a dose-dependent manner in QO.2 (1.21 ± 0.07 gand 4.04 ± 0.24 g/kg, NS), Q2 (1.09 ± 0.07 g and 3.81± 0.22g/kg, NS) and Q20 (0.87± 0.02 g and 2.95 ± 0.08 g/kg; bothp < 0.01 vs. V).

Quantitative analysis of myocardial f ibrosisc:::::J Group-N_ Group-V

~ Group-QO.2

~ Group-Q2 ' P<0.05 V5 . Group-V~ Group-Q20 ' : P<0.01 V5 . Group-V

• P<0.01 V5 . Group-N

Figure 2 shows representative photographs of thin sectionsstained with hematoxylin-eosin and Azan-Mallory, The nor­mal heart showed no fibrosi s (3 ± 1%). Among the fourgroups with heart failure, the area of myocardial fibrosis wasthe lowest in Q20 (32 ± 4% in V, 22 ± 4% in QO.2, 13 ± 3%in Q2, and 6 ± I% in Q20; p < 0.01, Q2 and Q20 vs. V).

Fig. I . Effects of quinapril on hemodynamic parameters. Although heartrate (HR), central venous pressure (CVP), mean blood pressure (mean BP)andpeak left ventricularpressure (LVP)did notdifferamongthe four groupswith heart failure. left ventricular end-diastolic pressure (LVEDP) and ±dPIdt improved after quinapril treatment in a dose-dependent manner. LVEDPand ±dP/dt in Q20 were significantly improved relative to those in V (p <0.05 and 0.01).

80

a e

Fig. 2. The effects of quinapril on myocardia l fibrosis. Figures show representative data for each group. Upper panel : Azan-M allory staining. Lower panel :hematoxylin-eosin staining. a, N; b, V; c, QO.2; d, Q2; and e, Q20 . Scale bar is 5 mm.

Discussion

In the present study, using a rat model of dilated cardiomy­opathy induced by autoimmune myocarditis, we examinedthe effects of the ACE inhibitor quinapril on survival rate,progression of heart failure and myocardial fibrosis . Wefound that quinapril treatment decreased mortality, heartweight, myocardial fibrosi s and mRNA expre ssion of TGF­~ I, and improved hemodynamic functions in rats with dilatedcardiomyopathy after myocarditi s.

A disproportionate accumulation of fibrillar collagen and

other components of the extracellular matri x are seen in theinterstitial space in cases with hypertrophy or dilation of theleft ventricle [20]. This interstitial remodeling probably playsan important role in the changes that occur in coronary bloodflow, the altered biochem istry of the myocardium, and thecompromised myocardial function in heart failure . Severallines of evidence suggest that angiotensin-II may be involvedin remodeling of the non-myocyte compartment of the heart :collagen synthesis of rat cardiac fibroblasts was found to beincreased by angiotensin-II in a concentration-dependentmanner, angiotensin-II also reduced collagenase activity in

1. TGF-~l 2. Collagen- ill 3. Fibronectin

A~

A~ A~ ~a

~ a~ a

B~

B~ B~

~ b ~b ~ b

N v 020 N V 020 N V 020

Fig. 3. Myocardial mRNA expression of transforming growth factor (TGF)-13 I , collagen-III and fibronectin. Although leve ls of expressio n of TGF-13 I, col­lagen-III and fibronectin mRNA were increased in V, they were suppressed after quinapril treatment. (A) Probe for target mRNA ; (B) Probe for glyceralde­hyde-3-phosphate dehydrogenase (GAPDH) mRNA; a, Protected band of target mRNA; b, Protected band of GAPDH mRNA .

fibroblast culture medium, and treatment with ACE inhibi­tors reversed and prevented myocardial accumulation of fi­brous tissue [21-23].

Treatment with quinapril, beginning from the late phaseof active inflammation, decreased heart weight and LVEDP,and increased ±dP/dt, without changing heart rate or leftventricular pressure. Remarkably, the area of fibrosis afterquinapril treatment was greatly reduced in a dose-dependentmanner from 32 to 22%, 13% or 6% of the myocardium.Recently, we reported that the p-adrenoceptor blocking agentcarvedilol improved cardiac function, fibrosis area and heartweight in this model [6]. Interestingly, these changes wereindependent of dose . The incidence of fibrosis was 31% inthe non-treated group, 12% in the carvedilol 2 mg/kg groupand 24% in the carvedilol 20 mglkg group. Therefore, it canbe concluded from these results that quinapril exerts moreprominent cardioprotective effects than carvedilol in the ratmodel of dilated cardiomyopathy.

Pathological cardiac remodeling, the process by which thenormal cardiac architecture is altered in response to myocar­dial damage induced by myocarditis, myocardial infarction,ischemia and cardiomyocyte loss, is characterized by hyper­trophic growth of cardiac myocytes, hyperplastic growth ofcardiac fibroblasts, and increased deposition of extracellu­lar matrix constituents [16]. Although regulation of cardiacfibroblast proliferation and collagen synthesis is thought tobe multifactorial in nature [24], circumstantial evidence in­dicates the involvement of the renin-angiotensin-aldosteronesystem and a crucial role of TGF-p 1 in cardiac fibrosis [25­29]. The amounts of extracellular matrix components are in­creased in the fibrotic areas and treatment with quinaprilrestores to normal myocardial deposition of collagen-III andother extracellular matrix components to normal levels in the

81

hypertrophied heart [28, 29]. As demonstrated in the presentstudy, levels of expression of TGF-p 1, collagen-III and fi­bronectin mRNA were markedly increased in the left ventri­cle of rats with dilated cardiomyopathy. Although levels ofmRNA expression of collagen-III and other extracellularmatrix components are generally elevated in early stages ofhypertrophy, these findings suggest that in end-stage preter­minal disease, when fibrosis is extensive, there may still besynthesis and turnover of collagen.

Treatment with quinapril significantly suppressed the in­crease in expression of TGF-p 1 mRNA in a dose-relatedmanner (Fig . 4). Quinapril also reduced the levels of colla­gen-III and fibronectin mRNA expression although lessprominently. These results suggested that the renin-angi­otensin-aldosterone system regulates the fibrotic responsein myocardial remodeling after extensive myocarditis, andthat the cardioprotective effects of ACE inhibitors may bepartly explained by suppression of the fibrotic responsethrough inhibition of mRNA expression of TGfi-]!1 and extra­cellular matrix components.These cardioprotective propertiesof quinapril may be valuable in preventing left ventricular dys­function in patients with myocardial infarction or dilatedcardiomyopathy.

Acknowledgements

This research was supported by grants from 'the Yujin Me­morial Grant', ' the Ministry of Education, Science, Sportsand Culture of Japan' and 'the Promotion and Mutual AidCorporation for Private Schools of Japan'.

References

Fig. 4. Myocardial transforming growth factor (TGF)-~1 mRNA expres­sion . TGF-~1 mRNA expression was decreased dose-dependently withquinapril treatment.

TGF-fH ..probe

GAPDH ..prob e

N V 0.2 2 20

.... TGF-131mRNA

.... GAPDHmRNA

I. Taliercio CPoSeward JB, Driscoll DJ, Fisher LD, Gersh BJ, Tajik AJ:Idiopathic dilated cardiomyopathy in the young : clinical profile andnatural history. J Am Coli Cardiol6: 1126-1131 , 1985

2. Dec GW, Palacios IF, Fallon JT, Aretz HT, Mills J, Lee DC, JohnsonRA: Acute myocarditis in the spectrum of acute dilated cardiomyopa­thies: Clinical features, histoligic correlates, and clinical outcome . NEng J Med 312: 885-890, 1985

3. DavidoffR, Palacios I, Southern J, Fallon JT, Newell J, Dec GW: Giantcell vs. lymphocytic myocarditis: A comparison of their clinical fea­tures and long-term outcomes. Circulation 83: 953-961 , 1991

4. Kodama M, Matsumoto Y, Fujiwara M, Masani F, Izumi T, Shibata A:A novel experimental model of giant cell myocarditis induced in ratsby immunization with cardiac myosin fraction. Clin Immunollmmuno­pathol57: 250-262, 1990

5. Kodama M, Hanawa H, Saeki M, Hosono H, Inomata T, Suzuki K,Shibata A: Rat dilated cardiomyopathy after autoimmune giant cellmyocardi tis. Circ Res 75: 278-284,1994

6. Watanabe K, Ohta Y, Nakazawa M, Higuchi H, Hasegawa G, Naito M,Fuse K, Ito M, Hirano S, Tanabe N, Hanawa H, Kato K, Kodama M,Aizawa Y: Low dose carvedilol inhibits progression of heart failure inrats with dilated cardiomyopathy. Br J Phannacol 130: 1489-1495,2000

82

7. CONSENSUS trial study group . Effects of enalapril on mortality insevere congestive heart failure : Results of the Cooperative NorthScandinavian Enalapril Survival Study (CONSENSUS). N Engl J Med316: 1429-1435,1987

8. Cohn IN, Johnson G, Ziesche S, Cobb F, Francis G, Tristan i F, SmithR, Dunkman WB, Loeb H, Wong M: A comparison of enarapril withhydralazine-isosorbide dinitrate in the treatment of congestive heartfailure . N Engl J Med 324: 303-310,1991

9. SOLVD investigators . Effects of enalapril on survival in patients withreduced left ventricular ejection fractions and congestive heart failure .N Engl J Med 325: 293-302,1991

10. Weinberg EO, Schoen FJ, George D, Kagaya Y, Douglas PS, LitwinSE, Schunkert H, Benedict CR, Lorell BH: Angiotensin-convertingenzyme inhibition prolongs survival and modifies the transition to heartfailure in rats with pressure overload hypertrophy due to ascendingaortic stenosis . Circulation 90: 1410-1422, 1994

II . Litwin SE, Katz SE, Weinberg EO, Lorell BH, Aurigemma GP, Doug­las PS: Serial echocardiographic-Doppler assessment of left ventricu­lar geometry and function in rats with pressure-overload hypertrophy.Chronic angiotensin-converting enzyme inhibition attenuates the tran­sition to heart failure . Circulation 91: 2642-2654, 1995

12. Lonn EM, Yusuf S, Jha P, Montague TJ, Teo KK, Benedict CR, Pitt B:Emerging role of angiotensin-converting enzyme inhibitors in cardiacand vascular protection. Circulation 90: 2056-2069, 1994

13. Linz W, Wiemer G, Gohlke P, Unger T, Scholkens BA: Contributionsof kinins to the cardiovascular actions of angiotensin-converting en­zyme inhibitors . Pharmacol Rev 47: 25-49,1995

14. Weber KT, Brilla CG: Pathological hypertrophy and cardiac intersti­tium. Fibrosis and renin-angiotensin-aldosterone system. Circulation83: 1849-1865, 1991

15. Swynghedauw B: Molecular mechanisms of myocardial remodeling.Physiol Rev 79: 215-262,1999

16. Powell JS, Clozel JP, Muller RK, Kuhn H, Hefti F, Hosang M, Baum­gartner HR: Inhibitors of angiotensin-converting enzyme preventmyointimal proliferation after vascular injury. Science 245: 186-188,1989

17. Schelling P, Fisher H, Ganten D: Angiotensin and cell growth : A linkto cardiovascular hypertrophy? J Hypertens 9: 3-15,1991

18. Yamamoto T, Feng L, Mizuno T, Hirose S, Kawasaki K, Yaoita E,

Kihara I, Wilson CB: Expression of mRNA for natriuretic peptide re­ceptorsubtypes in bovine kidney. Am J Physiol267: F318-F324, 1994

19. Ohta Y, Watanabe K, Nakazawa M, Yamamoto T, Ma M, Fuse K, ItoM, Hirono S, Tanabe T, Hanawa H, Kato K, Kodama M, Aizawa Y:Carvedilol enhances atrial and brain natriuretic peptide mRNA expres­sion and release in rat heart. J Cardiovasc PharmacoI36(suppI2): S19­S23,2000

20. Weber KT. Cardiac interstitium in health and disease : the fibrillar col­lagen network . J Am Coli Cardiol13 : 1637-1652, 1989

21. Brilla CG,Janicki JS, Weber KT: Cardioreparative effects of lisinoprilin rats with genetic hypertension and left ventricular hypertrophy.Circulation 83: 1771-1779, 1991

22. Brilla CG, Zhou G, Matsubara L, Weber KT: Collagen metabolism incultured adult cardiac fibroblasts : Response to angiotensin and aldos­terone . J Mol Cell Cardiol 26: 809-820, 1994

23. Pahor M, Bernabei R, Sgadari A, Gambassi G, Lo Giudice P, PacificiL, Ramacci MT, Lagrasta C, Olivetti G,Carbonin P: Enarapril preventscardiac fibrosis and arrhythmias in hypertensive rats. Hypertension 18:148-157,1991

24. Booz GW, Baker KM: Molecular signaling mechanism controllinggrowth and funct ion of cardiac fibroblasts. Cardiovasc Res 30: 537­543, 1995

25. Boluyt MO, O'Neill L, Meredith AL, Bing OH, Brooks WW, ConradCH, Crow MT, Lakatta EG: Alterations in cardiac gene expression dur­ing the genes encoding extracellular matrix components. Circ Res 75:23-32, 1994

26. Border WA, Noble NA: Transforming growth factor beta in tissue fi­brosis . N Engl J Med 331: 1286-1292, 1994

27. Takahashi N, Calderone A, Izzo NJ, Maki TM, Marsh JD, Colucci WS:Hypertrophic stimuli induce transforming growth factor-beta I expres­sion in rats ventricular myocytes . J Clin Invest 94: 1470-1476, 1994

28. Crawford DC, Chobanian AV, Brecher P:Angiotensin II induces fibron­ectin expression associated with cardiac fibrosis in the rat. Circ Res74: 727-739, 1994

29. Panizo A, Pardo J, Hernandez M, Galindo MF, Cenarruzabeitia E, DiezJ: Quinapril decreases myocardial accumulation of extracellular ma­trix components in spontaneously hypertensive rats . Am J Hypertens8: 815-822, 1995

Molecular and Cellular Biochemistry 251: 83-88, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Calpain-l-dependent degradation of troponin Imutants found in familial hypertrophiccardiomyopathy

Judit Barta,' Attila T6th,1 Komelia Jaquet,' Alexander Redlich,"Istvan Edes1 and Zoltan Pappi'Department of Cardiology, University ofDebrecen, MHSC, Debrecen, Hungary; 2Institut fur Physiologische Chemie ,Ruhr-Universitdt Bochum, Germany

Abstract

The mechanism by which mutations of the cardiac troponin I (cTnl) gene evoke familial hypertrophic cardiomyopathy (fHCM)is unknown. In this investigation the potential effects of three fHCM-related cTnl mutations on Calpain-J-induced cTnl deg­radation were tested , and a study was made of whether additional conformational changes due to troponin complex formationand protein kinase A-induced phosphorylation affect the intensity of cTnl proteolysis. Purified recombinant wild-type cTnland three of its fHCM-related missense mutants (R145G, G203S and K206Q), alone or in the troponin complex (i.e. togetherwith troponin C and troponin T) , in the non-phosphorylated or protein kinase A-bisphosphorylated forms were proteolyzed invitro in the presence of Calpain-I (0.05-2.5 U) at 30°C. Following incubation with Calpain-I for 0.5, 30, 60 or 120 min, theextent of protein degradation was evaluated through the use of Western immunoblotting and densitometry. The results indi­cated that both the wild-type and the mutant cTnl molecules were susceptible to Calpain-l. However, the degradation of thecTnl molecules in the troponin complex was less intense than that of the non-complexed forms. Moreover, phosphorylation byprotein kinase A conferred effective protection against cTnl proteolysis. The data suggested that mutations in the central in­hibitory domain (RI45G) and in the C-terminal region (G203S and K206Q) of cTnl do not affect its Calpain-l-mediated deg­radation, or the phosphorylation-induced protection against proteolysis. (Mol Cell Biochem 251 : 83-88, 2003)

Key words : hypertrophic cardiomyopathy, calpain, troponin I, mutation

Introduction

Familial hypertrophic cardiomyopathy (fHCM) is character­ized by ventricular hypertrophy, myofibrillar disarray, fibrosisand is often linked to a high incidence of sudden cardiacdeath. More than 100 point mutations in 9 genes, all codingthin and thick filament sarcomeric proteins, have been linkedto the disease. Numerous mutations of the cardiac troponin I(cTnl)-encoding gene also evoke fHCM [1]. Different regionsof this polypeptide, made up of 210 amino acid residues,interact with actin, troponin C and tropomyosin during thecardiac cycle [2]. Motivated by the wealth of info rmationpointing to the central position of cTnl in the regulation ofthe contractile process [2, 3], intensive research has been

conducted in an effort to understand the consequences of cTnlgene mutations on the myocardial mechanics [4-6] . In fact,most of the studies initiated on the basis of this functionalconcept revealed that the Ca 2+-sensitivity of force produc­tion and of myosin ATPase activity were increased in cer­tain preparations involving the fHCM-related cTnl mutants[4-7]. It is noteworthy, however, that the mutations affectstructurally and functionally distinct regions of cTnl that donot uniformly modulate the forces of contraction, the troponinC binding and the myosin ATPase activity [5, 7]. Conversely,hypertrophies with similar cardiac morphologies result frompoint mutations of remote regions of the cTnl molecule. Forexample, the Rl45G mutation, which alters the structure ofthe central inhibitory domain, and the K206Q mutation in the

Addressfor offprints:Z. Papp,Department of Cardiology, University of Debrecen, Medical and HealthScienceCenter, P.O. Box I, H-4004Debrecen, Hungary(E-mail: pappz@jaguar.dote.hu)

84

C-terminal dista l region both induce the ventricular type ofhypertrophy. Surprisingly, another mutation in the distal re­gion (G203S) is associated with the apical type of hypertro­phy [1]. Thus, the mutations in different cTnI regions andtheir functional consequences on the myofibrillar mechan­ics do not provide a full explanation of the morphology andclinical characteristics of fHCM.

Experiments on rat hearts indicated that proteolytic cTnIdegradation is involved in the pathogenesis of reversiblepostischemic myocardial dysfunction, i.e. myocardial stun­ning [8, 9]. Calpain-l (also called u-Calpain), a member ofthe Ca2+-dependent cysteine-protease family, decreases theCa-t-activated force in demembranated cardiac myocytes[10], and proteolyzes a number of myofibrillar proteins, in­cluding cTnI, in vitro [11]. There is strong indirect evidencein support of the hypothesis that Calpain-I is responsible forthe clipping of 17 amino acids from the C-terminus of cTnI[8, 9] during myocardial ischemia/reperfusion. Experimentswith transgenic mice that expressed the truncated cTnI mol­ecule (cTnI

I_

193) established a strong link between cTnI

degradation and a compromised cardiac function [12] . Un­fortunately, the physiological role and the regulation of theCalpains remain enigmatic in the myocardium. However, itis known, that the Calpains are involved in muscle growthand differentiation [13]. Furthermore, it has been firmly es­tablished that mutations of the Calpain-3 gene leads to oneform of limb girdle muscular dystrophy (LGMD2A) [14].Based on these data it has been hypothesized that an alteredsusceptibility of the different mutant cTnI molecules (R145G,G203S, K206Q) to Calpain-I induced proteolysis is respon­sible for the changes in contractile function and/or morpho­logical characteristics of fHCM. To test this hypothesis, wedecided to investigate the Calpain-I sensitivities of re­combinant wild-type (WT) and 3 fHCM-related cTnI mutants(R145G, G203S and K206Q), and to evaluate the influenceof conditions that may potentially prevent proteolysis in thehuman myocardium.

Materials and methods

Expression and purification ofhuman cardiac troponinmolecules

Human cardiac troponin molecules: cTnI (WT,R1450, G203Sand K206Q), cardiac troponin T (cTnT) and cardiac tropon inC (cTnC) were obtained as described previous ly [15,16]. Theexpression and purification procedures for cTnI were brieflyas follows: Escherichia coli BL21 (DE3) was transformed bya pET3c vector containing the corresponding cDNA of cTnI.To create the cTnI mutants, the following oligonucleotideswere used, R145G: 5'-CGG CCC ACC CTG GGG AGA GTGAGG-3' and 5'-CCT CAC TCTCCCCAG GGT GGG CCG-

3'; G203S: 5'-AGT GGAATG GAG AGC CGC AAG AAAAAG-3' and 5' -CTT TTT CTT GCG GCT CTC CAT TCCACT-3'; K206Q: 5' -GAG GGC CGC AAG CAAAAG TTTGAG AGC-3' and 5' -GCT CTC AAA CTT TTG CTT GCGGCC CTC-3'. The mutations atcodons 145,203 and 206 weregenerated by using the QuickChange site-directed mutagen­esis kit (Stratagene) . WT and mutant proteins were over­expressed in E. coli and purified by using CM-Sepharose fastflow (Pharmacia) and affinity chromatography. The massesof all recombinant proteins were determined by electrosprayionization mass spectrometry [17], and purities were checkedby SDS-PAGE [15% homogenous polyacrylamide] . cTnIproteins not used for reconstitution were stored at -20DC ina solution (pH 7.0) containing (in mM) MOPS 10, KCl 300,DTT 1.5, glycerol 60%.

Reconstitution ofhuman cardiac troponin complexes

Human heterotrimeric troponin complexes (cTn) were recon­stituted by mixing cTnT, cTnC and either WT or mutant cTnI(R1450, G203S and K206Q) at a molar ratio of 1:1:1 in abuffer containing 6 M urea [IS] . This was followed by dialy­sis against high salt buffer with decreasing concentrations ofurea, and the salt content of the protein was then reducedstepwise. Reconstitution of the cTn complex was checked byanalytical gel filtration (Pharmacia Sephadex G-75) . If nec­essary, uncomplexed subuni ts were separated from the cTncomplex by using gel filtration.

Phosphorylation ofcTnI

WT and mutant cTnI molecules were bisphosphorylated atSer-22 and Ser-23, using the catalytic subunit of protein ki­nase A as described previously [15]. Isolated cTnI subunitswere phosphorylated by using 80 mU protein kinase NmgcTnI. For the phosphorylation of WT cTnI and the G203Smutan t cTnI in the cTn complex, 160 mU/mg protein wasused ; for the complexes that contained the R 145G and theK206Q cTnI mutants, 120 mU/mg protein was used. Thisprocedure resulted in comparable phosphorylation degree sfor all the different cTnI molecules. The phosphorylationstates of cTnI were routinely controlled by isoelectric focus­ing . Only those proteins were used that contained no de­phosphorylated form s and contained less or equal than10% monophosphorylated and more or equal than 90 %bisphosphorylated forms.

In vitro proteolysis with Calpain-I

Purified human non-phosphorylated and protein kinase A­bisphosphorylated cTnI molecules (3 ug of the isolated WT

85

Western immunoblot analysis and evaluation ofcTnIproteolysis

Fig. 1. Proteolysis of WT cTnI by Calpain-1. (A) Western immunoblotsillustrate the proteolysis ofWT cTnl (0.2 ug in each lane) by Calpain-I (0­2.5U) after 0.5 or 120 min of incubation. In a control experiment Ca2+ wasomitted from the reaction mixture, but IU Calpain-I was added ('control') .(B) Application of 0.3 mM Calpain Inhibitor I prevented the Calpain-l­mediated proteolysis of WT c'Tnl. Numbers above the lanes correspondto the immunoreactive bands of WT cTnl (I), WT cTnl in complex (2)and bisphosphorylated WT cTnl in complex (3) . Digestions and Westernanalyses were performed in triplicate.

Equivalent amounts of 0.2 ug of the isolated cTnI moleculesand 0.5 ug of the cTn complexes were run in 15% SDS-poly­acrylamide gel and transferred to nitrocellulose membranesby means of a wet transfer apparatus (Bio-Rad). Membraneswere blocked in 5% non-fat dry milk, followed by incuba­tion with primary antibody (mouse anti-human cTnI , cloneC5 from Research Diagnostics Inc.; dilution I :2000) and withperoxidase-conjugated secondary antibody (from SIGMA;dilution I :5000). Enhanced chemiluminescence was used forthe detection of cTnI. Band intensities were quantified from

and R145G, G203S and K206Q mutants; 10 ug of the cTncomplexes with the above cTnI molecules) were incubatedat 30°C in volumes of 100 III containing (in mM): KCI 30,imidazole 15, NaCI5, MgC1

21, EGTA I, EDTA I, DTT 0.5

and CaCI2

5, at pH 7.5. Proteolysis was initiated by addingof 0.05,0.1,0.5, 1,2.5 U Calpain-I (Calbiochern) to the re­action mixtures . After incubation for 0.5,30,60 or 120 min,23 III aliquots were collected and boiled in SDS sample bufferfor 5 min. Incubations in the presence of 0.3 mM CalpainInhibitor I (Calbiochem) or in the absence of Ca2+ served ascontrols (Fig. I).

Results

Figure IA illustrates the degradation of WT cTnI as a func­tion of Calpain-I activity and time . The disappearance of theprotein band probed with anti-TnI antibody in immunoblotsat 31 kDa (native cTnI) indicated cTnI specific protein deg­radation. Additionally, the applied monoclonal antibody id­entified a cTnI degradation product at 26 kDa. At lowCalpain-I activities (0.05 and 0.1 U), relatively long incuba­tion (120 min) was required to provoke appreciable cTnIdegradation. High Calpain-I activities (0.5, I and 2.5 U), how­ever, accelerated cTnI proteolysis. In the presence of highCalpain-I activities, the cTnI specific bands had disappearedcompletely after 120 min of incubation, indicating that na­tive cTnI and its visible breakdown product were degradedinto fragments smaller than 26 kDa. cTnI truncation could beprevented either by omitting Ca2+ from the reaction mixtures('control', Fig . IA) or by the inclusion of 0.3 mM Calpain­specific inhibitor (Calpain Inhibitor I) (Fig. IB) . CalpainInhibitor I prevented the proteolysis (in the presence of I UCalpain-I and Ca2+) of all the cTnI molecules tested (see Fig .IB for examples). Hence, the detected degradations in cTnImust be specific to Calpain-I and there were no contaminat­ing proteases present in our reaction mixtures.

Figure 2 demonstrates the time courses of Calpain-l-in­duced proteolyses (I U Calpain-I) for the different cTnI mol­ecules (WT cTnI and fHCM-related cTnI mutants). The upperand lower panels show the results of Western immunoblotsfollowing test incubation for 0.5, 30, 60 or 120 min with iso­lated cTnI molecules or the cTnI molecules in the troponincomplex, respectively. Moreover, both panels present proteindigestion results on the bisphosphorylated cTnI forms. Therapid disappearance of the 31 kDa cTnI specific band of thedephosphorylated samples (isolated or complexed WT andR145G, G203S and K206Q mutant cTnI molecules) demon­strates that fHCM-related mutations do not prevent Calpain­l-induced proteolysis. The faint bands at 26 kDa (seenoccasionally for all the different dephosphorylated cTnI mol­ecules) suggested low levels of the cTnI degradation product.The appearance of this degradation product was, however,not associated with a specific cTnI sequence. The cTnI spe­cific bands of the bisphosphorylated forms at 31 kDa werepartially preserved during the entire course of Calpain-I in­cubation under identical experimental conditions. Thus , phos-

unsaturated recordings by densitometry, using custom-pre­pared software. Protein degradation was expressed as therelative decrease in intensity of the 31 kDa cTnI specificprotein band. Calculated values are expressed as means ±S.E.M. from at least 4 independent digestions. Differenceswere tested by means of Student's t-test at a level of signifi­cance p < 0.05.

- 31 kDa

- 26kDa

_ - 31kDa

- 26 kDa

., - 31kDa

26 kDa

o 0.05 0.1 0.5 1 2.5 control-------~--

0.5 min

120 min

120 min

Calpain-1 (U):

A

B

86

eTnl Oephosphorylated Bisphosphorylated

0.5' 30' 60' 120' 0.5' 30' 60' 120'

WT_...

- 31 kOa

- 26 kOa

R14SG ~ -.---G2035 - . -- - --K206Q

AWT

0.5' 30'

..eTnl

eTnl in complex

R145G

0.5' 30'

_ 31kO•

_ 26 kO.

- 31 kO.

- 26 kO.

Fig. 2. Digestion of various cTnI forms alone or in a complex with TnCand TnT by Calpain-I . Different mutants ofc TnI (WT, R145G. G203S andK206Q) were subjected to Calpain-I digestion ( I U). The reactions wereterminated at 0.5,30,60. 120 min. respectively. Both dephosphorylated (leftpanels) and bisphorphoryl ated (right panels) cTnls were used alone (upperpanels). and in complex with TnC and TnT (lower panels) in the experi­ments, Three to seven independent digestions were performed with similarresults,

phorylation at Ser-22 and Ser-23 opposed the proteolyticeffect of 1 U Calpain-I for the WT and mutant cTnI mol­ecules, Protein phosphorylation provided qualitatively similarprotection against Calpain-l-induced proteolysis for isolatedcTnI molecules and for the cTnI molecules in the troponincomplex.

To assess whether there are differences in the susceptibil­ity of the various cTnI molecules (isolated WT and mutant cTnlmolecules alone or in the troponin complex) for Calpain-I, thetest incubations were performed in the presence of a reducedCalpain-I activity (0.25 U), This did not eliminate cTnI im­munoreactivity following 30 min of Calpain-I proteolysis, andhence allowed an assessment of the amount of undegradedcTnI proteins (Fig. 3A) at this time point. The susceptibili­ties of the various cTnI form s to degradation were estimatedon the basis of the changes in the densitometric intensitiesof the 31 kDa cTnI band between 0.5 and 30 min of incuba­tion with Calpain-l . The result s depicted in Figure 3B illus­trate that 0.25 U Calpain-I decreased the amounts of isolatedWT, R145G, G203S and K206Q mutant cTnI molecules to22 ± 9, 27 ± 10, 25 ± 7 and 45 ± 6%, respectively. In con­trast, the amounts of cTnI in the complexed WT, R 1450,

Oephosph orylatod BI. pho sphory lated

0.5' 30' 60' 120' 0.5' 30' 60' 120'_ _ _ . _ 31kOa

_ 26k OaI O cTnl

'0' 100 l 0 cTnllncomplexEr:::o.­IV"0~OlQ)"0r:::2ea.

B

0203S and K206Q mutant cTnI molecules were significantly(p < 0.05) higher (87 ± 13, 89 ± 8, 75 ± 5 and 82 ± 10%,respectively) after 30 min of Calpain-I proteolysis. However,no significant differences in the relative protein amount s wereobserved when the different cTnI molecules were comparedwith each other in the two groups (p > 0.05). Thu s, the cTnIgene mutations did not modify the susceptibility to Calpain­1 proteolysis .

Discussion

Fig. 3. Comparison of Calpain-I mediated degrad ation of various cTnImutants. (A) Calpain-I (0.25 U) proteolyses of dephosphorylated (top) andcomplexed (bottom) WT and Rl45G mutant cTnI molecul es. (B) The ex­tent of protein degradation was expressed as the average of the reductionin densitometric intensity of the 31 kDa cTnI specific band (full-length form)following 30 min of proteolysis (± S.E.M.) from 4-10 independent experi­ments.

The accumulation of muscle mass is a consequence of a dis­turbed balance between protein synthesis and protein degra­dation. The Calpains have been implicated in the turnover ofmuscle proteins [13]. Hence, we decided to establi sh whetherthere is a relationship between Calpain-l-rnediated prote­olysis and specific mutations of cTnI that cosegregate withfHCM .The effects of conformational changes due to troponin

--

----G203 S

K206Q

R14SG

WT

eTnl in complex

complex formation and protein kinase A-mediated phospho­rylation on the proteolysis intensity were also tested.

Most of our knowledge on cTnI breakdown originates fromexperiments on ischemic/reperfused hearts of roden ts. It wasearlier recognized that cTnI degradation occurs in severalsteps in the postischemic myocardium of the rat [9]. Follow­ing the initial loss of a 17 amino acid long peptide from theC-terminus, subsequent proteolytic steps truncate the N-ter­minus by 62, and then by an additional 10 residues .The corre­spondence between the molecular masses of the cTnI specificbands demonstrated in this study and others (ischemic/re­perfused rat hearts [8, 9], and cardiac biopsies of individu­als undergoing coronary artery bypass surgery [12]) suggeststhat our antibody identifies the first cTnI degradation prod­uct (cTnII_193

) . Further, this finding extends earlier observationson rat hearts [8] to human WT and mutant cTnI molecules andsupports the theory of Calpain-l -induced cTnI degradationin the pathogenesis of postischemic stunning. The completeloss of cTnI immunoreactivity following intensive Calpain­1 digestion indicates that Calpain-l may be responsible for atleast two subsequent truncation steps, and that the epitope ofour antibody is located within the N-terminal fragment of cTnI.

It is currently not known how mutations in functionallydifferent regions of cTnI (i.e. at the C-terminus (G203S andK206Q) and in the central inhibitory domain (RI45G)) in­duce fHCM . The G203S mutation evokes the apical type ofhypertrophy, characterized by a spade-shaped left ventr icle.In contrast, K206Q and R145G were detected in the morefrequent ventricular type of hypertrophy. Expression of thetruncated cTnI (cTnI

1_

19) molecule in transgenic mice pro­

voked cardiac enlargement [12]. However, histo logical andbiochemical markers of the remodeled ventricles in this trans­genic line were not consistent with those found in anothertransgen ic line expressing the mutation equivalent to theR l45G mutation of fHCM (R146G in the mouse sequence)[4] or ventricular hypertrophy in humans . Thus, cTnI

1_193

isprobably not involved in fHCM. Alternatively, a decrease inthe breakdown of mutant cTnI molecules may theoreticallycontribute to the increase in muscle mass during fHCM. Theresults of this study, however, show that none of the muta­tions prevented Calpain- l digestion. In line with previousobservations [11], we found that Calpain- J-mediated prote ­olysis was generally less intensive when cTnI was assembledinto the troponin complex. However, we could not find sig­nificant differences in the proteolytic intensities when WTand mutant cTnI molecules were compared with each othereither in isolation or in the troponin complex. Hence , differ­ences in the Calpain-I sensitivities of the fHCM-related cTnImutations do not provide a plausible explanation for the de­velopment of either type of fHCM.

Intracellular protein kinase A phosphorylates two Ser res­idues (Ser-22 and Ser-23) close to the N-terminus of cTnIupon cardiac PI-receptor stimula tion. The cTnI conformation

87

that develops as a consequence [16] decreases the apparentCa't-sensitivity of force production [17], and thereby con­tributes to an enhanced relaxation during sympathetic acti­vation. Conversely, most of the cTnI mutations found infHCM increase the Ca' t-sensitivity of force production, andhence affect the relaxation adversely [4-6]. The results of arecent in vitro motility study demonstrated that the phospho­rylation-dependent regulatory properties of the R 145G mu­tant are largely compromised [15]. Although the combinedeffects of cTnI mutations and cTnI phosphorylation on themyofibrillar mechanics are not fully understood, there is agrowing consensus that an impairment of ventricular relaxa­tion may initia te the hypertrophic transformation of the myo­cardium during fHCM [3-6]. Previous studies on cardiacpreparations of the rat [9, 11] suggested that the phosphor­ylation of cTnI confers protection against Calpain-l-mediatedproteolysis. Here we provide evidence that cTnI mutations inthe central inhibitory domain (RI45G) and in the C-termi­nal region (G203S and K206Q) do not modulate phosphor­ylation-mediated protection against Calpain-I proteolysis.Additionally, we demonstrate that phosphorylated WT andmutant cTnI molecules are also protected against Calpain-lproteolysis in the troponin complex.

Conclusions

The R145G, G203S and K206Q mutations of cTnI did notaffect Calpain-t-induced cTnI degradation, nor its prote inkinase A-mediated prevention of Calpain-I proteolysis . Thus,protein phosphorylation may effectively influence the inten­sity of cTnI degradation in fHCM during ischemic attacks.Moreover, major differences in the Calpain-l-dependentdegradation of various cTnI mutants might not be probableunless there are differences in the phosphorylation levels ofthe cTnI mutants in the myocardium or in the functions ofintracellular Calpains during fHCM.

Acknowledgements

We thank Friedrich W. Herberg for providing the catalyticsubunit of protein kinase A, and Andrea Molnar, Zita Her­telendi and Nora Erdei for skilled technical assistance. Sup­ported by Hungarian Research Fund grant 6002- 1/01/ETT.

References

1. Kimura A, Harada H, Park IE , Nishi H, Satoh M, Takahashi M, HiroiS, Sasaoka T, Ohbuchi N, Nakamura T, Koyanagi T, Hwang TH, ChooJA, Chung KS, Hasegawa A, Nagai R, Okazaki 0, Nakamura H,Matsuzaki M, Sakamoto T, Toshima H, Koga Y, Imaizumi T, Sasazuki

88

T: Mutations in the cardiac troponin I gene associated with hypertrophiccardiomyopathy. Nat Genet 16: 379-382, 1997

2. Solaro RJ, Rarick HM: Troponin and tropomyosin : Proteins that switchon and tune in the activity of cardiac myofilaments. Circ Res 83: 471­480 , 1998

3. Solaro RJ: Troponin I, stunning , hypertrophy, and failure of the heart .CircRes84: 122-124, 1999

4. James J, Zhang Y, Osinska H, Sanbe A, Klevitsky R, Hewett TE,Robbins J:Transgenic modeling of a cardiac troponin I mutation linkedto familial hypertroph ic cardiomyopathy. Circ Res 87: 805-811,2000

5. Takahashi-Yanaga F, Morimoto S, Harada K, Minakami R, ShiraishiF, Ohta M, Lu QW, Sasaguri T, Ohtsuki I: Functional consequences ofthe mutations in human cardiac troponin [ gene found in familial hyper­trophic cardiomyopathy. J Mol Cell Cardiol33: 2095-2107,2001

6. Lang R, Gomes AV, Zhao J, Housmans PR, Miller T, Potter JD: Func­tional analysis of a troponin I (ArgI45Gly) mutation associated withfamilial hypertrophic cardiomyopathy. J BioIChern 277: 11670-11678,2002

7: Elliott K, Watkins H, Redwood CS: Altered regulatory properties ofhuman cardiac troponin I mutants that cause hypertrophic cardiomy­opathy. J BioI Chern 275: 22069-22074, 2000

8. Gao WD, Atar D, Liu Y, Perez NG, Murphy AM, Marban E: Role oftroponin I proteolysis in the pathogenesis of stunned myocardium. CircRes 80: 393-399,1997

9. McDonough JL, Arrell DK, Van Eyk JE: Troponin I degradation andcovalent complex formation accompanies myocardial ischemia/reperfusion injury. Circ Res 84: 9-20, 1999

10. Papp Z, van der Velden J, Stienen GJM: Calpa in-I induced alterationsin the cytoskeletal structure and impaired mechanical properties ofsingle myocytes ofrat heart . Cardiovasc Res 45: 981-993, 2000

II. Di Lisa F, De Tullio R, Salamino F, Barbato R, Melloni E, SiliprandiN, Schiaffino S, Pontremoli S: Specific degradation of troponin Tand [ by u-calpain and its modul ation by substrate phosphorylation.Biochem J 308: 57-61 ,1995

12. Murphy AM, Kogler H, Georgakopoulos D, McDonough JL, Kass DA,Van Eyk JE, Marban E: Transgenic mouse model of stunned myocar­dium. Science 287: 488--491, 2000

13. Goll DE, Thompson VF, Taylor RG, Christiansen JA : Role of thecalpain system in muscle growth . Biochimie 74: 225-237,1992

14. Richard I, Broux 0 , Allamand V, Fougerousse F, Chiannilkulchai N,Bourg N, Brenguier L, Devaud C, Pasturaud P, Roudaut C, Hillaire D,Passos-Bueno MR, Zatz M, Tischfield JA, Fardeau M, Jackson CE,Cohen D, Beckmann JS: Mutations in the proteolytic enzyme calpain3 cause limb-girdle muscular dystrophy type 2A. Cell 81: 27--40, 1995

IS. Deng Y, Schmidtmann A, Redlich A, Westerdorf B, Jaquet K, Thie­leczek R: Effects of phosphorylation and mutation RI45G on humancardiac troponin I function . Biochemistry 40 : 14593-14602,2001

16. Reiffert SU, Jaquet K, Heilmeyer LMG, Herberg FW: Stepwise subunitinteractionchanges by mono- and bisphosphorylation of cardiac troponinI. Biochemistry 37: 13516-13525,1998

17. Reiffert SU, Maytum R, Geeves M, Lohmann K, Greis T, Bliiggel M,Meyer HE, Heilmeyer LMG, Jaquet K: Characterization of the cardiacholotroponin complex reconstituted from native cardiac troponin T andrecombinant I and C. Eur J Biochem 261: 40--47, 1999

Molecular and Cellular Biochemistry 251: 89-95, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Gender mediated cardiac protection from adverseventricular remodeling is abolished by ovariectomy

Gregory L. Brower, Jason D. Gardner and Joseph S. JanickiDepartment ofAnatomy. Physiology and Pharmacology, Auburn University, Auburn, AL, USA

Abstract

Gender differences in the prevalence of cardiovascular disease have been observed both clinically and experimentally. Thesecardioprotective effects have frequently been attributed to female hormones, however, the underlying mechanisms responsi­ble for this cardioprotection are still poorly understood. Accordingly, this study sought to determine the contribution of ovar­ian hormones to the prevention of adverse ventricular remodeling and congestive heart failure in chronic volume overload (i.e.aortocaval fistula in intact or ovariectomized female rats) . Ovariectomized rats developed more extensive cardiac remodelingthan intact females at 21 weeks post-fistula, characterized by significantly greater left ventricular (LV) hypertrophy (167 vs.86%, respectively, p < 0.05) and a substantial increase in LV dilatation (71%, P < 0.05) relative to control. In contrast to theeccentric hypertrophy in ovariectomized females post-fistula, the hypertrophic response in the intact female hearts was essen­tially concentric. While neither fistula group suffered significant mortality, there was a marked increase in the lung weight ofovariectomized rats (87%, p < 0.05) consistent with the development of pulmonary edema. Overall, the extent of myocardialremodeling and decrease in LV function in the ovariectomized females was comparable to those changes reported for maleswith symptomatic heart failure, while intact females maintained chronic compensated ventricular function similar to that ofcontrols. The marked ventricular dilatation and symptoms of congestive heart failure seen at 21 weeks post-fistula in the ova­riectomized females clearly demonstrate the influence of circulating ovarian hormones on the pattern of myocardial remodelingresulting from a chronic volume overload. (Mol Cell Biochem 251: 89-95, 2003)

Key words: ventricular function , heart failure , hypertrophy, aortocaval fistula, estrogen

Introduction

Although, ventricular remodeling and function have beenextensively studied in chronic volume overload, studies todate have not assessed the contribution of ovarian hormonesto gender differences in ventricular remodeling. It was onlyrecently that we demonstrated the consistent, reproducibledevelopment of congestive heart failure (CHF) in male ratssubjected to an infrarenal aortocaval (AV) fistula [1,2]. Theserats developed extensive hypertrophy and marked ventricu­lar dilatation before succumbing to CHF. A subsequent studyclearly demonstrated gender differences in the pattern ofcardiac remodeling and incidence ofCHF and mortality sec­ondary to AV fistula induced chronic volume overload [3].While female hearts developed significant concentric hyper-

trophy, they had no impairment of cardiac function, minimalventricular dilatation and no change in myocardial compli­ance at 8 weeks post-fistula. While these results clearlydemonstrated significant gender-specific differences in theventricular remodeling induced post-fistula, this study didnot identify the underlying mechanism responsible for thecardioprotection in females . One theory which has been ad­vanced to explain the proportionally greater hypertrophyachieved by females in response to increased cardiac workis that the smaller initial size of the female heart allows for arelatively greater cumulative hypertrophy (hypertrophicreserve) than male rat hearts [4, 5] . Alternatively, studiesidentifying an increased risk of cardiovascular disease inpost-menopausal women suggest that gender-specific cardio­protection could be hormonally mediated [6]. Accordingly,

Addressforoffpr ints:G.L.Brower, DepartmentofAnatomy, Physiology andPharmacology, 106 GreeneHall,AuburnUniversity,Auburn, AL36849-5518, USA(E-mail: browegl@auburn.edu)

90

this study sought to determine the contribution of ovarianhormones to the prevention of adverse ventricular remodelingin the AV fistula model of CHE

Materials and methods

Studies were performed using 8 week old female SpragueDawley (Hsd:SD) rats weighing approximately 200 g at sur­gery. Rats were housed under standard environmental con­ditions and maintained on commercial rat chow and tap waterad libitum. All studies conformed to the princip les of the USNational Institutes of Health 'Guide for the Care and Use ofLaboratory Animals' (NIH Publication No. 85-23 , revised1996), and were approved by our Institution's Animal Careand Use Committee. Anesthesia for surgical procedures wasinduced with xylazine (7 mg/kg) and ketamine (62 mg/kg)administered by intraperitoneal injection. Post-operativeanalgesia was provided by buprenorphine HCl (0.025 mg/kg,subcutaneous) administered to the rats at the time of surgery.At the experimental endpoint, animals were anesthetized withsodium pentobarbital (50 mg/kg intraperitoneal) to evaluateventricular size and function .

