Chapter 21: Techniques of Molecular Biology

I. Introduction

A. Introduction: Developing Molecular Techniques To Study Cellular Function

1. Gene expression is necessary for the cell to function properly

a. DNA RNA Proteinb. The protein is what carries out the function of the gene with the information encoding each protein housed within the DNAc. Each step of this process is regulated

2. Types of proteins produced:

a. Enzymes to carry out important biological reactionsb. Structural proteins to give the cell shapec. Membrane bound proteins to receive signals and to anchor the celld. Signaling proteins which are secreted and carry signals from one cell to anotherf. Other proteins not covered in the other four categories

3. In order to study each step in the process, Molecular Biologists needed to develop techniques to study each molecule in this complicated process

B. Introduction: Practical Reasons For Developing Molecular Techniques

1. Techniques in Molecular Biology have been developed for four reasons

a. Study basic gene function/expressionb. Determine root causes of human genetic diseases and the symptoms that result c. Disease diagnoticsd. Forensics

2. Molecular biologists can easily follow two types of classes of genetic diseases

a. Chromosomal disorders

b. Single gene disorders

3. Chromosomal disorders:

a. An individual has too many copies of a single chromosomeb. Ex. Downs Syndrome c. Tools needed are those to visualize chromosomes in situ or in vitro

4. Single gene disorders

a. Disorders resulting from a mutation in a single geneb. Need techniques to study the DNA encoding the implicated genec. Need techniques to study the corresponding molecules produced when the implicated gene is expressed

C. Introduction: Practical Reasons For Developing Molecular Techniques

1. Besides these experimental tools being used for the basic study of gene function and the root cause of genetic disease, many have been either used, or modified such that they can be used to diagnose disease

a. Can be used to confirm or determine whether one has disease causing allelesb. Can be used for preventative purposesc. These techniques are used “genotype” people

2. Many of the same techniques used in disease diagnosis are also used in forensics due to the fact that one also wants to “genotype” suspects and criminals to find out who committed the crime

II. Visualizing Molecules

A. Visualizing Molecules: Introduction

1. To study genes/gene expression/genetic disease on a molecular, techniques were developed to visualize the following molecules

a. DNAb. RNA

c. Protein

2. The methods by which to visualize DNA and RNA are quite similar because they have similar chemistry

a. Nucleic acidsb. Negatively chargedc. Same directional polarityd. Only difference is that one is double stranded and the other is single stranded

3. Visualization methods for proteins can be quite different due to the fact that they have a different chemistry than DNA and RNA

B. Visualizing Molecules: DNA and RNA

1. Agarose gel electrophoresis is used to study nucleic acids

a. DNA b. RNA

2. The agarose is an inert substance that is used to create a porous gel matrix, which allows us to separate DNA molecules according to size

3. To produce an agarose gel, the agarose powder is mixed into solution with either 1X TAE or 1X TBE buffer

a. Buffers allow for the dissolving of agarose when heat is appliedb. Buffers contain salts which are necessary for running your nucleic acid into the gel

4. Once the agarose is melted into solution, the mixture is poured into a tray and allowed to solidify creating a matrix

a. DNA molecules are moderately flexible and occupy effective volumeb. The gel matrix acts as a sieve through which DNA molecules passc. Pore size is dependent on the % of agarose in the gel matrixd. Large DNA molecules have more volume and thus have more difficulty passing though the gel than smaller DNA molecules and so they run smaller

5. The gel is placed into a gel box, and the box is also filled with the appropriate salt buffer

a. If gel contains 1X TAE, then 1X TAE is usedb. If gel contains 1X TBE, then 1X TBE is used

6. In order to run your DNA samples through the gel, they are placed in wells at the top of the gel

7. Electrical current is applied-with the buffer salts being able to carry it through the chamber/gel

a. Negative electrode (black) is placed near the top of the gelb. Positive electrode (red) is placed near the bottom of the gelc. Since the DNA is negatively charged it will run toward the positive electrode when current is applied

