Bioportfolio: Lifelong persistence of variant andprototypic erythrovirus DNA genomes in human tissuePaivi Norja*, Kati Hokynar*, Leena-Maija Aaltonen†, Renwei Chen*, Annamari Ranki‡, Esa K. Partio§, Olli Kiviluoto¶,Irja Davidkin�, Tomi Leivo‡, Anna Maria Eis-Hubinger**, Beate Schneider**, Hans-Peter Fischer††, Rene Tolba‡‡,Olli Vapalahti*§§, Antti Vaheri*§§, Maria Soderlund-Venermo*§§, and Klaus Hedman*§§¶¶

*Department of Virology, Haartman Institute, University of Helsinki, FI-00290, Helsinki, Finland; §§Helsinki University Central Hospital Laboratory andDepartments of †Otorhinolaryngology and ‡Dermatology, Helsinki University Central Hospital, Haartmaninkatu, FI-00290, Helsinki, Finland; §Dextra MedicalCentre, Raumantie, FI-00350, Helsinki, Finland; ¶Central Military Hospital, FI-00300, Helsinki, Finland; �Department of Viral Diseases and Immunology,National Public Health Institute, Mannerheimintie 166, FI-00300, Helsinki, Finland; and **Institute of Medical Microbiology, Immunology, and Parasitology,† †Institute of Pathology, and ‡‡Department of Surgery, University of Bonn, Sigmund-Freud-Strasse 25, D-53105 Bonn, Germany

Communicated by Erkki Ruoslahti, The Burnham Institute, La Jolla, CA, March 20, 2006 (received for review January 20, 2006)

Human erythrovirus is a minute, single-stranded DNA virus causingmany diseases, including erythema infectiosum, arthropathy, andfetal death. After primary infection, the viral genomes persist insolid tissues. Besides the prototype, virus type 1, two majorvariants (virus types 2 and 3) have been identified recently, theclinical significance and epidemiology of which are mostly un-known. We examined 523 samples of skin, synovium, tonsil, or liver(birth year range, 1913–2000), and 1,640 sera, by qualitative andquantitative molecular assays for the DNA of human erythrovi-ruses. Virus types 1 and 2 were found in 132 (25%) and 58 (11%)tissues, respectively. DNA of virus type 1 was found in all agegroups, whereas that of type 2 was strictly confined to thosesubjects born before 1973 (P < 0.001). Correspondingly, the serafrom the past two decades contained DNA of type 1 but not type2 or 3. Our data suggest strongly that the newly identified humanerythrovirus type 2 as well as the prototype 1 circulated in North-ern and Central Europe in equal frequency, more than half acentury ago, whereafter type 2 disappeared from circulation. Type3 never attained wide occurrence in this area during the past >70years. The erythrovirus DNA persistence in human tissues is life-long and represents a source of information about our past, theBioportfolio, which, at the individual level, provides a registry ofone’s infectious encounters, and at the population level, a data-base for epidemiological and phylogenetic analyses.

epidemiology � gene therapy � parvovirus � phylogeny �single-stranded DNA

Parvovirus B19, of the erythrovirus genus, is the prototypichuman pathogen of the Parvoviridae family, encapsidating

within its minute (�20 nm) nonenveloped icosahedral protein shella single-stranded DNA genome of 5,596 bp (1–4). The virusmultiplies restrictively in the erythroid precursor cells of the bonemarrow (5), giving rise to high-titer viremia, which, according tosensitive techniques, subsides more slowly than thought previously(6–10). The viral DNA genome was long considered highly stableand the species, phylogenically monolithic (11). Because of recentdiscoveries, however, we now recognize three major types, theprototype (genotype 1) and two variants (genotypes 2 and 3),diverging from each other in sequence by �10% and in thepromoter region by �20% (12–15). The molecular biology andclinical significance of the newly recognized erythrovirus types areunder active study (13, 15–17). In line with the difficulties indetecting these viruses (16, 18, 19), two previously undescribedhuman parvoviruses have been identified recently among symp-tomatic patients (20, 21). Indeed, the evolution rate of thesemammalian single-stranded DNA viruses has turned out to beexceptionally high, comparable with that of RNA viruses (22, 23).