Surgical procedures

Infrarenal aortocaval fistula was created in rats as previouslydescribed [1]. Briefly, a ventral abdominal laparotomy wasperformed to expose the aorta and caudal vena cava approxi­mately 1.5 em below the renal arteries . An 18-gauge needlewas inserted into the exposed ventral abdominal aorta andadvanced through the medial wall into the vena cava to cre­ate the fistula. The needle was withdrawn and the ventralaortic puncture site sealed with cyanoacrylate. Creation of asuccessful AV fistula was visually evident by the pulsatileflow of oxygenated blood into the vena cava. In the ovariec­tomy study group, the ovaries were isolated, the ovarian ped­icles ligated and the ovaries excised. Abdominal musculatureand skin incisions were closed by standard techniques withabsorbable suture and autoclips, respectively.

Experimental protocol

All rats were studied at 21 weeks following creation of theAV fistula, as this corresponds to a point post-fistula whenmost male rats have developed CHF or died . This also al­lowed us to determine if remodeling in intact females wouldbe progressive. Two groups of female fistula rats consistingof intact (FIST, n =5) and ovariectomized (FOX, n =6) ani­mals were compared with an age-matched control group con­sisting of sham-operated female rats (SHAM, n =5). At the

experimental endpoint, each rat was weighed, anesthetizedand fistula patency visually confirmed. Cardiac output wasmeasured using a doppler flow probe (Transonic Systems,Ithaca , NY, USA) . The heart was then removed and attachedto a perfusion apparatus for evaluation of ventricular func­tion (described below). After completion of the functionalstudies, the atria and great vessels were removed and the leftventricle (LV, including septum) and right ventricle (RV)were separated and weighed. Lung wet weight was measuredafter the esophagus and trachea were trimmed away and thepleural surface blotted dry.

Assessment of ventricular size and function

Left ventricular volume and function were evaluated ex vivousing a blood-perfused isolated heart preparation as previ­ously described [1]. Arterial blood from the carotid artery ofa support rat was pumped to a pressurized reservoir for ret­rograde perfusion of the experimental heart. The coronaryvenous effluent was collected and returned to the support ratthrough a jugular vein catheter in order to filter and oxygen­ate the blood supply to the isolated heart. The temperatureof the blood in the perfusion reservoir was maintained at 37± 1°Cand the environment around the isolated heart was keptconstant at 35 ± 2°C. Coronary perfusion pressure was main­tained between 100 and 110 mmHg .

Prior to extirpation of the heart from the anesthetized rat,the carotid arteries were ligated and a cannula was insertedinto the thorac ic aorta at a level just proximal to the first pairof intercostal arteries and secured with a silk ligature. Retro­grade perfusion of the coronary arteries with blood from theperfusion reservoir was begun as soon as the cannula wassecured. The heart was then quickly removed from the chestand attached to the apparatus. Intraventricular volumes andpressures were recorded using a latex balloon inserted throughthe mitral valve orifice into the LV. Once the heart developedstable isovolumetric contractions, the balloon volume thatproduced an.LVend diastolic pressure (EDP) of 0 mmHg (V0)was determined. Balloon volume was then increased in 5­20 ~l increments from this point until an LVEDP of25 mmHgwas attained. The end diastolic and peak isovolumetric pres­sures were recorded following each increase in balloon vol­ume.

Data and statistical analysis

Left ventricular volumes were adjusted to account for the vol­ume displaced by the balloon material in the LV lumen . Bal­loon volume was calculated from the weight of the balloondivided by the density of the latex (0.898 g/ml) . Pressure­volume curves generated for the balloons alone indicated that

their contribution to LVEDP was negligib le. Statistical analy­ses were performed using SYSTATsoftware (SPSS Inc., Chi­cago, IL, USA). Grouped data comparisons were made byone-way analysis of variance. When a significant F ratio (p< 0.05) was obtained, inter-group comparisons were madeusing a modi fied r-test and Bonferroni bounds. Stati sticalsignificance was taken to be p <0.05/k, where k is the numberof comparisons.

Results

Successful exc isio n of ovarian tissue was confirmed by asubstantial decrease in uterine weights in the ovariecto mizedrats (28.5% of sham-operated uterine weight, p < 0.05). Av­erage LV, RV, lung and body weights for the control and 21week fistula groups are presented in Table 1. As comparisonof hypertrophy indexed by body weigh t is of limited valuein the presence of edema, actual ventricular weights are pre­sented . Significant increases in LV weights occurred in boththe intact (FIST) and ovariectomized (FOX) fistula animalsrelative to the sham-operated controls (86 and 167% respec­tively, p < 0.05), howe ver, ovariectomized rats developedsubstantially more hypertrophy than the intact rats (44%, p< 0.05). Marked increa ses in RV weights were observed forintact and ovar iectomized rats post-fistu la (92 and 232 %abo ve controls respectively; p < 0.05), and sim ilar to theobservation for LV weight, ovariec tomized rats developedsignificantly more RV hypertrophy than intact rats (p < 0.05).To assess whether the hypertrophy post-fistula was appropri­ate, the LV mass to volume (MIV) ratio was determined atan LVEDP of 10 mmHg (i.e. the in vivo LVEDP in fema le

91

rats post-fistula [7]; Table 2). Whi le the LV MIV for the in­tact fistula group was significantly increased (p < 0.05), theovariectomized fistula group was not significantly diffe rentfrom sham-operated con trols.

Lung weights were not significantly increased in the in­tact female rats, but were substantially increased in the ova­riectomized rats post-fi stula (87% above control, p < 0.05 ).Animals with lung weights deviating more than 3 standarddeviations above control were considered to have conges tiveheart failure . Of the 5 FIST anima ls studied, only 1 (20%)had lung weights indicative of CHF as compared to four ofsix (67%) FOX animals.

The differe nces in diastolic function depicted in the plotof the average end dias tolic pressure-end diastolic volume(EDP-EDV) relationship for each group (Fig. 1) are summa­rized in Table 2. Both structural and functional properties ofthe myocardium contribute to the ventric ular dilatation seenpost-fi stula. The extent of LV structural remodeling prod uc­ing larger ventr icular chamber dimensions can be assessedby the differences in unstressed LV volume (Vo) ' Increasesin Vo cause a parallel rightward shift of the EDP-EDV re­lationship, provided that there is no change in myocardialcompliance. Therefore, the substantially larger V0 in theovariectomized fema les (7 1% larger than control, p < 0.05 )indicates marked structural remod eling in these animals. Incontrast, intact fema les had negligible changes in V0 post­fistula. Changes in the material properties of the myocardium(e.g. decreased stiffness) cause changes in compliance whichare indicative of functional dilatation (i.e. dependent on al­terations in the in vivo LVEDP). This functional componentof dilata tion was assessed as the volume required to increa seLVEDP from 0-25 mmHg (llV0- 25) ' Increased comp liance is

Table I . Comparison of control , fistula and ovari ectomized fistula heart, lung and body weigh ts at 21 weeks

Group LV weight (mg) RV weight (mg) Lung weight (mg) BW (g)

Sham (n '= 5) 617 ± 41 177 ± 29 1333 ± 136 259 ± 33Fistula (n '= 5) 1147 ± 215* 339 ± 84* 1529 ± 223 255 ± 30Ovariectomized fistula (n = 6) 1646 ± 273*' 588 ± 164*1 2497 ± 838*1 394 ± 26*1

Mean ± S.D. *p < 0.05 vs. Sham; 'p < 0.05 vs. Fistula. Abbrevia tions: LV - left ventricle ; RV - right ventricle; BW - Body weight.

Table 2. Comparison of diastolic and systolic parameters from isolated heart function

Group v, (~l) ~V0-25 (~ 1 ) Slope of Pm" -V LVMIV(mm Hg/ul ) (rng/ul)

Sham (n= 5) 290 ± 50 43.0 ± 12 1.33 ± 0.21 2. 1 ± 0.2Fistula (n = 5) 281 ±43 175± 91* 0.4 2 ± 0.11* 3.8 ± 0.8*Ovariectomized fistula (n = 5) 496 ± 87*1 392 ± 52*' 0.18 ± 0.03*' 2.8 ± 0.3

Mean ± S.E. Diastolic and systolic parameters from isolated heart functi on assessed 2 1 weeks post-fistula comp ared to age- matched sham-operated cont rols.LV mass-to-volume was assessed at an LVEDP of 10 mmHg. *p < 0.05 vs. Sham; "p < 0.05 vs. Fistula . Abbreviations: V0 - LV volume at an EDP of 0 mmHg; ~V0-2s- change in LV volume between EDPofO and 25 mm Hg; Pm,,- V - peak isovolumetric pressure-volume relationship; MIV -mass-to-volume ratio.

92

FOXFISTSHAMO..L-...J...----l-

Estrogen Replacement Study (HERS, [II D, have caused theAmerican Heart Association to recommend that hormonereplacement therapy not be initiated for the sole purpose ofprimary coronary heart disea se prevention [12] . We havepreviously reported gender differences in the patterns of car­diac remodeling, as well as the subsequent development ofCHF and mortalit y, indu ced secondary to chronic volumeoverlo ad due to an infrarenal AV fistula in rats [3]. While thisstudy demonstrated the ability of females to develop appro­priate concentric hypertrophy sufficient to maintain a stablecompensated state and prevent the development of CHF, itdid not identify the underlying mechani sm respon sible for thisgender-mediated cardioprotection. Accordingly, this studysought to determine the contribution of ovarian hormonesto the prevention of adverse ventricular remodeling in thismodel of congestive heart failure.

Although, ventricular remodeling and function have beenexten sively studied in chronic volume overload, it was onlyrecently that we demonstrated the consistent, reproducibledevelopment of CHF in male rats post fistula [2]. The AVfistula model produces a biventricular volume overload withnormal or slightly reduced blood pressure and no retrogradeblood flow. The compensatory mechanisms and resultingpattern of myocardial remodeling in male rats are very simi­lar to that described for humans with CHF, particularly thosewith valvular insufficienc y. The myo cardial remodeling inmale heart s is characteri zed by significant dil atation , in­creased ventricular compliance , and the con sistent develop­ment of CHF associated with significant mortality post-fistula[2]. In contrast, the heart s of intact female s developed sig­nificant concentric hypertrophy, had no impairment of cardiacfunction, minimal ventricular dilatation , normal myocardialcompliance, and minimal mort ality [3]. The results of thisstudy are consistent with these previous findings, in that theextent of cardiac remodeling seen at 21 weeks in the intactfemales was nearly identical to that previously reported at 8

'2 150

]E-=- 100~Q.-~o~ 50:eIIIo

Fig . 2. Cardiac output for intact fistula (FIST), ovariect omized fistula(FOX) and control (SHAM) rats 21weeks post-fistula. Both FIST and FOXanimals had significantly increased cardiac output as compared to controls(*p < 0.05).

1000

-o-SHAM--FIST---FOX

750500

lVEDV (Ill)

250O-t---.,.4;r----if'----r------,o

5

25

c; 20J:EE 15ll.@10~

Gender differences in the prevalence and severity of cardio­vascular disease have been identified in human clinical stud­ies [9], howe ver, the underl ying mechanisms respon sible forthe lower incidence of cardiac disease in female s are poorl yunderstood. The prevailing wisdom for decades has been thatfem ale hormones contribute to the cardioprotective effectsbefore the onset of menopause [6]. This is based on studiesidentifying an increased incidence of cardiovascular diseasein post-menopausal women [10] . Compared to men, womenhave a delayed onset of heart disease by about 10 year s. Ithas been assumed that this protection has been afforded towomen because they have estrogen and men do not [6]. Butthe outcomes of recent clinical trials, especially the Heart and

Discussion

represented as a non-parallel rightward shift of the EDP-EDVrelation. Hearts from both intact and ovariectomized ratsexhibited significant increases in myocardial compliance ascompared to control. Howe ver, the increa se in complianceof the intact female hearts was substantially less than that seenin the ovariectomized female hearts (306 vs. 812% relativeto controls, p < 0.05 ).

Cardiac output was significantly increased in the intact andovariectomized fistula rats (I83 and 282 % relative to con­trol, respectively; Fig. 2). The slope of the peak isovolumetricpressure- volume (Pmax-V) relationship was used as an assess­ment of ventricular function . Suga et al. [8] have valid atedthe slope of the Pmax-V relationship as an accurate index ofLV contractility. The Pmax-V slope was significantly decreasedin both the FIST and FOX groups relative to sham-operatedcontrols (69 and 86% respectively, p < 0.05; Table 2) indica­tive of reduced intrinsic myocardial contractility.

Fig. 1. Average end diastolic pressure-volume relationships for intact fistula(FIST), ovariectomized fistula (FOX) and sham-operated control (SHAM)hearts at 21 weeks post-fistula. FOX hearts had significant ventricular dila­tation (p <0.05) comprised of increased LVcompliance (V0- 25' at 812% abovecontrol) and unstressed LV volume (Vo' 71% above control). Incontrast, FISThearts had no significant change in unstressed LV volume.

week s post-fistula. The lack of significant progressive re­modeling for periods of up to 21 weeks post-fistula in intactfemales indicates that concentric hypertrophy without dila­tation allows these hearts to achieve steady-state compen satedventricular function .

In contrast to the limited concentric remodeling in the in­tact female s, the hearts of ovariectomized female s developedmarked ventricular dilatation and increased ventricular com­pliance. In fact, the LV dilatation in the ovariectomized fe­males post-fi stula was more extensive than that previou slyreported in age-matched males with symptomatic CHF (i.e.Va of 496 vs. 475 Ill, respecti vely [2]). The significantly in­crea sed lung weights indicative of pulmonary edema in 67%of the ovariectomized female s also reflects the much higherincidence of CHF in this group. However, the cardioprotectionafforded the intact female s was not absolute, as ventricularcompliance was significantly increa sed, albeit only by 306%while the ovariectomized group increased by 812%. The Pmax­

V slope was significantly lower in both intact and ovariect­omized groups at 21 weeks post-fistula relati ve to control.This index of contractility in the intact fistula group was simi­lar to that previously reported in female heart s at 8 weekspost-fi stula [3]. Conversely, the marked depression in theslope of the Pmax- V relation ship seen in the ovariectomizedgroup is substantially lower, consistent with the contractilityreported in failing male hearts [2]. However, it must be notedthat this reflects intrin sic myocardial contractility in the ab­sence of the neurohormonal stimulation present in vivo.

Both groups had comparable significant increa ses in car­diac output post-fistul a. The marked increase in cardiacoutput in the intact fistula group can be accounted for bya combination of the increa se in LVEDP and heart rates pre­viously reported post-fi stula [3, 7], the increased myocardialmass to volume ratio , and the functional dilatation affordedby the moderate increase in compliance coupled with in­crea sed contractility. The comparable increase in cardiac out­put observed in the ovariectomized female s is largely due toincrea sed stroke volume produ ced by the substantially largerventricular volumes.

While both groups developed significant cardiac hypertro­phy post-fistula, the increase in LV weight in the intact femaleswas significantly less than in the ovariectomized females.Superficially, this seems at odds with a physiological impe­tus to normalize the force s responsible for inducing adversemyocardial remodeling. However, the implication of thesedifferences in LV hypertrophy and dilatation among thegroups are better understood by examining the LV mass/end­diastolic volume (MN) ratio. Consistent with our previousobservation in females [3], the LVMN ratio was significantl yincreased relative to controls in the female fistula hearts.Ovariectomy largely reduced the magnitude of the increasein LV MN post-fistula. Therefore, because the hypertrophyin the intact female hearts was concentric, rather than eccen-

93

tric as in ovariectomized females, the increased mass wassufficient to compensate for the additional workload imposedon the myocardium by significant increa ses in LVEDP post­fistula [7]. Con versely, the attenuated increase in LV MN inthe ovariectomized femal e hearts denotes inadequate or in­appropriate hypertrophy that fails to normalize the increasedwall stress.

Our finding s are consistent with the concept propo sed byGrossman et al. [13] that increased end diastolic wall stressis the stimulus for the eccentric hypertrophy and ventriculardilatation occurring secondary to volume overload. The sefinding s have the further implication that hypertrophy, in andof itself, is not detrimental to cardiac function . Thi s obser­vation is consistent with previous reports using the aorticbanding and SHHF rat model s of CHF, which found female sdev eloped comparable hypertrophy to that seen in male swithout developing CHF [5, 14]. This concept of appropri­ate hypertrophy is also supported by Litwin et al. [15], whofound that inadequate hypertrophy promoted ventricular dila­tation and the development of CHF. Thus, the developmentof appropriate hypertrophy allows the heart to adju st to theincrea sed demand imp osed by volume overload, and thedevelopment of concentric hypertrophy does not appear toimpair cardiac function.

These findings are largely consistent with previous stud­ies of chronic volume overlo ad performed with the AV fis­tula model. Liu et al. [7] previously reported the developmentof significant hypertrophy without progression to heart fail­ure in intact female rats. In that study there was no mort alityand most indexes of cardiac function were normal. In con­trast to our findings are those of Sharkey et al. [16], whofound that ovariectomy did not alter the progression to CHFin the hypertensive SHHF rat model. However, they subse­quently reported that hyperten sion, LV hypertrophy and dete­rioration in cardiac function were prevented by 17p-estradiolsupplementation in young ovariectomized SHHF rats [17].Therefore, the differences seen in these studies may reflectdifferences between the animal model s, the pathogenesis ofCHF in hypertension and volume overload, or other factors,such as the onset of hormone replacement relative to meno­pause.

Although the findin gs reported herein are ostensibly com­mon knowledge, this is the first study to demonstrate thatgender differences in cardiac remodeling and the subsequentdevelopment of CHF are mediated by ovarian hormones. Themarked ventricular dilatat ion and symptoms of CHF seen at21 weeks post-fi stula in the ovariectomized female s clearlydemonstrate the influence of circulating ovarian hormon eson the pattern of myocardial remodeling induced in responseto a chronic volume overload. This raise s the question : " Ifovarian hormones mediate the underlying mechanisms re­sponsible for the gender difference observed in the develop­ment of heart failure, then why have clinical studies failed

94

to demonstrate the benefit of hormone replacement?" Es­trogen has been touted to have protective cardiovascular ef­fects due to both direct and receptor-mediated effects on thevasculature and cardiovascular cells. Estrogen increaseseNOS and iNOS activity [18-21 ], and has been shown tomodulate pro-inflammatory cytokines, including TNF-a [22­25]. In addition, both cardiac myocytes and fibroblasts havebeen shown to have functional estrogen receptors [26] andestrogen has been shown to modulate the growth of cardiacfibroblasts [27], suggesting that estrogen could directlymodulate the cardiac remodeling process. This possibility issupported by the recent study of Wallen et at. [28], who foundthat a significant decrease in the heart weight to body weightratio in ovariectomized rats was returned to intact femalelevels by estrogen replacement. Additionally, there have beenseveral studies which call into question the relative efficacyof the different progestins utilized in hormone replacementtherapy [29- 31]. Therefore, further studies to determine theeffect of estrogen or estrogen-progestin combinations onmyocardial remodeling are needed.

In summary, the marked ventricular dilatation inducedpost-fistula in ovariectomized females would seem to con­firm that ovarian hormones are responsible for the gender­mediated protection from myocardial remodeling associatedwith CHF. Further, this study establishes that the rat AV fis­tula model is appropriate for the investigation of hormonalmechanisms responsible for gender differences in the devel­opment of CHF. The mixed results of current clinical trialsand their disparity with the epidemiological evidence illus­trate how much more we need to know about the cardiovas­cular effects of hormone replacement therapy. Given theexisting controversy over the efficacy of hormone replace­ment therapy, future studies should attempt to identify the roleof individual ovarian hormones in mediating these presumedcardioprotective effects.

Acknowledgements

This study was supported in part by NIH grants RO 1 HL5998I ,RO1 HL62228 and American Heart Association SouthernResearch Consortium grants 00515058 and 0160195B. Weare grateful to Kathryn A. Oberle, and James A. Stewart Jr.for providing technical support.

References

I. Brower GL, Henegar JR, Janicki JS: Temporal evaluation of left ven­tricular remodeling and function in rats with chronic volume overload.Am J Physiol Heart Circ Physiol 271: H2071-H2078, 1996

2. Brower GL, Janicki JS: Contribution of ventricular remodeling to path­ogenesis of heart failure in rats. Am J Physiol Heart Circ Physiol 280:H674-H683,2001

3. Gardner JD, Brower GL, Janicki JS: Gender differences in cardiacremodeling secondary to chronic volume overload . J Card Fail 8: 101­107,2000

4. de Simone G, Devereux RB, Daniels SR, Meyer RA: Gender differ­ences in left ventricular growth . Hypertension 26: 979-983, 1995

5. Tamura T, Said S, Gerdes AM: Gender-related differences in myocyteremodeling in progression to heart failure. Hypertension 33: 676-680,1999

6. Gorodeski GI: Impact of the menopause on the epidemiology and riskfactors of coronary artery heart disease in women. Exp Gerontol 29:357-375, 1994

7. Liu Z, Hilbelink DR, Gerdes AM: Regional changes in hemodynamicsand cardiac myocyte size in rats with aortocaval fistulas. 2. Long-termeffects . Circ Res 69: 59-65, 1991

8. Suga H, Sagawa K, Shoukas AA: Load independence of the instanta­neous pressure-volume ratio of the canine left ventricle and effects ofepinephrine and heart rate on the ratio . Circ Res 32: 314-322,1973

9. Hayward CS, Kelly RP, Collins P: The roles of gender, the menopauseand hormone replacement on cardiovascular function. Cardiovasc Res46: 28-49,2000

10. Kalin MF, Zumoff B: Sex hormones and coronary disease: A reviewof the clinical studies . Steroids 55: 330-352, 1990

11. Barrett-Connor E, Stuenkel C: Hormones and heart disease in women :Heart and estrogen/progestin replacement study in perspective. J ClinEndocrinol Metab 84: 1848-1853,1999

12. Mosca L, Collins P,Herrington DM, Mendelsohn ME, Pasternak RC,Robertson RM, Schenck-Gustafsson K, Smith SC Jr, Taubert KA,Wenger NK: Hormone replacement therapy and cardiovascular disease:A statement for healthcare professionals from the American Heart As­sociation . Circulation 104: 499-503, 2001

13. Grossman W, Jones D, McLaurin LP: Wall stress and patterns of hyper­trophy in the human left ventricle. J Clin Invest 56: 56-64, 1975

14. Weinberg EO, Thienelt CD, Katz SE, Bartunek J, Tajima M, RohrbachS, Douglas PS, Lorell BH: Gender differences in molecular remodelingin pressure overload hypertrophy. J Am Coli Cardiol34: 264-273, 1999

15. Litwin SE, Raya TE,Anderson PG, Litwin CM, Bressler R, GoldmanS: Induction of myocardial hypertrophy after coronary ligation in ratsdecreases ventricular dilatation and improves systolic function . Circu­lation 84: 1819-1827, 1991

16. Sharkey LC, Holycross BJ, Park S, McCune SA, Hoversland R, RadinMJ: Effect of ovar iectomy in heart failure-prone SHHFfMcc-facp rats.Am J Physiol275 : RI968-RI976, 1998

17. Sharkey LC, Holycross BJ, Park S, Shiry LJ, HoepfTM, McCune SA,Radin MJ: Effect of ovariectomy and estrogen replacement on cardio­vascular disease in heart failure-prone SHHFfMcc-facp rats. J Mol CellCardiol31 : 1527-1537, 1999

18. Andersen MR, Stender S: Endothelial nitric oxide synthase activity inaorta of normocholesterolemic rabbits : Regional variation and the ef­fect of estrogen. Cardiovasc Res 47: 192-199, 2000

19. Binko J, Majewski H: 17~-estradiol reduces vasoconstriction in en­dothelium-denuded rat aortas through inducible NOS . Am J Physiol274: H853-H859, 1998

20. Huang A, Sun D, Koller A, Kaley G: 17~-estradiol restores endothe­lial nitric oxide release to shear stress in arterioles of male hyperten­sive rats. Circulation 101: 94-100, 2000

21. Nuedling S, Kahlert S, Loebbert K, Doevendans PA, Meyer R, VetterH, Grohe C: 17~-estradiolstimulates expression of endothelial and in­ducible NO synthase in rat myocardium in vitroand in vivo.CardiovascRes 43: 666-674,1999

22. An J, Ribeiro RC, Webb P, Gustafsson JA, Kushner PJ, Baxter JD,Leitman DC: Estradiol repression of tumor necrosis factor-alpha tran­scription requiresestrogen receptor activation function-2 and is enhancedby coactivators. Proc Natl Acad Sci USA 96: 15161-15166, 1999

23. Deb S, Tessier C, Prigent-Tessier A, Barkai U, Ferguson-Gottschall S,Srivastava RK, Faliszek J, Gibori G: The expression of interleukin-6(IL-6), IL-6 receptor, and gpl30-kilodalton glycoprotein in the rat de­cidua and a decidual cell line: Regulation by 17~-estradioland prol­actin . Endocrinology 140: 4442-4450, 1999

24. Salem ML, Matsuzaki G, Madkour GA, Nomoto K: Beta-estradiol­induced decrease in IL-12 and TNF-alpha expression suppre sses mac­rophage functions in the course of Liste ria monocytogenes infectionin mice . Int J Immunopharmacol 21: 481-497, 1999

25. Salem ML, Hossain MS, Nomoto K: Mediation of the immuno­modulatory effect of beta-estradiol on inflammatory responses by in­hibition of recruitment and activation of inflammatory cells and theirgene expression of TNF-alpha and IFN-gamma. Int Arch AllergyImmunol 121: 235-245 ,2000

26. Grohe C, Kahlert S, Lobbert K, Stimpel M, Karas RH, Vetter H, NeysesL: Cardiac myocytes and fibroblasts contain functional estrogenreceptors . FEBS Lett 416 : 107-112, 1997

95

27. Dubey RK, Gillespie DG, Jackson EK, Keller PJ: 17~-estradiol,itsmetabolites, and progesterone inhibit cardiac fibrobl ast growth . Hy­pertension 31: 522-528, 1998

28. Wallen WJ, Cserti C, Belanger MP, Wittnich C: Gender-differences inmyocardial adaptation to afterload in normotensive and hypertensiverats. Hypertension 36: 774-779,2000

29. Adams MR, RegisterTC, Golden DL, Wagner JD, Williams JK: Med­roxyprogesterone acetate antagonizes inhibitory effects of conjugatedequine estrogens on coronary artery atherosclerosis . ArteriosclerThromb Vase Bioi 17: 217-221 ,1997

30. Rosano GM, Webb CM, Chierchia S, Morgani GL, Gabraele M, SarrelPM , de Ziegler D, Collins P: Natu ral progesterone, but not med ­roxyprogesterone acetate, enhances the beneficial effect of estrogenon exerci se-induced myocardial ischemia in postmenopausal women.J Am Coli Cardiol36: 2154-2159,2000

31. Sitruk-Ware R: Progestins and card iovascular risk markers . Stero ids65: 651-658,2000

Molecular and Cellular Biochemistry 251: 97-10 I, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Protein kinase C isoforrn-selective signals that leadto cardiac hypertrophy and the progression ofheart failure

Abdelkarim Sabri and Susan F. SteinbergDepartments ofPharmacology and Medicine , College of Physicians and Surgeons, Columbia University, New York, NY, USA

Abstract

Protein kinase C isoforms comprise a family of structurally related serine/threonine kinases that are activated by second mes­senger molecules formed via receptor-dependent activation of phospholipase C. Cardiomyocytes co-express multiple proteinkinase C isoforms which play key roles in a spec trum of adaptive and maladaptive cardiac responses. This chapter focuses onthe structural features, modes of activation, and distinct cellular actions of indi vidual PKC isoforms in the heart . Particularemphasis is placed on progress that comes from studies in molecular models of PKC isoform overexpression or gene deletionin mice . Recent studies that distinguish the functional properties of novel PKC isoforms (PKC8 and PKCs) from each other,and from the actions of the conventional PKC isofo rms, and suggest that these proteins may playa particularly significant rolein pathways leading to cardiac growth and/or cardioprotection also are con sidered. (Mol Cell Biochem 251 : 97-101 , 2003)

Key words : prote in kinase C, cardiomyocytes, ca rdiac hype rtrophy, MAPKs, AKT

Introduction

Cardiac hypertrophy represents a complex adaptational re­spon se whereby terminally differentiated cardiomyocytesstructurally, genetic ally, and functionally remodel in responseto mechanical, electrical, and/or neurohumoral stimuli. Ven­tricular wall thickening , with cardiomyocyte enlargement andthe formation of new sarcomeres, provides a short-term mecha­nism to decrease wall stress and improve contractile perform­ance. However, when sustained for prolonged intervals in thesetting of pathologic stresses (ischemic cardiac injury, hyper­tension , or valvular heart disease), the hypertrophic programbecomes maladaptive, resulting in enhanced cardiomyocyteapoptosis, fibrosis, ventricular dilatat ion, and the transitionto heart failure. Heart failure is associated with a significantlyenhanced risk of card iac death and has become a major healthcare burden in the United State s. Of note , properly designedendurance exercise train ing also leads to cardiac hypertro­phy, but this form of 'phys iologic hypertrophy ' doe s not de­compensate into dilated cardiomyopathy or heart failure.

Despite intense study, the precise stimulus-specific signals thatdistinguish physiologi c and pathologic hypertrophy (and thatcontribute to the latter's progression to heart failure) remainincompletely understood. Many laboratories have focused onthe actions of Gq-coupled receptors (GqPCRs) as well as ef­fecto r pathways that emanate from the freed aq subunit, asmany of these signaling molecules individually have beenimplicated as triggers of the cardiomyocyte hypertrophicgrowth program . Protein kinase C (PKC) has attracted particu­lar attention , as it represents a family of distinct enzymes (en­coded by distinct genes) with particularly important roles in aspectrum of adaptive and maladaptive card iac response s. Thischapter summarizes recent progress ascribing distinct signalingand functional properties to individual PKC isoforms in theheart. The focus is on the role of individual PKC isoforms inthe etiolog y of cardiac hypertrophy and heart failure. WhilePKC isoforms also play a pivotal role in cardioprotectionthrough ischemic preconditioning, th is topic (which hasbeen recentl y reviewed) [I] is beyond the scope of this chap­ter and will not be considered in any detail.

Present add ress:A. Sabri, University of Alabama at Birmingha, Alabama, USAAddress fo r offprints:S.F. Steinbe rg, Department of Pharmacology, College of Physicians and Surgeons, Columbia Univers ity, 630 West 168 Street, NY 10032,USA (E-mail: sfs I @columbia.e du)

98

Protein kinase C isoforms

Protein kinase C was first described as phospholipid-depend­ent serine-threonine kinases, which are activated as a resultof receptor-dependent activation of phospholipase C and thehydrolysis of membrane phosphoinositides [2]. The PKCfamily of enzymes is comprised of the calcium-sensi tivecPKCs (a, PI, P2, y), novel nPKCs (0, e, .." 8), and atypicalaPKCs (~, 'Aft). Models of PKC activation are derived largelyfrom studies of cPKCs, 'which partition to the soluble frac­tion of quiescent cells; cPKC activation is via the combinedactions of calcium (which increases the affinity of the enzymefor lipids) and DAG (which anchors the enzyme in its stableconformation to membrane structures). For all PKC isoforms,translocation to memb rane structures provides a mechanismto regulate access to substrate and has been taken as the hall­mark of activation. Since individual PKC isoforms displayonly limited substrate spec ificity in vitro, distinct substratespeci fic ity in vivo has bee n ascri bed to isoform-se lectiveinteractions with membrane-associated anchoring proteins,termed RACKs (receptors for activated C-Kinase) [3]. RACKsspecifically and saturably bind only activa ted conforma tionsof PKC isoforms and thereby provide an optimal strategy torecrui t activated PKC isoforms to their intracell ular targetsubst rates. Of note, recent studies describe additional mecha­nisms to regulate PKC isoforms function. For example, theeffects of nitric oxide donors (at doses that afford cardio­protect ion) to activate PKCf: sig naling path way has beenattributed to nitration of PKCf: on tyrosine residues, a post­translational modification that promotes PKCf: interactionswith the RACK protein and facilitates PKCf: translocation andactivation [4]. Other rece nt studies identify tyrosine phos­phory lation of PKC o by Src family tyrosine kin ases [5] .Phosph orylation at tyrosine-311 in the hinge region of themolecule is particularly noteworthy as this post-translationalmodification renders PKC o lipid-independent (thereby pro­viding an important ancillary mechanism to activate the en­zyme in a distinct cellular compartment). PKCo also is a targetfor caspase cleavage, generati ng a PKCo fragment that is amarker (and potent ially also an effector) of apoptos is. Stud­ies that consider post-translational PKC isoform processingas potential additiona l regulatory mec hanisms that enab ledistinct modes for PKC signaling in the heart are likely torepresen t frui tful areas of future researc h.

Protein kinase C isoform function incardiomyocytes - lessons from geneticmouse models

Cardiomyocytes co-express multiple PKC isoforms. There isgenera l consensus that ventricular myocytes co-express cal-

cium-sensitive PKCa , novel PKCo and PKCf:, and atypicalPKC'A.; the presence of PKCp in cardiomyocytes remains thefocus of lingering controversy [6-9]. Similarly, many labo­rator ies report effec ts of GqPCR agonists to induce the trans­location (activation) of nPKCs (0 and e) from the solu blefraction to particulate structures in cardiac myocy tes. Effec tsof GqPCRs to act ivate cPKCs (a, P) also have been reportedin studies that use an immunocytochemical approac h. How­ever, for reasons that still remain somewhat elusive, cPKCisoform activation by GqPCR s generally is not detected instudies that use bioche mica l subfrac tionation and Westernblotting techn iques [9-1 2]. The presence of mul tiple PKCisofo rms in cardiomyocytes (like in most cells) has fueledspeculation that indiv idual PKC isoforms mediate uniquefunctions in the heart.

The earliest studies attempting to distinguish PKC isoformsignaling/function in the heart focused on PKCp (note, anisoform whose presence in card iomyocy tes remains the fo­cus of lingering controversy). Initial studies demonstratedthat overexpress ion of exogenous PKCp leads to the tran­scriptional activation of the fetal gene program in cardiac cul­tures [13]. Shortly thereafter, several laboratories describedthe phenotype of mice that overexpress PKCp in the heart.These early studies emphasized the importance of the leve lof transgene expression, the use of the wild-type vs. theconstitutively activa ted mutant protei n, and the age andbackground strai n of the mouse harboring the transgeneas modifiers of the cardiac phenotype. Overexpression ofwild-type PKCp in the hearts of transgenic mice (at levelsreported to be 10- 20 fold higher than the endoge nous pro­tein) resulted in concentric pathologic hypertrophy, fetal geneexpression, and contracti le dysfunction [14, 15]. Conditionaloverexpression of the constitutively-active PKCp mutant pro­tein in the adult mouse heart (at low levels, such that the pro­tein is be low the level of detect ion) also indu ced ca rdiachypertroph y with abnor mal co ntrac tile functio n, but thepathologic changes were relatively mild (and accompaniedby littl e fibrosis or fetal gene induction) [16]. In contras t,overexpression of the constit utive ly-active PKCp transgenefrom birth resulted in a malignant phenotype (not observedin the adult animal) with abnormalities in the regulation ofintrace llular calci um and neonatal sudden death [16]. Thesestudies emphasize the importance of consi dering the contex­tual nature of PKC isoform signaling.

Subsequent studies focused on PKCf:, the isofo rm impli­cated as an upstream regulator of the RaslRaf-ERK cascadeand mediato r of GqPCR-d ependent mobilization of intrac­ellular calcium in cardiomyocyte cultures [II , 17]. Over­expressio n of a constitutive ly-active PKCf: mutant in cardiaccultures is reported to induce cell ular remodeling (elonga­tion), without a significant increase in overall surface areaor total protein accumulation [18]. Similarly, transgenic car­diac-selective overexpression of constitutively-active PKCf:

leads to mild concen tric cardiac hypertrophy with normal illvivo contractile performance and partial recapitulation of thefetal gene program, but no fibrosis [19].

The ability of PKC isoforms (whic h typ ically are up­regulated or activated durin g hypertrophy/ischemia) to pro­mote cardiomyocyte growth and remodeling has been takenas ev idence that PKC s contribute to the induction of thehypertroph ic phenotype . However, rece nt studies reveal thattargeted disruption ofPKCP or PKCl; in mice does not inter­fere with normal neonatal cardiac development/g rowth [20,21] and a null mutation of PKCp does not block the devel­opment of pathologic hypertrophy in adult mice [22] . The seresult s argue that PKCp or PKCe are not required for car­diac growth (or that there is substantial redundancy in thesesignaling pathways) .