8. Smaller DNA molecules will run faster than large ones

9. In order to visualize the DNA, the gel is stained with ethidium bromide

a. Interacalating agentb. DNA fluoresces when UV light is shine on the gelc. DNA will be visualized as bands

10. When running an agarose gel, a size standard is also used for comparison to determine the size of the DNA bands in your samples

11. RNA is also visualized also using agarose gels

a. RNA has secondary structureb. Gel will contain agarose, buffer and formaldehydec. Formaldehyde is used to denature the secondary structure in the RNA to ensure it runs true to size

C. Visualizing Molecules: Proteins

1. In order to visualize proteins, we also use gel electrophoresis

2. To visualize proteins, SDS-polyacrylamide gel electrophoresis (SDS-PAGE) is used instead of agarose gel electrophoresis

a. Acrylamide will form the gel matrixb. SDS acts as a denaturant to relieve structure within the protein so that it runs true to size on the gelc. SDS also coats the linearized proteins (which have a relatively uncharged backbone) giving them a net negative charge

3. The SDS-Polyacrylamide gel, actually consists of 2 gels which consists of different amounts of acrylamide

a. Stacking gel (which stacks all the proteins so the enter the separating gel togetherb. Separating gel, which allows for separation of proteins according to size

4. A running buffer of Tris/Glycine and SDS is used

5. Since the protein now has a net negative charge, electrical current can be used to run the proteins through the gel

a. Negative electrode is placed at the top of the gelb. Positive electrode is placed at the bottom of the gel

6. Proteins run on the SDS-Polyacrylamide gel according to size

a. Proteins with greater molecular weight (larger proteins) run slowerb. Proteins with lesser molecular weight (smaller proteins) run faster

7. To visualize the proteins, coomassie blue dye is used, which binds the proteins and causes them to appear purple

8. Proteins size is measured as a function of molecular weight (Daltons)

10. A size standard (ladder) is run as a guide to determine the molecular weights of proteins in your sample lanes

D. Visualizing Molecules: Proteins by Coomassie Blue Staining

1. If you run purified protein on an SDS-Polyacrylamide gel, then you should see only one band upon coomassie blue staining

a. Band represents the only type of protein present in the sampleb. Many copies of that single protein in the visible bandc. Band should run true to the protein’s size

2. If you run a cellular extract, then you will see all the different proteins present in the cell type

a. Each type of protein is represented by a band on the gelb. Each protein band should run true to size

E. Visualizing Molecules: Finding A Single Protein From A Cellular Extract

1. Advantages of coomassie blue staining of an SDS-Polyacrylamide

a. Easyb. Can see all the proteins present in the cellular extract

2. If you want to study one specific protein in a cellular extract, coomassie blue staining of the gel is not the best way to visualize

a. Your protein will be one band amongst manyb. An extract may contain several proteins of similar molecular weight

3. The western blot can be used as a technique to study a single protein in an extract

a. Whether the protein is present in an extract, and if so, the gene is expressedb. Western blot, if done right, can tell you protein levels-which will give an idea to the level the gene is expressed

F. Visualizing Molecules: Creating Protein Specific Antibodies For Western Blots

1. The western blot technique requires antibodies

a. Produced by B-cellsb. Antibodies are a specific type of proteinc. Are meant to recognize foreign proteins in vivo

2. Production of antibodies:

a. For the protein you are interested in studying, first obtain purified proteinb. Inject the purified protein into a rabbitc. Rabbit’s immune system will recognize that the protein is foreign and will make antibodies against the proteind. Take blood samples from the rabbit and then purify antibodies from the blood samplese. Antibodies produced are considered polyclonal antibodies because each protein that is injected a mixture of antibodies will made that recognize different epitopes within the protein

G. Visualizing Molecules: Actual Western Blotting Procedures

1. First, protein must be extracted from the cell line of choice to make an extract

2. Next, a sample of extract is then mixed with SDS-sample buffer and boiled

a. The sample buffer contains dyeb. The sample buffer contains SDS, which is a detergentc. The SDS acts to denature the proteind. The SDS also coats the protein, giving it a net negative chargef. The boiling step also aids in the denaturation of the protein

3. Once the proteins are denatured, the sample above is run on an SDS-polyacrylamide gel

4. Once the gel is run, the proteins are transfer horizontally to a nitrocellulose membrane

a. In the transfer apparatus, the gel is placed vertically to allow for a horizontal transferb. Proteins are transferred by using electrical currentc. The transfer is done horizontally towards the anode, as the proteins are coated with the negatively charged SDS

5. Supplemental Figure: Visualizing Molecules: Actual Western

6. In order to visualize your proteins on the blot, the blot must be probed with your antibodies

7. In order to get an efficient probing of the blot, two antibodies are used

a. The primary antibody binds the protein of interestb. The secondary antibody binds the constant region of the primary antibodyc. The constant region of an antibody is held in common for all antibodies produced by organisms of the same speciesd. The secondary antibody has either Alkaline phosphatase or Horseradish peroxidase conjugated to it

8. Once the antibodies are bound, the protein of interest can be visualized by two methods

a. Using a chemiluminescent substrate or a colorimetric substrateb. The conjugated enzyme will oxidize the substrate and if it is the chemiluminescent substrate, light will be emittedc. The conjugated enzyme will oxidize the substrate and if it is the colorimetric substrate, then a purple product is left behind

9. In either case, the protein of interest will appear as a band on the blot

10. Besides telling you whether a protein is present or absent in a sample, a western blot can tell you whether the protein’s size or levels has been altered

11. If the protein is somehow truncated, then one would find the protein lower on the western blot (because it ran faster on the gel)

12. If the protein’s levels have been altered, the intensity of the band may be altered

a. If levels of protein are increased then the band appears darkerb. If the levels of protein are decreased, then the band appears lighter

H. Visualizing Molecules: Finding A Specific RNA From An Extract

1. In addition to following proteins, when studying gene expression RNA can be followed

a. mRNA serve as substrates for translation and their levels are oftentimes proportional to the amount of protein producedb. For some genes, the RNA is the terminal product

2. The northern blot is used to study a single RNA amongst all present in a cellular extract is the northern blot

a. Method is easy and produces results that are reproducibleb. Most common method used to study cellular mRNA levels c. Inexpensived. This technique can be used to determine whether a specific gene is expressed, and to what levels it may be expressed

3. Note: Again for protein coding genes, this technique is not the most direct technique to study gene expression

J. Visualizing Molecules: Northern Blot Analysis-Procedural Overview

1. First RNA isolations must be performed from the cell line/strain of choice

a. Create a sample of cellular RNA (all types)b. Only ~2% of RNA is mRNA in yeast, ~10% in other species

2. The total RNA is run on a formaldehyde-agarose gel (1.25%)

a. Staining with ethidium bromide will show the ribosomal RNA as bands on the gelb. The mRNA, since the levels are so low, will not be seen by staining

3. The RNA is transferred to a nylon membrane by capillary action

K. Visualizing Molecules: Transferring the RNA To The Nylon Membrane (agarose gel)

1. In order perform a northern transfer, a transfer apparatus must be create

2. Create a transfer apparatus by using a tray and making a paper wick with Whatman Paper

3. In the tray, place 10X SSC

a. SSC stands for salt (NaCl), Sodium Citrateb. Does not need to function as a denaturant since the formaldehyde in the gel performed the process

4. Place gel on bed of wet whatman paper

5. Place nylon membrane on top of the gel

6. Place three whatman papers on top of the gel

7. Place a stack of paper towels on top of the membrane

8. Place a weight on top of the paper towels

9. 10X SSC will move out of the tray and up through wick, gel, membrane and paper towels by capillary action-RNA will move out of the gel and be transferred to membrane

10. The RNA is then usually crosslinked to the membrane by using UV light

L. Visualizing Molecules: Probing the Northern Blot

1. In order to probe the blots, two types of probes can be used

a. RNA probes (full length) with complementary sequence to the mRNA of interestb. Oligo probes with complementary sequence to the mRNA of interest