Protein kinase C isoforms as nodalpoints in cardiomyocyte signalingnetworks

One of the more intriguing aspects of previous investigationsof Gaq signaling relates to the observation that Gaq inducesa continuum of responses, from compensated hypertrophyto decompensated heart fai lure, as the stimulus strength in­creases or is maintained over prolonged intervals. The obser­vation that modest increases in wild-type Gaq express ioninduces stable cardi ac hypertrophy, but very intense Gaqstimulation (with very high levels of wild-type Gaq proteinsor with constitut ively activated Gaq mutants) induces a di­lated cardiomyopathy with evidence of funct ional decom­pensation and cardiomyocyte apoptosis, has been taken asevidence that hypertrophy and apoptosis represent differentphases of the same proce ss initiated by a common Go.q-acti­vated biochemical signal [23-25]. PKC isoform s representone of the few traditional Gaq subunits targets that would belikely to fulfill this requirement. In fact, two recent lines ofinvestigation suggest that PKC isoforms are well suited to actas molecular switches at nodal points in signaling pathwaysleading to cardiomyocy te hypertrophy and apoptosis .

Heidkamp et at. recentl y mapped distinct signaling path­ways downstream from PKC8 and PKCe in cardiomyocytes[26]. Using a replic ation-defective adenovirus encoding theconstitutive ly-activated mutant of PKCe, they demonstratedthat PKCe selectively activates ERK, a MAPK cascade gener­ally implicated in growth respon ses and ce ll surv ival; thestress-activated protein kin ase cascades (JNK and p38­MAPK), generally implicated in the detrimental changes thataccompany cardiac ischemia are not substantially activatedby PKCe. The functi on al co nsequences of PKC e over­express ion are confined to cell elongation, with little to noother features of the hypertrophic phenotype. In con trast,

99

using a repli cation-defective adenovirus encoding the con­stitutively-activate mutant of PKC8, they identi fied an effectof PKC8 to preferentially activate JNK and p38-MAPK (andnot ERK); PKC8 overexpression results in cell detachmentwith clear evidence of cardiomyocyte apoptosis.According tothese studies, neurohumoral stimulation of GqPCR s will en­gage nPKC isoform (8 and e) pathways; the fate of the car­diomyocyte would be dictated largely by the balance of nPKCsignaling to (pre-wired) downstream signaling cascades.

The second set of studies that identify PKC isoform s asnodal points in cell signaling networks come from our labo­rato ry. These experiments used recombinant Pasteurellamultocida toxin (rPMT, an activator of free monomeric Ga

ql

I I subunits), as a pharm acological agonist of endogenous Gagsubunits [27,28] . Current concepts ofGq function in the hearthave evol ved almo st exclusively from studies in geneticallyengineered models of Gaq overexpression (at times with con­stitutively activated Gaq subunits) . While these studies pro­vide valuable insigh ts into Gaq function, transgene sis altersthe natural stoichiometry and/or targeting of Gaq subunitsrelative to their physiologically relevant binding partners inthe plasma membrane. Gaq overexpression at high levels (notlikely to be encountered even in human disease) or with con­stitutive ly active mutant a q subunits also might lead to non­physiologic phenotypes. Accordingly, we emb arked uponstudies that used rPMT as a strategy to interrogate the signalingproperties of endogenous Gaq subunits in cardiomyocytes,reasoni ng that a pharmacologic approac h might be bettersuited to distinguish the molecular signals that trigger hyper­trophy vs. apopto sis and functional decompen sation.

Previous studies had used rPMT in fibrobl asts, where itgain s access to the cytoso l via a poorly characterized en­docytic mechanism and activates a spectrum of Guq -de­pendent signal transducti on pathways (inositol phospholipidhydroly sis, mobili zation of intracellular calc ium , transloca­tion of PKC, activation of the extracellular-regulated kinase(ERK) MAPK cascade, and tyrosine phosphorylation of fo­cal adhe sion kina se [27, 28]) that culminate in cell prolifera ­tion. In an analogo us manne r, cardiomyocytes chronicallystimulated with rPMT display pronounced activation of phos­pholipase C, nPKC isoforms, ERK, and (to a lesser extent)JNK/p 38-MAPK and all features of cardiac hypertro phy (in­clud ing cell enlargement, increased sarcomeric organ ization,and increased ANF expression) [29]. The effects of rPMT toinduce cardiomyocy te hypertrophy were anticipated on thebasis of previous genetic studies of Gaq function in the heart.However, further studies revealed an unanticipated effec t ofGa stimulation by rPMT to repress the phosphorylation of

gAKT (a serine/threonine protein kinase that mediates cardi -oprotection by receptor tyrosine kinases, and also is reportedto be activated by certain Gq-coupled GPCRs) [30, 3 1] andprevent AKT activation by ligands that activate receptor ty­rosine kinases .

100

Supported by U.S.P.H.S.-N.H.L.B .I. grant HL-64639.

yt APOPTOSIS

"',J-) ( -~ .-/

'y, ~ ..

!t APOPTOS IS

HYPERTROP HYICARDIOPROTECTION?

Acknowledgement

survival pathways). These studies identify a continuum ofresponses emanating from nPKC isoforms that both contrib­ute to compensated hypertrophy and also trigger decompen­sation and heart failure. The effects of chronic nPKC isoformactivation (as typically occur s in heart failure with elevatedcatecholamine levels) to stimulate JNK/p38-MAPK and re­press AKT phosphorylation would be deleterious to the natu­ral history of heart failure . However, as mentioned at theoutset, when acu tely activated in the course of ischemia/reperfusion injury, PKC is generally viewed as cardio­protective; PKC isoforms are well-recognized mediators ofischemic preconditioning. The challenge of future researchwill be to determine whether cardioprotection (ischemic pre­condi tion) , hypertrophic signaling, and enhanced apoptosisreflect the actions of overlapping or distinct sets of PKCisoform s. Research that charts the multifunctional actions ofindividual PKC isoforms in the heart, distingui shing the ben­eficial and deleterious actions of each PKC isoforrn, willprovide the essential groundwork to direct pharmaceuticalprograms that consider PKC isoforms as targets for the de­velopment of therapeutic modalities for heart failure andischemia.

Summary and future directions

The literature provides little guidance regarding a mech­anism(s) that would link Gag activation to the repression ofAKT phosphorylation. Pathways leading to PI-3K/AKT ac­tivation, as a mechanism for cell survival, proliferation, anddifferentiation, have been the focus of research in many labo­ratories [32], but mechanisms that curtail AKT activat ion areless well understood and there are only limited (and incon­sistent) reports regarding the regulation of AKT by Gagsubunits or phorbol ester-sensitive PKC isoforms. For exam­ple, AKT is variably reported to be activated or inhibited byGag subunits [33, 34]. Similarly, PKCa overexpression is re­ported to increase AKT activity (and reduce apoptosis) inmyeloid cells [35], but PKC8 has been implicated in the re­pression ofIGF- I-dependent activation of AKT in PC 12cells[36], and a kinase-deficient mutant of PKCs (but not wild­type PKCs or kinase-dead PKCa or PKCS) is reported toinhibit AKT phosphorylation/activation by insulin, heatshock, or HP2in L6 myotubes and CHO cells [37]. To de­termine whether PKC isoforms provide a link between Gagact ivation and the repression of AKT pho sphorylation incardiomytocytes, we examined AKT phosphorylation follow­ing PKC activation with PMA . We demonstrated that PMArepresses basal AKT phosphorylation [29]. Experiments withPKC isoform-selective pharmacologic antagonists were ableto implicate nPKC (not cPKC) isoforms as mediators of thePMA-dependent repress ion of AKT phosphorylation; limi­tations of available pharmacologic antagonists (which vari­ably impaired cardiomyocyte viability and/or altered thephosphorylation state of stress-activated protein kinases)precluded further resolution of the relative contributions ofPKC8 and PKCs in this pathway.

PMA-dependent repression of AKT phosphorylation car­ries functional significance for cardiomyocytes. Whereas thefall in basal AKT phosphorylation does not lead to grosschanges in cell morphology (or the basal rate of apoptosis),apoptosis induced by HP2(a stimulus that simulates the in­sults that characterize the progression of cardiac diseases) isincreased in cardiomyocytes treated with rPMT (which can­not recruit the AKT pathway). These results extend currentmodels of PKC isoforms actions, placing nPKC isoforms ata pivotal juncture upstream in pathways that both promotehypertrophy and also render cardiomyocytes susceptible tostresses that induce apoptosis.

Figure I provides a scheme that summarizes newer conceptsof nPKC isoform signaling in cardiomyocytes. Current lit­erature identifies PKCs activation of the ERK cascade , PKC8activation of JNK and p38-MAPK (and apoptosis), and nPKCisoform (s and/or 8) repression of AKT phosphorylation (and

Fig. 1. nPKC isoforrn signaling to MAPK casc ades and AKT . Recent stud­ies show preferential activation of ERK l12 by PKCE and preferential acti ­vation of JNK and p38-MAPK by PKC&. nPKC isoforms (10 and/or &) repressAKT phosphorylati on (and its phosphorylation by survival factors such asEGF and IGF-I) .

References

I. Bolli R: The late phase of preconditioning. Circ Res 87: 972-983, 20002. Demp sey EC, Newt on AC, Moch ly-Rosen D, Fields AP, Reyland ME,

Insel PA, Messi ng RO : Protein kinase C isozymes and the regulationof diverse cell responses . Am J Physiol 279: L429-L438, 2000

3. Mackay K, Mochly-Rosen D: Local ization, anchoring, and functionsof protein kina se C isozymes in the heart. J Mol Cell Cardiol33 : 1301­1307,2001

4. Balafanova Z, Bolli R, Zhang J, Zheng Y, Pass JM, Bhatnagar A, TangXL, Wang 0, Cardwell E, Ping P: Nitric oxide induces nitration ofPKC E, facilitating PKCE translocation via enhanced PKC E-RACK2interactions: A novel mechanism of NO-triggered activation of PKC E.J Bioi Chern 277 : 15021-15027,2002

5. Gschwendt M: Prote in kinase CIl. Eur J Biochem 259 : 555-564, 19996. Rybin VO, Buttrick PM, Steinberg SF: PKC -A is the atypi cal protein

kinase C isoform expressed by immature ventricle. Am J Phy siol 272 :HI636-H I642,1997

7. Rybin VO, Steinberg SF : Pro tein kina se C isoform expre ssion andregulation in the developing rat heart . Circ Res 74: 299-309, 1994

8. Rybin VO, Steinberg SF: Do adult rat ventricular myocytes expressprotein kinase Ca? Am J Physiol 272 : H2485 -H249I , 1997

9. Mochly-Rosen D, Henrich CJ, Cheever L, Khaner H, Simpson PC: Aprotein kinase C isozyme is translocated to cytoskeletal elements onactivation. Cell Reg I: 693-706, 1990

10. Rohde S, Sabri A, Kamasamudran R, Steinberg SF: The a,-adrener­gic receptor subtype- and protein kinas e C isoforrn-depe ndence ofnorepinephrine 's actions in cardiomyocytes . J Mol Cell Cardi ol 32:1193-1209,2000

II. Clerk A, Bogoyevitch MA, Andersson MB, Sugden PH: Differen tialactivation of protein kina se C isoform s by endo thelin-I and phenyle­phrine and subsequent stimulation of p42 and p44 mitogen-activ atedprote in kina ses in ventricular myoc ytes cultured from neonata l ratheart s. J Bioi Chern 269 : 32848- 32857, 1994

12. Pucea t M, Hilal -Dandan R, Strulovici B, Brunton LL, Brown JH: Dif­ferential regulation of protein kinase C isoforms in isolated neonataland adu lt card iomyoc ytes. J Bioi Chern 269 : 16938-16944, 1994

13. Kariya K, Karns LR, Simp son PC: Expression of a con stituti vely ac­tivated mutant of the ~-isozyme of protein kinase C in cardiac myocytesstimul ates the promoter of the ~-myosin heavy chain isogene. J BiolChern 266 : 10023-10026,1991

14. Wakasaki H, Koya D, Schoen FJ, Jirousek MR, Ways DK, Hoit BD,Walsh RA, King GL: Targeted overexpression of protei n kinase C ~II

isoform in myocardium causes card iomyopathy. Proc Natl Acad SciUSA 94 : 9320-9325 ,1997

15. Take ishi Y, Chu G, Kirkpatrick DM, Li Z, Wakasaki H, Kranias EG,King GL, Walsh RA: In vivo phosphorylation of cardiac troponin I bypro tein kinase C~II decreases cardiomyocyte calcium responsivenessand contractil ity in transgenic mouse heart s. J Clin Invest 102: 72-78,1998

16. Bowman JC, Steinberg SF, Jiang T, German D, Fishman GI, Butt rickPM : Express ion of protein kinase C-~ in the heart causes hypertrophyin adult mice and sudden death in neonates. J Clin Invest 100: 2189­2195,1997

17. Jiang T, Pak E, Zhang HL, Kline RP, Steinberg SF. Endothelin-depend­ent actions in cultured AT-I cardiac myocyte s:The role of the s-isoformof protein kinase C. Circ Res 78 : 724-736,1996

18. Strait JB, III , Mart in JL, Bayer A, Mestri l R, Eble DM, Samarel AM:Role of protein kinase CEin hypertrophy of cultured neonatal rat ven­tricular myocytes . Am J Physiol 280 : H756-H766 , 200 I

19. Takeishi Y, Ping P, Bolli R, Kirkpatrick DL, Hoit BD , Walsh RA :Trans genic overexpression of constitutively active pro tein kina se CE

101

causes conce ntric cardiac hypertrophy. Circ Res 86: 1218-1223, 200020. Leitges M, Schmedt C, Guin amard R, Davoust J, Schaal S, Stabel S,

Tarakhovs ky A: Immunodeficie ncy in protein kinase C-~-deficient

mice . Science 273 : 788-791,199621. Khasar So, Lin YH, Martin A, Dadgar J, McMahon T, Wang D, Hundle

B, Aley KO, Isenberg W, McC arter G, Green PG, Hod ge CW, LevineJD, Messing RO : A novel nocicepto r signaling pathway reve aled inprotein kinase CE mutant mice . Neuron 24: 253-260, 1999

22. Roman BB, Geenen DL, Leitges M, Buttrick PM. PKC~ is not nece s­sary for cardiac hypertrophy. Am J Physiol 280 : H2264-H2270, 200 1

23 . D'Angelo DD, Sakata Y, Lorenz IN, Boivin GP, Walsh RA, Liggett SB,Dorn GW: Tran sgenic Gaq ove rexpre ssion induces cardiac contrac­tile failure in mice . Proc Nat! Acad Sci USA 94 : 8121- 8 126, 1997

24. Adams JW, Sakata Y, Davi s MO, Sah VP, Wang Y, Liggett SB, ChienKR, Brown JH, Dorn GW: Enhanced Gaq signaling: A common path ­way mediates cardiac hypertrophy and apoptotic heart failure. Proc NatlAcad Sci USA 95: 10140-10145 ,1998

25. Mende U, Kagen A, Meis ter M, Neer EJ: Signal transduct ion in atriaand ventricles of mice with transient cardiac expression of activatedG protein a q" Circ Res 85: 1085-1091 , 1999

26. Heidkamp MC, Bayer AL, Martin JL, Samarel AM : Differential acti­vation of mitogen-activated protein kinase cascades and apoptosi s byprotei n kina se CEand Il in neonatal rat vent ricul ar myocytes . Circ Res89: 882-890,2001

27. Wilson BA, Zhu X, Ho M, Lu L: Pasteurella multocida toxin activatesthe inos itol tripho sph ate signaling pathway in Xenopus oocytes viaGqa-coupled phospholipase C-p I. J Bioi Chern 272: 1268-1275, 1997

28. Seo B, Choy EW, Maudsley S, Miller WE , Wilson BA, Lutt rell LM:Pasteurella multocida toxin stimulates mitogen -acti vated protein ki­nase via Gql1,-depende nt transactivation of the epid ermal growth fac­tor receptor. J Bioi Chern 275 : 2239-2245 , 2000

29. Sabri A, Wilson BA, Steinberg SF : Dual actions of the Gq agon istPasteurella Multocida toxin to promo te cardiom yocyte hypertrophy andenhance apoptosis susceptib ility. Circ Res 90:850-857, 2002

30. Sabri A, Mu ske G, Zhang H, Pak E, Da rrow A, Andrade-Gordon P,Steinberg SF : Signaling properties and func tion s of two disti nctcardiomyocyte prote ase-activated receptors. Circ Res 86: 1054-1061 ,2000

31. Ches ley A, Lundberg MS, Asai T, Xiao RP, Ohtan i S, Lakatta EO, CrowMT:The ~2-adrenergic receptor delivers an anti-apoptotic signal to car­diac myocyte through G,-dependent coupling to phosphatidy linositol3'-kinase. Circ Res 87: 1172- 1179, 2000

32. Franke TF, Kaplan DR , Can tley LC: PI3K: Down stream A KTionblocks apoptosis . Cell 88: 435-437, 1997

33. Murga C, Laguinge L, Wetzke r R, Cu adrado A, Gutkind JS : Activa­tion of AktJprote in kinase B by G protein-coupled recepto rs. A rolefor a and ~y subunits of heterotrimeric G prot eins acting throughpho sphat idyl inos itol-3-0H kinase y. J Bioi Chern 273 : 19080-19085,1998

34. Bommakanti RK, Vinayak S, Simonds WF: Dual regulation of AktJ

Protein kinase B by heterotrimeric G protein subunits. J BioI Chern 275:38870-38876,2000

35. Li W, Zhang J, Flechner L, Hyun T, Yam A, Franke TF, Pierce JH:Protein kinase Ca overexpression stimulates AKT activity and sup­presses apopt osis induced by interleukin 3 withdrawal. Oncogen e 18:6564-6572, 1999

36. Zheng WH , Kar S, Quirion R: Stimul ation of protein kina se C modu ­lates insulin -like growth factor-I- induced akt activation in PC 12 cells.J BioI Chern 275: 13377-13385 ,2000

37. Matsumoto M, Ogawa W, Hino Y, Furukawa K, Ono Y,Takahashi M,Ohba M, Kuroki T, Kasuga M: Inhibition of insu lin-induced activa­tion of AKT by a kina se-deficient mutant of the epsilon isozyme ofprotein kina se C. J Bioi Chern 276: 14400-14406,2001

Molecular and Cellular Biochemist ry 251: 103-109,2003 .© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Contractile effects of adenovirally-mediatedincreases in SERCA2a activity: A comparisonbetween adult rat and rabbit ventricular myocytes

Babar Chaudhri,' Federica del Monte,' Roger 1. Hajjar' andSian E. Harding l

'National Heart and Lung Institute , Faculty ofMedicine, Imperial College ofScience, Technology and Medicine , London,UK; 2Cardiovascular Research Center, Massachusetts General Hospital and Harvard Medical School , Boston, MA, USA

Abstract

Adenoviral vectors have been successfully used to increase the activity of the sarcoplasmic reticulum Ca2+-ATPase in adultventricular myocytes and to produce functional improvements in contractility in vivo and in vitro. While in vivo experimentsare often performed in rat, in vitro manipulation of myocytes has been confined to rabbit and human cells . In the present studywe make quantitative comparisons between cultured adult rat and rabbit myocytes in their responses to SERCA2a overexpressionusing adenoviral vectors. We also compare the strategy of SERCA2a overexpression with that of phospholamban down-regu­lation , using adenovirus carrying antisense message, as a means to increase SERCA2a activity and enhance contraction andrelaxation. Adult myocytes were cultured for 48 h with either vector, and contraction assessed in 2 mM Ca2+, 37°C, at a rangeof stimulation frequencies. Contraction amplitude was enhanced to a similar degree in either rat or rabbit myocytes at moststimulation frequencies, with SERCA2a overexpression and phospholamban down-regulation approximately equally effec­tive. The maximum effect of either vector was less than that of ~-adrenoceptor agonists. Relaxation was accelerated in rabbitmyocytes more strongly than in rat. Phospholamban antisense was slightly less effective than SERCA2a overexpression onrelaxation times in rabbit. Increasing stimulation frequency also accelerated relaxation in rat myocytes: this effect was greaterthan, and additive with, that of SERCA2a overexpression. We conclude that, despite some species-dependent modification,the effects of increased SERCA2a activity are broadly similar in rat and rabbit. Both SERCA2a overexpression and phos­pholamban down-regulation are effective strategies, and neither appears to produce supraphysiological stimulatory effects oncontraction or relaxation. (Mol Cell Biochem 251: 103-109,2003)

Key words: myocyte, gene therapy, SERCA2a, phospholamban, rat, rabbit

Introduction

Genetic manipulation is being used to modulate the activityof the sarcoplasmic reticulum (SR) Ca2+-ATPase, SERCA2a,in adult cardiac myocytes either in vivo or in vitro. The maintechniques for modi fication of adult myocytes, which areresistant to infection with DNA alone, are the creation oftransgenic animals or infection with adenoviral vectors . Agreat deal of useful information has been generated on thefunctional effect of stimulation or inhibition of SERCA2a

activity in normal and failing myocardium. However, fortechnical reasons the type of experiments performed arestratified by species . Transgenic animals are usually mice [1­4], while adenoviral infection of adult myocytes has beendone only for rabbit and man [5-9]. Neonatal rat myocyteshave been used for adenoviral transfection [10, 11], but thereis a difference between adult and neonatal cells in the pro­portion of the various calcium-handling proteins. Studies todetermine the effect of increased SERCA2a in pathologicalstates have been performed in rat models , since this species

Address fo r offprints: S.E. Harding, Card iac Medicine , NHLI , Imperial College School of Science, Technology and Medic ine, Dovehouse Street, LondonSW3 6LY,UK (E-mail : sian.harding@ic.ac.uk)

104

is particularly amenable to the surgical manipulation involvedin creating the pathology (e.g. aortic banding) and for glo­bal gene transfe r using adenovirus r12-14]. It would be pre­dicted that the species used would influence the degree andpossib ly even the direction of change. Rat and mouse my­ocytes depend heavily on the SR for removal of diastolic Ca2+and maintenance of the subsequent Ca2+ transient. It has beenestimated that 92% of Ca2+ uptake/release is SR-dependentin rat, compared to around 70% in rabbit or human cells[15] . It might therefore be predicted that overexpression ofSERCA2a would be less effective in normal rat than rabbitmyocytes, since the system is already close to saturation.Conversely, measures involving the SERCA2a inhibitoryprotein, phospholamban, might be more effective in ratthan rabbit because of the high dependence on SERCA2afor optimal function . In the present study we have explic­itly compared the response of rat and rabbit myocytes toadenovirally-mediated increases in SERCA2a. This is ach­ieved by either overexpression of SERCA2a , as previouslydescribed, or by down-regulation of phospholamban usingan adenovirus expressing the complete antisense sequence forphospholamban. We show that the degree of enhancement ofcontraction is similar between the two species, but that beatduration is accelerated to a greater degree in rabbit cells.

Materials and methods

Adenoviral vectors

Ad.SERCA2a.OFP and Ad.OFP constructed and used as pre­viously described [6, 8]. For Ad.PlbAs.OFP, the completeantisense sequence was subcloned into the adenoviral shut­tle vector which uses the CMY Long Terminal Repeat as apromoter. The shuttle vector used had a concomitant OreenFluorescent Protein (OFP) under the control of a separateCMV promoter as described [16].

Isolation, culture and infection ofadult rat and rabbitventricular myocytes

Myocytes were isolated from adult male New Zealand Whiterabbits or Sprague-Dawley rats and cultured as previouslydescribed [8, 17]. To 10,000 rod- shaped myocytes in eachwell of a 12-well plate was added 2-10 x 107 p.f.u. ofAd.SERCA2a.OFP, 1-3 x 107 p.f.u,Ad.PlbAs.OFPor 2 x 107

p.f.u, of Ad.OFP, and the cells were cultured for 48 h. In eachcase more than 90% of myocytes displayed production ofOFP.

Functional characterisation

Myocytes were superfused with Krebs-Henseleit (K-H) so­lution (in mmol/L 119 NaCl, 2 CaCI2, 4.7 KCl, 0.94 MgS0

4,

1.2KHl04, 2 NaHC03

and 11.5 glucose) gassed with 95%02-5%C02to pH 7.4. Experiments were carried out at 37°Cwith field stimulation at 0.5 Hz (basal frequency), or 0.2­3 Hz during frequency-response curves, and contraction mon­itored by a video edge detection device with spatial resolut ionof 1 in 256 or 512 and a time resol ution of 10 or 20 msec.Contraction amplitude and times to peak contraction, 50 and90% relax ation (TTP, R50, R90) in basa l (2 mmol/l) Ca2+

were obtained from 5-8 myocytes in each preparation.

Western blotting

For Western blotting, myocytes were cultured by attachmentto laminin-coated 35 mm' dishes, and non-viable cells re­moved by washing 1h after attachment and immediately priorto harvest. After 48 h culture with or without viral infectionthe myocytes were scraped from the dishes , spun at 500 g for1 min and resuspended in PBS . Myocytes were lysed in 15%SDS, 100 mmol l' Tris-HCl pH 6.8, 40 mmol l' PMSF and10 mmol 1-1 EDTA, with vortexing every 5 min for 25 minplus trituration through a fine needle. After centrifugation at10,000 g the supernatant collected and protein concentra­tions determined using the Bradford reagent (Biorad pro­tein microassay kit), followed by standard Western blottingtechniques. Briefly, lysates were diluted in Laemmli Samplebuffer (15% SDS) and electrophoresed on acrylamide gels,followed by blotting onto a nitrocellulose membrane (Hy­bond C, Amersham). Membranes were then exposed to pri­mary mouse monoclonal antibodies for SERCA2a andphospholamban and a secondary anti-mouse Ig, peroxidaselinked, species specific F(ab ')2 fragment from sheep (Affin­ity Bioreagents Inc. , Oolden, CO, USA). Binding of sec­ondary antibodies was detected using the ECL system(Amersham).

Statist ical analysis

Results for a number of myocytes for a given preparationwere pooled, so that n values for statistics refer to prepara­tions , except where indicated. Results are expressed as mean± S.E.M. Comparisons were performed using paired Studentt-tests where appropriate , otherwise groups r-tests or one-wayANOVA. Differences between frequency curves were deter­mined by repeated measures ANOYA.

105

Results Rabbit

Infection of adult rabbit myocytes with adenovirus expressingthe antisense sequence for phospholamban (Ad.PlbAs .GFP)was able to decrease phospholamban levels by more than50% in 48 h. Relative OD units decreased from 6.8 ± 1.8 to3.0 ± 2. 1. This compares with a 5-fold overexpression ofSERCA2a using the Ad.SERCA2a.GFP virus [6, 8]. Ad.Plb­As.GFP did not alter SERCA2a levels (data not shown).

8 Systolic -+-Con-o-SERCA

,'.- Plb-As

2

3

32

Stimulation frequency, Hz

1 2

Stimulation frequency, Hz

2

o +--J-=--=----,-----,--------r­o

8 Diastolic

o -t-------,----.-------,­o

Fig. J. Frequency-dependent increase in contraction amplitude (upperpanel) and diastol ic shortening (lower panel) in rabbit myocytes from 6preparations cultured for 48 h without infection (Con. n = 14 cells). infectedwith Ad.SERCA2 a.OFP (SERCA, n =17) or Ad.PlbAs.OFP (Plb-A s, n =17). Both SERCA and Plb-As curves were significantly different from Con(p < 0.001 in each case) but were not significantly different from each other.

In rabbit myocytes (Fig. I) Ad.SERCA2a.GFP- and Ad.Plb­As.GFP-treated myocytes showed enhancement of contrac­tion amplitude in 2 mM Ca2+. Repeated measures ANOVAshowed significant differences between control and Ad.­SERCA2a.GFP or control and Ad.PlbAs.GFP, but not be­tween Ad.PlbAs.GFP and Ad .SERCA2a.GFP. We havepreviously shown that infection with adenovirus over­expressing GFP alone has no effect of contraction over thisrange of frequencies [8]. A similar pattern was seen in ratmyocytes (Fig. 2), with SERCA2a overexpression and phos­pholamban down-regulation equipotent in enhancing con­traction. There was a tendency for the effect to be morefrequency-dependent in rabbit myocytes than in rat, with asmaller increment in contraction seen at slower rates. In nei­ther species was there any effect on diastolic contracture: thisdiffers from our previous findings with myocytes contractingin 4 mM Ca2+ [8]. Contraction amplitude was not maximallyenhanced by adenoviral infections, since stimulation by the~-adrenoceptor agonist isoproterenol (1 flM) produced largerincreases (maximum amplitude at 0.5 Hz, % shortening, rat13.6 ± 0.6%, n = 5; rabbit 9.3 ± 0.5 , n = 7).

Contraction amplitude with increasing stimulationfrequency

Beat duration with increasing stimulation frequency

In rabbit myocytes, acceleration of contraction and relaxationby adenoviral vectors was robust. Figure 3 shows matched datafrom 9 preparations where time-to-peak contraction (TTP)and times-to-50 and 90% relaxation (R50, R90) were deter­mined at the basal frequency of 0.5 Hz in 5-8 cells from eachgroup in each preparation. SERCA2a overexpression wassomewhat more effective than phospholamban down-regu­lation, giving significant decreases of around 50% in TTP,R50 and R90. The effects of Ad.PlbAs.GFP were in a simi­lar direction, but only reached statistical significance forR50 . However, differences between Ad.SERCA2a.GFP andAd.PlbAs.GFP did not reach statistical significance . For ratmyocytes, results at the basal frequency showed a moremodest effect of either Ad.PlbAs.GFP or Ad.SERCA2a.OFP

(Fig. 4). The decrease in TTP was significant only for Ad.Plb­As.OFP, and for R50 only for Ad.SERCA2a.GFP.

Increasing stimulation frequency shortens beat duration inthe absence of other interventions. The interaction betweenfrequency-dependent acceleration in rat myocytes and thatinduced by Ad.SERCA2a.OFP or Ad.PlbAs .OFP is shown inFig. 5. Increases in stimulation frequency from 0.2-3 Hz re­duced TTP by 33 ± 7% (p < 0.001, n = 9), but there was nosignificant difference between frequency-response curves forinfected and non-infected myocytes. R50 was reduced 51 ±7% over the same frequency range, and there was a signifi­cant additive effect of either Ad.SERCA2a.OFP (p < 0.001)and Ad.PlbAs.OFP (p <0.001). Overexpression of SERCA2aand down-regulation of phospholamban were equipotent intheir acceleration of relaxation at all stimulation frequencies .

106

Rat Rabbit

TIP250

12

10OJ

.~ 8Q)

'§ 6s:(/)

cf. 4

Systolic

! ! ,...., , , .

-+-Con

-o-SERCA..• - Plb-As

200

en 150E

100

Con

*

2

*

PLB-As SERCACono-'--..L-_ -'---=="--

enE

31 2

Stimulation frequency, Hz

25 R501 2 3

Stimulation frequency, Hz 20

*en 15E10

50

0Diastolic Con PLB-As SERCA

R90

0+-------,-----.------,­o

8

.~cQ)t:i?4(/)

-;R.o2

Fig. 2. Frequency-dependent increase in contraction amplitude (upperpane l) and diastolic shortening (low er panel) in rat myocytes from 4 prepa ­rations cultured for 48 h without infection (Con , n =9 cells) , infec ted withAd.SERCA2 a.GFP (SERCA, n = 13) or Ad .PlbAs .GFP (Plb-As, n = I I) .Both SERCA and Plb- As curves were significantly different from Con (p< 0.0 I for SERCA, p < 0.02 for Plb-As) but were not significant ly differ­ent from each other.

Fig. 3. Time -to-peak contraction (TTP) and times -to-50% and 90% relaxa­tion (R50, R90) in rabbit myocytes from 9 preparations (5-8 cells from eachpreparation studied for each condit ion) from myocytes cultured for 48 h with­out infectio n (Con), with Ad.SERCA2a.GFP (SERCA) or Ad.PlbAs.GFP(Plb-AS). Significantly different from Con *p < 0.05, **p < 0.01. SERCAand Plb-As were not significantly different from each othe r.

Similarly, late relaxation (R90) was significantly and equallyenhanced by Ad.SERCA2a .GFP or Ad.PlbAs .GFP.

Discussion

Three main points emerge from the data reporte d here (1)SERCA2a up-regulation and phospholamban down-regula­tion are both effective in increasing contraction amplitude andaccelerating contraction in isolated myocytes, (2) the effecton relaxation is more marked in rabb it than in rat myocytesand (3) the effect of ei ther SERCA2a overexpression orphospholamban decrease on beat duration is quantitativelyless than the acceleration due to increasing stimu lation fre-

quency, and is additive with the frequency-dependent effect.These points will be cons idered in turn .

Marked effects of SERCA2a up-regulation by adenovirushave previously been shown by ourselves and other workers[5, 6, 8], but down-regulation of phospholamban was surpris­ingly effective in producing similar effects on both contrac­tion amplitude and contraction or relaxation speed. Completedown-regul ation of pho spholamb an has previousl y beenshown to be effective in stimulating contractile function intransgenic mice [4], with myocytes from knockout animalshaving contraction amplitudes approximately double thosefrom wild-type. This is similar to the maximum response inthe present study, although true quantitative compar isons aredifficu lt because experiments with mouse myocytes were

107

2 3

TIPRat Rat

TIP100

100 * en

en E

E 5050

00 0

Con PlbAs SERCA

R5075

-+--Con-o- SERCA--·- Plb-As

320 +-- - -,-- - ---,-- - -,-o

~50 ~)'25

Con PLB-As SERCA

en 50E

25

R50

**75

R90

}*

2 3

Stimu lation frequency, Hz

0 +-- - -,-- ----,--- -,­o

PLB-As SERCACon

en 10E

Fig. 4. Time-to-peak contraction (TTP) and times-to-50% and 90% relaxa­tion (R50, R90) in rat myocytes from 5 preparations (5-6 cell s from eachpreparation studied for each condition) from myocytes cultured for 48 h with­out infection (Can), with Ad.SERCA2a.GFP (SERCA) or Ad.PlbAs.GFP(Plb-AS) . Significantly different from Ca n *p < 0.05, **p < 0.01 . SERCAand Plb-As were not significantly different from each other.

Fig. 5. Frequency-dependent decrease in time-to-peak contraction (TTP)and times-to-50 and 90% relaxation (R50, R90) in rat myocy tes from 4preparations cultured for 48 h without infection (Can, n =9 cells) , infectedwith Ad.SERCA2a.GFP (SERCA, n = 13) or Ad.PlbAs.GFP (Plb-As, n =I I). For R50 and R90, both SERCA and Plb-As curves were significantlydifferent from Can (R50, p < 0.00\ for SERCA or Plb-AS vs. Can, R90, p< 0.002 SERCA vs. Ca n, p < 0.02 for Plb-As vs. Can) but were not signifi­cantly different from each other.

performed at a stimulation frequency of 0.5 Hz, which is closeto rested state for this species, and at room temperature. How­ever, adenoviral down -regulation of phospholamban has pre­viously had mixed success. A 54% decrease in phospholambanlevels in adult rabbit myocytes had no significant effect oncontraction amplitude or R50 , althou gh the velocity of short­ening was increased [7]. In neonatal rat cardiomyocytes, how­ever, a reduction in phospholamban of 37 % resulted inhalving of the time-to-50% declin e of the Ca2+ transient [18] .While there is a suggestion in the present study that SERCA2aoverexpre ssion was functionally better than phospholambandown-regulation (more effective on beat duration in rabbit,greater enhancement of amplitude in rat), differences werenot statistically significan t. Both SERCA2a overexpression

and phospholamban down-regulation increased contractionampl itude by 50-100% in both species , and decreased R50to around half the orig inal value in rab bit myoc ytes. It is dif­ficult to relate protein levels to contraction in a quantitativemanner, since non-viable or non-infected cell s will influencethe bioc hemical measurem ents whereas these cells will notbe used for contraction experiments (since they have poormorphology, do not contract or do not display green fluores­cence ). However, we estimate that SERCA2a levels were in­creased by around 5-fo ld, while phospholamban was onlydecreased to 50% of initial values . This suggests that there isa limitatio n on the effectiveness of SERCA2a overexpression,which might be a result of the number of SERCA2a molecules

108

that the SR membrane is capable of supporting. It is unlikelythat it represent some natural limitation in the myocytes be­cause catecholamine stimulation is able to increase shorten­ing to levels greater than those seen with adenoviral infection,and increasing frequency can produce more marked effectson relaxation. An upper limit on SERCA2a incorporation hasbeen suggested previously, in a quantitative study using ad­enoviral vectors in chick embryo myocytes [19]. While ex­pression ofEGFP and SERCA2a mRNA continued to rise withincreasing viral titre, the SERCA2a protein levels reached anasymptote at amounts 3-fold greater than control.

Enhancement of contraction amplitude was quantitativelysimilar between rat and rabbit myocytes following adenoviralstimulation of SERCA2a, but relaxation parameters were lessmarkedly affected in rat. A species difference had been pre­dicted, since the strong dependence on SR Ca2+ uptake forrelaxation in rat compared to rabbit is well known [15]. It ispossible that the limitation on SERCA2a incorporation mightbe restricting the maximum response in the rat. Minimal ef­fects of SERCA2a overexpression on relaxation were seenin transgenic mice, another species with high basal SR Ca2+

uptake .A 2.6-fold increase in mRNA translated into only 1.2­fold increases in SERCA2a protein, and R50 for myocyterelengthening was accelerated by a modest 22% (compara­ble to the 20% decrease in R50 for rat in the present study). 1

More robust overexpression of SERCA2a increased mRNAby 3.9 and 7.9 fold in two separate lines, but again proteinwas increased only 1.31 and 1.54 fold respectively [2]. WhenSERCA 1a (the fast skeletal isoform) was overexpressed thenmore effect on relaxation was observed, but down-regula­tion of the native SERCA2a occurred at the same time asSERCAla was incorporated [20].

The effect of SERCA2a overexpression on contractionamplitude was frequency-dependent, as has been shown be­fore for transgenic mouse trabeculae [21] and adult rabbit [8]or human [6] myocytes. However, the acceleration of relaxa­tion as a result of increasing stimulation frequency was in­dependent of, and additive with, acceleration by SERCA2aoverexpression (or phospholamban down-regulation). In factthe frequency-dependent effect was greater in magnitude,with a change from 0.2-3 Hz decreasing R50 by 35 msec,compared to the 17 msec decrease due to Ad.SERCA2a.GFP.This suggests that SERCA2a-independent mechanisms con­tribute to the frequency-dependent acceleration of relaxation.Action potential duration (APD) increases with increasingstimulation frequency in the rat [22], so that it is unlikely thatacceleration of repolarisation underlies the abbreviation ofthe twitch. A more probable candidate is the Nat/Ca-t-ex­changer: intracellular Na' activity increases with stimulationfrequency [23], and this combined with the longer APD mayincrease the likelihood of Ca2+ extrusion via the exchangerduring diastole.

In conclusion, this study confirms the utility of gene trans­fer to stimulate SERCA2a activity and produce functionaleffects on contractility in rat and rabbit ventricle. Despite somespecies-dependent modification, the effects of increasedSERCA2a activity are broadly similar in rat and rabbit.Moderate phospholamban down-regulation can be as almosteffective as robust SERCA2a overexpression, and neitherstimulates contraction or relaxation beyond the normal physi­ological range . This adds further strength to the conclusionsin vivo which show that SERCA2a overexpression can re­verse failure-induced changes in contractility but does notdamage the heart by overstimulation [14].

Acknowledgements

We would like to thank Peter O'Gara for preparation of my­ocytes. This work was supported by British Heart Founda­tion grant FS/99053 .