2. RNA probes are made by in vitro transcription

a. Transcription reaction is performed in the presence of 32P radio-labeled nucleotide (s) b. Usually use the nucleotide that is most frequently found in the mRNA to be probed c. Maximizes the signal allows for study of less abundant transcripts

3. Oligo probes are short (~20-30 nt) and composed of DNA

a. To add a radiolabel to the oligo use 32P-labeled dATP and T4 DNA Kinaseb. Easy to make and good for studying abundant transcripts

4. Alternatively an AP-conjugated nucleotide can be used which will allow for detection by:

a. Colormetric assayb. Chemiluminescence

5. If RNA is present in the RNA sample(s) then it will appear as a band on the blot

III. Manipulating DNA

A. Manipulating DNA: Introduction

1. Unlike proteins and RNAs, most naturally occurring DNA molecules are much larger than can be analyzed in the lab

a. Eukaryotic chromosomes contain thousands of genesb. Eukaryotic chromosomes can contain more than 100 Mb of DNAc. Study of individual genes/regions requires the breakdown of the DNA

2. There are two ways at which we can break the genome into more manageable pieces

a. Use restriction endonucleases to cleave the DNA into smaller fragmentsb. Can copy specific sequences by use of Polymerase chain reaction (PCR)

B. Manipulating DNA: Introduction Restriction Endonucleases

1. The discovery of restriction endonucleases in the 1970s

a. The enzymes were discovered in bacteriab. They function to cut DNA by binding SPECIFIC Sequencesc. Non-processived. Discovered as a type of bacterial “immune system” against viruses

2. Today, we know of more than 3500 restriction enzymes

3. There are three classes of restriction enzymes

a. Type Ib. Type IIc. Type III

4. Type I restriction enzymes cut DNA at sites that are far from their recognition sequence

5. Type II restriction enzymes recognize specific DNA sequences and cut within (or near) those sequences

6. Type III restriction enzymes recognize two non-palindromic sequences in opposite orientations, and then cut outside the sequences they recognize

C. Manipulating DNA: General Information About Restriction Enzymes

1. Of the 3500 restriction enzymes identified, only a small percentage are commercially available for use in laboratory experiments

a. There are 240 type II restriction enzymes, which compose a great percentage of those availableb. A small percentage of those commercially available are type I restriction enzymes

2. Each type II restriction endonuclease is composed of two identical peptide subunits that join together to form a homodimer

3. Each restriction endonuclease is named for the organism in which they were discovered, using a system of letters and numbers

4. HindIII was discovered from Haemophilus influenza (strain D)

a. The Hin comes from the first letter of the genus name and the first two letters of the species nameb. The d comes from the first letter of the strain typec. The III comes from the fact that it is the third restriction enzyme isolated from this organism

5. EcoRI was isolated from E. coli strain R and is the first enzyme isolated from this organism

D. Manipulating DNA: Sequence Recognition By Restriction Endonucleases

1. The sequence that is recognized by the restriction endonuclease within the DNA is known as the restriction site or the restriction recognition site

2. Most of the type II restriction enzymes recognize DNA sequences of either 4 or 6 base pairs, however some recognize sequences of 8 or 10 base pairs in length

3. The most commonly used restriction enzymes recognize sequences 6 base pairs

4. The sequences the restriction enzymes recognize are palindromes

a. The sequences in the recognition site when read in the 5’ 3’ direction are the same for both strands b. EcoRI is a restriction enzyme that recognizes the sequence 5’ GAATTC 3’c. The complementary strand also has the sequence 5’ GAATTC 3’

E. Manipulating DNA: Type II Restriction Endonucleases Cut DNA Specifically

1. When digesting the DNA with restriction enzymes, one can consistently predict the possible products no matter which restriction enzyme is used

a. The restriction enzymes recognize specific sequences b. The restriction enzyme cuts the DNA at the recognition site in a consistent manner (the same way every time)

2. For instance, when a restriction enzyme cuts, it cuts at the specific site by cleaving the phosphodiester backbone

3. EcoRI restriction enzyme cuts the DNA at the 5’ GAATTC 3’ site between the G and the A

a. After cutting, what is left is something called a 5’ overhang

b. The 5’ overhang is single stranded sequence that is left on the products (the DNA molecules left after using the restriction enzyme) after cutting the DNA with the EcoRIc. Some restriction enzymes are blunt cutters, leaving no overhangs (eg SmaI)d. Some enzymes leave 3’ overhangs (eg PstI)

4. Each restriction site recognized by a type II restriction enzyme has an axis of symmetry

a. Axis of symmetry lies right in the middle of the restriction siteb. If you actually flip one side of the restriction site, you will find that the site will look completely symmetrical

5. One can predict what type of overhangs will be produced if one knows where a specific restriction enzyme cuts within its specific restriction site

6. If the restriction enzyme cuts 5’ to the axis of symmetry, then 5’ overhangs are produced

a. EcoRI cuts between the G and the Ab. This site is 5’ to the axis of symmetry

7. If the restriction enzyme cuts 3’ to the axis of symmetry, then 3’ overhangs are produced

a. PstI cuts between the G and the A in its restriction recognition siteb. This site is 3’ to the axis of symmetry and thus leaves 3’ overhangs

8. If the restriction enzyme cuts at the axis of symmetry, then it is considered a blunt cutter, and no overhangs are produced

9. After the DNA is cut, what are left are termed fragments

10. There are two different geometries to the DNA molecules one can cut

a. Linear DNA moleculesb. Circular DNA molecules

11. The number of fragments left after cutting a circular DNA molecule is equal to the number of restriction sites present in the DNA molecule

12. The number of fragments left after cutting a linear DNA molecule is equal to the number of restriction sites present in the DNA molecule plus 1

13. Let’s cut the following DNA molecule with BamHI (which recognizes 5’ GGATCC 3’)–5’ CACGACGGATCCCTAGATGCTGAAATTCTAGGATCCCCCGGGTTTAAA 3’ (coding strand)

a. Please note that these sequences are double stranded in vivob. Note: BamHI cuts between the G and the G

F. Manipulating DNA: The Southern Blot

1. There are three reasons by which one may want to restriction digest DNA

a. Molecular Cloningb. Genotype an individual (for a specific gene)

2. Genotyping experiments require taking a sample of genomic DNA from an individual and digesting using either a single restriction enzyme, or several restriction enzymes

a. Genomic digests result in generation of hundreds if not thousands of DNA fragmentsb. Problem: How do we find the fragment(s) corresponding to our gene of interestc. To find a specific fragment amongst many, the southern blot is performed

3. Southern blotting was developed in the 1975 by Edward Southern

4. The goal of the southern blot technique allows one to find an examine specific DNA fragments amongst a large number of DNA fragments

a. These fragments are usually derived from the genomic DNA from the appropriate source

b. The DNA fragments are produced by restriction digests

5. From this, you can find the specific DNA fragment(s) containing your gene of interest

6. Once one obtains the genomic DNA of choice, the first thing is to digest it using restriction enzyme(s)

7. The next step is to then run the DNA sample on an agarose gel

8. To be analyzed, the DNA must be first denatured such that it become single stranded, and so the transfer is run using 0.4N NaOH

9. Just like the Northern, the DNA is transferred to a nylon membrane by capillary action

a. The gel is placed on top of a stand and Watman wick b. To transfer the nylon membrane is placed directly on top of the gelc. On top of the membrane, 3 Watman papers, a stack of paper towels and a weight is placedd. In this setup, the liquid in the Watman moves up from the Watman to through the gel to the nylon membrane carrying the single stranded DNA with it

10 . Once the DNA is transferred to the membrane, it is then cross-linked to the membrane

11. To identify the specific fragment(s) the blot must be probed with a single stranded DNA probe that is complementary to the gene you are interested in studying

a. This probe doesn’t have to cover the full length of the geneb. The probe is labeled with radioactivity (32P) such that you can use X-ray film or a phosphorimager to visualize your results