References

l. He H, Giordano FJ, Hilal Dandan R, Choi DJ, Rockman HA, Mc­Donough PM, Bluhm WF, Meyer M, Sayen MR, Swanson E, DillmannWH: Overexpression of the rat sarcopl asmic reticulum Ca2+ATPasegene in the heart of transgenic mice accelerates calcium transients andcardiac relaxation . J Clin Invest 100: 380-389, 1997

2. Baker DL, Hashimoto K, Grupp IL, Ji Y, Reed T, Loukianov E, Grupp0, Bhagwhat A, Hoil B, Walsh R, Marban E, Periasamy M: Targetedoverexpre ssion of the sarcoplasmic reticulum Ca1+-ATPase increasescardiac contractility in transgenic mouse hearts . Circ Res 83: 1205­1214,1998

3. Luo W, Grupp IL , Ponniah S, Grupp 0, Duffy H, Doetschman T,Kranias EG: Targeted ablation of the phopholamban gene Is associ­ated with markedly enhanced myocardial contractility and loss of~·

agonist stimulation. Circ Res 75: 401-409,19944. Wolska BM, Stojanovic MO, Luo W, Kranias EO, Solaro RJ: Effect of

ablation of phospholamban on dynamics of cardiac myocyte contrac­tion and intracellular Ca2+. Am J Physiol 271: C391-C397, 1996

5. Meyer M, Dillmann WH: Sarcoplasmic reticulum Ca2+-ATPaseover­expression by adenovirus mediated gene transfer and in transgenicmice. Cardiovasc Res 37: 360-366, 1998

6. del Monte F, Harding SE, Schmidt U, Matsui T, Kang ZB, Dec GW,Gwathmey JK, Rosenzweig A, Hajjar RJ: Restoration of contractilefunction in isolated cardiomyocytes from failing human hearts by genetransfer of SERCA2a. Circulation 100: 2308-2311 , 1999

7. He H, Meyer M, Martin JL, McDonough PM, Ho P, Lou X, LewWY, Hilal D, Dillmann WH : Effects of mutant and anti sense RNAof phospholamban on SR Ca/t-Al'Pasc activity and cardiac myocytecontractility. Circulation 100: 974-980, 1999

8. Davia K, Bernobich E, Ranu HK, del Monte F, Terracciano CMN ,MacLeod KT, Adamson DL, Chaudhri B, Hajj ar RJ, Harding SE:SERCA2a overexpression decreases the incidence of aftercontractionsin adult rabbit ventricular myocytes. J Mol Cell Cardiol33: 1005-1015,2001

9. del Monte F, Harding SE, Dec GW, Gwath mey JK, Hajja r RJ: Target­ing phospholamban in human heart failure by gene transfer. Circula­tion 105: 904-907, 2002

10. Hajjar RJ, Kang JX, Gwathmey JK, Rosenzweig A: Physiological ef­fects of adenovira l gene transfer of sarcoplasmic reticulum calciumATPase in isolated rat myocy tes. Circu lation 95: 423-429,1997

I I. Gior dano FJ, He H, McDonough P, Meyer M, Sayen MR, DillmannWH: Adenovirus-mediated gene transfer reconstitutes depressed sar­coplasmic reticulum Ca2+-ATPase levels and shortens prolonged car­diac myocyte Ca" transient s. Circ ulation 96: 400-403, 1997

12. Schmidt U, de l Monte F, Miyamoto MI, Matsui T, Gwathmey JK,Rosenzweig A, Hajjar RJ: Restoration of diastolic funct ion in senes­cen t rat hearts through adenoviral gene transfer of sarcop lasmic reticu­lum Ca' +-ATPase . Circu lation 101: 790-796, 2000

13. Miyamoto MI, del Monte F, Schmidt U, DiSalvo TS, Kang ZB, MatsuiT, Guerrero JL, Gwathmey JK, Rosenzweig A, Hajjar RJ: Adenoviralgene transfer of SERCA2a improves left-ventricu lar function in aor­tic-banded rats in transition to heart failure. Proc Natl Acad Sci USA97:793-798,2000

14. de l Monte F, Williams E, Lebeche D, Schm idt U, Rosenzweig A,Gwathmey JK, Lewandowski ED, Hajjar RJ: Improvement in survivaland cardiac metabolism after gene transfer of sarcop lasmic reticulumCa2+-ATPase in a rat model of heart failure . Circulation 104: 1424­1429, 2001

15. Bers DM, Bassani JW, Bassan i RA: Na-Ca exchange and Ca fluxesduring cont raction and relaxation in mammali an ventricu lar muscle(Review) . Ann NY Acad Sci 779: 430-442,1996

16. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B: A sim-

109

plified system for generating recombinant adenoviruses. Proc NatlAcad Sci USA 95: 2509-25 14, 1998

17. Davia K, Hajjar RJ, Terracciano CMN, Kent NS, Ranu HK, O'Gara P,Rosenzweig A, Harding SE: Functional alterations in adult rat myocytesafter overexpression of pho spholamban usi ng adenovirus . PhysiolGenom I : 41-50,1999

18. Eizema K, Fechner H, Bezstaros ti K, Schneider-Rasp S, van der LaarseA, Wang H, Schultheiss HP,Poller WC, Lamers JM: Adenovirus-basedphospholamban antisense expre ssion as a novel approach to improvecard iac contr actile dysfunction: Comparison of a constitutive viralversus an endothelin-I -respo nsive cardiac promoter. Circulation 101:2193-2 199,2000

19. Sumbilla C, Cavagna M, Zhong L, Ma H, Lewis D, Farrance I, InesiG: Comparison of SERCAI and SERCA2a expressed in COS-I cellsand card iac myocytes. Am J Physio I277: H2381- H2391, 1999

20. Ji Y, Loukianov E, Loukianova T, Jones LR, Periasamy M: SERCA lacan functionally substitute for SERCA 2a in the heart. Am J Physiol276: H89- H97, 1999

21. Hashimoto K, Perez NO, Kusuoka H, Baker DL, Periasamy M, MarbanE: Frequency-dependent change s in calcium cycling and contracti leactivat ion in SERCA2a transge nic mice. Basic Res Cardiol 95: 144­15 1, 2000

22. Schouten VJ, ter Keurs HE: Role oflca and Na+/Ca2+ exchange in theforce-frequency relations hip of rat heart muscle . J Mol Cell 23: 1039­1050,199 1

23. Framp ton JE, Harrison SM, Boyett MR, Orchard CH: Ca" and Na' inrat myocytes showing differe nt force -freq uency relationshi ps. Am JPhysiol 261: C739-C750 1991

Molecular and Cellular Biochemistry 251: 111-117, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Losartan inhibits myosin isoform shift aftermyocardial infarction in rats

Mei Luo Zhang, Samer Elkassem, Allen W. Davidoff, Kaoru Saito andHenk E.D.J. ter KeursDepartments ofMedicine and Physiology and Biophysics, Faculty ofMedicine, University of Calgary, Calgary, Alberta ,Canada

Abstract

Hypertrophy and heart failure following a myocardial infarction in rodents are accompanied by a switch of myosin isoformsfrom VI to Vy The angiotensin II receptor blocker, Losartan, has been demonstrated to improve cardiac function and long­term survival after myocardial infarction. In this study we have investigated whether chronic Losartan treatment affects myosinisoform compos ition in the hearts of rats following a myocardial infarction. Rats were subjected to coronary artery ligationand received either Losartan (l giL ) in the drinking water or water only. Four months after myocardial infarction, rats wereclassified as having either conge stive heart failure (cMI) or uncomplicated myocardial infarction (uMI) based on their lungweight to body weight ratio (LW/BW) . Compared with sham operated rats, uMI rats showed a 68.5% increase in the relativecontribution of V3 and a 33.7% decrease in the relative contribution of V I (p < 0.05). Untreated cMI showed 39.7% more V 3and 38.2% less VI when compared with untreated uMI (p < 0.05). Losartan treatment after myocardial infarction reduced theincidence of cMI from 30.4 to 4.5% and scar size from 1.52 ± 0.07 to 0.94 ± 0.11 em' respectively. The percentage of V I inLosartan treated uMI (LuMI) was 25.2% higher than the percentage of V. in untreated uMI (p < 0.05), whereas the percentageof V

3in LuMI was 24.2% lower than that in untreated uMI (p < 0.05). A positive correlation of V3 myosin and scar area was

observed. Our study suggest s that expre ssion of V3 myosin in the left ventricle is associated with scar size and the progres s ofhemodyn amic changes after myocardial infarct ion. Losartan treatment reduces scar size and wall stress of the heart after theinfarct, and therefore inhibits the signals shifting myosin isoform expression from V I to V3 after a myocardial infarction. (MolCell Biochem 251: 111-117, 2003)

Key words: angiotensin II blockade, Losartan, myocardial infarction, myosin isoforms

Introduction

The distribution of myosin isoform s has been shown to beassociated with the contractile performance of myocardium.In rat ventricle s, three distinct myosin isoforms have beencharacterized based on their electrophoretic mobility andATPase activity [1,2] . These three isoforms consist of twodistinct heavy chains (a and ~) with identical light chains andare designated as VI (aa homodimer), V

2(a~ heterodimer)

and V3 (~~ homodimer) respec tively. VI myosin is known asfast myosin with higher ATPase activit y, while V3 myosin isreferred to as slow myosin with lower ATPase activity. In ro-

dents the expression of cardiac myosin isoforms is regulatedduring development with V3 myosin predominant in fetalstages and V1 myosin predominant in young adults [3]. Whenthe heart undergoes hemodynamic overload after myocardialinfarction, cardiac hypertrophy develops and a transition fromV1 to V3 myosin isoform production occurs accompanied byactivation of other genes normall y expressed in fetal stages[4-6]. The redistribution of myosin isoforms is consideredto be a hallmark of phenotypic changes of the hypertrophiedmyocardium and may contr ibute to slowed contr action andrelaxation of the hypertrophied cardiac myocytes [7].

Potential signals that are involved in this isoform transi-

Addressfor offprints: H.E.DJ. ter Keurs, Departments of Medicineand Physiology and Biophysics, University of Calgary, 3330 Hospital Drive N.W., Calgary,Alberta, T2N 4NI , Canada (E-mail: terkeurs@ucalgary.ca)

112

tion in the infarcted heart remain to be elucidated. Accumu­lating evidence suggests that the cardiac renin-angiotensinsystem plays an important role in the hypertrophic adapta­tion of the heart to pressure overloads after myocardial in­farction [8, 9) . Studies in isolated fetal cardiomyocytessubjected to angiotensin 11 revealed growth and activationof fetal genes similar to that seen in mechanically stretchedcardiac cells [10-12] . Increased angiotensin converting en­zyme (ACE) activity, with increased angiotensin II receptordensity and angiotensin II concentration in the infarct zonehas been shown to be associated with ventricular remodelingafter myocardial infarction [12-14] . Inhibition of angiotensinproduction and activity by ACE inhibitors or specific angi­otensin receptor blockers attenuates cardiac hypertrophy, lim­its infarct size and improves left ventricular function in animalmodels and clinical trials [15-17].

The purpose of the present study is to examine whetherblocking angiotensin II receptors prevents the shift in pro­duction of ventricular myosin isoforms after myocardial in­farction . Heart failure after myocardial infarction in rats ismarked by increased LWIBW and is associated with a largemyocardial infarct area , generally exceeding 1.5 em- [18]. Inrats with infarct size less than 1.5 ern', the LW/BW ratio wasnot significantly different from that of sham operated animals.This finding allows us to differentiate between clinical mani­festations of congestive heart failure and the status of inf­arcted animal s lacking major hemodynamic complications.We used this model to investigate the myosin isoform distri­bution under different hemodynamic conditions after myo­cardial infarction and the effect of an angiotensin II receptorantagonist, Losartan on the expres sion of myosin isoforms.

Materials and methods

Animals and experimental myocardial infarction

Two hundred and forty male LBN rats, weighing 200-250g,were purchased from Harlan Sprague Dawley (Indiana, USA)and housed in the Animal Resource Center in our instituteunder standard conditions. Coronary artery ligation was per­formed to induce myocardial infarction according to thetechnique of Johns [19]. The rats were anesthetized withperitoneal injection of sodium pentobarbital (39 mglkg) dis­solved in 0.9% NaCl. A left thoracotomy was performed andthe left anterior descending coronary artery was ligated 1-2mm from its origin with a 7-0 silk suture. The chest was thenclosed. The same procedure was followed for sham oper­ated animal s leaving the ligature untied. A rodent ventila­tor (Harvard) was used during the surgery.The acute mortalityin this procedure was approximately 50% in coronary ligatedrats.

Experimental protocol

Rats were divided into five groups: (1) Sham operated group.(2) uMI group : Infarcted rats with LWIBW < 2 S.D. from themean of controls. (3) cMI group : Infarcted rats with LWIBW> 2 S.D. above the mean of controls. (4) LuMI: uMI grouptreated with Losartan. (5) LcMI: cMI group treated withLosartan . For myosin isoform analysis , each group had 7 ratswith the exception of the LcMI group in which only 2 ratsamples were included because of dramatically reduced in­cidence of heart failure after Losartan treatment.

Losartan was kindly provided by Merck Frosst Inc. Thetreated groups received the drug at I giL in the drinking wa­ter starting immediately after recovery from surgery. Un­treated groups were given standard drinking water. Fourmonths after treatment, rats were sacrificed and hearts weresubject to myosin isoform analysis .

Tissue preparation

Hearts were removed from rats anesthetized with ether andperfused with HEPES buffer. Lung and body weights wereobtained and the LW/BW ratio was calculated. After trim­ming of the vessels and connective tissue, the left and rightatria, ventricles and scar tissue were weighed separately. Alltissues were snap frozen in liquid nitrogen and stored at ­80°C until assay. Left ventricle (LV) and right ventricle (RV)mass were normalized to BW in order to have a quantitativecomparison .After the scar had been excised, its boundary wastraced on paper. The area of the scar was determined fromthe weight of the paper replica.

Myosin isoform analysis

Native myosin isoforms were separated by the pyrophosphategel electrophoresis technique modified from Hoh [20]. Hearttissue from the left ventricles was homogenized with a dis­membrator (Braun, Melsungen, BFR) . Myosin was extractedin 10 volumes of buffer containing 100 mM Na4pp 7' 5 mMEDTA, and 2 mM Mercaptoethanol , pH 8.8 at 4°C. Thesupernatant was collected by centrifugation at 20,000 g for30 min at 4°C and mixed with an equal volume of ice-coldglycerol. Protein concentration was determined by a dye­binding assay (Bio-Rad). The purified myosin samples werestored at -20°C until use.

Electrophoresis was performed in a Pharmacia apparatusGE-2/4 (Uppsala, Sweden), which allows recirculation ofbuffer between the anodic and cathodic reservoirs. Gels wereprepared in cylindrical tubes (6 x 0.5 em) with the followingcomposition: 20 mM Na4pp 7; 3.88 % acrylamide; 0.12 %bis-acrylamide; 10% glycerol ; 0.15% TEMED and 48 mg%

freshly prepared ammonium persulphate. Two to three mgmyosin samples were loaded directly on to the top of thegels. Electrophoresis was carried out at a constant voltageof 60 volts for 24 h at 4DC with continuous circulation of theupper and lower chamber buffer (20 mM NalPT 10% glyc­erol, 4 mM systeine pH 8.8). Gels were stained with 0.025%Coomassie blue (G-250) in 10% acetic acid and 25% isopro­panol overnight and destained in 10% methanol and 15%acetic acid for 24 h.

The density of each myosin isoform band was quantifiedwith a Matlab computer program using Gaussian curve fit­ting. Myosin isoforms were expressed as the percentage ofthe total area under the curves.

Modeling of the LV parameters

The LV was modeled as a truncated rotational ellipsoid withan ellipticity (long axis/short axis ratio) of 2.7 and a wallthickness of 3.1 mm.The ellipticity in untreated and Losartantreated animals was the same; wall thickness without a myo­cardial infarction was reduced to 2.5 mm by Losartan treat­ment. These assumptions yielded a LV volume and LV massand shape, which were identical to those observed experimen­tally. Then, we assumed that the effect of an MI was to causea fibrous scar and a proportional increase of LV short axisdiameter (l mm/rnm?of scar in untreated, but amm/mm? ofscar in Losartan treated animals , respectively) and wall thick­ness (2.6 mm/mm- of scar in untreated and 3.6 mm/mm' ofscar in Losartan treated animals, respectively). These assump­tions lead to identity of the relations, in the model comparedto experimental data, between scar area and LV mass, LVvolume, and ellipticity (data not shown).

Statistical analysis

The data are shown as mean ± S.E.M. The data from the ex­perimental groups was compared using one-way ANOVAfol­lowed by a Student Newman-Keuls test. Differences in themyosin isoform percentages and cardiac parameters wereconsidered significant at a p < 0.05 levels .

113

Results

Effects ofLosartan treatment on heart failure incidenceand cardiac parameters after myocardial infarction

Losartan treatment dramatically reduced the incidence ofcongestive heart failure after myocardial infarction, i.e. 4.5%(2 out of 44 animals) compared to 30.4% (17 out of 56) inrats without treatment. Body weight, LWIBW and cardiacmass are presented in Table 1. Compared with the sham op­erated group, LW/BW and RV/BW were unchanged in uMI,but significantly increased in cMI (p < 0.05). LVIBW in bothuMI and cMI groups remained constant, despite substantiallosses of myocardium due to infarction, indicating the devel­opment of hypertrophy in the remaining myocardium of theleft ventricle. The scar area in cMI rats was significantlylarger than that in uMI rats and was responsible for the se­vere hemodynamic changes in the heart after myocardial in­farction. Losartan treatment significantly reduced the LVIBWin LuMI group when compared to the sham and uMI rats sug­gest ing decreased hypertrophy of the left ventricle. The LV/BW in 2 LcMI rats was reduced by a proportion similar toLuMI. Losartan treated rats showed significant reduced scararea (0.94 ± 0.07 ern") when compared with non-treated rats(1.52 ± 0.11 em', p < 0.01).

Effects ofLosartan treatment on myosin isoformdistribution after myocardial infarction

Figure 1 shows the representative myosin isoform electro­phoresis patterns and the corresponding densitometric pro ­files together with fitted density distributions assumingGaussian distribution for each myosin isoform.

The relative proportions of ventricular isomyosins areshown in Fig. 2. Myocardial infarction modified the iso­enzymic profile of left ventricle myosin. In sham operatedcontrols, the proportion of VI' V

2and V

3myosin were 51.9

± 3.0, 28.7 ± 1.0 and 19.5 ± 2.1% respectively. The distribu­tion ofleft ventricle myosin isoforms showed a V I dominantpattern. Compared with controls, the proportion of VI myosindecreased significantly in the uMI group (p < 0.05), whereas

Table 1. Body weight (BW), Lung weight (LW)/BW, right ventricle mass (RV)/BW, left ventricle mass (LV)/BW and Scar area in different groups

Sham (n =27) uMI (n =39) cMI (n =17) LuMI (n =42) LcMI (n - 2)

BW (g) 474.37 ± 12.97 497 .82 ± 11.36 470.96 ± 10.82 433.75 ± 7.23 428 .5LW/BW (mg/g) 3.45 ± 0.13 3.43 ± 0.07 7.64 ± 0.03*1 3.44 ± 0.09 8.04RV/BW (mg/g) 0.47 ± 0.01 0.49 ± 0.002 1.12 ± 0.04* ' 0.44 ± 0.12 1.03LV/BW (mg/g) 1.97 ± 0.06 1.72±0.13 1.83 ± 0.05 1.40 ± 0.03*' 1.42Scar area (em") 1.23 ± 0.11 2.07 ± 0.J4! 0.88 ± 0.07 1.36

Values are means ± S.E. *Significant vs. sham controls, p < 0.05; ' significant vs. uMI, p < 0.05.

114

V, V3 v, V3v, V3 V2

JJi iV:~ V2 /1 I••II" VV •

r~V' It:\~J \ 1

3J '-'\

I 1 '1 I \ j I: \r . ', , _J~:.._ .t J ~ _ _ .» .L~ v· .;.' • \. \.. - ---J'_ _ x, x.,

Sham uMI eMI LuMI LeMI

Fig. 1. The represen tative myosin electrophoresis pattern in sham. uMI. cMI. LuMI and LcMI groups. V,. V, and V3

myosin isoforms are indicated. Dashedlines are fitting lines for the three myosin isoform bands. Solid lines indicate Gaussian dist ribution of individual myosin isoform band.

the V3 proportion increased (p < 0.05). A relatively equalamo unt of VI (34.4 ± 1.5%), V

2(32.9 ± 1.2%) and V

3(32 .8

± 1.2%) has been observed in uM!. In cMI rats, the V3

myosin(45.8 ± 1.7%) was further increased (p < 0.05), while corre­sponding ly, the V I myosin (21.3 ± 1.1 %) was dramaticallydecreased (p < 0.05) compared with uMI rat. The distribu­tion of myos in isoforms in the cMI group showed a V3 domi­nant pattern.

Losartan treatment significantly inhibited the shift of my­osin isoforms in left ventricles after myocardial infarction.Compared with uMI rats, the distribution of myosin isoforms

in LuMI showed a V I dominant pattern. The V I myos in (43.0± 2.1 %) was significantly higher, and V3 myosin (24 .9 ±1.7%) was significantly lower in LuMI than that in uMI (p <0.05) . Two of LcMI rats exhibited higher V I (31.6%) andlower V3 (34.7%) myos in isoforms when compared with theuntreated cMI group. However it' s statistical significance wasnot able to be assessed. V2 isoform did not show a signifi ­cant difference among the groups. The distribution of myosinisoforms after myocardial infarction was not completely nor­malized with the Losartan treatment. The proportion of V

3and V: myosin in LuMI was significantly different from thatin the sham operated group (p < 0.05) .

Fig. 2. Myosin isoform distribution (mean ± S.E.M.) in rat left ventriclesfrom each experimental group . Myosin was purified from left ventricles andsubjected to pyrophosphate gel electrophoresis . The gels were photographedand the density of the myosin bands was quantified with a Matlab program .(0) V, myosin isoform . ( EJ ) V, myosin isoform . (. ) V

3myosin isoform.

*p < 0.05 vs. corresponding value in sham group . 'p < 0.05 vs. correspond­ing value in uMI group .

Correlation ofmyosin isoforms with scar area andcalculated myocyte volume

The correlation between V3

myosin isoform proportion andthe scar area after myocardial infarction was examined byplotting the percentage of V

3myosin against scar area as

shown in Fig. 3. A tight positive correlation between V3

my­osin isoform proportion and scar area was observed (R =0.99) .

Hav ing satisfied the requirement for identical relations be­tween scar area and LV mass volume and ellipticity, we ob­tained the fractio n of the LV surface covered by the scar fromthe model (0.16 %/mm2scar in untreated and 0.23 %/mm2scarin Losartan treated animals) as well as dimension s of thesurviving cells in the LV wall. Cell length in the model in­creased in the untreated heart (0.16%/mm2scar), while crosssectional area of the cells (0.11% /rnm?scar) and cell volume(0.33 %/mm2 scar) were increased. In contrast , cell length inthe model did not change in the Losartan treated LV, whilecross sectional area of the cells and cell volume increased only

eMI LuMI LeMISham uMI

60

~50 ·t ·t0

T---E 40'-0- -0 30

~

CJ) ;tCCJ) 200>.

:2: 10

0

115

dominant pattern of myosin isoform expression, while ratswith congestive heart failure displayed a V3 dominant pat­tern . A relatively equal percentage of VI and V3 were ob­served in the uncomplicated group. Rats with heart failureexpressed higher V3 than that in the uncomplicated group,indicating the expression of V.isoform parallels the severityof hemodynamic changes after myocardial infarction. Thechange from V I to V3production has been shown to decrea seATPase activity and speed of contraction, to reduce oxygenconsumption, and thus, perhap s to allow more efficient forcegeneration in cardiac muscle [21-23] .

Losartan treatment significantly reduced the scar size andthe incidence of heart failure after myocardial infarction . Cor­respondingly, LV/BW ratio was reduced in Losartan treatedrats indicating less hypertrophy in the ventricles. Calculatedfrom the LV model, Losartan treatment reduced the LV cellvolume and cross sectional area .The shift of myosin isoformfrom VI to V3 after myocardial infarction was inhibited byLosartan treatment. These findings indicate that the benefi­cial effects of Losartan on heart failure after myocardial in­farction are apparent in decreased cardiac hypertrophy as wellas in qualitative features of the myosin isoform distributionin myocardium. V3myosin expression was well correlatedwith the scar size indicating that the orig inal damage in theLV plays a key role on distribution of myosin isoforms in theheart after myocardial infarct ion. A linear correlation of V

3myosin expression and LV cell volume was observed in ratswithout Losartan treatment. The reduction of cell volume byLosartan was clearly larger than the reduction of the fractionof V3' This may reflect combined hemodynamic effects andreceptor dependent effects of the drug on myocyte growth ,compared to direct receptor dependent effect alone of the drugon myosin isoform expression.

Improvement of cardiac dysfunction, cardiac hypertrophyand the shift of myosin isoform by long term administrationof Losartan may involve several mechanisms. Locally pro­duced angiotensin II after myocardial infarction may havevarious effects upon the myocardium. Angiotensin II po­tentiates mechanical activity by altering catecholamine lev­els at sympathelic terminals [24]. Long term stimulation ofmyocardial contractility can lead to increased myocardialenergy consumption and can be harmful to the function ofmyocytes [25]. Angiotensin II acts as an important mediatorof stretch-induced hypertrophic response [26] and myocar­dial interstitial fibrosis [II]. The increased interstitial fi­brosis in the heart enhances organ stiffness and results indecreased diastolic function. Angiotensin II has been shownto be responsible for activation of the p53gene and inducesapoptosis in cardiac myocytes [27]. In high concentration, an­giotensin II causes card iac myocyte necrosis [28]. The inf­arcted region may extend due to further loss of myocytesinduced by apopto sis or necrosis leading to progressive ven­tricular dysfunction.All these phenomena suggest that excess

50

R=0.986

40~0

c 30'w0 50>. eft 40 :/E 20 c

.~ 30('I)

~ 20> ~

10~ 10 R=O.999

060 80 100 120 140160

MyocyteVolume (%j

00 0.5 1.5 2 2.5

Scar area (cm2)

Discussion

Fig. 3. Correlation of V1 myosin and scar area. (A) Sham group. (0) uMIgroup . (e) LuMI group. °(0 ) cMI group. (_) LcMI group . The line reflectsa second order polynomial through the data. The inset shows correla tion ofV3 myosin and calculated myocyte volume , normalized to myocyte volumeof untreated sham heart (20 pL). The line is fit through the data of untreatedSham, uMI and cM!. Treatment with Losartan appeare d to reduce myocytevolume in LuMI and LcMI animals more (35-70 %, respectiv ely) than thefraction of VJ"

In the present study, we have investigated the effects of Los­artan on myosin isoform changes in the LV after myocardialinfarction. We used the LW/BW ratio to classify the degreeof cardiac function after myocardial infarction, which al­lowed us to discriminate the adaptive process from heartfailure . In this model, 30.4 % of myocardial infarcted ratsdeveloped heart failure in a 4 month period . Comparing withthe uMI group , cMI rats showed hemodynamic dysfunctionof heart indicated by increa sed LW/BW and RV/BW ratios .The larger scar size in cMI rats was a major determinant forthe severe hemodynamic changes after myocardial infarction .However the existence of substantial scar area after myocar­dial infarction had no apparent effect on LV/BW ratio , indi­cating the development of cell hypertrophy in the remainingmyocardium. The distribution of myosin isoforms showeddistinctive patterns during the development of heart failureafter myocardial infarction. Sham operated rats showed a VI

by 0.14 %/mm2scar. The proportion of V, myosin was tightlycorrelated to the calculated myocyte volume in Sham, uMIand cMI groups (Fig . 3 inset ; R =0.99) . Losartan treatmentreduced both calculated myocyte volume and V3 myosinisoform, albeit that the reduction of cell volume was clearlylarger than the reduction of V3'

116

endogenous synthesis of angiotensin II may contribute to ini­tiation or acceleration of myocardial injury and the develop­ment of heart failure . Blocking angiotensin II activity maytherefore inhibit angiotensin II mediated downstream eventsand preserve cardiac function .

In hypertension induced cardiac hypertrophy, inhibition ofAngiotensin II formation by an ACE inhibitor or AngiotensinII effects by blockade of its receptor completely restored theshift of myosin isoform [29, 30]. In our study, Losartan treat­ment significantly but not completely normalized the myosinisoform alteration in a myocardial infarct model, similar toresults of using ACE inhibitor in this model [31]. It is possi­ble that angiotensin independent systems might be involvedin signal pathways mediating myosin isoform changes.

In conclusion, our study indicates that the distribution ofmyosin isoforms after myocardial infarction correlates withscar size and the myopathic process. Increased expression ofV3 myosin is associated with the severity of hemodynamicchange in the myocardium of the infarcted heart. Blockingangiotensin II activity with Losartan reduces infarct size andattenuates the hemodynamic changes of the heart, and there­fore inhibits myosin isoform shift after myocardial infarction.

Acknowledgements

The work was supported by grants from the CIHR and a Med­ical School Grant of the Merck Frosst Inc . (Rahway, NJ,USA) . The authors thank Merck Frosst Inc. for the gener­ous gift of Losartan. Mei Luo Zhang is supported by a post­doctoral fellowship of Merck Frosst Canada Inc. H.E.DJ. terKeurs is AHFMR Scientist.

References

I. Hoh JF, McGrath PA, Hale PT: Electrophoretic analysis of multipleforms of rat cardiac myosin : Effects of hypophy sectomy and thyrox­ine replacement. J Mol Cell Cardiol 10: 1053-1076, 1978

2. Pope B, Hoh JF, Weeds A: The ATPase activities of rat cardiac myosinisoenz ymes. FEBS Lett 118: 205-208, 1980

3. Lompre AM, Nadal-Ginard B, Mahdavi V: Expression of the cardiacventricularalpha- and beta-myosin heavy chain genes is developmentallyand hormonally regulated. J Bioi Chern 259: 6437-6446,1984

4. Martin AF, Robin son DC, Dowell RT: Isomyo sin and thyroid hor­mone levels in pressure-overloaded weanling and adult rat hearts. AmJ Physiol 248: H305-H31O , 1985

5. Haddad F, Bodell PW, Baldwin KM: Pressure-induced regulation ofmyosin expression in rodent heart . J Appl Physiol 78: 1489-1495, 1995

6. YueP, Long CS, Austin R, Chang KC, Simpson PC, Massie BM: Post­infarction heart failure in the rat is associated with distinct alterationsin cardiac myocyte molecular phenotype . J Mol Cell Cardiol30: 1615­1630, 1998

7. Dom GW, Robbins J, Ball N, Walsh RA: Myosin heavy chain regula­tion and myocyte contract ile depression after LV hypertrophy in aor­tic-banded mice. Am J Physiol267 : H400-H405, 1994

8. Reddy DS, Singh M, Ghosh S, Ganguly NK: Role of cardiac renin­angiotensin system in the development of pressure-overload left ven­tricular hypertrophy in rats with abdominal aortic constriction. Mol CellBiochem 155: 1-11 ,1996

9. Baker KM, Booz GW, Dostal DE: Cardiac actions of angiotensin II:Role of an intracardiac renin-angiotensin system . Annu Rev Physiol54:227-241 ,1992

10. Sadoshima J, Jahn L, Takahashi T, Kulik TJ, Izumo S: Molecular char­acterization of the stretch-induced adaptation of cultured cardiac cells.An in vitromodel of load-induced cardiac hypertrophy. J BioI Chern267: 10551-10560,1992

II . Sadoshima J, Izumo S: Molecular characterization of angiotensin 11­induced hypertrophy of cardiac myocytes and hyperpl asia of cardiacfibroblasts. Critical role of the AT! receptor subtype. Circ Res 73: 413­423, 1993

12. Komuro I, Kaida T, Shibazaki Y, Kurabayashi M, Katoh Y, Hoh E,Takaku F, Yazaki Y: Stretching cardiac myocytes stimulates proto­oncogene expres sion . J Bioi Chem 265: 3595-3598, 1990

13. Hirsch AT, Talsness CE, Schunkert H, Paul M, Dzau VJ: Tissue-spe­cific activation of cardiac angiotensin converting enzyme in experi­mental heart failure . Circ Res 69: 475-482, 1991

14. Yamagishi H, Kim S, Nishik imi T, Takeuchi K, Takeda T: Contribu­tion of cardiac renin-angiotensin system to ventricular remodelling inmyocardial-infarcted rats . J Mol Cell Cardiol25 : 1369-1380,1993

15. Richer C, Fornes P, Cazaubon C, Domergue V, Nisato D, GiudicelliJF: Effects of long-term angiotensin II AT! receptor blockade on sur­vival , hemodynamics and cardiac remodeling in chronic heart failurein rats (see comments). Cardiovasc Res 41: 100-108, 1999

16. Pitt B, Segal R, Martinez FA, Meurers G, Cowley AJ, Thomas I,Deedw ania PC, Ney DE, Snavely DB, Chang PI: Randomised trialof Losartan vs. captopril in patients over 65 with heart failure (Evalu­ation of Losartan in the Elderly Study, ELITE) (see comments). Lan­cet349: 747-752,1997

17. Xia QG, Chung 0 , Spitznagel H, Sandmann S, IIlner S, Rossius B,Jahnichen G, Reinecke A, Gohlke P, Unger T: Effects of a novel angi­otensin AT(I) receptor antagonist, HR720 , on rats with myocardialinfarction . Eur J Pharmacol385: 171-179, 1999

18. Davidoff AW: Congestive heart failure in the rats. Thesis , Universityof Calgary, 1998, pp 40-48

19. Johns TNP, Olson BJ: Experimental myocardial infarction. I. A methodof coronary occlusion in small animals. Ann Surg 140: 675-682, 1954

20. Hoh JY, McGrath PA, White RI: Electrophoretic analysis of multipleforms of myosin in fast-twitch and slow-twitch muscles of the chick .Biochem J 157: 87-95, 1976

21. Schwartz K, Leca rpent ier Y, Martin JL, Lompre AM, Mercadier JJ,Swynghedauw B: Myosin isoenzymic distribution correlates withspeed of myocardial contraction . J Mol Cell Cardiol 13: 1071-1075,1981

22. Alpert NR, Mulieri LA: Increased myothermal economy of isometricforce generation in compensated cardiac hypertrophy induced by pul­monary artery constriction in the rabbit. A characterization of heat lib­eration in normal and hypertrophied right ventricular papillary muscles.Circ Res 50: 491-500, 1982

23. Kissling G, Rupp H, Malloy L, Jacob R: Alterations in cardiac oxy­gen consumption under chronic pressure overload. Significance ofthe isoenzyme pattern of myosin . Basic Res Cardiol 77: 255-269,1982

24. Xiang JZ, Linz W, Becker H, Ganten D, Lang RE, Scholkens B, UngerT: Effects of converting enzyme inhibitors : Ramipril and enalapril onpeptide action and sympathetic neurotransmission in the isolated heart.Eur J Pharmacol 113: 215-223 , 1985

25. KatzAM: Potential deleterious effects of inotropic agents in the therapyof chronic heart failure . Circulation 73: III I84-III1 90, 1986

26. Sadoshima J, Xu Y, Slayter HS, Izumo S: Autocrine release of angi­otens in II media tes stretch-induced hypertrophy of cardiac myocyte sin vitro. Cell 75: 977-984,1993

27. Leri A, Claudio PP, Li Q, Wang X, Reiss K, Wang 5 , Malhotra A,Kajstura J, Anversa P: Stretch-mediated release of angiotensin II in­duces myocy te apop tosis by activating p53 that enhances the localrenin-angio tensin system and decreases the Bcl-2-to-Bax protein ra­tio in the cel l. J Clin Invest 101: 1326-1342, 1998

28. Tan LB, Jalil JE, Pick R, Janicki JS, Weber KT: Cardiac myocyte necro­sis induced by angio tensin II. Circ Res 69: 1185-1195, 1991

29. Childs TJ, Adams MA, Mak AS: Regression of cardiac hypertrophy

117

in spontaneously hypertensive rats by ena1apri1 and the expression ofcontractile proteins . Hypertension 16: 662-668, 1990

30. Kojima M, Shiojima I, Yamazaki T, Komuro I, Zou Z, Wang Y,MizunoT, Ueki K, Tobe K, Kadowaki T: Angiotensin II recep tor antagon istTCV-1l6 induces regression of hypertensive left ventricular hypertro­phy in vivo and inhibits the intrace llular signaling pathway of stretch ­mediated cardiomyocyte hypertrophy in vit ro. Circulation 89 :2204-2211 ,1994

31. Michel JB, Lattion AL, Salzmann JL, Cerol ML, Philippe M, CamilleriJP, Corvo l P: Hormonal and cardiac effects of converting enzyme in­hibition in rat myoca rdial infarction. Circ Res 62: 64 1-650, 1988

Molecular and Cellular Biochemistry 251: 119-126,2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Mechanism of cell death of rat cardiac fibroblastsinduced by serum depletion

Monika Leicht, 1 Grit Marx, 1 Doris Karbach, 1 Michael Gekle,'Thomas Kohler' and Heinz-Gerd Zimmer''Carl-Ludwig-Institute ofPhysiology, University of Leipzig, Leipzig; 2Institute ofPhysiology, University ofWuerzburg,Wuerzburg; 3Roboscreen®Gesellschaft fur molekulare Biotechnologie mbH, Leipzig, Germany

Abstract

Serum starvation has recently been shown to cause cell death of cardiac fibrobl asts and increased synthesis of extracellularmatrix proteins in the surviving cells . In the present study, events occurring in the dying cells were investigated. Cultured adultrat cardiac fibroblasts were exposed to serum-free medium. Cell number was measured using a Coulter Counter Channel yzer.The activity of the extracellular signal-regulated or mitogen-activated protein kinases (ERK 1/2, p42/p44MAPK) , the p38 kinase(p38MAPK) , the c-Jun N-terminal kinases (p46/p54JNK) , and Akt kinase was assessed by Western blotting and phospho-specificantibodies. Caspase 7-cleavage was investigated by Western blotting and specific antibodies. Caspase 3 activity was measuredby detection of its cleaved substrate. The appearance of necrosis was studied by inclusion of trypan blue. Apoptosis was as­sessed by DNA ladder formation . The mRNA expression of Bax and Bcl-2 was investigated by quantitative real-time PCR.Serum withdrawal led to the death of 26% of cultured isolated cardiac fibroblasts during the first 5 h. The activity of the p42/p44MAPK as well as of Akt kinase was partially reduced. For p46/p54JNK and p38MAPK, elevated phosphorylation was measured.Inhibition of p46/p54JNK and p38MAPK activity by SB202190 did not affect the decrease in cell number. Cleavage of caspase 7was detected after 90 min. However, no activation of caspase 3 was measured . DNA fragmentation was not found after serumdepletion. Trypan blue staining, however, was observed in 16% of the cells after 5 h. The mRNA level s of both Bax and Bel­2 were increased after 30 min. These results indicate the appearance of necrosis during serum starvation in cardiac fibroblasts.However, some processes typical of apoptosis were also detected. (Mol Cell Biochem 251: 119-126,2003)

Key words: ischemia, necrosi s, apopto sis, protein kinase, caspase

Introduction

Myocardial ischemia/reperfusion injury has been shown tocau se cell death as has been demonstrated in a number ofstudies mainly dealing with its effect on myocytes [1-3] . Itis assumed that cardiomyocyte death contributes to the de­velopment of heart failure [4].

Cell growth and for many cell types also their survival re­quire s the availability of a single or of various serum factors.Their withdrawal causes cell cycle arrest or even cell death[5,6] . For some cell types, the occurrence of events specificfor apoptosis has been documented, while in others it is dueto necrosis. Necrosis and apoptosis are distinct mechanisms

of cell death with very different characteristics [5].Apoptosisis an active proces s of cell destruction. It involve s the bal­anced transcription of antiapoptotic and proapoptotic genessuch as Bax and Bel-2 [7]. The transcription of these apoptoticgenes is regul ated by intracellular signal transduction sys­tems. It has been reported that among members of the mi­togen-activated protein kinase (MAPK) family, activation ofthe extracellular signal-regulated kinases (ERKs) promotes cellsurvival, whereas activation of the c-Jun N-terminal kinases(p46/p54JNK) and p38MAPK induce s apoptosis [8-10] . Moreo­ver, a number of studies indicates a role for Akt kinase in theprotection against apopto sis [11-13]. The implication of cas­pases in the induction of the apoptotic death program has

Address f or offprints : H.-G. Zimmer, Carl- Ludwig-Institute of Physiology, Universi ty of Leipzig, Liebigstrasse 27, D-04103 Lepzig, Germany(E-mail : zimmer @medizin.uni-l eipzig.de)

120

often been stressed [14, 15]. It is therefore regarded as onehallmark of apoptosis. Anothe r feature is the condensation,margination, and degradation of chromatin [5]. Necrosis,however, may occur as a consequence of chemical or physi­cal cell insults, including energy depriv ation. During necro ­sis, plasma membrane integrity gets lost, cellular contentsare being released and unspecific degradation of DNA takesplace [5].

We have recently reported on a cell culture model of iso­lated rat cardiac fibroblasts in which one effect of ischemia,the lack of nutrients, was examined [16]. We have shown theloss of part of these cells with a parallel increa se in the syn­thesis of extracellular matrix protein s in the surviving cells .The present study was performed to identify the processeswhich occur in the dying cells, and which are involved in theirdeath .

Materials and methods

Animals used in this study were maintained in accordancewith the Guide for the Care and Use of Laboratory Animalspublished by the US National Institute of Health (NIH Pub­lication No. 85-23 , revised 1996). SB 202190 was from Cal­biochem (Bad Soden, Germany).

Cell culture

Cardiac fibroblasts were isolated from hearts of adult femaleSprague-Dawlay rats (220-260 g) as previously described[16]. Cells were grown in Dulbecco 's minimal essential me­dium (DMEM)/Ham's F-12 (Biochrom, Berlin, Germany)/10% fetal calf serum (FCS, Biochrom)/l % penicillin/strep­tomycin to confluency and were then passaged once .

For all subsequently described experiments, cell s wereseeded at 7-8 x 103 cells/em?and were again grown to con­fluency. Serum containing medium was then removed, andfresh DMEM/l % penicillin/streptomycin without fetal calfserum (FCS) was added for the indicated periods of time.

Determination ofcell number

The cell number was determined using a Coulter CounterChannelyzer (Beckman Coulter, Krefeld , Germany) as de­scribed earlier [17].

Trypan blue-staining

Cells were detached from the dish by treatment with 0.5%trypsin-EDTA and suspended in PBS . 0.2% Trypan blue wasadded, and the percentage of stained cells was evaluated.