12. Binding of the probe to complementary sequence (hybridization) will mark the location of the DNA fragment you are interested in on the blot

13. Where your fragment is you will see a band on the developed X-ray film, or on your phosphorimager scan

G. Manipulating DNA: Using The Southern Blot To Do RFLP

1. One can use restriction digestion and southern blotting to do RFLP

2. RFLP stands for Restriction Fragment Length Polymorphism

3. RFLP is a difference in homologous DNA sequences that can be detected by the presence of fragments of different lengths after digestion of the DNA samples with specific restriction endonucleases

4. The main use for using the RFLP is to determine the genotype of an individual for a single gene or a set of genes

a. Genetic Mappingb. Diagnose diseasec. Paternityd. Forensics

5. In order to do RFLP, you need a target sequence

a. Consists of DNA sequence corresponding to the gene (either a portion of the entire full length) you are interested in studyingb. The target sequence will eventually be bound by a probe with complementary sequence during the southern blotting part of the protocol

H. Manipulating DNA: Using The Southern Blot To Do RFLP

1. Each allele for a given gene may have either more or less restriction recognition sites for a given restriction enzyme

a. The number of DNA fragments produced for each allele will be differentb. The size of the DNA fragments produced for each allele will also be different

2. If you take an individual, he/she will have two copies of each gene

a. Homozygotes will have 2 copies of the same alleleb. Heterozygotes will have 2 different alleles for the gene

3. In order to do RFLP, take a sample of genomic DNA from an individual, and then restriction digest it with one or more restriction endonucleases

4. Next, run the samples on an agarose gel, then transfer the samples to a nylon and perform a southern blot with a probe to detect your gene of interest

5. Upon probing, one should be able to determine the identity of both alleles an individual has for a given gene by looking at the number and size of bands produced (be aware that each individual’s DNA will be represented in a single lane, and you will see the results for both alleles for an individual in ONLY one lane)

J. Manipulating DNA: Copying Your Gene of Interest by Polymerase Chain Reaction (PCR)

1. To amplify (make copies) of your gene of interest, one can use the polymerase chain reaction (PCR)

2. PCR was developed by Kary Mullis in the early 1980s

3. In a PCR reaction, we place several components

a. Genomic DNAb. Nucleotides (the building blocks of DNA)c. Taq DNA polymerase (enzyme that carries out the reaction and is thermostable in that it can withstand high temperaturesd. A buffer that is optimized for Taq activitye. Primers

4. The primers small DNA molecules of about 20 nucleotides

5. They are specific for the gene of interest because they are designed to be complementary to the ends of your gene of interest

6. There are two primers in the reaction, the forward primer and the reverse primer

7. The forward primer has complementary sequence to the DNA strand that goes 5’ 3’ in the right to left direction, and it binds on the 3’ end to its complementary sequence

8. The reverse primer has complementary sequence to the DNA strand that goes 5’ 3’ in the left the right direction on the 3’ end

9. Once the reaction is set-up, we will then run the reaction in a DNA thermocycler, and instrument that can precisely and quickly change the temperature at which the reaction is being run at

10. To start the reaction, we bring the temperature up to 95 C

11. This acts to denature the DNA-i.e. the heat will break the hydrogen bonds between the two strands of DNA to make them single stranded

12. The single stranded DNA molecules will be the templates for the reaction

13. Next, the temperature is cooled to about 55 C – 60 C to allow the primers to bind to their complementary sequence (30S)

14. Once the primers have bound their complementary sequence, we move the reaction up to 72 C

15. 72 C is the optimal temperature for Taq DNA polymerase to work

16. The Taq DNA polymerase creates new DNA sequence by binding onto the 3’ ends of the primers, and extending the DNA sequence

17. The taq DNA polymerase extends the DNA sequence in the 5’ 3’ direction creating sequence complementary to the template

18. If you were to start with one molecule of DNA, after one round of PCR, you would have 2

19. We often repeat these steps where we change temperature about 30 times

20. In the end we have 230 copies of our gene of interest

21. At the end, you have enough copies to visualize on an agarose gel