Gel electrophoresis and immunostaining

SDS-PAGE and Western Blott ing was performed as previ­ously descr ibed [17]. Cells were lysed in 50 mM Tris-Cl , pH6.7,2% sodium dodecy l sulfate (SDS), 2% mercaptoethanol,and 1 mM sodium orthov anadate (Laemmli buffer) followedby digestion of nucleic acids with benzonase. The Iysateswere heated for 10 min at 95°C, and the protein content wasquantified [18].

The following antibodies were used: anti-phospho-Akt ki­nase and anti-Akt kinase (both I ug/ml, New England Biolabs,Schwalbach, Germany), anti-cleaved Caspase 7 (also recog­nises precursor Caspase 7; 3 ug/ml , New England Biolabs),anti-phospho Thr202/Tyr204-ERK I (both 1 ug/ml, New Eng­land Biolabs) and anti-ERKI (Santa Cruz Biotechnology,Heidelberg, Germany, K-27, 0.5 ug/ml), anti-phospho Thr180/Tyr182-p38MAPK and anti-p38MAPK (both I ug/ml, New EnglandBiolabs), anti-phospho-JNK and anti-JNK2 (both 2Ilg/ml,Santa Cruz, FL and G-7, respectively). Horseradish per­oxydase labeled sheep-anti-mouse IgG and goat-anti-rabbitIgG antibodies were from Dianova (Hamburg, Germany).

Determination ofDNA-ladder formation

DNA fragmentation was assessed as described earlier [19].Cells were lysed in 5 mMEDTA, pH 8.0, 0.5% Triton X-I 00,and centrifuged for 20 min at 13000rpm, 4°C.The supernatantwas removed and incubated with proteinase K and RNase for60 min at 37°C. Subsequently, DNA was extracted using phe­nol/chloroform/isoamylalcohol followed by centrifugation for30 min at 6000 rpm. DNA was precipitated overnight with 0.1volumeof3 M sodium actetate, pH 5.2, and 2 volumes of 100%ethanol at -20°C.After a 30 min centrifugation at 13,000 rpm,the pellet was washed with 70% ethanol and dried. After re­suspension of the pellet, the DNA concentration was deter­mined, and equal amounts were loaded onto a 1.4% agarosegel. The bands were visualized using ethidium bromide .

Determination ofcaspase activity

Caspase-3 activity was determined with the Caspase-3 Ac­tivity Assay from Boehringer Mannheim GmBH (Mannheim,Germany) according to the manufacturer's instructions. Ac­tivity was determined as the cleavage of the fluorescentsubstrate 7-amino-4 -trifluoromethyl-coumarin (pmoles per hper mg of cell protein) .

High-throughput transcript analysis by quantitative real­time fluorescence PCR

Total RNA isolation was performed according to the methoddescribed by Chomczynski and Sacchi [20] . Bcl-2, Bax

121

Activity ofMAP kinases and Akt

-l:- *

~I-l

•..-0 100~-c0 90o.....0

~ 800--~Q) 70.0E~ 60cQ)o

Fig. 1. Time course of the number of card iac fibrobla sts after serum re­moval. Primary cultures were passaged after 6 days and seeded at 7-8 x 103/

em? on 12 well plates. Cells were grown to confluency in DMEM supple­mented with 10% calf serum . The medium was then replaced by DMEMwithout serum. After the indicated time intervals, cells were trypsinized, andthe number of viable cells was determined by use of a Coulter CounterChann elyzer. The cell number which fibrobla sts had reached at the start ofthe experiment was set at 100%. Each point represents the mean ± S.E.M.of 6 separate experiments. Measurements were done in duplicate. *p < 0.05vs. FCS treated , time matched controls.

o 20 40 60 80t (h)

Further experiments were carried out to elucidate possiblesignaling pathways involved in the regulation of the abovedescribed processes. The activity of various members of theMAP kinase family was monitored during serum depletionby Western Blotting of the proteins in whole celllysates anduse of phospho-specific antibodies. Figure 2A shows for theactive form of the p42/p44MAPK a decrease in immunoreac­tivity after 10 min and up to 2 h. After 3 h, a partial recoveryof its activity was detected with a transient maximum to con­trollevel at 6 h after serum withdrawal. The panel below (Fig.2A) indicates that the amount of total p42/p44MAPK proteinwas unaffected. For the p38MAPK

, there was also a decreasein activity which started already after 5 min and lasted until2 h of serum depletion (Fig. 2B). A recovery to control lev­els was measured between 3-6 h after serum removal. Again,the protein level of p38MAPK remained constant throughout theperiod of investigation. Hardly any activity was detected forp46/p54JNK in control cells (Fig. 2C). It started to increase af­ter 5 min reaching a maximum after 5-6 h decreasing there­after. After 24 h, the activity of both isoforms had returned

until 24 h after serum removal. After 48 h, the number ofsurviving cells had further decreased to 64% and remainedconstant up to 72 h.

(splice variants alpha, beta, delta, sigma, zeta; not gamma andepsilon), and glyceraldehyde-3-phosphate dehydrogenase(GAPDH) transcripts were measured from cDNA in dupli­cate experiments by Robofiene" ready-to-use PCR testkits(Roboscreen" Gesellschaft fur molekulare BiotechnologiembH, Leipzig, Germany) as described [21,22] . Briefly, con­ventional 96-well bases were loaded with one 8-well-ready­to-use reference DNA strip which was storage-stably coatedwith 8 different amounts of respective reference-DNA forquantitation of the desired transcripts, forward and reverseprimer, and the Taqlvlan" probe. The probes were either 5'­labeled with the fluorescent reporter dye 6-carboxyfluorescein(FAM) or 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein(JOE) for GAPDH, and the common 3'-fluorescent quencherdye 6-carboxytetramethylrhodamine (TAMRA) in order togenerate the respective standard reference curves for each run.The remaining free positions were loaded with the requirednumber of sample strips containing only the respective Taq­Man" oligonucleotide sets. Reaction premixes containing PCRbuffer, the passive fluorescence dye 6-carboxy -tetramethyl­rhodarnin (ROX), dNTPs, and 0.5-1 U ofAmpli'Iaq" 'GOLD'(Appl ied Biosystems, Weiterstadt, Germany) were mixedaccording to the manufacturer's guidelines and supplementedwith Hp to a final volume of 25 ul. , Aliquots of the mixeswere added to each reaction tube using a BIOMEK®2000laboratory automation workstation (Beckman InstrumentsInc., Fullerton, CA, USA). Sample reactions were completedby the addition of 2-IlL aliquots of cDNA. PCR amplifica­tion and detection was performed on an ABI PRISM® 7700Sequence Detection System (Applied Biosystems).Amountswere calculated from a reference curve obtained from thesimultaneously processed reference DNA strips . Bcl-2 andBax data were expressed as zeptomoles (zmol , 10-21 mole)cDNA per attomole (amol, 10-18 mole) of GAPDH cDNAwhich was calculated from the same cDNA sample .

Statistical analysis

Results

Measurement ofcell number

Serum depletion caused the loss of 26% cardiac fibroblastsafter 5 h (Fig. I) . Cell number remained constant at this level

All data were analysed and expressed as mean ± S.E.M. Thedata were first compared by analysis of variance (ANOVA).Evaluation of statistical significance was performed by useof a post hoc test employing the Student-Newrnan-Keulsmethod (SigmaStat 2.0®, Jandel Corporation). A value ofp < 0.05 was considered significant.

o 15' 30' 60' 90' 120' 240' 480'

o 5' 10' 15' 1h 2h 3h 4h 5h 6h 16h24h

120 -.-aL.- 110-.....c

I- a ? ----r-yIa>..0 oE "'C 100-

a>:::J~Cro 90-

a> .....eno '+-a

80~0-- " " "1 ""', ....,

0 1 10 100 100088202190 (nM)

Fig. 3. Effect of SB202 190 on the decrease in cell number induced by se­rum removal. Confluent cells were depr ived of serum. Indicated concen­trations of SB202 190 were added 30 min before and at the time serum-freemedium was given. Cell number was determ ined after 24 h using a CoulterCounter Channelyzer. Each column represe nts the mean ± S.E.M. of 3 sepa­rate expe riments in duplicate determinations using cells from eac h isola­tion. The cell number which serum-starve d fibroblasts had reached at theend of the experiment (after 24 h) was set to 100%. *p < 0.05 starved cells.

Caspase 7 cleavage and caspase 3 activity

In order to elucidate the mechani sm of cell death , cell s wereagain subjected to serum remov al, and the time course ofcaspase 7 cleavage and activation was investigated. Caspase7 is a member of a famil y of proteol ytic enzymes. The acti­vation of these proteases usually results in apoptosis [23].Caspase 7 is synthesized as precursor of 38 kDa . During itsac tivation, thi s pre cursor polypeptide is proteolyti call yclea ved into fra gments of 28 and 20 kDa. To determinewhether caspase 7 is cleaved and activated after serum re­moval, cells were lysed after the indicated time periods, andthe individu al caspase 7 fragments were dete cted by West­ern Blott ing and by use of an antibody which is dire ctedagainst cleaved caspase 7 (Fig. 4A). Serum depletion inducedthe appearance of small, active fragments after 15 min indi­ca ting that apoptosis had occ urred. The most pronounced

Effect of iNK and p38 blockade on cell survival

Since we had detected temporary changes in the activity ofp38M APK and p46/p54JNK, protein kinases which have beenshown to be involved in the regulation of apoptosis, we testedthe effect of their inhibition by SB202190 on cell number.Figure 3 shows that the induction of cell death by serum re­moval was not affected by inhibiti on of the stress- activatedMAP kinases. For all concentrations of SB202190 used, thesurvival rate was not significantly changed.

.:1

Akt

ophosphoAkt

to control level s. The quantification of the p46/p54 JNK immu­noreactivity showed that the level of the entire protein re­mained constant.

Reduction ofAkt phosphorylation

In many cell types, the phosphorylation of Akt kinase pro­vides a survival signal that protects cells from apoptosis in­duced by various factors. Since many inhibitors of apoptosisactivate Akt, its phosphorylation appears to be an antiapoptoticmechani sm, and its depho sphorylation can be regarded as asign of apopto sis. Akt activity was assessed by Western Blot­ting and use of a phospho-specific antibody (Fig. 20). Im­munoreactivity of phosphorylated Akt was attenuated from15 up to 240 min after serum-depletion with a minimum af­ter 90 min. Akt pho sphorylation then recovered to nearl ycontrol level of non- starved cells after 8 h.

122

Aphosphop42/p44MAP K

p42/p44MAPK

B phosphop38MAPK

p38MAPK

Cphosphop46/p54JNK

p46/p54JNK

Fig. 2. Ti me course of p42/p44MAPK(A), p38MAPK(B), p46/p54J~K (C) , andAkt (D) phosphory lation . Confluen t cells were deprived of serum. After thetime per iods indica ted, cells were lysed, and the phos phorylation of theindicated protei n kinases was inve stiga ted by Western blott ing using thephospho-specific antibodies (respective upper panels). The antibodies werethen removed from the blot membrane, and the amount of the respecti veproteins was detected by use of specific antibodies (respective lower pan­els). Detection was performed by chemi luminescence. Western blots are rep­resentative of 4 separate experiments.

increase in 20 kDa fragments appeared after 90 min. Theamount of the precursor protein behaved in an inverse fash­ion. 15 min after serum depletion, it started to decrea se witha minimum detectable after 60 min (upper arrow). The precur­sor recovered thereafter reaching almost control level againafter 480 min. The fragments disappeared after 480 min. Inseveral cell types, caspase 7 is involved in the induction ofapoptosis by HPz. We have therefore used HPz as a posi­tive control for the induct ion of apoptosis and activation ofcaspase 7.The first lane in Fig. 2 shows the result ofthe HPz­treated cells. Caspase 7 was cleaved to a high degree, i.e. itwas activated.

A

123

Figure 4B depict s the results of caspase 3 activ ity meas­urements. Serum deprivation did not alter caspase 3 activ ity.In contrast, cis-platin (100 IJM) which was used as a posi­tive control, elevated its activity by about 6 fold.

DNA fragmentation

Internucleosomal chromatin cleavage is associated almostexclusively with apopto sis. It generates DNA lengths that areinteger multipl es of 180-200 bp observed as a ladder on gelelectrophoresis [5]. Figure 5 shows that neither after 5 or 24h did serum depletion lead to DNA fragmentation typical forapopto sis.

Trypan blue stainin g

Caspase 7

CleavedCaspase 7

(min)

B

~~ 0 15 30 60 90 120240 480

Trypan blue staining of the cells is a marker of plasma mem­brane integrity. In contrast to apopto sis, the cell membranebecomes permeable to vital dyes.Therefore, this test was usedto estimate necrotic cell death . After 5 and 24 h, respect ively,16 and 19% of the serum deprived cardiac fibroblasts exertedstaining by trypan blue indicating the respective percentageof necrosis (Fig. 6).

Expression of Bax- and Bcl-2 mRNA

Fig. 4. Time course of caspase 7 processing (A) and caspase 3 activity (B)during serum deplet ion. Confluent cells were depr ived of serum for theindicated periods of time. Cells were lysed as described in 'Materia ls andmethods' . (A) The proteins were separated by 15% SDS-PAGE. lmmun o­blott ing was performed using an antibody which binds to the proenzyme aswell as to the cleaved forms of caspase 7. The sizes of the individual caspase­7 fragments are indicated . Detection was done by che moluminesce nce.Hp,: 5 flM HP2was applied in the presence of 10% FCS for 60 min.Results are representative of data from 5 separate experiments. (B) Caspase3 activity was determined after 5 h of serum depletion (Sd) or incubationwith 100 flM cis-platin (cP) as described in 'Materials and methods' . Thevalue obtained for control cells (Co) was set at 100%. Each point represe ntsthe mean ± S.E.M. of 2 separate experime nts. Measurements were done induplicate. *p < 0.05 vs. FCS treated, time matched controls .

800>........

:~ c: 600....... 0() .....ro C

C") 8 400(1)_(/) 0ro~C200roo

oCo Sd

*

cP

The expre ssion of the proapototic protein Bax and of theantiapoptotic protein Bcl-2 was investigated on the mRNA

10kb­6kb­4kb ­3kb­2kb ­1.5 kb­1 kb_

0.5 kb-

0.1 kb -

..coo::::::..c..c..c-.;::t0::::::: 0 L.() L.() N

Fig. 5. DNA fragmentation. Cells were deprived of serum for the indicatedperiods of time. Isolation of DNA and electrophoresis was performed asdescribed in 'Materials and methods' . M: I kb plus 100 bp marker. Resultsare representative of 8 independent experiments.

124

700 *.........600 -.-Bax

0... -A-Bcl2..... 500c0

400o-0 300~ 2000.......-« 100zn:: aE -100Discussion

level. During serum starvation, a significant increase wasfound for Bax mRNA after 0.5 h when it reached a maximumwhich was 4.5 fold of control level. It was also significantlyhigher after 5 h. For Bcl-2 mRNA, there was also a peakmeasured after 0.5 h of 2.9 fold of control. However, thisincrease was not statistically significant. A signific ant eleva­tion was detected after 3 h when it was 1.6 fold higher thancontrol level (Fig. 7).

Fi g. 6. Trypan blue inclusion . Cell s wer e deprived of serum for 5 and

24 h. Cell s were trypsin ized and treated with trypan blue as described in'M ater ials and methods ' . The number of stained cell s is shown as percent­age of the entire cell numbe r. Each column represents the mean ± S.E.M.of 4 separate expe riments. Measurements were done in tripli cate . *p < 0.05vs. FCS treated, time matched control s.

Cardiac cell death has been implicated as a consequence ofischemia/reperfusion injury. It is well documented that itexhibits properties of both apoptosis and necrosis contribut­ing to cardiac infarction [24, 25]. Our present study revealsthe appearance of events specific for both apoptosis andnecrosis during death of cultured rat cardiac fibroblasts af­ter serum depletion.

MAPKs are important mediators of intracellular signalingtransduction from the plasma membrane into the nucleus.Three subfam ilies of MAPKs have been identified: the ex­tracellular signal-regulated kinase (ERK1/2), the p38 kinase,and the c-Jun N-terminal kinases (JNKs). ERKs respond tomitogenic stimuli, whereas p38 kinase and JNKs respondpredominantly to cellular stresses or inflammatory cytokines[26-28]. Activation ofERKs has been implicated in the regu­lation of cell growth and survival. Evidence for a protectiverole against apoptosi s has been provided [26- 30]. In PCl2cells, activation of p38 and JNKs with concurrent inhibitionof ERK 1/2 was found to induce apoptosis [31]. In cardiaccells, p38 and JNK appear to be involved in mediating growthand apoptosi s [31-33]. Our data demonstrating the coinci­dence of reduced ERK and elevated JNK and p38 activitywith cell death (Figs 2A-2C) is in good agreement with these

Fig. 7. Temp oral profil e of mRNA abundance of Bax and Bcl-2. Cardiacfibroblasts were grown to confluency in 10 em petri dishes, and serum-freeDMEM was given for the indic ated time interv als. RNA was prepared asdescr ibed in 'Materials and methods' . The abundance of Bax- and Bcl-2mRNA was investigated by quantitative real-time fluor escence PCR . Datawere normali zed to GAPDH mRNA, and expressed as percentage increasewith non-starved controls being set to 100%. The data are means of 5 ex­periments. Means ± S.E.M. *p < 0.05 vs. non-treated cells.

reports. However, it needs to be mentioned that recent pub­lications have provided evidence for a protective role of JNKand p38 against apopto sis [34-36]. Our result that inhibitionof both JNK and p38 kinase by SB202190 did not affect thesurvival rate (Fig. 3) suggests that these proteins are not in­volved in the regulat ion of the observed cell death in cardiacfibroblasts.

Activation of Akt [37, 38] and inhibit ion of caspases [39,40] were shown to have antiapoptotic effects . We found re­duced phosphorylation ofAkt kinase and slight activation ofcaspase 7 with a minimum/maximum after 90 min (Figs 2Dand 4A) which suggests the contribution of apoptosis to theobserved cell death .

The activation of caspase 3 and cleavage of DNA intooligomeres of 180-200 bp and multiples thereof was investi­gated because of their established critical role in apoptosis [5,14, 15,41]. However, activation of caspase 3 and apoptosis­specific fragmentation of DNA were not observed at the timemaximal death occurred (Fig. 4B). Together with the find­ing of increased trypan blue inclusion (Fig. 6), a typical fea­ture of necrosis, these data lead us to the conclusion thatapoptosis contributes only to a minor degree to the docu­mented cell death. Thi s hypothesis is supported by our re­sults on Bax and Bcl-2 mRNA expression (Fig . 7) . Bax isa proapoptotic member of the Bcl-2 family of proteins. Itsproduction and homodimerization was shown to inducecharacteristic features of apoptosis, including cell death, DNAfragmentation, and caspase activation [42]. Bcl-2 exerts aprotective function against apopto sis which is lost when itforms heterodimers with Bax [43]. We have demonstrated that

542 3t (h)

1a

5 h 24 h

- -}~

-20

15

10

5

o

!!l.Q)o

"'CQ)c::ro-en

..-~o--

serum depletion increased the expression of Bax mRNA af­ter 0.5 h. A rise in BcI-2 mRNA was detected after 3 h witha nonsignificant increase after 1.5 h. We would therefore liketo conclude that the putative apoptotic signal pro vided byexcessive Bax production may be overcome by a parallelelevation of Bcl-2 .

We assume that the mode of cell death that occurs in 26%of serum-deprived cardiac fibroblasts is mainly necrosis. Thisis suggested by the 16% increase in trypan blue uptake . How­ever, we have also found indications for the parallel occur­rence of apoptosis which may be responsible for the deathof the rema ining 10%. Data supporting this notion are theactiv ation of caspase 7 (Fig . 4A) and inactivation of Akt ki­nase (Fig . 2D) . On the other hand , we did not detect activa­tion of caspase 3, one of the main executioner proteases ofapoptosis. It is likely that at the time caspase 3 activity wasmeasured, its activity had already vanished. However, inves­tigation of the lysates that were used for caspase 7 analysiswere also taken for Western Blotting of caspase 3 and did notrender any caspase 3 activation (data not shown). Moreover,we have not been able to find any DNA laddering in cardiacfibroblasts . Other authors described similar events whereserum-removal caused processes typical for apoptosi s as wellas for necrosis [44] .

Acknowledgement

This study was supported by the Deutsche Forschungs­gemeinschaft (Zi 199/10-1, Zi 199/10 -3).

References

I . Fliss H, Gatting er D: Apoptosi s in ischemic and reperfu sed rat myo­cardiu m. Circ Res 79: 949-956, 1996

2. Olivetti G,Quaini F, Sala R, Lagrasta C, Corradi D, Bonacina E, GambertSR, Cigola E, Anversa P: Acute myocardial infarction in humans is as­sociated with activation of programmed myocyte cell death in the sur­viving portion of the heart. J Mol Cell Cardiol 28: 2005-2016, 1996

3. Gottl ieb RA, Burleson KO, Kloner RA, Babior BM, Engler RL: Re­perfus ion injury induces apoptosis in rabbit cardiomyocytes. J ClinInvest 94: 1621-1628, 1994

4. Haunstetter A, Izumo S:Apoptosis : Basic mechanisms and implicationsfor cardio vascula r disease . Circ Res 82: 1111 -1129, 1998

5. Arend s MJ, Wyllie AH: Apoptosis: Mechani sms and roles in pathol­ogy. Int Rev Exp Pathol 32: 223-254, 1991

6. Simm A, Hoppe V, Tatje D, Schenzinger A, Hoppe J: PDGF-AA ef­fectively stimulates early events but has no mitogenic activity in AKR­2B mouse fibrobla sts. Exp Cell Res 201: 192-199, 1992

7. Willi ams GT, Smith CA: Molecular regulation of apoptosi s: Geneti ccontrols on cell death . Cell 74: 777- 779, 1993

8. Xia Z, Dicken s M, Rainge aud J, Davis RJ, Greenberg ME: Oppo singeffect s ofERK and JNK-p38 MAPkinases on apoptosis. Science 270:1326-1331 , 1995

9. Wang Y, Huang S, Sah VP, Ross J Jr, Brown JH, Han J, Chien KR:

125

Cardiac muscle cell hypertrophy and apoptosis induced by distinctmembers of the p38 mitogen-activated protein kinase family. J BioiChern 273: 2161-2168,1998

10. Wang Y, Su B, Sah VP, Brown JH, Han J, Chien KR: Cardiac hyper­trophy induced by mitogen-activated protein kinase kinase 7, a spe­cific activator for c-Jun NH2-terminal kinase in ventricular musclecell s. J Bioi Chern 273: 5423-5426, 1998

II . Matsui T, Li L, del Monte F, Fukui Y, Franke TF, Hajjar RJ, RosenzweigA:Adenov iral gene transfer of activated phosphatidylinositol3'-kinaseand Akt inhibits apoptosis of hypoxic cardiomyocytes in vitro. Circu­lation 100: 2373-2379, 1999

12. Aikawa R, Nawano M, Gu Y, Katagir i H, Asano T, Zhu W, Nagai R,Komuro I: Insulin prevents cardiomyocyte s from oxidati ve stress-in­duced apoptosis through activation of PI3 kinase/Akt. Circulation 102:2873-2879,2000

13. Fujio Y, Nguyen T, Wencker D, Kits is RN, Walsh K: Akt promotessurvival of cardiomyocytes in vitro and protects again st ischemia­reperfusion injury in mouse heart. Circulation 101: 660-667, 2000

14. Steller H: Mechanisms and gene s of cellular suicide. Science 267:1445-1449,1995

15. Kumar S: ICE-like proteases in apoptosis. Trends Biochem Sci 20:198-202, 1995

16. Leicht M, Briest W, Holzi A, Zimmer HG: Serum depletion inducescell loss of rat cardiac fibrobl asts and increased expression of extra­cellular matrix proteins in surviving cells . Cardiovasc Res 52: 429­437 ,2001

17. Leicht M, Greipel N, Zimmer H: Com itogenic effect of catechol­amines on rat cardiac fibroblasts in culture. Cardi ovasc Res 48 : 274­284 , 2000

18. Henkel AW, Bieger SC: Quantific ation of proteins dissolved in an elec­troph oresis sample buffer. Anal Biochem 223: 329-331 1994

19. Gekle M, Schwerdt G, Freudin ger R, Mildenberger S, WilflingsederD, Pollack V, Dander M, Schramek H: Ochratoxin A induce s JNK ac­tivation and apoptosis in MDCK-C 7 cells at nanomolar concent rations.J Pharmacol Exp Ther 293: 837-844,2000

20. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acidguanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem162: 156-159, 1987

21. Kohler T, Schill C, Deininger MW, Krahl R, Borchert S, Hasencl everD, Leiblein S, Wagner 0 , Niederwieser D: High Bad and Bax mRNAexpression correlate with negative outcome in acute myeloid leukemia(AML). Leukemia 2002 (in press)

22. Taubert H, Kohler T, Meye A, Bartel F, Lauten schlage r C, Borchert S,Bache M, Schmidt H, Wurl P: mdm2 gene expre ssion level is a prog­nostic facto r in soft tissue sarcoma. Mol Med 6: 50-59, 2000

23. Cohen GM: Caspases: The executioners of apoptosi s. Biochem J 326:1-16, 1997

24. Bialik S, Geenen DL, Sasson IE, Cheng R, Horner JW, Evans SM, LordEM, Koch CJ, Kitsis RN: Myocyte apoptosi s during acute myocardialinfarction in the mouse locali zes to hypoxic regions but occurs inde­pendently of p53. J Clin Invest 15: 1363-1372, 1997

25. Kajstura J, Cheng W, Reiss K, Clark WA, Sonnenbl ick EH, KrajewskiS, Reed JC, Olivett i G,Anversa P: Apoptotic and necrotic myocyte celldeaths are independent contributing variables of infarct size in rats. LabInvest 74: 86-107, 1996

26. Force T, Bonventre JV: Growth factor s and mitogen-activated proteinkinases. Hypertension 31: 152-161 , 1998

27. Sugd en PH, Clerk A: 'Stress-responsive ' mitogen-activated proteinkinase s (c-Jun N-terminal kinases and p38 mitogen- act ivated proteinkinases) in the myocardium. Circ Res 83: 345-352, 1998

28. Seger R, Krebs EG: The MAPK signaling cascade. FASEB J 9: 726­735 , 1995

29. Sheng Z, Knowlton K, Chen J, Hoshijima M, Brown JH, Chien KR:

126

Cardiotrophin I (CT-I) inhibition of cardiac myocyte apoptosis via amitogen-activated protein kinase-dependent pathway. Divergence fromdownstream CT-I signals for myocardial cell hypertrophy. J Bioi Chern272:5783-5791 ,1997

30. Gu Y, Zou Y, Aikawa R, Hayashi D, Kudoh S, Yamauchi T, UozumiH, Zhu W, Kadowaki T, Yazaki Y, Komuro I: Growth hormone signal­ling and apoptosis in neonatal rat cardiomyocytes. Mol Cell Biochem223: 35-46,2001

31. Xia Z, Dickens M, Raingeaud J, Davis RJ, Greenberg ME. Opposingeffects of ERK and JNK-p38 MAP kinases on apoptosis . Science 270:1326-1331 ,1995

32. Wang Y, Huang S, Sah VP, Ross J Jr, Brown JH, Han J, Chien KR:Cardiac muscle cell hypertrophy and apoptosis induced by distinctmembers of the p38 mitogen-activated protein kinase family. J BioiChem273:2161-2168,1998

33. Wang Y, Su B, Sah VP, Brown JH, Han J, Chien KR: Cardiac hyper­trophy induced by mitogen-activated protein kinase kinase 7, a spe­cific activator for c-Jun NH2-terminal kinase in ventricular musclecells . J Bioi Chern 273: 5423-5426,1998

34. Zechner D, Craig R, Hanford DS, McDonough PM, Sabbadini RA,Glembotski CC: MKK6 activates myocardial cell NF-kappaB and in­hibits apoptosis in a p38 mitogen-activated protein kinase-dependentmanner. J Bioi Chern 273: 8232-8239, 1998

35. Whitrnarsh Al , Davis RJ. Transcription factor AP-I regulation by mi­togen-activated protein kinase signal transduction pathways. J MolMed 74: 589-607,1996

36. Nishina H, Fischer KD, Radvanyi L, Shahinian A, Hakem R, Rubie

EA, Bernstein A, Mak TW, Woodgett JR, Penninger JM: Stress-sig­nalling kinase Sekl protects thymocytes from apoptosis mediated byCD95 and CD3. Nature 385: 350-353, 1997

37. Dudek H, Datta SR, Franke TF, Birnbaum MJ, Yao R, Cooper GM,Segal RA, Kaplan DR, Greenberg ME: Regulation of neuronal survivalby the serine-threonine protein kinaseAkt. Science 275: 661--665, 1997

38. Fujio Y, Guo K, Mano T, Mitsuuchi Y, Testa JR, Walsh K: Cell cyclewithdrawal promotes myogenic induction of Akt. a positive modula­tor of myocyte survival. Mol Cell Bioi 19: 5073-5082, 1999

39. Salvesen GS, Dixit VM: Caspase activation: The induced-proximitymodel. Proc Natl Acad Sci USA 96: 10964-10967, 1999

40. Nemoto S, Xiang J, Huang S, LinA: Induction of apoptosis by SB202190through inhibition of p38beta mitogen-activated protein kinase . J BioiChern 273: 16415-16420, 1998

41. Nicholson DW, Ali A, Thornberry NA, Vaillancourt JP, Ding CK,Gallant M, Gareau Y,Griffin PR, Labelle M, Lazebnik YAet al.: Iden­tification and inhibition of the ICE/CED-3 protease necessary for mam­malian apoptosis . Nature 376: 37-43,1995

42. Xiang J, Chao DT, Korsmeyer SJ: BAX-induced cell death may notrequire interleukin I beta-converting enzyme-like proteases. Proc Nat!Acad Sci USA 93: 14559-14563, 1996

42. Gross A, Jockel J, Wei MC, Korsmeyer SJ : Enforced dimerizationof BAX results in its translocation, mitochondrial dysfunction andapoptosis . EMBO J 17: 3878-3885, 1998

43. Simm A, Bertsch G, Frank H, Zimmermann U, Hoppe J: Cell death ofAKR-2B fibroblasts after serum removal: A process between apoptosi sand necrosis. J Cell Sci 110: 819-828, 1997

Molecular and Cellular Biochem istry 251: 127-137 ,2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands .

Effect of propranolol on cardiac cytokineexpression after myocardial infarction in rats

Alexander Deten, Hans Christian Volz, Alexander Holzl,Wilfried Briest and Heinz-Gerd ZimmerCarl-Ludwig-Institute ofPhysiology, University ofLeipzig, Leipzig, Germany

Abstract

The pro-inflammatory cytokines interleukin (IL)-l ~ and IL-6 have been shown to be upregulated in the myocardium after injuryand after adrenergic receptor stimulation. Together with other cytokines, such as the transforming growth factor (TGF)-~, thepro-inflammatory cytokines have been implicated in the initiation of tissue repair and wound healing after myocardial infarc­tion (MI). In the present study, the effect of ~-adrenergic receptor blockade with propranolol (2 mg/kg-h s.c. by miniosmoticpumps) on cardiac cytokine expression and on wound healing was analyzed in rats from 6-72 h after MI. IL-I ~ and IL-6 geneexpression strongly increased in the infarcted myocardium 6 h after MI and peaked after 12 h, while TGF-~, progressivelyincreased from 12 h onwards. Also, TGF-~2 increased after 12 h, peaked after 24 h and declined thereafter, while TGF-~, wasonly elevated after 72 h. Treatment with propranolol had a negative chronotropic effect throughout the observation period of72 h. It attenuated the initial elevation in LVEDP and increased cardiac output ultimately. Furthermore, propranolol attenuatedIL-l ~ mRNA expression, but had not effect on the other cytokines. Moreover, MMP-9 gelatinolytic activity was markedlyattenuated by propranolol indicating a delayed resorption of the necrotic tissue and, possibly, collagen turnover. Replacementby scar tissue, however, was not affected as indicated by normal collagen expression. (Mol Cell Biochem 251: 127-137,2003)

Key words : myocardial infarction, cytokine expression, remodeling, beta-blocker

Introduction

The pro-inflammatory cytokines interleukin (IL)-l~ and IL­6 have been shown to be upregulated in the myocardium earlyafter injury [1-4]. Together with other cytokines, such as thetransforming growth factor (TGF)-~ , the pro-inflammatorycytokines have been implicated in the pathophysiology of tis­sue repair and wound healing after myocardial infarction (MI)as well as of cardiac hypertrophy and ventricular remodeling[5,6]. Cytokine actions in the myocardium include the stimu­lation of myocyte hypertrophic growth and fibroblast prolif­eration, and the induction or preventing of apoptosis [7-10] .Specifically, the pro-inflammatory cytokines have been in­criminated to playa role in the development of cardiachypertrophy [8] . They are also supposed to be involved inmyocardial remodeling by regulat ing the expression of col­lagen which is a main component of the extracellular matrix

(ECM) as well as in the expression and the gelatinolytic ac­tivity of matrix-metalloproteinases (MMPs) [I , 7, 11].

Many factors have been shown to contribute to the induc­tion of pro-inflammatory cytokines such as hypoxia, comple­ment derived factors (C5a), and tumor necrosis factor (TNF)a [12-14]. In addition, both IL-l~ and IL-6 are induced inthe myocardium after treatment with norepinephrine (NE) bya receptor mediated mechanism [7]. NE evokes IL-6 expres ­sion also in adult rat cardiac fibroblasts [15]. Moreover, pro­inflammatory cytokines have been shown to precede theremodeling after both myocardial infarction and adrenergicstimulation , since cardiac hypertrophy and fibrosis occurredsubsequent to increased cytokine expression [1,7]. Moreo ­ver, NE is locally and systemically elevated after MI [16].Therefore, we tested the hypothesis, that catecholamines maybe involved in the increase of cytokine expression and re­modeling after myocardial infarction.

Address for offprints:A. Dcten , Carl-Ludwig-Institute of Physiology, University of Leipzig, Liebigstrasse 27, D-04103 Leipz ig, Germany(E-mail : dcta @medizin .uni-leipz ig.de)

128

Materials and methods

Animal model

Myocardial infarctionswere induced in female Sprague-Dawleyrats by ligation of the left anterior descending coronary ar­tery (LAD) under ether anesthesia essentially as previouslydescribed [6, 17]. As a modification, a large anatomical for­ceps was used instead of a sharp small surgical one to fix theheart for a moment when the LAD was underpassed with thethread (6/0 prolene, Johnson and Johnson) attached to theneedle .Additionally, the hearts were allowed to recover a fewseconds from this procedure before the ligation was made bytightening the knot. Sham-operated animals underwent thesame procedure except that no ligation was performed. Pro­pranolol treatment (2 rng/kg-h,Sigma-Aldrich) was carried outby using osmotic minipumps (Alzet Model 2ML4 , ALZA).The pumps were implanted subcutaneously the day beforeinduction of MI. Heart and circulatory function was measuredin closed-chest spontaneously breathing rats anesthetized withthiopental sodium (Trapanal" 60 mg/kg i.p., Byk Gulden)using ultraminiature catheter pressure transducers (3 French;Millar Instruments Inc.) as previously described [6, 18]. Car­diac output was measured by the thermodilution method (Car­diomax IIR, Columbus Instruments). After the hemodynamicmeasurements had been obtained, the ascending aorta wascannulated, and the hearts were retrogradely perfused with1-2 ml phosphate buffered saline (PBS) to identify the inf­arct area . Thereafter, the hearts were excised, and the infarctarea was cut from the non-infarcted myocardium. The ante­rior region of the LV free wall of the hearts of sham-oper­ated animals which corresponded to the infarcted area servedas control. The tissue pieces were snap frozen in liquid ni­trogen. The investigation conforms with the Guide for theCare and Use of Laboratory Animals published by the USNational Institutes of Health (NIH Publication No. 85-23,revised 1996) and was approved by the appropriate Stateagency of Saxony.

RNase protection assay (RPA)

The rat matrix metalloproteinase (MMP)-, extracellularmatrix (ECM)- and transforming growth factor (TGF)­cDNA-template sets were generated by means of RT-PCRas previously described [6]. The rat cytokine template set(rCKI) was obtained from PharMingen. The template setswere labeled with [a_32p (3000 Ci/mmol, Amersham) by meansof Ribotjuant" In VitroTranscription Kit (PharMingen) as de­scribed by the manufacturer. Total RNA was isolated usingthe Trizol v-Reagent (Gibco BRL) according to the protocol

supplied by the manufacturer. 2.5-7 .5 pg of total RNA wereused in the RNase protection assay (RiboQuant" RPA Kit,PharMingen) as earlier described [6]. Protected probes werequantified using the Molecular Imager (BioRad). The signalsof specific mRNAs were normalized to those ofL32 or ARPPmRNA.

The template sets contained the following cDNA probes(probe length in bp/protected):

I. rCKI-set: IL-Ia (432/403) , IL-IP (390/361), TNF-P(351/322), IL-3 (315/286), IL-4 (285/256), IL-5 (255/226), IL-6 (231/202), IL-I 0 (210/181), TNF-a (189/160), IL-2 (171/142), Interferon y (156/127), L32 (141/112) and GAPDH (126/97);

2. MMP-set: MMP-9 (415/340), MMP-8 (261/186), ARPP(143/l13) and GAPDH (128/82);

3. ECM-set: collagen type al (I) (504/449), collagen typeal (III) (310/211) , colligin (225/161), ARPP (143/113)and GAPDH (128/82) and

4. TGF-set: TGF-P 1 (442/412), TGF-P2(282/209), TGF­

P3

(288/230), ARPP (143/113) and GAPDH (128/82).

Zymography: Detection ofcardiac matrixmetalloproteinase activity

Extracellular proteins of 25 mg frozen tissue were extractedby the addition of the 20-fold volume of extraction buffer(10 mmol/L Tris-CI pH 7.5, 150 mmollL Nad, 20 mmol/LCaCl , I flmoIlLZnS040.01%(v/v)TritonX-100, 1.5mmol/L NaN

3, 0.5% (w/v) PMSF) at 4°C over night. The super­

natant was used for total protein assay (BioRad). The extractscontained approximately 1.5 mg/ml protein and were directlyused for electrophoresis.

Myocardial MMP activity was measured as described else­where [6]. Briefly, gelatin (0.1% (w/v), Merck) was addedto Laemmli acrylamide polymerization mixture. The extractswere mixed 1:4 with substrate gel sample buffer (10% (w/v)SDS, 4% (w/v) sucrose, 0.25 mmollL Tris-CI pH 6.8 and0.1% (w/v) bromphenol blue). Approximately 4 ug wereloaded immediately without boiling. The gels were run at20 rnA at 4°C.Following electrophoresis the gels were soakedin 2.5% (w/v) Triton X-I 00, incubated overnight at 37°C insubstrate buffer (50 mmol/L Tris-CI pH 8.0, 5 mmol/L CaCI

2

and 0.02% (w/v) NaN3) . They were stained for 15-30 min in

0.05% Coomassie Blue R-250 in acetic acid:methanol:water(I :4.5:4.5 by volume), destained in 10% acetic acid 5 metha­nol and scanned using the EagleEye II imaging system (Strat­agene) for relative lytic activity, normalized to the amountof protein extract loaded onto the gel. A human MMP-2 andMMP-9 mixture (Chemicon) served as zymography standard.

129

Statistical analysisIIR

LV devel oped pre ssure

The data are expressed as mean ± S.E.M. Multiple range testand Kruskall-Wallis test on ranks was used for multigroupcomparison (STATGRAPHICS Plus 4.1, Statistical Graph­ics Corp. ) utilizing multiple comparison procedure accord­ing to Tukey's HSD method. The Mann- Whitney V-test wasused for two-group comparison. A value of p < 0.05 was con­sidered significant.

-11111

:;00

i: : 1111

11111

:110

sham 6h I: h :-1 h n h

Results

Hemodynamic measurements

150.?

1lI0

50

sham 6h

+ t

12 h

.:. +

2-1 h nh

Seventy two h after MI, however, IL-l ~ mRNA expre ssionwas slightly increa sed by propranolol. The expre ssion ofIL­6 after MI was not affected significantly by propranolol treat­ment. Also , TNFa mRNA expre ssion slightly increased witha maximum 24 h after MI (Fig . 2) and was not influenced bypropranolol treatment.

72 h

7: h

.;. ;~

: -1 h

: -1 h

: -1 h

I: h

I : h

12 h

T!'R

LVED!'

CO-Index

';' f:

6h

6h

6hsham

sham

shun:

~~ jI"

1 ~" I)

-100

0. 1- 0.0 f-l--''----,.-'---

.§ .100

~ :00

100

Fig. I . Heart rate (HR), left ventricular developed pressure (LV developedpressure), left ventricular end-diastolic pressure (LVEDP), cardiac outputindex (CO-index) and total peripheral resistance index (TPR) in rats at dif­ferent times after myocardial infarction (M)) and after myocardial infarc­tion plus propranolol treatment (Ml + P). Since there were no significantdiffere nces, the hemodynamic data of all sham-operated rats were combined(open columns; total of n = 20); n = 6-8 for each MI-group . Data are shownas mean ± S.E.M. "p < 0.05 vs. sham-opera ted controls; ' p < 0.05 MI + Pvs. MI.

Large myocardial infarctions were confirmed in all experi­mental animals by inspection of the left ventricular (LV)myocardium and by ECG. As in our previous studies [1, 6,17], all animals had a severe depre ssion in LV function whichwas characterized by a LVdeveloped pressure below 110mmHgand a marked increa se in LV end-diastolic pressure (LVEDP,Fig. I).Also, cardiac output decreased, while the total periph­eral resistance (TPR) was reduced only after 6 h. The hemo­dynamic measurements further showed a strong reduction inthe rate of rise and fall in LV pressure (LV dP/dtrna, and LV dPIdt

rnin, respectively) as well as in LV stroke work (not shown).

Propranolol treatment constantly reduced heart rate (HR)to about 300 bpm (Fig. I). The initial drop in LV developedpressure 6 h post-MI was attenuated by propranolol treatmentwhen compared to untreated MI-rats. Additionally, the in­crea se in LVEDP was less pronounced in the first hours af­ter MI (Fig. 1). After 6 h, thi s was accompanied by anincrease in TPR and a pronounced decrease in cardiac out­put. Inversely, TPR decreased and cardiac output increasedin propranolol-treated rats compared to untreated MI-ratsafter 24 and 72 h, while LV developed pressure and LVEDPwere not different. Furthermore, 14 out of 49 MI-rats treatedwith propranolol (29%) died within the first 6 h after surgery.In the untreated Mi-group the early post-MI mortality was13%. None of the sham-operated animal s died .

mRNA Expression ofpro-inflammatory cytokines

The expression of IL-l ~ and IL-6 mRNA was induced in theinfarcted myocardium 6 and 12 h after coronary artery oc­clusion (Fig. 2). This increase was more pronounced for IL-6when compared to IL-l ~ (Fig. 3). After maximum expre ssion12 h post-MI, IL-6 expression rapidl y decl ined to norm allevel 24 h post-MI. IL-l~ mRNA expre ssion also reachedmaximum after 12 h, but was still significantly elevated af­ter 24 h. It returned to normal 72 h post-MI. This increa se inIL-I~ mRNA expression was attenuated by treatment with the~-adrenergic receptor blocking agent propranolol (Fig . 3).

130

O.hamOMI. 1I11 '\'

72h

72h

24h

IL-6

24 h

IL-I (3t

12 h

12 h

50

on 40

s 30

1:' 20g

10:e.::. II<I 6 hu§

-::lc~'" 150<Z0:::

!OOE~'iO 511

"20

6h

FiR. J. Relati ve ca rdiac interleuk in (IL)-I ~ and IL-6 mR NA ex press ion inthe myocardium and at different time s af te r sham operation (sham) , myo­cardial infarction (M Il and myocardi al infarcti on plu s propranolol treatment(M I + Pl. Data arc expres sed as mRNA abunda nce re lative to L32 mRN Aand show n as mean ± S. E.M. ; n = 6- 8 for each MI-group and n = 4 for eac hgro up of sham-operated contro ls; 'p < 0.05 vs. sham-o perate d co ntro ls; ' p

< 0.05 MI + P vs . MI.

+P+P+P

- - - - - -

•

+P

--

IL-6

11.- 113

TNFa

1--6 h - n- 12 h -tt-24 h-tt-72h-t

1.32

GAPDH

strongly upregulated as early as 6 h after MI. The maximumexp ression of MMP-8 mRNA occurred 12 h after MI , whil eMM P-9 expression peaked 24 h afte r MI. Thereafter. MMP­8 and MMP-9 expression declined , but was still elevated af­ter 72 h (Fig. 4B). The increase in both MMP-8 and MMP-9was more pronounced in the infarcted myocardium afte r pro­pranol ol treatment when compared to untreated MI-rats. Th etime cou rse, how ever, was not different.

-- - -- - - Zvmograph y: Gelatinolytic activity qfMMP~2 and MMP- 9

FiR. 2. Representat ive autora diograph fro m RNase pro tect ion assay (rC K 1­set) in the infarcted myocardiu m at different tim es after myoca rdi al infarc­tion and myocardi al infarct ion plu s propranolol treatm ent (+ P l. Each lanewas loa ded with 7.5 Ilg tot al RNA.

MMP IIlRNA expression

Very weak signals were detectable for both MMP-8 and MMP­9 mR NA in the myocardium of a ll sha m-o pe rated rats (Fig .4A) . Both MMP-8 and MMP-9 mR NA expre ssion was

Gel atinol ytic acti vit y of MMP-9 was barel y detectable byzymography in the myoc ard ium of all sham-o perated rat s. Itwas strongly inc reased in the infarcted myocardium within24 h after MI (Fi g. 5A) , reach ed maximum after 24 h, andrapid ly declined thereafter. It also increased in the infarctedmyo cardium of the propranolol-treated MI-rats to a similardegree compared to untreat ed MI-rats 6 h afte r MI. However,propranolol treatment pre vent ed the subsequent pronouncedincrease (Fi g. 5B).

Gel at inolytic activity of MMP-2 was read ily detectable byzymography in the myoc ardium after MI as well as after shamoperation . It decre ased in the infarcted myocardium within12 h, which was more pronounced by propranol ol trea tment6 h afte r MI (Fig . 58). Seventy two h after MI , MMP-2 ge l­atin olyti c act ivity was not different from sham-operated con­trols in both the propranolol-treated and the untreated MI-rats.

131

A) I-- Sham -----1 f-1---- - - - - - - MI - - - - - - - - - ---<

- - - - ---<11-- 12 11 -----41-- 2-1 h -----41-- 72 11-----4

f-- -+- I' -i f-- -'-I'~ f-- ·1 P -i f-- -'-I' -i

\I I\IP-lJ

>------ 6h~+p ......

. - ..... - .. ..M:vll' -S = • • •

- I

ARI'I'

GAPDII

B)MMP-9

25-:-:;.

20 .;" #

';"t:

15

3

5 10

>.'-c: 5.:::

.J::)'-

0'Ju sham 6h 12 h 24 h 72h

'""~ MMP-8.D 60 -;- #

'"<C50:z

:::::::: 40

~",' j;

30 .'.c: "i:: "

'J .;. r'- 20

J()

0

sham 6h 12 h 24 h 72 h

o sha m OMl i\11+ I'

Fig. 4. (A) Representative autoradiograph from RNase protection assay (MMP -set) in the myocardium at different times after sham operation (sham), myo­card ial infarction (Ml) and myocardial infarction plus propranolol treatment (MI + P) . Each lane was loaded with 5 ug total RNA . (B) Relative MMP-9(upper pane l) and MMP-8 (lower panel) mRNA expression in the myocardium at diffe rent times after sham operation (sham) , myocardial infa rction (MI) andmyocardial infarction plus propranolol treatment (MI + P). Data are expressed as mRNA abundance relative to ARPP mRNA and shown as mean ± S.E.M.;n =4-6 for eac h MI-group; since there were no significant differences, the data of all sham-operated rats were combined (open bars on the left hand side ,total of n = 16); tp < 0.05 vs. sham -operated controls; 'p < 0.05 MI + P vs. MI.

132

A)

,- MI ---< MI+P f- MI ---< MI+P f- 11 ---< MI+P f-- MI---< MI+P

f---- 6 h II--- 12h ---·f--2-l h~-· - - n h-l SId.

;vlivll' -9

M~vI1' -2

B)

MMP-9 gelatinolytic activity

.;. T

M MP-2 gelatinolytic activity

.32I() -+-...l-_'-_-,._'-_

',. .,'

72 h

T

sham 6h 12 h 2-1 h

o sham 0 :VII

72h

:VII \ P

Fig . 5. (A) Representative photograph of zymographic analysis of gelatinolytic activity in the extracellu lar protein extracts from the infarct area at differenttimes after myocardial infarction (MI) and myocardial infarction plus propranolol treatment (MI + Pl. Four ug of the prote in extract were loaded onto eachlane . A human MMP-2 and MMP-9 mixture served as gelatinase zymography standard (std.) . (B) Relative gelatinolytic activity of MMP-9 (upper panel) andMMP-2 (lower panel) from 6 up to 72 h after myocardial infarction (MI) and myocardial infarction plus propranolol treatment (MI + Pl. Data are expressedas relative lytic activity , normalized to the amount of protein loaded onto each lane. Values are mean ± S.E.M.; n =4-6 for each Ml-group; since there wereno signific ant differences, the data of all sham-operated rats were combined (open bars on the left hand side, total of n =10); t p < 0.05 vs. sham operatedcontrols ; ' p < 0.05 MI + P vs. MI.

Colligin and collagen mRNA expression

The expression of colligin, collagen type I and collagen typeIII mRNA was strongly upregulated in the infarcted myocar­dium 72 h after MI (Fig . 6A) . The increase in colligin mRNAexpression preceded the increase in collagen expression inthat it was significantly increased already 24 h after MI (Fig .6B). However, the induction of colli gin and collagen expres­sion was not affected by propranolol treatment.

Expression pattern of the TGF-f3 isoforms

The mRNA expression ofI'Gl--B, progressively increased inthe infarcted myocardium from 12 h after MI onwards (Figs7A and 7B). Also, TGF-P2mRNA expression was induced inthe infarcted myocardium 12 h after MI, reached maximumexpression after 24 h and, thereafter, declined. In contrast,the only significant increase in TGF-P

3mRNA expression oc­

curred 72 h after MI. There were no differences in this ex-

Fig. 6. (A) Representative autoradiograph from RNase protection assay (ECM-set) in the infarcted myocardium at different times after myocardial infarc­tion (MI) and myocard ial infarction plus propranolol treatment (MI + P). Each lane was loaded with 2.5 ug total RNA. (B) Relat ive collagen type I (upperpanel) , collagen type III (middle panel) and colligin (lower panel) mRNA expres sion in the myocardium 24 and 72 h after sham operation (sham), myocar­dial infarction (MI) and myocardial infarction plus propranolol treatment (MI + P). Data are expressed as mRNA abundance relative to ARPP mRNA andshown as mean ± S.E.M.; n = 4-6 for each Ml-g roup and n = 4 for sham-operated control s; "p < 0.05 vs. sham-operated control s.

pression pattern ofTGF-~ isoforms after propranolol treat­ment when compared to untreated MI-rats (Fig . 7B).

Discussion

Functional alterations

The experimental animals in this study were characte rized bylarge myocardial infarctions which invariably extended overalmost the entire LV free wall. The severity ofMI was evalu­ated on the basis of the hemodynamic alterations as in previ­ous studies [I , 6, 17]. All experimental animals had severeLV dysfunction (Fig. I). Heart funct ion was globally reducedas indicated by a decrease in LV developed pressure , in therate of rise of LV pressure and in cardiac output as well asby an increase in LVEDP. Furthermore, large myocardialinfarctions caused a high mortality. This early mortal ity de­creased by the modifications of the surgical technique from39% in our previous study [6] to 13% in this study, althoughthe hemodynamic measurements showed no differences in thesurviving animals.

Treatment with propranolol constantly reduced heart rateto about 300 bpm. Cardiac function seemed to improve 6 hafte r MI, since LV developed pressure was decreased andLVEDP increased to a lesser extent compared to untreated ratsafter MI (Fig . I). Cardiac output was decreased compared tountreated MI-rats 6 h after MI, while TPR was increased .Thisis a well known acute effect of ~-adrenergic receptor block­ade. We suggest that this drop in cardiac output contributedto the increased early mortality in Ml-rats treated with pro­prano lol. Moreover, we speculate that the less pronouncedincrease in LVEDP is rather due to a lower LV filling fromthe pulmonary circulation where the vascular resistance mightalso be increased. Sia et al. recently described a similar de­crease in survival due to excessive early mortality after MIin rats treated by carvedilol [19] . In contrast to the initial ef­fect of propranolol, cardiac output was increased and TPRwas decreased compared to non-treated MI-rats 24 and 72 hafter MI. This indicates an increase in stroke volume sinceheart rate was still reduced by ~-adrenergic receptor block­ade. Therefore, one might speculate that a longer lasting ~­

adrenergic receptor blockade before Ml has beneficial effects .However, the primary aim of this study was to investigatecard iac cytokine expression after MI under ~-adrenergic

134

A) B)110 n ;F-II, t .;.IOU

".;.

~II ~II'I' ~II ~II+I'so

~I\ ~I\ I' \1\ ~I\'I'" 0

- (> h --< - 12 h --< -24 h--< - 72 h - 'J, ~(I

--, 20

T(i F-II IC· (I

- - - - - • • .~ 6 h 12 h ;~h -;~ h

-e311

T(IF -rl, - .E.- ~

;; 2(1

rc iF -f\ , : - : ] 1(1-;;

I < 0i\R I' I' I 7-c:: (,h 12 h ::: ·1h 7~h0:

"II

.~ ~n 'I C F-JlJ tI I II I '1'"( iA I'DII ~ 30

20

10

"6h 1211 2~h 7: h

rO , ham O \ I\ . \ I\ · 1' :

Fig. 7. (A) Representative autoradiograph from RNase protection assay (TGF-set) in the infarcted myocardium at different times after myocardial infarction(MI) and myocardial infarction plus propranolol treatment (MI + P). Each lane was loaded with 5 j.lg total RNA. (B) Relative TGF-~ , (upper panel) , TGF­~2 (middle panel) and TGF-~3 (lower panel) mRNA express ion in the myocardium at different times after sham operation (sham) , myocardial infarction (MI)and myocardial infarction plus propranolol treatment (Ml + P). Data are expressed as mRNA abundance relative to ARPP mRNA and shown as mean ±

S.E.M.; n = 5-6 for each MI-group and n = 3-5 for each group of sham-operated controls ; tp < 0.05 vs. sham-operated controls .

receptor blockade. Its effectiveness was documented by thelowered heart rate .

Cardiac cytokine expression and matrix remodeling

The expression of IL-l ~ and IL-6 was rapidly upregulatedin the infarcted myocardium (Fig . 2). A similar induction ofpro-inflammatory cytokines was observed in various mod­els of ischemia and reperfusion [1-4]. Moreover, inflamma­tion is important for initiating repair as well as wound healingof the injured tissue, although the precise role of IL-l ~ andIL-6 is still a matter of debate. There are many factors whichmight contribute to the induction of pro-inflammatory cyto­kines such as hypoxia, complement derived factors (C5a) orTNFa, the latter liberated from resident mast cells [12, 13].Both IL-l Band IL-6 are induced in a similar fashion in themyocardium after treatment with norepinephrine (NE) [7].This increase in cytokine expression after NE is receptormediated, since it was prevented by combined a- and B­adrenergic receptor-blockade by carvedilol but not by nor­malizing TPR with the calcium-antagonists verapamil ornifedipine [7]. Previously, we have also shown that NE evokesIL-6 expression in cultured adult rat cardiac fibroblasts dueto B-adrenergic stimulation [15]. Additionally, NE is locallyand systemically elevated after MI [16].

The increase in the expression oflL-l Bwas attenuated bypropranolol 6 h to 1 day after MI. The expression of IL-6,however, was not significantly different in treated and un­treated animals (Fig. 3). Moreover, the increase in IL-6 ex­pression was much more pronounced than the increase inIL-l B.Similar differential effects of the B-adrenergic receptorblocker metoprolol on myocardial expression ofIL-IP and IL­6 have recently been reported in a rat model of post-Ml heartfailure [20]. Therefore, one might suggest that the inductionof IL-l ~ is mainly dependent on adrenergic activation, whilethat of IL-6 induct ion is not. This also helps to explain theparallel increase of both lL-l ~ and IL-6 expression as wellas the longer lasting induct ion of IL-l P. This differs fromthe classical cytokine cascade in which IL-IP precedes andinduces IL-6 expression.

The data also emphasize our previous proposition that 11­IP and IL-6 have distinct pathophysiological functions afterMI [I] . There is evidence that IL-IP is involved in extracel­lular matrix metabolism either in regulating the expressionof collagens or in regulating expression, liberation and acti­vation of matrix metalloproteinases [11, 21-25] . In fact , thegelatinolytic activity of MMP-9 measured by zymographywas markedly attenuated in the infarcted myocardium of thepropranolol-treated Ml-rats (Fig. 5). This suggests a role ofIL-IP in the MMP-9 activation, although this might also bea more indirect effect of IL-I B by delaying leukocyte infil-

tration, which, in tum, produce MMPs. Less infiltration, onthe other hand, is not likely, due to the presence of high levelMMP-8 and -9 mRNA (Fig . 4). Moreover, IL-6 was shownto be involved in leukocyte invasion by induction of ICAM­1 [2] or promoting transendothelialleukocyte migration [12].IL-6 expression was not affected after propranolol treatment(Fig. 3).

This highlights the complex interacting network of MMPregulation including cytokines and growth factors as well asextracellular matrix components, changes in cell shape, andcell-cell and cell-matrix interactions. All these stimuli mightbe responsible for the ongoing increase in MMP mRNA ex­pression (Fig. 4). Our data are in good agreement with previ­ous studies in which a compensatory upregulation of severalMMPs in the network was described in MMP-9 knock outmice as well as in rabbits with selective MMP inhibition [26­28]. Heymans et al. reported that MMP-9-deficient mice havea slightly decreased leukocyte infiltration, reduced cardiacruptures, but unchanged collagen deposition compared withwild type littermates [26]. Similar results have been reportedby Ducharme et al. in the same Ml-rnodel of MMP-9-defi­cient mice [27]. Furthermore, they observed decreased accu­mulation of interstitial collagen, probably due to increasedcollagen degradation, since MMP (-2, -3, -13) protein con­tent increased in MMP-9-deficient mice, while there were nodifferences in collagen type I mRNA. Reduced post-MI wallthinning and reduced ventricle dilatation were also recentlydescribed in rabbits and mice with MMP inhibition [28, 29] .MMP-7 and -13 protein was increased in the rabbit model,but total collagen content did not change in both studies [28,29]. However, a comparison is difficult, since mice and ratsdo not express MMP-1 postnatally. Moreover, all these stud­ies, as ours, did not measure collagen turnover. This wouldbe of importance, since the deposition rate of newly synthe­sized collagen is known to vary from 20-90% [30] .

Taken together, these data lead us to suggest that a decreasein MMP-9 activity contributes to the beneficial effects of~­adrenergic receptor blocking therapy in heart disease. Al­though it may be somewhat confusing at first glance, reducedMMP-9 activity may lead to reduced ventricular remodelingand collagen accumulation. One theory is that disruption ofcollagen fibrils is necessary to establish new matrix attach­ments [31] . On the other hand, collagen turnover might beincreased due to a compensatory elevation in expression andactivity of other MMPs. This is supported by a pronouncedincrease in MMP-8 gene expression after propranolol treat­ment (Fig . 4) . Gelatinolytic activity ofMMP-2, however, washardly affected (Fig . 5) . An increase in MMP-3 , -7 and -13protein was also observed in models of MMP-9 knock outor blockade [27,28]. The underlying mechanism of decreasedMMP-9 activity after ~-adrenergicblockade might be direct,but might also be mediated via a decrease in IL-l ~. A mecha­nistic link between IL-l~ and wound healing has recently been

135

suggested by Hwang et al . using anti IL-1~ antibodies in amouse Mi-model [21]. Interestingly, anti-Il--If treatmentincreased the occurrence of ventricular rupture. Since theresorption of the necrotic area needs to precede the replace­ment by scar tissue, one might speculate that anti-IL-1 ~ treat­ment leads to delayed inflammation and wound healing. Itis, therefore, not surprising that Hwang et al. proposed de­layed wound healing as indicated by the observed suppressedcollagen accumulation in the infarct-related area [21] . Col ­lagen III expression was reduced, but MMP expression andactivity were not examined [21].

The main limitation of our study is that IL-1 ~ and MMPprotein content as well as the histology of the infarcted heartcould not be examined due to the limited tissue amounts .Therefore, we cannot completely rule out the possibility thatpropranolol treatment reduced the post-MI cell infiltration.A slight reduction in leukocyte infiltration between 4 and 15days after MI in MMP-9 knock out mice has recently beendescribed [26, 27]. Additionally, we can only hypothesize onthe net MMP activity. Finally, it could be speculated that theresidual IL-1 ~ mRNA expression after ~-adrenergic receptorblockade (Fig . 3) may result in smaller amounts ofIL-l~ pro­tein. This might be sufficient for normal leukocyte infiltra­tion, wound healing and collagen expression (Fig . 6). The netcontribution of IL-l ~ to collagen expression, however, re­mains a matter of discussion. Other factors are important aswell. We have recently suggested that also IL-6 might be in­volved in collagen expression either directly or indirectly bypromoting (myo)fibroblast proliferation [1, 32-34]. This isin good agreement with our observation that neither IL-6 norcollagen expression were affected by propranolol treatment.TGF-~ is also recognized as a powerful fibrotic cytokine

family mediating tissue repair. TGF-~, is capable to stimu­late the proliferation of mesenchymal cells and it is a power­ful initiator of the production of ECM components in a varietyof cell types [35]. Moreover, TGF-~, stimulates MMP-2 and-9 expression, while it decreases the net MMP activity bydecreasing MMP-l expression and possibly by stimulatingTIMP expression. In previous studies, TGF-~, was elevatedup to 12 weeks after MI [6, 36, 37] . Little is known about thefunction ofTGF-~2 and -~3 ' As we have recently shown, TGF­~2 is expressed predominantly in the wall of blood vessels inthe border zone of infarctions [6]. In addition, it occurs inmost embryonic tissues with development [38]. It may, there­fore, be involved in the induction of the fetal gene programin the myocardium which is known to indicate cardiac hyper­trophy. Additionally, TGF-~3 is involved in early cardiac de­velopment [38,41], but it was also shown to avoid overscarringin gastric ulcers and dermal wounds [42,43] . It has recentlybeen shown to be persistently increased in the infarct scarfrom day 3 after MI onwards [6]. The expression pattern ofthe TGF-~ isoforms, however, was essentially the same af­ter propranolol treatment when compared with untreated MI-

136

rats (Fig. 7). This is in line with the data on normal collagenexpression after propranolol treatment and suggests a regu­lar invasion of the injured tissue by (myo)fibroblasts.

Acknowledgements

This work was supported by the Deutsche Forschungs­gemeinschaft (ZI 199/10-3). The excellent technical assist­ance of Brigitte Mix and Grit Marx is gratefully appreciated.

References

I. Deten A, Volz HC, Zimmer H-G : Cardiac cytokine expression is up­regulated in the acute phase after myocardial infarction. Experimen­tal studies in rats . Cardiovasc Res 55: 329-340, 2002

2. Kukielka GL , Smith CW, Manning AM, Youker KA, Michael LH,Entman ML: Induction of interleukin-6 synthesis in the myocardium.Potential role in postreperfusion inflammatory injury. Circulation 92:1866-1875,1995

3. Frangogiannis NG, Youker KA, Rossen RD , Gwechenberger M,Lindsey MH, Mendoza LH, Michael LH, Ballantyne CM, Smith CW,Entman ML : Cytokines and the microcirculation in ischemia andreperfusion. J Mol Cell Cardiol30: 2567-2576,1998

4. Gwechenberger M, Mendoza LH, Youker KA, Frangogiannis NG,Smith CW, Michael LH, Entman ML : Cardiac myocytes produceinterleukin-6 in culture and in viable border zone of reperfusedinfarctions. Circulation 99: 546-551 , 1999

5. Sutton MG,Sharpe N: Left ventricular remodeling after myocardial in­farction : Pathophysiology and therapy . Circulation 10I: 2981-2988,2000

6. Deten A, Holzi A, Leicht M, Barth W, Zimmer H-G: Extracellular ma­trix changes in the infarct area and in the non-infarcted left ventricleafter coronary artery ligation in rats. J Mol Cell Cardiol33 : 1191-1206,2001

7. Barth W, Deten A, Bauer M, Remohs M, Leicht M, Zimmer H-G: Dif­ferential remodeling of the left and righ t heart after norepinephnnetreatment in rats: Studies on cytokines and collagen . J Mol Cell Cardio!.32: 273-284,2000

8. Hirota H, Yoshida K, Kishimoto T, Taga T: Continuous activation ofgp 130, a signal-transducing receptor component for interleukin 6-re­lated cytokines, cause s myocardial hypertrophy in mice. Proc Nat AcadSci USA 92: 4862-4866, 1995

9. Long CS: The role of interleukin-I in the failing heart. Heart FailureRev 6: 81-94,2001

10. Wollert KC, Drexler H: The role ofIL-6 in the failing heart. Heart Fail­ure Rev 6: 95-103, 2001

II. Siwik DA, Chang DL, Colucci W7: Interleukin-I beta and tumornecrosis factor-alpha decrease collagen synthesis and increase ma­trix metalloproteinase activity in cardiac fibroblasts in vitro . Circ Res86: 1259-1265,2000

12. Rui T, Cepinskas G, Feng Q, HoY-S, Kvietys PR: Cardiac myocytesexposed to anoxia-reoxygenation promote neutrophil transendothelialmigration. Am J Physiol281 : H44<J.-H447, 2001

13. Frangogiannis NG,Smith CW, Entman ML:The inflammatory responsein myocardial infarction. Cardiovasc Res 53: 31-47, 2002

14. All MH, Schlidt SA, Chandel NS, Hynes KL, Schumacker PT, GewertzBL: Endothelial permeability and IL-6 production during hypoxia : RoleofROS in signal transduction. AmJ PhysioI277 : LI 057-L1 065, 1999

15. Burger A, Benicke M, Deten A, Zimmer H-G: Catecholamines stimu­late interleukin-6 synthesis in rat cardiac fibrob lasts .Am J Physiol 281:H14-H21,2001

16. Schomig A: Catecholamines in myocardial ischemia. Systemic and car­diac release . Circulation 82: 1113-1122, 1990

17. Zimmer H-G, Gerdes AM, Lortet S, Mall G: Changes in heart func­tion and cardiac cell size in rats with chronic myocardial infarction. JMol Cell Cardiol22: 1231-1243, 1990

18. Zierhut W, Zimmer H-G: Significance of myocardial alpha- and beta­adrenoceptors in catecholamine-induced cardiac hypertrophy. Circ Res65: 1417-1425, 1989

19. Sia YT, Parker TG, Tsopori s IN , Liu P, Adam A, Rouleau JL: Long­term effects of carvedilol on left ventricular function, remodeling, andexpression of cardiac cytokines after large myocardial infarction in therat. J Cardiovasc Pharmacol 39: 73-87,2002

20. Prabhu SD, Chandrasekar B, Murray DR, Freeman GL: Beta-adren­ergic blockade in developing heart failure : Effects on myocardial in­flammatory cytokines, nitric oxide , and remodeling. Circulation 101:2103-2109,2000

21. Hwang MW7, Matsumon A, Furukawa Y, Ono K. Okada M, IwasakiA, Hara M, Miyamoto T, Touma M, Sasayama S: Neutralization ofinterleukin-Ibeta in the acute phase of myocardial infarction promotesthe progression of LV remodeling. J Am Coil Cardiol 38: 1546-1553,2001

22. Opdenakker G, Masure S, Grillet B, Van Damme J: Cytokine-medi­ated regulation of human leukocyte gelatinases and role in arthritis.Lymphokine Cytokine Res 10: 317-324, 1991

23. Zhang Y, McCluskey K, Fuju K, Wahl LM : Differential regulation ofmonocyte MMP- and TIMP-I production by TNF-alpha, granulocyte­macrophage CSF, and IL-I beta through prostaglandin-dependent and-independent mechanisms. J Immunol lo l: 3071-3076,1998

24. Johnatty RN, Taub DD, Reeder SP, Turcovski-Corrales SM, CottamDW, Stephenson TJ, Rees RC: Cytokine and chemokine regulationof proMMP-9 and TIMP-I production by human peripheral bloodlymphocytes. J Immunol 158: 2327-2333, 1997

25. Zaoul P, Barro C, Morel P: Differential expression and secretion ofgelatinases and tissue inhibitor of metalloproteinase-I during neu­trophil adhesion. Bioch im Biophys Acta [290: 101-112, 1996

26. Heymans S, Luttun A, Nuyens D, Theilmeier G, Creemers E, MoonsL, Dyspersin GD, Cleutjens JP, Shipley M, Angell ilo A, Levi M, Nube0, Baker A, Keshet E, Lupu F, HerbertJM, Smits JF, Shapiro SD, BaesM, Borgers M, Collen D, Daemen MJ, Carmeliet P: Inhibition of pias­minogen activators or matrix metalloproteinases prevents cardiac rup­ture but impairs therapeutic angiogenesis and cause s cardiac failure.NatMed5: 1135-1142,1999

27. Ducharme A, Frantz S, Aikawa M, Rabkin E, Lindsey M, Rohde LE,Schoen FJ, Kelly RA, Werb Z, Libby P, Lee RT: Targeted deletion ofmatrix metalloproteinase-9 attenuates left ventricular enlargement andcollagen accumulation after experimental myocardial infarction . J ClinInvest 106:55-62,2000

28. Lindsey ML, Gannon J, Aikawa M, Schoen FJ, Rabkin E, Lopre sti­Morrow L, Crawford J, Black S, Libby P, Mitchell PG, Lee RT: Se­lective matrix metalloproteinase inhibition reduces left ventricularremodeling but does not inhibit angiogenesis after myocardial inf­arction . Circulation 105: 753-758, 2002

29. Rohde LE, Ducharme A, Arroyo LH, Aikawa M, Sukhova GH, Lopez­Anaya A, McClure KF, Mitchell PG,Libby P, Lee RT: Matrix metallo­proteinase inhibition attenuates early left ventricular enlargement afterexperimental myocardial infarction in mice. Circulation 99: 3063­3070, 1999

30. Bishop JE, Laurent GJ: Collagen turnover and its regulation in the nor­mal and hypertrophying heart. Eur Heart J 16(suppl C): 38-44, 1995

31. Weber KT: Extracellular matrix remodeling in heart failure . Circula­tion 96: 4065-4082, 1997

32. Kondo K, Okada T, Matsui T, Kato S, Date K, Yoshihara M, Nagata Y,Takagi H, Yoneda M, Sugie I: Establishment and characterization of ahuman B cell line from the lung tissue of a patient with scleroderma;extraordinary high level of IL-6 secretion by stimulated fibroblasts .Cytokine 13: 220-226, 2001

33. Xue H, McCauley RL, Zhang W: Elevated interleukin-6 expression inkeloid fibroblasts . 1 Surg Res 89: 74-77, 2000

34. Choi I, Kang HS, Yang Y, Pyun KH: IL-6 induces hepatic inflamma­tion and collagen synthesis in vivo. Clin Exp Immunol 95: 530-535,1994

35. Thompson NL, Bazoberry F, Speir EH, Casscells W, Ferrans Vl , Flan­ders KC, Kondaiah P, Geiser AG, Sporn MB: Transforming growthfactor beta-I in acute myocardial infarction in rats. Growth Factor s I:91-99, 1998

36. Hao 1, Ju H, Zhao S, lunaid A, Scammell-La Fleur T, Dixon 1M: El­evation of expression of Smads 2, 3, and 4, decorin and TGF-beta inthe chronic phase of myocardial infarct scar healing. 1 Mol Cell Cardiol31: 667-678,1999

37. Sun Y, Zhang ro, Zhang 1, Ramires Fl : Angiotensin II, transforminggrowth factor-betal and repair in the infarcted heart. 1 Mol Cell Cardiol30: 1559-1569,1998

38. lakowlew SB, Ciment G, Tuan RS, Sporn MB, Roberts AB: Expres-

137

sion of transform ing growth factor-beta 2 and beta 3 mRNAs and pro­teins in the developing chicken embryo. Differentiation 55: 105-118 ,1994

39. Potts JD, Dagle 1M, Walder lA , Weeks DL, Runyan RB: Epithelial­mesenchymal transform ation of embryonic cardiac endothel ial cells isinhibited by a modified antisen se oligodeoxynucleotide to TGF-beta3. Proc Nat Acad Sci USA 88: 1516-1520, 1991

40. Lafyatis R, Lechle ider R, Roberts AB, Sporn MB: Secretion and tran­scriptional regulation of transforming growth factor-beta 3 duringmyogenesis . Mol Cell Bioi II : 3795-3803, 1991

41. Kaartinen V, Voncken rw,Shuler C, Warburton D, Bu D, HeisterkampN, Groffen 1: Abnormal lung development and cleft palate in micelacking TGF-beta 3 indicates defects of epithelial-mesenchymal inter­action . Nat Genet II : 415-421 , 1995

42. Wu L, Siddiqui A, Morris DE, Cox DA, Roth SI, Mustoe TA: Trans­forming growth factor beta 3 (TGF beta 3) accelerate s wound healingwithout alteration of scar prominence. Histologic and competitive re­verse-transcription-polymerase chain reaction studies.Arch Surg 132:753-760, 1997

43. Coerper S, Sigloch E, Cox D, Starlinger M, Koveker G, Becker HD:Recombinant human transforming growth factor beta 3 acceleratesgastric ulcer healing in rats . Scand 1 Gastroenterol 32: 985-990, 1997

Molecular and Cellular Biochemistry 251: 139-1 43, 2003.© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Revisiting the surgical creation of volume load byaorto-caval shunt in rats

Catherina Ocampo, Paul Ingram, Michel Ilbawi, Rene Arcilla andMadhu GuptaThe Heart Institute for Children, Advocate Hope Children's Hospital , Oak Lawn, IL, USA

Abstract

Cardiac hypertrophy is an earl y landmark during the clinical course of heart failure , and is an important risk factor for subse­quent morbidity and mortality. The hypertrophy response to different types of cardiac overload is distinguished both at themolecular and cellular levels.These changes have been extensively characterized for pressure load hypertrophy; however, similarinformation for volume load hypertrophy is still needed. This study was undertaken to impro ve the existing method of produc­ing experimental cardiac volume load . Previous investigators have employed surgical aorto-caval shunt (ACS) as a model forvolume load hypertrophy (VO) in rats. The procedure is relatively simple and involves glue to seal the aortic hole after ACS.However, it has several limitation s mostly related to the use of glue e.g. poor visualization due to hardening of tissues, imper­fect sealing of the puncture site and glue seeping throu gh the aorti c hole resultin g in shunt occlusion. We have modified theprocedure using aortic adventitial suture instead of glue and 18G angiocatheter instead of 16G needle, which eliminated thetechnical difficulties from the former method. TheACS was visually confirmed at sacrifice, and the VO demonstrated by time­related changes in the heart weight/body weight ratio which increased from 78% at 4 week s to 87% at 10 weeks and increasedliverlbody weight ratio by 22% at 10 weeks of post aorto-caval shunt. Cardiac expre ssion of atrial natriuretic peptide (ANF)also demon strated time-related increa se in ANF mRNA (+275% increase at 4 weeks , p < 0.05, and +370% increa se at 10 weeks,p < 0.00 1). This modified technique of aorto-caval shunt offers simpler, reprod ucible and consistent model for VO hypertro ­phy in rats. (Mol Cell Biochem 251: 139- 143, 2003)

Key words: cardiac hypertrophy, volume load, aorto-caval shunt, gene expression

Introduction

Chronic imposition of increased workload on the myocar­dium results in hypertrophy, initially con sidered an adap­tation to increased work but ultimately leading to dilatedcardiomyopathy and heart failure. Cardiac overload may befrom pressure load, e.g. right or left ventricular outflow ob­struction and systemic or pulm onary hypertension, or it maybe from volume overload, e.g. intra or extra cardiac shunt­ing or valve regurgitation. These may be congenital or ac­qu ired . Several (surgical and non- surgical ) methods areavailable for the creation of volume overload in the rat heart.The most widely used is the method described by Garcia andDiebold [I] . Briefly, a midline abdominal incision is made

and the aorta is punctured with a 16G needle , which is ad­vanced into the IVC throu gh the posterior wall of the aorta,creating an aorto -caval fistula. The aortic puncture site is im­mediately sealed with cyanoacrylate glue . Althou gh a sim­ple process, we have encountered several difficulties with thistechnique , mainly related to the glue application and the useof 16G needle . The se include counter puncturing of the venacava by the long bevel of the needle, spreading of the glue tothe neighboring tissues resulting in tissue hardening, oozingand bleeding from the puncture site due to imperfect sealing,poor visua lization of the shunt due to tissue hardening andrepeated glue applic ation and, on many occa sions, extrava-

Addressfor offp rints: M. Gupta, The Heart Institute for Children, Advocate Hope Children 's Hospital, 4440 W. 95th Street , Oak Lawn,IL 60453 , USA(E-mail: mgupta@thic.com)

140

sation of glue into the vessel, resulting in occlusion of shuntflow. More importantly, it has been difficult to visualize orascertain the status of the fistula at the time of sacrifice.

We have modified this method without the use of glue, spe­cial equipment or microsurgery for sealing the puncture site.The technique is easy and reproducible and confirmation ofthe VO was provided by the visualized fistula at sacrifice,blood gas measurements, heart weight/body weight ratios,and increased expression of atrial natriuretic factor (ANF),which is a molecular marker of hypertrophy.

Materials and methods

Shunt creation

The Board of Biological Research Laboratory at Universityof Illinois at Chicago approved all protocols for animal careand experimentation. Thirty adult male Sprague-Dawley rats(300 ± 20 g) were anesthetized with intraperitoneal pento­barbital (50 mg/kg) and positioned supine on the table . Amidline abdominal incision was made and the descendingaorta above the renal bifurcation was cleared of adjacent tis­sues and a snugger was placed. The infra-renal portion of theaorta and inferior vena cava were exposed at a site where thetwo vessels share a common fascia . At this site, a 7-0 poly­propylene suture was applied on the aorta, with special at­tention that the suture penetrated only the adventitia (Fig. la).A deep suture otherwise, will result in occlusion ofthe aorta.The supra-renal portion of the abdominal aorta was thenoccluded with a snugger to control bleeding. The ACS was

then created with an 180 angiocatheter inserted between thesutures on the anterior surface of the aorta (Fig. 1b), carefullypuncturing the posterior aortic wall up to the adjoining IVCwith the needle, and then advancing the catheter into the IVC.The suture was then tightened against the catheter and tiedupon withdrawal of the catheter. Following release of thesnugger, we observed mixing of arterial and venous blood inthe IVC, with distention of and pulsations in the IVC. Theabdomen was then closed using 4-0 silk sutures. Controlanimals (n =12) were treated the same way except for IVCpuncture. The rats were allowed to recover on warm beddingand routine care was continued at the animal laboratory inaccordance with the Guiding Principles in the Care and Useof Animals.

Shunt patency

Rats were sacrificed after 4 and 10 weeks of volume over­load . After intraperitoneal injection of pentobarbital, a mid­line incision was again made and the IVC and aorta werevisualized. Blood samples were obtained from the femoralvein, IVC above the shunt and from the aorta. Oxygen satu­ration was measured to confirm arterial blood flow into theIVC. Hearts and livers were weighed and compared to bodyweight. The hearts were then flash frozen in liquid nitrogenand stored at -80°C for RNA analysis.

Gene expression

a

IVC

b

Angiocath

Total RNA was extracted from frozen hearts using Trizolreagent as per manufacturer's instruction (Life Technologies) .Twenty ug of total RNA was separated by electrophoresis ona 1.2% formaldehyde agarose gel. The RNA was transferredto a Hybond-N membrane (Amersham Pharmacia Biotech).The probes utilized for ANF was 620 bp cDNA fragment, re­leased from its vector pOEM following Bam HI and EcoRIdigestion, gel purified and radiolabelled by random prim­ing using 3

2p adCTP (lCN Biochemicals). Ethidium bromidestaining and hybridization with cytoskeletal p-actin cDNAwas used to correct for variations in loading efficiencies. Fol­lowing hybridization, the signal was detected by autoradiog­raphy and quantified by densitometry.

Fig. I. Schematic diagram for creating ACS. (a) rvc and aorta are exposedat a site where they run in close proximity below renal artery . A 7-0 sutureis applied on the adventitia of the aorta and a snugger was placed on thesupra renal portion of the aorta (not shown). (b) An angiocatheter is intro­duced between the sutures and advanced through the aorta to the adjacentwall of the IVC to create a fistula . The catheter is later withdrawn, the su­ture tied, and the snugger relea sed.

Data analysis

All values are expressed as means ± S.D. Student's t-test wasused to compare values , using p value < 0.05 for statisticalsignificance.

141

Fig. 2. Photograph of the IVC at the time of sacrifice of sham control (left) and va (right) . Note marked distention of the IVC (arrow) in the va model ascompared to sham-operated animal.

Results

Shunt patency

All rats with ACS demonstrated good shunt flow from theaorta into the IVC at the time of sacrifice as evidenced bymarked distention of the IVC and obvious arterio-venousmixing (Fig. 2). In addition, there was a palpable abdominalthrill in all rats with VO that was clearly absent in the shamcontrols. In our initial pilot experiments, 2 rats died within24 h after surgery. These animals were found to have oc­cluded flow in the distal descending aorta, caused by the

suture that was not confined to the adventitial layer of theaorta, resulting in large shunt flow into the IVC and mark­edly dilated hearts. In the VO group, the oxygen saturationin the IVC above the shunt was markedly higher as comparedto that of sham, and was nearly equivalent to the arterialoxygen saturation of the abdominal aorta (Table 1). The oxy­gen saturation below the shunt (femoral vein) was compa­rable in the sham and VO groups. The oxygen saturationanalysis was done only to confirm shunt patency shown bythe presence of arterial blood in the vena cava but was notused for hemodynamic calculations.

Organ to body weight ratios

Note the difference in oxygen saturation of lVC between sham and va dueto arterial shunt flow into the latter.

Table 1. Oxygen saturation (%) of blood samples obtained from aorta (ref­erence for arterial saturation), lVC above the shunt (to confirm ACS) andfemoral vein (control for venous saturation) of sham control (sham) and ratssubjected to ACS (Va)

Group

ShamShamShamVOvava

Aorta (%)

979998999899

Fern. vein (%)

797268697860

lVC (%)

716872949596

To measure the extent of cardiac hypertrophy following 4 and10 weeks of VO, the heart and liver weights of all animalswere obtained. These were normalized by their respectivebody weights. As shown (Table 2a), a significant degree ofhypertrophy was already evident at 4 weeks of ACS as re­flected by 78% increase in the heart weight to body weightratio in VO group as compared to sham control (p < 0.002).The liver to body weight ratio between controls and VO didnot differ at this time point. At 10 weeks of VO (Table 2b) theheart weight to body weight ratio was increased by 87% ascompared to respective sham (p < 0.005), and the liver to bodyweight ratio also showed 22% increase in VO group (p < 0.01).

142

Table 2. Heart weight and liver weight at the time of sacrifice were indexed to body weight (mg/g), n =6. (A) Liver/body weight ratios were similar in bothgroups but heart weight/body weight ratio was significantly higher in va.body weight. (B) After 10 weeks of Vf) , both indexe s were significantly higher inva than in sham group

Group Body weight Heart weight HeartlBW Liver weight Liver/BW(g) (g) (mg/g) (g) (mg/g)

(A) 4 weeksSham 388 ± 8 1.25 ± 0.2 3.3 ± 0.2 12.2 ± 1.1 32.3 ± 1.34 weeks 380 ± 10 2.25 ± .3 5.9 ± 0.4 12.9 ±1.4 33.7 ± 3.2p value NS 0.001 0.0002 NS NS

(B) 10 weeksSham 427 ±20 1.4 ± 0.1 3.25 ± 0.2 12.9 ± 0.9 30.2 ± 1.110 weeks 461 ±21 2.8 ± 0.4 6.07 ± 0.7 17.0 ±2.4 36.7 ± 3.7p value NS 0.001 0.0005 0.016 0.014

Gene expression

We used Atrial Natriuretic Factor (ANF)-specific gene probeto further confirm induction of hypertrophy in our models.ANF has been widely studied as a marker for both volume andpressure-induced cardiac hypertrophy [5, 6]. As compared tocontrols the steady state mRNA levels forANF normalized for~ actin, showed 270% increase at 4 weeks (p < 0.05) and 370%increase at 10 weeks of VO (p < 0.001) (Fig. 3b).

Discussion

Volume overload induces morphologic and molecular changeswhich are distinct from other forms of hypertrophy [4-6] . Tofacilitate reliable analysis of the mechanisms by which these

changes occur, use of a more consistent and predictable modelof volume load hypertrophy is needed. Our simplified tech­nique for creating ACS allows immediate confirmatio n atsurgery, continued monitori ng, and repeat confirmation of theACS prior to sacrifice. The entire proc edure takes less than10 min to perform, with less than 3 min of aortic clamp timeand no mortality. No special equipment is needed, and theprocedure can be performed in any standard animal labora­tory using easy to obtain materials. Prior to sacrifice, an ab­dominal thrill was present in VO group but not in the shamcontrols. Blood gas measurements confirmed the patency ofthe shunt, which corre lated strongly with the abdominal thrilland ongoing volume load. All models demonstrated progres­sive increase in heart weight/body weight ratios over time,with the hearts weighing almost twice the normal weight. Thisfinding is very similar to prior experimental models [2]. Liver

A I Sham 4weeks VO 10weeks VO I B1200

1000 ~

800

600

400

200 -

Do .sham 4weeks 10weeks

Fig. 3. (A) Analysis of ANF expression in total RNA isolated from hearts of sham controls (sham, n = 3), volume load for 4 weeks (4 weeks va,n = 3) andvolume load for 10 weeks (10 weeks va, n =4). Twenty microgram of total RNA resolved on a 1.2% formaldehyde agarose gel transferred to a nylon mem­brane and hybridized to an ANF probe (upper panel). Lower panel: the same membra ne was stripped of ANF probe and re-hybridized to a random primedeDNA probe for cytoskeletal pactin to correct for loading differences. (B) Quantitative analysis of ANF expression in sham controls , 4 weeks VO and 10weeks va. The radiograms of 3a were scanned, the density of each signal was quantified as number of pixels present in defined area, which were normalizedfor the pactin pixel units and are presen ted as arbitrary units.

weight also increased but to a lesser extent, consistent withhepatic congestion from heart failure.

The increase in expression of ANF also was more markedat 10 weeks as compared to the 4-week model , suggestinginvolvement of genes other than ANF in the early phase ofcardiac hypertrophy [4, 6].

We are in the process of further characterizing this VOmodel by echocardiography - monitoring degree of hyper­trophy and dilatation, and correlating these with functional,hemodynamic and molecular changes. A more complete un­derstanding of the molecular mechanisms that bring aboutvolume load hypertrophy will be helpful in future attemptsto manipulate these genes to prevent and treat volume inducedcardiac hypertrophy.

Acknowledgements

This work was supported by grants from the American Heart

143

Association, Children's Heart Foundation and Med-Fund ofChrist Hospital

References

I . Garcia R, Diebold S: Simple, rapid , and effective method of produc­ing aorto caval shunts in the rat. Cardiovasc Res 24: 430-432 , 1990

2. Flaim S, Minteer W: Chronic arteriovenous shunt : Evaluation of amodel for heart failure . Am J Physiol236: H698-H704, 1979

3. Hatt P, Rakusan K, Gastineau P, Laplace M: Morphometry and ul­trastructure of heart hypertrophy induced by chronic volume overload .J Mol Cell Cardiolll : 989-998,1979

4. Calderone A, Takahashi N, Colucci WS: Pressure and volume-inducedleft ventricular hypertrophies are associated with distinct myocytephenotypes. Circulat ion 92: 2385-2390, 1995

5. Su X, Brower G,Janicki JS: Differential expres sion of natriuretic pep­tides and their receptors in volume overload cardiac hypertrophy in therat. J Mol Cell Cardiol31 : 1927-1936,1999

6. Gupta M, Gupta M: Cardiomyocytes and non-muscle cells in cardiachypertrophy. Prog Ped Card 9: 183-197,1999

Molecular and Cellular Biochemistry 251: 145-151 ,2003 .© 2003 Kluwer Academic Publishers. Printed in the Netherlands.

Proteomic analysis of Racl transgenic micedisplaying dilated cardiomyopathy reveals anincrease in creatine kinase M-chain proteinabundance

Nina Buscemi,' Amanda Doherty-Kirby,' Mark A. Sussman,'Gilles Lajoie' and Jennifer E. Van EykI ,4

Departments of IPhysiology and "Biochemistry, Queen's University, Kingston, Ontario ; 2Department ofBiochemistry,University of Western Ontario, Siebens-Drake Research Institute, London, Ontario, Canada ; "The Children's Hospital andResearch Foundation, Division ofMolecular and Cardiovascular Biology, Cincinnati, OH, USA

Abstract

Here, we demonstrate the application of the proteomic approach to the study of a transgenic mouse model of heart failure andprovide an example of a disease-associated protein alteration that can be observed using this approach. Specifically, we ap­plied the proteomic approach to the analysis of a mouse model of dilated cardiomyopathy in which the small GTPase, Racl,was constitutively expressed specifically in the myocardium. We utilized the methods of two-dimensional gel electrophoresis(2-DE) for protein separation, silver-staining for protein visualization and mass spectrometry (MALDI-TOF and MS/MS) forprotein spot identification. Computer-generated composite images were created which represent a normalized average of four2-DE gel images derived from analysis of either Rae I transgenic (n = 4) or non-transgenic (n = 4) mice . Analysis of compositeimages derived from NTG and Rae I experimental groups revealed numerous statistically significant differences in mean pro­tein spot intensities. Here, we report a statistically significant increase, of approximately 1.6-fold, in the mean protein spotintensity for creatine kinase M-chain in the composite image of Rae I transgenic mice compared to control. This protein altera­tion may be cons istent with an end-stage heart failure phenotype in which maximal myocardial reserve is employed to sustainsurvival. (Mol Cell Biochem 251: 145-151,2003)

Key words: proteomics, heart failure, Racl

Introduction

Heart failure is a multi-factorial disease characterized by im­pairment of pump function and involves abnormalities in exci­tation-contraction coupling, calcium sensitivity and energeticsof cardiac myocytes (reviewed in [1]). Chronic heart failure isa progressive disease involving time-dependent molecularadaptation processes of the cardiac myocyte geared towardmaintaining adequate pump function. In early stages of thisdisease, cardiac myocytes respond to the pathological insult,such as ischemia/reperfusion injury, by decreased function and

energy expenditure in order to maintain basal cellular homeo­stasis. However, persistent exposure to the toxic stimulus andchronic impairment in cardiac output results in activation ofseveral neuro-renal-endocrine mechanisms designed to main­tain arterial blood pressure at homeostatic levels. Althoughinitially beneficial, these compensatory mechanisms persistbeyond normal levels and induce the heart to employ maxi­mal resources for the maintenance of cardiac output. Theseevents result in damaged myocardium from excessive stimu­lation and increased after-load secondary to chronic hyperten­sion, characteris tic of end-stage heart failure .

Addressfor offprints: I.E . Van Eyk, Department of Physiolog y, Queen 's University , Kingston, Ontario , Canada , K7L 3N6 (E-mail : lVE1 @post.queensu.ca)

146

Myocardial remodeling is an important feature of the pro­gression of heart failure (reviewed in [2]). This processinvolves myocyte hypertrophy and apoptosis, renewedexpre ssion of fetal genes and alterations in the myofilament,cytoskeleton and extracellular matrix. Importantly, knowl­edge of the protein alterations associated with myocardialremodeling will provide insight into the underlying mecha­nisms of heart failure development, and strategies to inhibitthese mechanisms will likely prove useful in inhibiting theprogression of heart disease.

The application of the proteomic approach to the studyof myocardial remodeling and progression of heart failurewould provide insight into the mechanisms underlying theseprocesses, since this approach permits comparisons of cel­lular protein profiles along the course of changing environ­mental influences and progression of disease. Although theultimate goal may be to determine the molecular mechanismsof human heart failure , the multi-factorial nature of this dis­ease in humans precludes derivation of associations betweenthe original heart failure stimulus and specific changes to thecellular proteome and thus mechanisms of disease progres­sion. The use of animal models of human heart failure mayprove useful in this regard, since it is possible to employ aspecific stimulus of heart failure and characterize prote inalterations associated with this particula r stimulus and, ulti­mately, invoke a stimulus-specific mechanism for cardiacdisease progression. A number of studies have applied abroad-base proteomic strategy for characterization of proteinalterations associated with various animal models of heartfailure [3-7] . The results of these studies indicate that anumber of categories of proteins and cellular compartmentsare involved in mechanisms of cardiac failure, including pro­teins associated with the mitochondria and energy produc­tion and the cytoskeleton.

Rae 1 is a member of the Ras superfamily of monome ricG-proteins and has been implicated in cardiac myocyte re­model ing (reviewed in [8]). Transgenic mice expressing aconstitutively active form of Rac1 specifically in the myo­cardium develop one of two phenotypes, namely,compensatedhypertrophy or dilated cardiomyopathy, the latter phenotyperesulting in death within 3 weeks of birth and representingthe predominant phenotype among Rac1 mice. In this study,we applied the proteomic approach to the analysis of Rac1transgenic mice displaying dilated card iomyopathy. Thismodel underscores the essential role of cardiac remodelingin the development of heart failure and proteomic analysisof this model of cardiac failure will likely shed light on theunderly ing mechanisms of cardiac remodeling that are rel­evant to severe cardiac dysfunction.

Here we present a detailed illustration of the process in­volved in proteomic analysis of a transgenic mouse modelof heart failure and provide an example of a disease-associ­ated protein alteration that can be observed using this ap-

proach. Importantly, we report an approximate 1.6-fold in­crease in creatine kinase M-chain in ventricular tissue of Rae1 transgenic mice compared to control. Creatine kinase M­chain is a subunit of creatine kinase , the latter involved incatalysi s of the biochemical reaction whereby creatine phos­phate and ADP are converted to creatine and ATP.

Materials and methods

Animal model

Creation and breeding ofRac1 transgenic and non-transgenic(NTG) mice is described in detail in [9]. The transgene wascreated by insertion of full length rae 1 cDNA, encoding con­stitutively active Racl protein, downstream of the a -MHCpromoter. Rac1 transge nic mice displayed const itutive ex­pression ofRacl specifically in the myocardium and showeddilated cardiomyopathy. Collection of mouse hearts is de­scribed in detail in [9]. For purposes of proteomic analysis,hearts were isolated from 2 -3 week old Racl transgenicmice displaying the dilated phenotype (range of heart-to­body weight ratio e 14-17) as well as age-matched NTG mice(range of heart- to-body weight ratio e 5-6) and immediatelyfrozen in liquid nitrogen .

Sample preparation

A sequential extraction technique ('IN sequence' ) was em­ployed for the enrichment of cytoplasmic proteins from ven­tricular tissue of NTG and Rae1 transgenic mice [10]. Thisapproach allowed for a detailed investigation of the cytosoliccompartment, which is known to contain many of the com­ponents of Racl signaling in the myocyte [8]. Specifically,for each animal to be analyzed, ventricular tissue was homog­enized , at 4°C, in a buffer containing 20 mM Tris-CI, pH 6.8,0.25 mM PMSF, 1 mM leupeptin, 1 11M pepstatin, 2 mMEDTA-Na, 0.2 mM Na

3V0

4, and 50 mM NaF, and the ho­

mogenate was centrifuged at 16,000 g for 5 min at 4°C. Thesupernatant was isolated as a cytoplasmic protein -enrichedextract and stored as small aliquots at - 80°C. Protein con­centration was determined by use of a Bradford Assay andconfirmed by densitometry of Coomassie Blue staining ofone-dimensional sodium dodecyl sulphate-polyacrylamidegel electrophoresis (I -D SDS-PAGE).

Protein separation

Proteins were resolved by two-dimensional gel electrophore­sis (2-DE) [11]. Proteins were separated in the first dimen ­sion by isoelectric focusing (IEF) using immobilized pH

gradient (IPG) Ready Strips (170 mm, BioRad) , which hada linear pH range ofeither 4--7or 3-10. One hundred and fiftyug of total protein was dissolved in approximately 450 III ofrehydration buffer containing 8 M urea, 2.5 M thiourea, 0.5%ampholytes (pH 3.5-10, Sigma), 4% CHAPS , 2 mM EDTAand 100 mM DTT prior to application to IPG strips. IPG stripswere actively rehydrated at 50 V for 10 h and subjected to100V for 25 volt-h, 500 V for 125 volt-h, 1000 V for 250 volt­hand 8000 V for 65 000 volt-h at a temperature maintainedat 20°e. Upon completion of IEF, IPG strips were stored at-20°C.

Proteins were separated in the second dimension by SDS­PAGE. First , IPG strips were equilibrated in a buffer contain­ing 50 mM Tris-cl, pH 8.8, 6 M urea, 30% glycerol (v/v) , 2%SDS (w/v) and 10 mg/ml DTT for 20 min. This step was fol­lowed by incubation in a similar buffer containing 25 mg/mliodoacetamide instead of 10 mg/ml DTT for 20 min. Equili­brated IPG strips were subsequently applied to 4.5% stack­ing/12 .5% resolving SDS-PAGE gels using a Protean II XLsystem (BioRad). SDS-PAGE was conducted at 100 V for30 min followed by 250 V for 4.5 h.

Protein visualization

Subsequent to electrophoresis, 2-DE gel s were fixed in asolution containing 50% methanol/l 0% acetic acid. Proteinspots were visualized by sliver staining according to a pre­viou sly described method [12], which is compatible withspectrometric analysis of prote in.

Image analysis

2-DE gel images were acquired using a PowerLook II scan­ner (UMAX Data Systems Inc.) on a Sun Ultra 5 computer(Sun Microsystems Inc.) at a resolution of 150 dpi . Investi­gator HT Proteome Analyzer 1.0.1 software (Genomic So­lutions) was used to detect, quantify and match spots frommultiple 2-DE gel image s for the creation of composite im­ages. Two composite images were generated, each represent­ing a normalized average of four 2-DE gel images derivedfrom analysis of either four distinct NTG or Rae I transgenicmice. Significant differences in protein spot amounts wereascertained by t-test analysis of integrated intensities of corre­sponding protein spots from compo site images. A differencewith an associated p-value of less than 0.05 was consideredsignificant.

Protein identifi cation

The protein spot was subjected to in-gel digestion using trypsin,and this procedure was followed by recovery of peptides.

147

Peptide samples were dissolved in 6 ul, of 0.1% TFA (aq).Two ul, was used for MALDI analysis with the remainingused for LC-MS-MS analysis. MALDI was performed (inquadruplicate) on a Micromass MALDI-R reflectron massspectrometer in an automated fashion using MassLynx 3.5as the operating software. Calibration was performed priorto analysis using a standard set of peptides. The spectra wereexternally calibrated using adrenocorticotrophic hormoneclip 18-39 (monoisotopic mlz 2465.1989). Spectra wereautomatically proce ssed using the PeptideAuto.exe compo­nent of the MassLynx 3.5 software.The resulting text file wasused to search the Swiss-Prot and NCBInr databa ses usingProfound (http://prowl.rockefeller.edul) .

Liquid chromatography tandem mass spectrometry (LC­MS-MS) analysis was performed on a Micromass Q-TOF2quadrupole-time-of-flight mass spectrometer fitted with ananospray source . Desalting and separat ion were achievedonline using a Cl8-precolumn (5 x 0.3 mm, LC Packings)on a Waters Capl.C, Automated function switching was usedto obtain both a survey spectrum and multiple MS-MS spec­tra. Peptide sequences were determined in a semi-automatedmanne r using the PepSeq algorithm in the Biolynx compo­nent of MassLynx 3.5.

Results

Quali ty control assessment

As a first step, we sought to determine which IEF pH range,either 3-10 or 4-7, would allow for optimal resolution of alarge proportion of proteins from cytoplasmic protein-en­riched extracts. Approximately 150 ug of a cytoplasmic pro­tein-enriched extract from one animal was resolved by 2-DEusing either a pH gradient of 4--7 (Fig. I, panel A, upper) ora pH gradient of 3-10 (Fig. I, panel A, lower). Importantly,proteins with isoelectric point s within the 7-10 range werewell resolved and represented a larger proportion of the cy­toplasmic prote in-enri ched extract compared to those withisoelectric points between 4 and 7 (Fig. I, panel A, compareupper and lower). Thus, in order to conduct a more compre­hensive investigation of the cytosolic compartment, pH 3­10 IEF was employed for all subsequent analysis of Rae 1mice. Next, we sought to assess reproducibility of protein spotpattern s and intensities of 2-DE gels derived from analysisof a given animal. An equal amount of protein from multiplecytoplasmic protein-enriched extracts, origin ating from agiven animal, was resolved independently by 2-DE. Impor­tantly, a high degree of consistency in protein spot pattern andintensity was evident among 2-DE gels derived from analy­sis of unique sample preparations originating from ventricu­lar tissue of a particular Rae I transgenic mouse heart (Fig.I, panel B, compare upper, middle , and lower).

148

A pi- - -. ( pH 4-7) Bpi--.

Samp lePrep. #3

SamplePrep. #2

SamplePrep. #1

••

MW

•

,' .

. ... -, ..-

1~-----=1I-p-,-.(pH 3-10)~

MW

Fig. I . Appropriate representation of a cytoplasmic protein-enriched extract of ventricular tissue by 2-DE and reproducibility of 2-DE gel protein spotpatterns and intensities among unique sample preparations of ventricular tissue from a Rae I transgenic mouse heart. A cytoplasmic-protein enrichedextract of ventricular tissue contains a high proportion of proteins with isoelectric points between 7 and 10 and these are well resolved on a IEF pH rangeof 3-10 (panel A, compare upper and lower) . Sample preparations I, 2, and 3 yield similar 2-DE gel protein spot patterns and intensities (panel B, com­pare upper , middle and lower). Procedures are outlined in detail in 'Materials and methods'.

Alteration in protein level

Composite images of 2-DE gel images derived from analysisof NTG (Fig. 2, panel A, upper) and Rac1 transgenic (Fig. 2,panel A, lower) mouse ventricular tissue were generated. Spe­cifically, a composite image was generated by consolidationof four 2-DE gel images each derived from a distinct animal.Comparison of protein spot mean integrated intensities amongthe two composite images revealed several alterations in pro­tein spots in Rae I transgenic compared to NTG mice. One ofthese alterations corresponded to a protein of approximatemolecular weight of 45 kDa and isoelectric point of 7 (Fig. 2,panel A, denoted by arrow in upper and lower) . The mean in­tegrated intensity for this protein spot changed from 2.37 ± 0.45in the NTG composite image to 3.90 ± 0.42 in the Rac1 com­posite image, representing an approximate 1.6-fold increase(p < 0.05) in the integrated intensity of this spot in the Rac1compared to the NTG composite image.

Identification ofprotein of interest

In general, in order to identify a protein of interest, the pro­tein spot is excised from a 2-DE gel and subjected to in-gel

digestion using either proteases, such as trypsin, or chemi­cal agents, such as cyanogen bromide, to produce a mixtureof peptides that are unique to the protein of interest. Themasses of these peptides are determined by MALDI-TOFmass spectrometry to produce a peptide mass fingerprint(PMF) for the protein of interest. The PMF is then comparedto theoretical PMFs of known and DNA-sequence derivedproteins contained within protein databases. A high degreeof similarity in this signature sequence between the proteinof interest and a protein from the database is denoted by ahigh probability score and is evidence of a possible identifi­cation. Tandem mass spectrometry (MSIMS) provides aminoacid sequence information on peptide fragments of the parentprotein. Together, mass information derived from MALDI­TOF analysis in conjunction with peptide sequence informa­tion obtained from MS/MS analysis provides a strong basisfrom protein identification.

In this study, in order to identify the protein of interest, theprotein spot of interest was excised from a silver-stained 2­DE gel and analyzed by both MALDI-TOF and MS/MS (Fig.3). MALDI-TOF analysis revealed that the tryptic peptidemass fingerprint (PMF) of the protein spot of interest washighly matched with the theoretical tryptic PMF of mousecreatine kinase M-chain (19% masses matched, 54% se-

A.Compos ite Images

-1L

Mw'D•NTG •Composite Image

Rac1 Transgen icComposite Image

IMW I

•

B.2-DE Gel Image

149

Fig. 2. Position of creatine kinase M-chain on composite and 2-DE gel images . The area of composite images containing the crea tine kinase M-chain proteinspot is shown in panel A. The composi te images are derived from 2-DE gel images of cytoplasmic protein-enriched extracts of ventricular tissue obtainedfrom NTG (panel A, upper) and Racl transgen ic (panel A, lower) mouse hearts. Panel B shows the region of a 2-DE gel image of a cytoplasmic protein­enriched extract of ventricula r tissue obtained from a Rae I transgenic mouse contai ning the creati ne kinase M-chain protein spot. Arrows denote the preciseposition of creatine kinase M-chain in composite (panel A) and real gel (panel B) images . Procedures are outli ned in deta il in 'Materials and methods' .

quence coverage) (Fig. 3, panel A). Moreover, MS/MS analy­sis of the 1785.0 I Da tryptic peptide, one of the peptide frag­ments of the protein spot of interest, revealed an amino acidsequence tag (Fig. 3, panel B), which corresponded to residues345- 358 of mouse creatine kinase M chain (Fig. 3, panel C).An additional sequence tag ofFDPLL, corresponding to res­idues 89-93 of mouse creatine kinase M-chain, further veri­fied the identit y of the protein spot.

Discussion

Here, we illustrate the utility of the proteomic approach inthe analysis of a tran sgen ic mou se model of heart failure.Importantly, we demonstrate the strategy involved in estab­lishing optimal repre sentation of the proteome based on theresearch question of interest and, furth ermore, the processinvolved in the assessment of reproducibility of results.Moreover, we report an approx imate 1.6-fold increase increa tine kina se M-chain protein levels in Racl tran sgenicmouse ventricular tissue compared to control tissue.This find­ing is consistent with one derived from a similar prote omicanalysis of human dilated cardiomyopathy [13]. The latterstudy revealed a greater than 2-fold increase in mitochondrialcrea tine kinase in right atria l tissue of patients with dilatedcardiomyopath y comp ared to controls. However, proteomicanalysis of a canine model of pacing-indu ced heart failurerevealed an approximate 1.3-fold decrea se in creatine kinaseM-ch ain in diseased ventricular tissue compared to control[6].

Interestin gly, comparison of findings derived from pro­teomi c analysis of distinct model s of dilated cardiomyopa-

thy reveals differences in direction of protein alterations amongstudies. For example, desmin was found to decrease in ven­tricular tissue isolated from dogs undergoing heart failure dueto rapid ventricular pacing [5], while this prote in was foundto increase in ventricular tissue obtained from cattle display­ing a heredit ary form of dilated cardiomyopathy [7], com­pared to control. The different findings derived from thesestudies may be related to important differences in the stageof heart failure development and the pathway activation pro­file incurred during the course of disease progres sion, amongthese different heart failure model s. The nature of the initialstimulus is likely a key determinant of the signaling profileof the card iac myoc yte during the development of heart fail­ure. Moreover, even at a given stage of heart failure devel­opment, the act ivation profile of the cardiac myocyte may beunique to the originating stimulus. In support of such a no­tion, studies have revealed important proteomic differencesamong cardiomyocytes following exposure to different hyper­trophic stimuli even though they displayed a similar hyper­trophi c phenot ype [14]. Thu s, the proteomic profile of thecardiac myocyte is likely a reflection not only of the stage ofdisease progression, but, also, the nature of the initial heartfailure stimulus . Moreover, distinct model s of dilated car­diomyopathy, characterized by a given stage of disease pro­gression and originating stimulus, may correlate with uniqueproteomic profiles of card iac myocytes.

The increased abundance of creatine kina se M-chain inRae I transgenic mouse hearts compared to controls may bedue to (l ) increased creatine kinase M-chain mRNA produ c­tion and/or reduced creatine kinase M-chain mRNA tum-over(2) decreased creat ine kinase M-chain protein turn-o ver (3)increa sed isoform switching from the B-chain to the M-chain

150

A B

1789.86

18Xl.89

ExpectedSequence: 341LGSSEVEQVQLWDGVK35BObserved SequenceTag: EVEQVQLWDGVK

c

m/z

1312.77,,2

-f·.2l)--,--r- , --rv--r- ,~~~ LTI--r----:-VOUVK-----l bMa'- K Vi.GrD-r~~Y+l Q II Q E II E (344.21)---4 yMa:x

1 "; I 18 24 y4 sn 85~52 I616.41 1213.75~ ylt

147.12 729.49 9$.00Yl y7 fJ

1004.7010

2212.18

199502

1004.03

I

1007.14

1!m.1~

I

*12'll.75

I *11270.

74 * ~1007\.00 1~02

1331.811515.83, i1715.91! :; 1

1Zl2.oo

'1188.00

1187.00

1(61.74II

76&55 882.57" I

22 1 I:1

.,,!,

en 0Cx> «oo 1200 . 1400 . 1€OO . 1€OO . 2a:xl . 2200 2400 2EOO 2€00

m/z

51921

I

~(/)c:Q)­c:Q)> o/c:p«lQ)

c:::

Fig. 3. Ident ification of creatine kinase M chain by MALDI-TOF and Q-TOF analysis. Panel A shows a mass spectrum of tryptic fragment s of creatinekinase M-chain as determined by MALDI- TOF analysis. The tryptic peptide fragment of mass 1785 .01 Da was analyzed by Q-TOF to obtain the mass spec­trum shown in panel B. Panel C shows the sequence tag observed by Q-TOF analysis and its homology to residues 345-358 of mouse creatine kinase M­chain. The peptide masses used in homolo gy searches are denoted by asterisk and the tryptic peptide analyzed by MS/MS is denoted by an arrow. Proceduresare outlined in detail in 'Materials and methods'.

of creatine kinase and/or (4) relocalization of creatine kinaseM-chain from non-cytosolic to cytosol ic compartments. In­terestingly, this finding is in contras t to some other findingssuggesti ng opposi te changes in creatine kinase in heart fail­ure [15, 16]. The alternate results may be indicative of sig­nificant differences in severity of cardiac dysfunction andrelevant signaling pathways underlying the disease pheno­type, among the different models under study. Indeed, thedilated phenotype of Rae I transgenic mice was associatedwith aberrant morphology of hearts and early post-natalmortality, indicating a severe, end-stage heart failure pheno­type [9]. In this context, one could speculate that the proteinalterations associated with this particular phenotype wouldrelate to ensuring maximal function of the myocard ium inorder to maintain survival of the organism. Thus, from thisperspective, an increase in creatine kinase levels would be acrucial component of a survival mechanism, considering theessential role of this protein in ATP production. In additionto the apparent severity of the cardiac disease state, the ini-

tial stimulus, namely, constitutive activat ion of Rae I , likelyactivates a unique set of pathways in the cell compared tostimuli such as ventricular pacing. Indeed, Rae I is associatedwith diverse signaling networks of the cell related to variousfunctions such as cytoskeletal reorganization, transcriptionand apoptosis [8, 17] and each of these functions is highlydependent on the availability of ATP [18-20]. Thus, pro­nounced activation ofRacl likely yields a unique proteomicprofile of the cardiac myocyte involving multiple protein net­works and cellular compartments, compared to other stimuliof heart failure , and this activation profile is characteri zed byhigh energy requirements.

Identification of additional protein alterations in the Rae1transgenic mouse model of heart failure will provide insightinto the possible mechanisms underl ying card iac myocyteremodeling and severe cardiac dysfunction. Moreover, com­prehensive proteomic analysis of this model will allow for adeeper understanding of the potential cross-talk mechanismsinvolved in Racl signaling in the myocardium and, in gen-

eral, reveal possible mechanisms whereb y diverse cellularcompartments and protein networks interact to produce aheart failure phenotype.

Acknowledgements

Dr. Jennifer Van Eyk is supported by Canadian Institutes ofHealth Research and the Heart and Stroke Foundation ofOntario . She is a Heart and Stroke Foundation of CanadaScholar and Nina Buscemi is a Heart and Stroke Foundationof Canada Trainee. Dr. Gilles Lajoie is funded by the NationalSciences Research Council (NSERC) and the Ontario Re­search and Development Challenge Fund (ORDCF).

References

1. Ceco ni C, Cargnoni A, Curello S, Ferrari R: Recognized molecularmechanisms of heart failure: approaches to treatment. Rev Port Cardiol17(suppl II): 79-9 1, 1998

2. Colucci WS: Molecular and cellular mechanisms of myocardial fail­ure. Am J Cardiol 80: 15L-25L, 1997

3. Pleibner KP, Soding P, Sander S, Oswa ld H, Neun M, Regitz-ZagrosekV,Fleck E: Dilated cardiomyopathy-associa ted proteins and their pres­entation in a WWW-accessible two-dim ensional gel protein database.Electrophoresis 18: 802-808, 1997

4. Corbett JM, Why HJ, Wheeler CH, Richardson Pl .Archard LC, YacoubMH, Dunn MJ: Cardiac protein abnormalities in dilated cardiomyo pa­thy detected by two-dim ensional polyacrylamide gel electrophoresis .Electrophoresis 19: 203 1-2042, 1998

5. Heinke MY, Wheeler CH, Chang D, Einstein R, Drak e-Holland A,Dunn MJ, dos Remedi os GC: Protein changes observed in pacing-in­duced heart failure using two-dim ensional electrophores is. Electro­phoresis 19: 2021-2030, 1998

6. Heinke MY,Wheeler CH, Yan JX, Amin V, Chang D, Einstein R, DunnMJ, dos Remedios CO: Changes in myocardial protein expression inpacing-induced canine heart failure. Electroph oresis 20: 2086-2093,1999

151

7. Weekes J, Wheeler CH, Yan JX, Weil J, Eschenhagen T, Scholtysik G,Dunn MJ: Bovine dilated cardiomyopa thy: Proteomic analysis of ananimal model of human dilated cardiomyopathy. Electrophoresis 20:898-906, 1999

8. Clerk A, Sugden PH: Small guanine nucleotide-binding proteins andmyoca rdial hypertrophy. Circ Res 86: 1019- 1023,2000

9. Sussman MA, Welch S, Walker A, Klevitsky R, Hewet T, Price RL,Schaefer E, Yager K: Altered focal adhes ion regulati on correlates withcardiomyopathy in mice expressi ng constitutive ly active rae I. J ClinInvest 105: 875-886,2000

10. Neverova I, Van Eyk J: Applica tion of reversed phase high perform­ance liqu id chro matog raphy for subpro teo mic analysis of cardiacmuscle. Proteomics 2: 22-3 1, 2002

II . Barany K, Barany M, Giometti CS: Polyacrylamide gel electrophoreticmethod s in the separation of structural muscle protein s. J ChromatogrA 698: 301-332, 1995

12. Shevchenko A, Wilm M, Vorm 0, Mann M: Mass spectrometric se­quencing of proteins from silver-stained polya crylamide gels. AnalChern 68: 850-858, 1996

13. Knecht M, Regitz-Zagrosek V, Pleissner KP, Jungblut P, Steffen C,Hilderbrandt A, Fleck E: Characterization of myocardial protein com­position in dilat ed cardiomyopathy by two-dimensional gel electro­phoresis. Eur Heart J 15(suppl D): 37-44, 1994

14. Schaub MC, Hefti MA, Harder BA and Eppenberger HM: Varioushypertroph ic stimuli induce distinct phenotypes in cardiomyocytes. JMol Med 75: 90 1-920, 1997

15. Ingwall JS: The hypertrophied myocardium accumulates the MB-crea­tine kinase isozy me. Eur Heart J 5(suppl F): 129-139, 1984

16. Neuba uer S, Frank M, Hu K, Remkes H, Laser A, Hom M, Ertl G, andLohse MJ: Changes of creatine kinase gene expression in rat heart post­myocardial infarc tion. J Mol Cell Cardio l30: 803-8 10, 1998

17. Aspenstrom P: Effectors for the Rho GTPases . Curr Opin Cell Bioi II :95-102, 1999

18. Bereiter-Hahn j , Luck M, Miebach T, Stelzer HK, Voth M: Spreadingof trypsinized cell: Cytoskeletal dynamics and energy requ irements. JCell Sci 96: 171-1 88, 1990

19. Luse DS, Kochel T, Kuemp el ED, Coppola JA, Cai H: Transcriptioninitiation by RNA polymerase II in vitro. At least two nucleotides mustbe added to form a stable ternary complex. J Bioi Chern 262: 289-297,1987

20. Shiraishi J, Tatsumi T, Keira N, Akashi K, Mano A, Yamanaka S, MatobaS, Asaayama J, Yaoi T, Fushiki S, Fliss H, Nakagawa M: Important roleof energy-dependent mitochondr ial pathways in cultured rat card iacapoptosis. Am J Physiol Heart Circ Physiol281: H1637-H1 647 , 2001

Molecular and Cellular Biochemistry 251: 153-159, 2003.© 2003 Kluwer Academic Publishers. Primed in the Netherlands.

Adenosine and cardioprotection during reperfusion•- an overVIew

Martin Donato and Ricardo J. GelpiLaboratory of Cardiovascular Physiopathology, Departm ent ofPathology, Faculty ofMedicine, University ofBuenos Aires,Bueno s Aires and The Group of Multic entric Studies in Argentina Foundation (GEMA) , Buenos Aires, Argentina

Abstract

Ischemic heart disease includes a number of entities that have been grouped in accordance with physiopathology and evolutivecriteria. In recent years 'new' ischemic syndromes have been described. Within the 'new' ischemic syndromes, ventricular post­ischemic dysfunction - also known as 's tunned myocardium' - is worth mentioning. In this route, several studies have sug­gested that reperfusion per se could cause cellular injury (reperfusion injury ). In previous years, a protective effect on the injurycaused by ischemia and reperfusion in the heart has been attributed to adenosine . These effects have been documented in dif­ferent experimental in vivo and in vitro models . Thu s, the admi nistration of exogenous adenosine, or agonists of adenosinereceptors prior to ischemi a reduce s the size of the infarction, impro ves the recovery of the ventricular function during reperfusion(attenuating stunning) and prolongs the time period to the ischemi c contrac ture. However, focusing on a potential therapeut icapplication, it is of the utmo st importance to find this protection and learn the mechanisms involved when procedures are ap­plied during earl y reperfusion.

We showed that adeno sine , administered from the beginning of reperfusion , attenuated sys tolic and diastolic (myocardialstiffness) alterations ofthe stunned myocardium. This protective effect was mediated by the activation ofAI adeno sine receptors,and without modification on infarct size. According to some authors, adenosine can decrease the release of endothelin, duringearly reperfusion, and reduce an overload of Ca2+ that could cause a cellular lesion. Finally, ischemic preconditioning involvesa series of intracellular event s that are initiated with the activation of the AIreceptor, and end at the sensitive K+ ATP channelsof the mitoc hondria. The phosphorylation and opening of these channels would cau se the protective effect. Activation of thisspecific mechanism during reperfusion has not been studied extensively. (Mol Cell Biochem 251 : 153-159,2003)

Key words: myocardial ischemia, myocardial stunning, aden osine

Introduction

There are many situations where myocardial ischemia playsan important role , and there are also many factor s that shouldbe analyzed when studying its physiopathology. Hence, is­chemic syndromes can include from an ischemic transientepisode that has no function al repercussion [1], to an associa­tion with post myocardial infarct in ventricular remodel ing [2].

Con ventionally, ischemic heart disease includes a numberof entities that have been grouped in accordance with physi­opathology. In recent years ' new' ischemic syndromes havebeen described [3], and should be considered together withthe 'class ical' ischemic syndromes [4]. The se 'new' physi-

opathology entities could be present in patients who unde r­went myocardial revascularizat ion surgery, therapy withthrombolitics, angioplasty, cardiac transplant, pat ient s withstable/unstable angina, and exe rcise-induced ischemia [5].

Within the 'new ' ischemic syndromes , ventricular post­ischemic dysfunction, also known as 'stunned myocardium ' ,is worth mentioning. The stunned myocardium is a post- is­chemic systolic and diastolic mechanical dysfunction with theabsence of irreversible injury and preserved contractile re­serve (Fig. 1) [5]. The study of this syndrome increased dur­ing the ' 80s and continued to grow during the '90s mainlydue to two reasons: ( I) The introduction of reperfusion thera­pies (thrombolitics, angioplasty, and coronary revascu lar-

Addressfo r offprints: R.J. Gelpi , Laboratory of Cardiovascular Physiopathology, Department of Pathology, Faculty of Medicine, University of Buenos Aires,Uriburu 950 - 2nd Floor (CII14AAD), Buenos Aires, Argent ina (E-mail : rgelpi@fmed.uba.ar)

154

24hours

• p<0.01tP<0.05

3 hours1 hour

Reperfusion

t 1 min 15min

Occlusion

0------- I If I~

--r---.-r·120

SYSTOLIC WALLTHICKENING

%b,. -60

Fig. 1. Mod ifications of the systolic wall thickening in conscious dog s after 15 min of coronary artery occlu sion, follow ed by reperfusion (modified fro mHeyndrickx et al., Am J Physio l 234: H653-H659, 1978).

ization surgery) for the treatment of patients with ischemiccardiac disease, and (2) some patients experience spontane­ous reperfusion as a result of the lysis of a coronary muralthrombus, or the release of a coronary spasm. Acco rdingly,it becomes evident that post- ischemic dysfunction is part ofthe natural evolution of the ischemic cardiac disease. This ex­plains the effort research investigators are doing in trying tounderstand the mechanism respon sible for the dysfunct ion asthe firs t step towards a possible prevention and/or therapy.

Adenosine

Adenosine is a nucleoside that is present in different humanbody tissues . It is produced by various cell types , and behavesin general as a regulatory substance with many organ-spe­cific functions that include an important role in the localmetabolic regulation of coronary circulation, the nervoussystem, and the endocrine system. Specific studies on adeno­sine and its effects on the cardiovascular sys tem started in1929. Drury and Szent Gyorgy [6] found that the extracts ofdifferent tissues that contained adenosine caused bradycar­dia, hypotension and coronary vasodilation. These conceptswere revisited years later by Berne et at. in what they called'the adenosine hypothesis'.

It is known today that adenosine is a nucleoside generatedby the dephosphorylation of the 5' -AMP and by the hydroly­sis of the S-adenosylhomocysteine [7]. It plays an importantrole in the regulation of coronary circulation [8].

However, this compound has other effec ts on the heart [9]such as:

1. Depression of the sinus and atrioventricular nodes activ­ity.

2. Reduction of the atrial contractility.3. Attenuation of the contractile response to catecholamines

(mainly in the ventricles).4. Depression of the cardiac automaticity.

The adenosine receptors are classified as:

a. Those that inhibit the activity of the adenyl cyclase enzyme(AI)' and

b. Those that stimulate the activity of this enzyme (A2

) .

Both receptor subtypes are blocked by the methyl xanthines[9]. These receptors were characterized in radioligands bind­ing studies that evaluated the pharmacological specific re­sponse to adenosine and its analogs [7]. In the heart,AIreceptorsare found in the myocytes and in the vascular smooth muscle ,whereas A

2receptors can be found in the endothelium and the

vascular smooth muscle [7]. AI receptors mediate the chrono­tropic [10], dromotropic [11], and neg ative inotropic [12]effects, and would participate in the protective effects of ad­enosine against the injury caused by ischemia and reperfusion.This mechanism will be described in detail in the paragraph cor­responding to myocardial protection by adenosine .

On the othe r hand, as mentioned before, A2

receptors stim­ulate the enzyme adenyl cyclase producing AMPc, and re­laxing the arterial smooth muscle. However, it has not beenshown that the AMPc cau ses arteriolar vasodilation [7]. Fi­nall y, A

3receptors [13] have been described in the last few

years as being located in the pla smatic membrane of themyocyte, and as having effects that are very similar to thoseof the Al receptors.

Myocardial protection by adenosine

It is accepted that cellular necrosis caused by myocardialischemia is sign ificantly limited by an early reperfusion.However, several studies have suggested that reperfusion perse could cause cellular injury [14] . Consequently, this typeof lesion called reperfusion injury is also a target for futurepharmacological interventions.

In previous years , a protective effect on the injury causedby ischemia and reperfusion in the heart has been attr ibuted

to adenosine. These effects include the ability of adenosineto:

I. Inhibit neutrophil aggregation, as well as neutrophils ad­herence to, and injury of endothelial cells [9],

2. Reduce ATPdepletion during ischemia and improve reple­tion of ATP on reperfusion [7],

3. Stimulate myocardial glycolysi s [15],4. Normalize the oxygen supply/demand ratio through its

vasodilat ing and anti adrenergic properties [9], and5. Inhibit platelet aggregation [9].

These effects have been documented in different experimen­tal in vivo and in vitro models . Thus , the administration ofexogenous adenosine, or agonists of adenosine receptorsprior to ischemia reduces the size of infarction [16], improvesthe recovery of ventricular function during reperfusion (at­tenuating stunning ) [17] and prolongs the time period toischemic contracture [18]. Some of these beneficial effectscan be observed in low flow ischemia. However, focusing ona potential therapeutic application, is of utmost importanceto find this protection and to learn the mechanisms involvedwhen procedures are applied during early reperfusion.

On the other hand, the therapy with exogenous adenosineduring reperfusion and its beneficial effects are controversialissues. In the first place, the majority of studies have assessedits effect on the size of the infarction [19,20], and obtainedcontroversial results. In the second place , only a few authorshave studied its effect on post-ischemic ventricular dysfunc­tion, an entity where the size of the infarction is less signifi­cant [21, 22].

Reduction ofmyocardial infarct size

The already mentioned adenosine effects suggest that theadministration of exogenous adenosine can protect the heartfrom the injury caused by ischemia and reperfus ion. Adeno­sine administered during reperfusion could specifically at­tenuate injury by reperfu sion. Hence, Olafsson et al. [23] andPitarys et al. [20] showed that the administration of intra­coronary and intra-venous adenosine respectively, reducessignificantly the infarct size caused by 90 min of regionalischemia in dogs. Although the canine model has been fre­quently used to study the effect s of different pharmaco­logical interventions on the ischemic heart, it shows greatvariability in the infarct size, mainly due to the presence ofan important collateral circulation. In the study by Olafssonet al. [23] lidocaine was used to prevent arrhythmias causedby reperfusion. However, it has been suggested that lido­caine has a protective effect, per se, on the injury causedby ischemia and reperfusion. This compound reduces the re­lease of lipid peroxidation products, and also reduces neutro-

155

phils adherence, as well as the release of lysosomal enzymesand superoxide anions by these cells.

Homeister et al. [24] showed that in dogs subjected to 90min of regional ischemia the intracoronary administration ofadenosine during reperfusion decreased the size of the inf­arct only when administered to animals treated with lidocaine.

Further studies with experimental models [25, 26] wereperformed using a different species, like the rabbit, thatshowed great similarity with the human heart. This similar­ity becomes objective regarding collateral circulation and thedeficit of the enzyme xanthine-oxidase. These studies showedthat the admini stration of adeno sine, an AI receptor agonist,and an Azreceptor agonist, decreased the infarct size after 30min of occlusion of a coronary artery. However, these stud­ies were carried out in models of regional ischemia and didnot evaluate the ventricular function.

On the other hand , Goto et al. [27], working on a modelof instrumented rabbit, and Vander Heide et al . using con­scious dogs [28], could not show the decrease in the infarctsize, even when the compound was administered in combi­nation with lidocaine.

Some authors [29, 30] suggest the poss ibility that adenos­ine improves the systolic function via an increase of thecoronary flow acting on the Az vascular receptors (Gregg'sphenomenon). Also these authors sugge st that similarly toFrank-Starling's law, adenosine maintains the length of themyocardial fiber by increasing the parietal vascular tone, andconseq uently, the length of the encircling myocites (internalpreload).

We believe that only one study [31] showed improvementof the contractile state and attenuation of the increase indiastolic stiffness during reperfusion in a model of isolated,isovolumic rabbit heart, subje cted to the administration toadenosine before, dur ing, and after the ischemic period.However, when the intervention was carried out only duringreperfusion, the protection attained was not significant. Also,they used a prolonged period of ischemia (60 min) and there­fore it is possible to believe that adeno sine decreased theinfarct size (through preconditioning?) and thus indirectlyimproved ventr icular function .

Attenuation ofpostischemi c dysfunction ('stunnedmyocardium ')

Due to its cardioprotective capacity, adenosine is one of thecompounds most extensively studied. Consequently somestudies were performed to explain the effect of adenosineon post-ischemic ventricular dysfunction. Ogawa et al. [17]found that intravenous administration of adenosine before theperiod of ischemia is capable of protection against systolic'stunning ' caused by 10 min of coronary occlusion in a modelof regional ischemia. Mosca et al. [32] showed that adenos-

156

_____ CONTROL

-0- ADENOSINE

---T- ADENOSINE + DPCPX

20

60

40

* *

0

120

..........OJ 90IEE 60-C- *C-O 30

C­O>....J

..........OJIEE-

and diastolic alterations of the stunned myocardium. The ad­ministration of this compound attenuated the systolic altera­tions (Fig . 2) and the increase of diastolic stiffness that werepresent after 15 min of global ischemia (Fig. 3). This protec­tive effect was abolished with the administration of DPCPX,a selective blocker of AI adenosine receptors, showing thatthe activation of these receptors is the starting point for theappearance of the protection.

We also analyzed the effect of this compound on the smallinfarct areas that appear after 15 min of global ischemia.Adenosine protected the myocardium from post-ischemicdysfunction without modifying the infarct size. On the contrary,when DPCPX was administered, the infarct size was increasedsignificantly compared to the control group (Fig. 4).

With this duration of ischemia, the infarct size is not sig­nificant, and the functional injury is completely reversible.Only two studies [21, 33] evaluated the effects of adenosine

___ CONTROL

-0- ADENOS INE---T- ADENOSIN E + DPCPX

120

C­0 40>....J

..........OJI 80EE-

ine imitates the effect of ischemic preconditioning in a modelof global ischemia, in isovo lumic, isolated hearts. However,in these studies the drug was administered before the periodof ischemia. Few projects studied the effects of the admin­istration of exogenous adenosine, using short periods ofischemia ~ 15 min) .

Using open chest instrumented dogs as experimental mo­del and causing regional ischemia, Sekili et al. [21], andJeroudi et al. [33] found that continuous adminis tration of ad­enosine (before, during, and after the period of ischemia), andof an AI receptor selective agonist attenuated the systolic al­terations of the 'stunned myocardium' .

However, this beneficial effect decreased when the com­pounds were administered only at reperfusion. In disagreewith these authors, Peart et al. [34] showed that endogenousadenosine released during ischemia attenuated post ischemicdysfunction and that this effect was exercised during reper­fusion due to the activation of AI purinergic receptors. Fewstudies have assessed the diastolic function in this phys i­opathological entity, and in most cases the assessment wasperformed only through indirect indexes, or through myocar­dial stiffness [21,32,35] .Additionally, only models of regionalischemia have been used [21, 23], which made it difficult toevaluate the ventricular function and the prolonged periodsof ischemia [31] where the presence of necrosis comp licatedresults analysis. Finally, the time of administration of the drughas not been specifically taken into account as a variab le thatcould modify possible protective actions.

In the studies carried out in our laboratory [22, 36] usingisolated rabbit hearts, we assessed the effects of adenosine , ad­ministered from the beginning of reperfusion, during systolic

20 30 40 50

Reperfusion

Fig. 3. Values of left ventricu lar end diastol ic pressure (LVEDP , top panel)and coronary perfusion pressure (CPP, bottom panel). In the control group ,the group trea ted with adenosine, and the group where adenosine andDPCPX (A, blocker) were administered. Note that adenosine attenuated theincrease of myocardial stiffne ss. This effec t was abolished with the admin­istration of DPCPX . As shown, adenosine decreased CPP during reperfusionperiod . *p < 0.05 vs. control.

40 50

Reperfusion

OL-- ~._.__~..l-----'---l...-----.J

o 10 20 30 60 minl-J[ ll--------.l

Cant. Ischemia

Fig. 2. Values of left ventricular developed pressure (LVDP) , in the con­trol group, the group treated with adenosine, and the group where adeno­sine and DPCPX (A, blocker) were administered . Note that adenosineattenuated the systolic alterations of post ischemic dysfunc tion . This effectwas abolished with the administration of DPCPX . *p < 0.05 vs. control.

157

0 '-----jJ-.-- - - - -{}-- - - - - - - -

Fig. 4. Size of the infarct expre ssed as percentage of the area of the leftventricle in the control group , the group treated with adenosine, and thegroup where adenosine plus DPCPX (A, blocker) was administered. *p <0.05 vs. contro l.

in reperfusion during short periods of ischemia. These stud­ies used a different species, the dog, in an experimental modelof open chest; i.e. hearts that were perform ing external work,which made it difficult to evaluate the ventricular functionas mentioned earlier in this paper. Besides, these authorscould not find benefits with the admini stration of the drugduring reperfusion.

The beneficial effects of adenosine could be attributed toany of the following mechanisms: (1) Preservation of ATPlevels [37], (2) inhibition of neutrophils activation [9], (3) in­creased coronary flow [29].

Although adenosine is known as a precursor of the ATPsynthesis , it is not clear if the administration of this compoundduring early reperfusion can increase the levels of high-en­ergy phosphates . An increment of ATP levels in the post­ischemic myocardium was shown only when exogenousadeno sine was administered to isolated hearts perfused witha solution of crystalloids [37]. However the administrationof this compound to in vivo models did not restore ATP lev­els, probably because the enzyme adenosine deaminase rap­idly degraded adenosine [38].

Adeno sine would attenuate the activation of neutrophils[39]. These cells are important for the production offree radi­cals, which are compounds that are directly involved in re­perfusion injury.The inhibition of free radicals formation couldbe mediated by the activation of purinergic A

2receptors [40].

Finally, the vasodilating action of adenosine could havebeneficial effects on the ischemic myocardium. The massiverelease of adenosine during ischemia and reperfusion couldattenuate the alterations of coronary microcirculation [41].In addition, the increa se of coronary flow as a response toGregg 's phenomenon would improve the systolic function of

the reperfused myocardium [29, 30]. Hence, Randhawa et al.[42] reported that a brief (10 min) intracoronary infusion ofadenosine in the stunned myocardium (after 60 min of re­perfusion), increased the systolic regional function. This ef­fect was associated to a significant increase of the coronaryflow.When adenosine infusion was finalized, the parietal thick­ness was also decreased proportionally to the coronary flow.

This was not the case in our experimental model , as weworked with constant coronary flow. On the other hand, whenwe blocked adenosine AI receptors during reperfusion, theprotective effect was disappeared. However, we do not ex­clude the possibil ity that a vascular component intervenes inthe protection exerted by adenosine, provided that the decreaseof coronary perfusion pressure (CPP) during reperfusion couldexplain only in part, the decrease of diastolic stiffness. Al­though values of CPP decrease significantly, this decreasewould not be of sufficient magnitude to explain the effect ondiastolic stiffness (Fig. 3).

The stimulation of the Al receptor triggers different meta­bolic changes that could attenuate post-ischemic dysfunction[43].

During the early reperfusion period, numerous compoundsare released and they could contribute to the presence ofreperfusion injury [44] . Endothelins can be found amongthese substances. These compounds have the most potent va­soconstrictor effect known up to date, and could participateduring reperfusion, causing a significant deterioration of thevasodilating response, and reducing the blood flow in thepreviously ischemic bed [44]. Velasco et al. [44] describedthat adenosine could decrease the release of endothelins dur­ing early reperfusion, thus improving the ventricular func­tion. The mechani sm whereby adenosine would decrease theformation of endothelins remains unknown. On the otherhand, the potent vasodilating properties of adenosine could notonly reverse the vasoconstriction caused by the endothelins,but also reduce the contraction of the vascular smooth mus­cle by decreasing the incoming of Ca2+ to the same via theslow Ca2+ channels [15].

It is known that during reperfu sion, there exists an over­load of Ca2+ (proposed mechanism for myocardial stunning)that could cause a cellular lesion by activating phospholipasesand proteases that would accelerate ATP degradation. Byactivating Al receptors, adenosine could reduce the incom­ing Ca2+ through sarcolemma, inhibiting the adenyl cyclaseenzyme. This process decreases the levels of AMPc and theactivity of the protein kinase A (PKA). Consequently, nophosphorylation is produced at the slow Ca2+ channels of thecytoplasm, thus decreasing the inflow of Ca2+ towards cytosol[44,45]. Although this possible mechanism of protection hasnot been studied in detail , our research shows prima facie thatthis specific mechan ism is present, as we have shown that theprotection during reperfusion requires the activation of Alreceptors.

88 *

o +o§

Adenosine +DPCPX

f

o

8

Adenosine

+Control

20

.-...~ 150..........Q.)N

"w 10-U~

<tl....C

5

158

Finally, ischemic preconditioning involves a series of in­tracellular events that are initiated with the activation of theAl receptor, and end at the sensitive K+ ATP channels of themitochondria. The phosphorylation and opening of thesechannels would cause the appearance of the protective effect.Although the activation of this specific mechanism duringreperfusion has not been studied extensively, our data sug­gest that the initial steps on this specific protection mecha­nism in myocardial stunning have been taken, as shown inour study that the protection during reperfusion requires Alreceptor activation.

The activation of Al receptors during reperfusion couldmodify the inflow of Ca2+ through the sarcolemma by acti­vating the K+ ATP sensitive channels, and by inhibiting theslow Ca2+ channels. Thus, Fralix et al. [46] have shown thatthe protection reached with adenosine is associated to a re­duction of the intracellular concentration of Ca2+ and H+. Also,the reduction of Na" and H+ indirectly decreases Ca2+ overloadduring early reperfusion. On the other hand, Shigematsu et al.[47] worked on an experimental model of isolated guinea pigheart, free ventricular wall, and showed that ATP sensitiveK+ channels could be opened during reperfusion. This factshould be highlighted, because when activated during re­perfusion, they could participate as mediators in the protectionexercised by adenosine. However, it remains to be clarifiedwhich is the linking point between the activation of purinergicAl receptors, and the opening of the already mentioned chan­nels .

Summarizing, in an experimental model, with strict vari­ables of control and global ischemia, the administration ofadenosine during reperfusion protects the myocardium fromsystolic post-ischemic alterations and from the increase ofdiastolic stiffness without modifying the isovolumic relaxa­tion. This protection is in direct relationship with the acti­vation of Al purinergic receptors and is independent of themodifications in the infarct size. Although the extrapolationof data obtained from experimental animals, and also fromhuman patients, should be carried out with extreme caution,the fact that the administration of adenosine after ischemiahas a protective effect, could present an interesting therapeu­tical response. However, its hypotensive effects due to theactivation of the A

2receptor, the very short duration of this

compound, and the tolerance when it is administered chroni­cally should also be considered [48].

References

I. Bolli R, Zhu W, Thornby J, O'Neill P, Roberts R: Time course anddeterminants of recovery of function after reversible ischemia in con­scious dogs . Am J Physiol 254: HI 02-H 114, 1988

2. Olivett i G, Carpasso J, Meggs L, Sonnenblick E, Anversa P: Cellu larbasis of chronic ventricular remodeling after myocardial infarction inrats. Circulation 68: 856-869, 1991

3. Opie L: The multifarious spectrum of ischemic left ventricular dysfunc­tion: Relevance of the new ischemic syndromes. J Mol Cell Cardiol28: 2403-2414, 1996

4. Tajer C: Fisiologfa y fisiopatologfa de la circulaci6n coronaria. In:Bertolasi Cardiologfa 2000. Edit. Panamericana. Vol2. 1998, pp 1828­1843

5. Bolli R: Mechani sm of myocardial 'stunning' . Circulation 82: 723­738, 1990

6. Drury AN, Szent-Gyorgyi A: The physiological activity of adeninecompounds with especial reference to their action upon the mamma­lian heart. J Physiol (Lond) 68: 213-237, 1929

7. Hori M, Kitakaze M: Adenosine, the heart, and coronary circul ation.Hypertension 18: 565-574,1991

8. Berne R: The role of adenosine in the regulation of coronary blood flow.Circ Res 47: 807-813,1980

9. Belardinelli L, Lindel J, Berne R: The cardiac effects of adenosine . ProgCardiovasc Dis 32: 73-97,1989

10. Heller LJ, Olsson RA: Inhibition of rat ventricular automaticity byadenos ine. Am J Physiol 248: H907-H9l3, 1985

11. Belardinelli L, Fenton RA, West A, Linden J, Althaus JS, Berne R:Extracellular action of adenosine and the antagonism by aminophyl­line on the atrioventricular conduction of isolated perfused guinea pigand rat hearts . Circ Res 51: 569-579, 1982

12. Baumann G,Schrader J, Gerlach E: Inhibitory action of adenosine onhistamine and dopamine stimulated cardiac contractility and adenylatecyclase in guinea pigs. Circ Res 48: 259-266, 1981

13. Tracey WR, MageeW, Masamune H, Kennedy SP,Knight DR, BuchholzRA, Hill RJ: Selective adenosine A

Jreceptor stimulation reduces is­

chemic myocardial injury in the rabbit heart. Cardiovasc Res 33: 410­415 ,1997

14. Piper HM, Garcia Dorado D, Ovize M: A fresh look at reperfusioninjury. Cardiovasc Res 38: 291-300,1998

15. Forman M, Velasco C, Jackson E: Adenosine attenuates reperfusioninjury following regional myocardial ischaemia. Cardiovasc Res 27:9-17,1993

16. Liu GS, Thornton J, VanWinkle DM, Stanley A, Olsson RA, DowneyJM: Protection against infarction afforded by preconditioning is me­diated by Al adenosine receptors in rabbit heart. Circulation 84: 350­356, 1991

17. Ogawa T, Miura T, Kazuaki S, limura OJ: Activation of adenosinereceptors before ischemia enhances tolerance against myocardial stun­ning in the rabbit heart . J Am Coil Cardiol27 : 225-233 , 1996

18. Cave A: Preconditioning induced protection against post-ischaerniccontractile dysfunction : Characteristics and mechanisms . J Mol CellCardiol27: 969-979, 1995

19. Babbitt D, Virmani R, Forman M: Intracoronary adenosine adminis­tered after reperfusion limits vascular injury after prolonged ischemiain the canine model. Circulation 80: 1388- 1399, 1989

20. Pitarys C, Virmani R, Vildibill H, Jackson E, Forman M: Reduction ofmyocardial reperfusion by intravenous adenosine admin istered duringthe early reperfusion period . Circulation 83: 237-247, 1991

21. Sekili S, Jeroudi M, Tang X, Zughaib M, Zhong-Sun J, Bolli R: Effectof adenosine in myocard ial 'stunn ing' in the dog . Circ Res 76: 82-94,1995

22. Donato M, Morales C, Bagnarelli A, Scapfn 0 , Gelpi RJ: Exogenousadenosine and post ischemic disfunction in isolated rabbit heart.Medicina (Buenos Aires) 59: 339-347,1999

23. Olafsson B, Forman M, Puett D, Pou A, Cates C, Friesinger G,VirmaniR: Reduction of reperfusion injury in the canine preparation by intra­coronary adenosine: Importance of endothelium and the no-reflow phe­nomenon . Circulation 76: 1135-1145, 1987

24. Homeister J, HoffP, Fletcher D, Lucchesi B: Combined adenosine andlidocaine administration limits myocardial reperfusion injury. Circu­lation 82: 595-608, 1990

25. Norton E, Jackson E, Virmani R, Forman M: Effect of intravenousadenosine on myocardial reperfusion injury in a model with low myo­cardial collateral blood flow. Am Heart J 122: 1283-1 291, 1991

26. Norton E, Jackson E, Turner M, Virmani R, Forman M: The effect sof intraven ous infusions of selective adenosine A,-receptor and A2­

receptor agonists on myocard ial reperfusion injury. Am Heart J 123:332-338, 1992

27. Goto M, Miura T, Illiodoromitis E, 0 ' Leary E, Ishimoto R, Yellon D,Iimura 0 : Adenosine infusion during early reperfu sion failed to limitmyocardial infarct size in collateral deficient species. Cardiova sc Res25:943-949,1991

28. Vander Heide R, Reimer K: Effect of adenosine therapy at reperfusionon myocardial infarct size in dogs. Cardiovasc Res 31: 711-7 18, 1996

29. Schlack W, Schafer M, Uebing A, Schafer S, Borchard U, Thamer V:Adenosine A, receptor activation at reperfusion reduces infarct sizeand improv es myocardial wall function in dog hea rt. J CardiovascPharmacol22: 89-96,1993

30. Stahl L, Aversano T, Becker L: Select ive enhancement of function ofstunned myocardium by increased flow. Circulation 74: 843-851, 1986

31. Janier M, Vanoverschelde JL, Bergman S: Adenosine protects ischemicand represse d myocardium by recepto r-mediated mechanism. Am JPhysiol264: HI63-HI70, 1993

32. Mosca S, Gelpi RJ, Cingolani HE: Adenosine and dipyridamole mimicthe effects of ischemic preconditioning. J Moll Cell Cardiol 26: 1403­1409, 1994

33. Jeroudi M, Xian-Liang T, Abd-Elfattah A: Effect of adenosine AI re­ceptor activation on myocardial stunning in intact dogs. Circulation 90(abstr): 2574, 1994

34. Peart J, Headrick J: Intrin sic AI adenosine receptor activation dur­ing ischemi a or reperfusion improv es recovery in mouse heart s. AmJ Physiol279: H2166-H2175, 2000

35. Rynning S, Hexegerg E, Birkeland S, Wetsby J, Grong K: Blockadeof adenosine receptors during ischaemia increases systolic dysfunctionbut does not affect diastolic creep in stunned myocardiu m. EuropeanHeart J 15: 1705-1711 , 1994

36. Donato M, Morales C, D' Annunzio V, Scapin 0, Gelpi RJ: The acti-

159

vation of AI recepto rs attenuates myocardial stunning in the rabbits.Medicina (B Aires) 61: 424-430, 2001

37. Ely S, Mentzer R, Lasley R, Lee B, Berne R: Functional and metabolicevidence of enhanced myocardial tolerance to ischemia and reperfusionwith adenosine . J Thorac Cardiovasc Surg 90: 549- 556, 1985

38. Ely S, Berne R: Protective effects of adenosine in myocardial ischemia.Circulat ion 85: 893-904, 1992

39. Cronstein BN, Kramer SB, Weissmann G, Hirschhorn R: Adenosine:A physiologic modulator of superoxide anion generation by humanneutrophils. J Exp Med 158: II 60-1 177, 1983

40. Cronst ein BN Levin RI, Belanoff J, Weissmann G, Hirschhorn R:Adenosine: An endogenous inhibitor of neutrophil-mediated injury toendothelial cells. J Clin Invest 78: 760-770, 1986

41. Lasley R, Mentzer R: Protective effects of adenosine in the reversib leinjured heart. Ann Thorac Surg 60: 843-846, 1995

42. Randh awa MP Jr, Lasley RD, Ment zer RM Jr : Adenosine and thestunned heart . J Card Surg 8(suppI2): 332- 337,1 993

43. Zhao Z, Katsuhiko N, McGee S, Ping T, Vinten-Johansen J: AI receptormediated myocardial infarct size reduction by endogenous adenosine isexerted primarily during ischemia. Cardiovasc Res 28: 270-279, 1994

44. Velasco C, Jackson E, Morrow J, Vitola J, Inagami T, Forman M: In­travenous adenosine suppresses cardiac release of endothelin aftermyocardial ischaemia and reperfusion . Cardiovasc Res 27: 121-128,1993

45. Forman MB, Velasco CE: Role of adenosine in the treatment of myo­cardial stunning. Cardiovasc Drug Ther 5: 901-908,199 1

46. Fralix TA, Murphy E, London RE, Steenbergen C: Protect ive effect sof adeno sine in the perfu sed rat heart : Changes in metab olism andintracellu lar homeostasis . Am J Physiol 264: C986-C994 , 1993

47. Shigematsu S, Sato T,Abe T, Saikawa T, Sakata T,Arita M: Pharmaco­logical evidence for persistent activation of ATP-sensitive K+ channelsin early phase ofreperfusion and its protective role against myocardialstunning. Circulation 92: 2266-2275,1995

48. Cohen MV, Yang XM, Downey JM: Conscious rabbits become toler­ant to multiple episodes of ischemic preconditioning . Circ Res 74: 998­1004, 1994

Molecular and Cellular Biochemistry 251: 161-163,2003 .

Index to Volume 251

Abe S, see Kato K et atAizawa Y, see Juan W et atAizawa Y, see Kato K et atArciIla R, see Ocampo C et atAronow B, see Prabhakar R et at

Barta J, T6th A, Jaquet K, Redlich A, Edes I, Papp Z: Calpain-I-dependent degradat ion of tropon in I mutants found in familialhypertrophic card iomyopathy

Berger RMF, see Peters THF et atBlasig IE, see Wallukat G et atBogers AJJC, see Peters THF et atBoivin GP, see Prabhakar R et atBriest W, see Deten A et atBrower GL, Gardner JD, Janicki JS: Gender mediated cardiac protection from adverse ventricular remodeling is aboli shed by

ovariectomyBrown L, see Fenning A et atBullough DA, see Villarreal F et atBuscemi N, Doherty-Kirby A, Sussman MA, Lajoie G, Van Eyk JE: Proteomic analysis of Racl transgenic mice displa ying

dilated cardiomyopathy reveal s an increase in creatine kinase M-chain prote in abundance

Chaudhri B, del Monte F, Hajjar RJ, Harding SE: Contractile effect s of adenovirally-mediated increases in SERCA2a activity:A comparison between adult rat and rabbit ventricular myocytes

Csonk a C, see Wallukat G et at

Davidoff AW, see Zhang ML et atde Jong PL, see Peters THF et atdel Monte F, see Chaudh ri B et atDeten A, Volz HC, Holzi A, Briest W, Zimmer H-G: Effect of propranolol on cardiac cytokine expres sion after myocardi al

infarction in ratsDixon IMC, see Kirshenbaum LA et atDoherty-Kirby A, see Buscemi N et atDonato M, Gelpi RJ: Adenosine and cardioprotection during reperfusion - an overviewDwyer D, see Fenning A et at

Edes I, see Barta J et atElkassem S, see Zhang ML et atErion MD, see Villarreal F et at

Farahmand F, see Khaper N et atFenn ing A, Harrison G, Dwyer D, Rose 'Meyer R, Brown L: Cardiac adaptat ion to endurance exerc ise in ratsFord DA, see Goel DP et atFuse K, see Juan W et at

Fuse K, see Kato K et at

Gao CQ, see Lalu MM et atGardner JD, see Brower GL et atGekle M, see Leicht M et atGelpi RJ, see Donato MGoel DP, Ford DA, Pierce GN: Lysophospholipids do not directly modulate Na+-W exchangeGupta M, see Ocampo C et at

83-88

89-95

145-151

103-109

127-137

153-159

51-59

3-7

162

Hajjar RJ, see Chaudhri B et alHanawa H, see Kato K et alHarding SE, see Chaudhri B et alHarrison G, see Fenning A et alHasegawa G, see Juan W et alHayashi M, see Kato K et alHirono S, see Kato K et aJHolzl A, see Deten A et al

Ilbawi M, see Ocampo C et alIngram P, see Ocampo C et alIto BR, see Villarreal F et alIto M, see Kato K et al

Janicki JS, see Brower GL et alJaquet K, see Barta J et alJuan W, Nakazawa M, Watanabe K, Ma M, Wahed MIl, Hasegawa G, Naito M, Yamamoto T, Fuse K, Kato K, Kodama M,

Aizawa Y: Quinapril inhibits progression of heart failure and fibrosis in rats with dialted cardiomyopathy after myocarditis

Karbach D, see Leicht M et alKato K, Kodama M, Hirono S, Okura Y, Hanawa H, Shiono T, Ito M, Fuse K, Tsuchida K, Maruyama S, Yoshida T, Abe S,

Hayashi M, Nasuno A, Saigawa T, Ozawa T,Aizawa Y:Analysis of postextrasystolic relaxation response in the human heartKato K, see Juan W et alKaur K, see Khaper N et aJKhaper N, Kaur K, Li T, Farahmand F, Singal PK: Antioxidant enzyme gene expression in congestive heart failure following

myocardial infarctionKirshenbaum LA, Dixon IMC, Singal PK: PrefaceKlompe L, see Peters THF et alKodama M, see Juan W et alKodama M, see Kato K et alKohler T, see Leicht M et al

Lajoie G, see Buscemi N et alLalu MM, Gao CQ, Schulz R: Matrix metalloproteinase inhibitors attenuate endotoxemia induced cardiac dysfunction : A potential

role for MMP-9Leicht M, Marx G, Karbach D, Gekle M, Kohler T, Zimmer H-G: Mechanism of cell death of rat cardiac fibroblasts induced

by serum depletionLi T, see Khaper N et al

Ma M, see Juan W et alMakhsudova L, see Villarreal F et alMaruyama S, see Kato K et alMarx G, see Leicht M et alMolkentin JD, see Prabhakar R et alMontag AC, see Villarreal F et alMorwinski R, see Wallukat G et al

Naito M, see Juan W et alNakazawa M, see Juan W et alNasuno A, see Kato K et alNissen E, see Wallukat G et al

Ocampo C, Ingram P, Ilbawi M, Arcilla R, Gupta M: Revisiting the surgical creation of volume load by aorto-caval shunt inrats

Okura Y, see Kato K et alOzawa T, see Kato K et alPapp Z, see Barta J et al

77-82

43-46

9-15I

61-66

119-126

139-143

Peters THF, de Jong PL, Klompe L, Berger RMF, Saxena PR, Sharma HS, Bogers AJJC : Right ventircular collagen andfibronectin levels in patients with pulmonary atresia and ventricular septal defect

Petrashevskaya N, see Prabhakar R et atPierce GN, see Goel DP et atPodlowski S, see Wallukat G et atPollack JR, Witt RC, Sugimoto JT: Differential effects of calpain inhibitors on hypertrophy of cardiomyocytesPrabhakar R, Petrashevskaya N, Schwartz A, Aronow B, Boivin GP, Molkentin JD, Wieczorek DF: A mouse model of familial

hypertrophic cardiomyopathy caused by a a-tropomyosin mutation

Redlich A, see Barta J et atRose 'Meyer R, see Fenning A et at

Sabri A, Steinberg SF: Protein kinase C isoform-selective signals that lead to cardiac hypertrophy and the progression of heartfailure

Saigawa T, see Kato K et atSaito K, see Zhang ML et atSaxena PR, see Peters THF et atSchulz R, see Lalu MM et atSchwartz A, see Prabhakar R et atSharm a HS, see Peters THF et atShiono T, see Kato K et atSingal PK, see Khaper N et atSingal PK, see Kirshenbaum LA et atSteinberg SF, see Sabri A et atSugimoto JT, see Pollack JR et atSussman MA, see Buscemi N et at

ter Keurs HEDJ, see Zhang ML et atTosaki A, see Wallukat G et atT6th A, see Barta J et atTsuchida K, see Kato K et at

Van Eyk IE, see Buscemi N et atVillarreal F, Zimmermann S, Makhsudova L, Montag AC, Erion MD, Bullough DA, Ito BR: Modulation of cardiac remodeling

by adenosine: In vitro and in vivo effectsVolz HC, see Deten A et at

Wahed MIl, see Juan W et atWallukat G, Podlowski S, Nissen E, Morwinski R, Csonka C, Tosaki A, Blasig IE: Functional and structural characterization

of anti-Bl-adrenoceptor autoantibodies of spontaneously hypertensive ratsWatanabe K, see Juan W et atWieczorek DF, see Prabhakar R et atWitt RC, see Pollack JR et at

Yamamoto T, see Juan W et atYoshida T, see Kato K et at

Zhang ML, Elkassem S, Davidoff AW, Siato K, ter Keurs HEDJ: Losartan inhibits myosin isoform shift after myocardialinfarction in rats

Zimmer H-G, see Deten A et atZimmer H-G, see Leicht M et atZimmermann S, see Villarreal F et at

163

27-32

47-50

33-42

97-101

17-26

67-75

111-137

Developments in Molecular and Cellular Biochemistry

Series Editor: Naranjan S. Dhalla, Ph.D., M.D. (Hon.), FACC

1. VA Najjar (ed.): Biolog ical Effects of Glutamic Acid and Its Derivatives. 19812. VA. Najjar (ed.) : Immunologically Active Peptides. 19813. VA. Najjar (ed.): Enzyme Induction and Modulation . 19834. V.A. Najjar and L. Lorand (eds.): Transglutaminase . 19845. GJ. van der Vusse (ed.) : Lipid Metabolism in Normoxic and Ischemic Heart. 19896. J.Ee. Glatz and GJ . van der Vusse (eds.): Cellular Fatty Acid-Binding Proteins. 19907. H.E. Morgan (ed.): Molecular Mechanisms of Cellula r Growth. 19918. GJ. van der Vusse and H. Starn (eds.): Lipid Metabolism in the Health and Diseased Heart .

19929. Y. Yazaki and S. Mochizuki (eds.): Cellular Function and Metabolism. 199310. J.Ee. Glatz and GJ. van der Vusse (eds.): Cellular Fatty-Acid-Binding Proteins, II . 199311. R.L. Khandelwal and J.H. Wang (eds.): Reversible Protein Phospho rylation in Cell

Regulation . 199312. J. Moss and P. Zahradka (eds.): ADP-Ribosylation: Metabolic Effects and Regulatory

Functions . 199413. V.A. Saks and R. Ventura-C1apier(eds.): Cellular Bioenergetics: Role ofCoupled Creatine

Kinases. 199414. J. Slezak and A. Ziegelhoffe r (eds.): Cellular Intera ctions in Cardiac Pathophysiology.

199515. J.A. Barnes , H.G Coore, A.H. Mohammed and R.K. Sharma (eds.): Signal Transduction

Mechanisms. 199516. A.K. Srivastava and J.-L. Chiasson (eds.): Vanadium Compounds: Bioch emical and

Therap eutic Applications. 199517. J.M.J . Lamers and P.D. Verdouw (eds.): Biochemistry ofSignal Transduction in

Myocardium. 199618. E.-G Krause and R. Vetter (eds.): Biochemical Mechan isms in Heart Function. 199619. R. Vetter and E.-G Krause (eds.): Biochemical Regulation ofMyocardium. 199620. GN. Pierce and W.C. Claycomb (eds.): Novel Methods in Molecular and Cellula r

Biochemistry of Muscle . 199721. EN. Gellerich and S. Zierz (eds.): Detection ofMitochondrial Diseases. 199722. P.K. Singal, V Panagia and G.N. Pierce (eds.): The Cellular Basis of Cardiovascular

Function in Health and Disease. 199723. S. Abdel-a1eem and J.E. Lowe (eds.): Cardiac Metabolism in Health and Disea se. 199824. A.K. Srivastava and B. Posner (eds.): Insulin Action . 199825. VA. Saks, R. Ventura-Clapier, X. Leverve, A. Rossi and M. Rigoulet (eds.): Bioenergetic s

of the Cell: Quantitative Aspects. 199826. GN. Pierce, H. Rupp, T. Izumi and A. Grynberg (eds.): Molecular and Cellular Effects of

Nutrition on Disease Processes. 199827. K. Ahmed, E. Chambaz and 0.0. Issinger (eds.): Molecular and Cellular View ofProtein

Kinase CK2. 1998

ISBN 90-6193 -841-4ISBN 90-6193 -842-2ISBN 0-89838-583-0ISBN 0-89838 -593-8ISBN 0-7923-0479-9ISBN 0-7923-0896-4ISBN 0-7923-1183-3

ISBN 0-7923-1850-1ISBN 0-7923-2158-8ISBN 0-7923-2395-5

ISBN 0-7923-2637-7

ISBN 0-7923-2951-1

ISBN 0-7923-2952-X

ISBN 0-7923-3573-2

ISBN 0-7923-3663-1

ISBN 0-7923-3763-8

ISBN 0-7923-4067-1ISBNO-7923-4118-XISBN 0-7923-4259-3

ISBN 0-7923-4387-5ISBN 0-7923-9925-0

ISBN 0-7923-9974-9ISBN 0-7923-8104-1ISBN 0-7923-8113-0

ISBN 0-7923-8118-1

ISBN 0-7923-8171 -8

ISBN 0-7923-8208-0

Developments in Molecular and Cellular Biochemistry

28. M.V. Cohen , J.M. Downey, RJ. Gelpi and J. Slezak (eds.): Myocardial Ischemia andReperfusion . 1998

29. D.A. Bernlohr and L. Banaszak (eds.) : Lipid Binding Proteins within Molecular andCellular Bioch emistry. 1998

30. R. Albarez-Gonzalez (ed.) : ADP-Ribosylation Reactions : From Bacterial Pathogenesisto Cancer. 1998

31. S. Imai and M. Endo (eds.): Muscle Physiology and Biochemistry. 199832. D.K. Das (ed.): Stress Adaptation, Prophylaxis and Treatment. 199933. H. Rupp and B. Maisch (eds.) : Control of Gene Expression by Catecholam ines and the

Renin-Angiotensin System34. X. Shi, V. Castranova, V. Vallyathan and WG. Perry (eds.): Molecular Mechanisms of

Metal Toxicity and Carcinogenesis . 200135. K. Ahmed, J.E. Allende and 0.-0. Issinger (eds.): Protein Kinase CK2 - From Structure to

Regulation . 200136. R.K. Sharma (ed.): Guanylate Cyclase. 200237. V. Vallyathan, V. Castranova and S. Shi (eds.) : Oxygen/Nitrogen Radicals: Cell Injury and

Disea se. 200238. J.F.C. Glatz (ed.): Cellula r Lipid Binding Proteins. 200239. E. Kardami, L. Hryshko and N. Mesaeli (eds.): Cardiac Cell Biology. 200340. J.F. Clark (ed.): Guanidino Compounds in Biology and Medicine . 200341. P. Zahradka, J. Wigle and G.N. Pierce (eds.): Vascular Biochemistry. 200342. J.S.C. Gilchrist, P.S. Tappia and T. Netticadan (eds.): Biochemistry ofDiabetes and

Atherosclerosi s. 200343. L.A. Kirshenbaum, I.M.C . Dixon and P.K. Singal (eds.): Biochemistry ofHypertrophy and

Heart Failure. 2003

KLUWER ACADEMIC PUBLISHERS - DORDRECHT / BOSTON / LONDON

ISBN 0-7923-8173-4

ISBN 0-7923-8223-4

ISBN 0-7923-8235-8ISBN 0-7923-8264-1ISBN 0-7923-8406-7

ISBN 0-7923-7981-0

ISBN 0-7923-7498-3

ISBN 0-7923-7666-8ISBN 0-7923-7682-8

ISBN 1-4020-7085-3ISBN 1-4020-7220-1ISBN 1-4020-7296-1ISBN 4020-7297-XISBN 1-4020-7398-4

ISBN 1-4020-7423-9

ISBN 1-4020-7434-4