After primary infection, the erythroviral genomic DNA remainsdetectable in human tissues, in both symptomatic and asymptom-atic subjects (24–26). Serodiagnostics (i.e., IgG seropositivity; IgGavidity, IgG epitope type specificity, and the absence of IgM ruling

out recent primary infection) verified the specificity of the originalfindings and showed the DNA persistence in synovium to be long(24, 27). Besides revolutionizing the diagnostic criteria of parvovi-rus arthropathy (28, 29), the tissue persistence has evoked wideinterest in the possible etiopathogenic role of these viruses ininflammatory and other chronic diseases (30–36). However, thesubstantial span of the viral genome persistence as well as its cellularand molecular mechanisms remained undefined.

In the present work, we have determined the extent and durationof persistence of genomic DNA of the different erythrovirus typesin a large number of tissue samples and patient sera from the pasttwo decades. We found that erythrovirus genome persistence inhuman tissues is ubiquitous and lifelong and represents an entity,named the Bioportfolio, which indicates that the newly discoveredvirus type 2 was actually ‘‘older’’ in occurrence in Central andNorthern Europe than the virus prototype and that the type 3 neverattained wide circulation in the area during the 70-year observationperiod from the 1930s to the present day.

Results and DiscussionIn our previous studies with a small number of samples, thegenomic DNA of erythrovirus type 2 was found in skin but notin synovium (12). We consequently determined the tissue type-specific occurrence of the previously known and the recentlydiscovered virus types 2 and 3 by studying a large number ofsolid-tissue and serum samples with qualitative and quantitativemolecular assays for DNA of all three erythrovirus types.

Virus type 1 DNA was found in all tissue types (skin, synovia,tonsil, and liver), with detection rates varying from 16% in tonsilsto 35% in synovia. The universal distribution held also for virustype 2, albeit at a lower frequency (Table 1). Also, the DNA copylevels of the two virus types were similar (data not shown). Virustype 3 was absent from all of the tissues studied. Two tonsilscontained erythroviral DNA with a melting point of 63°C (18),which, by sequencing, turned out to be a subvariant of virus type1. Altogether, these large-scale PCR findings ruled against tissuespecificity of any of the erythrovirus types.

We next grouped the sample donors according to their birthyears (Fig. 1). Whereas virus type 1 was seen almost uniformlyin subjects of all ages (except small children), virus type 2 wasstrictly confined to the older age groups (P � 0.001). Amongthose born in the 1950s or earlier, the genoprevalences of virustypes 1 and 2 were similar: 22% (41 of 189) and 28% (53 of 189),respectively. By contrast, among those born in the 1960s, virustype 2 occurred in merely 3% (3 of 92); and among those bornin the 1970s, virus type 2 was present in only a single individual

Conflict of interest statement: No conflicts declared.

¶¶To whom correspondence should be addressed at: University of Helsinki, Haart-maninkatu 3, FI-00290, Helsinki, Finland. E-mail: klaus.hedman@helsinki.fi.

© 2006 by The National Academy of Sciences of the USA

7450–7453 � PNAS � May 9, 2006 � vol. 103 � no. 19 www.pnas.org�cgi�doi�10.1073�pnas.0602259103

Dow

nloa

ded

by g

uest

on

July

19,

202

0

(1%; 1 of 100). Among children born during the 1990s, theoverall erythrovirus genoprevalence was low (4%; 3 of 69), andall were of virus type 1.

In the sera collected during 1983–1997 from patients with avariety of symptoms, erythrovirus DNA was detected in 17% ofthe serum pools. According to both melting curve analysis andtype-specific PCR, all of the findings were of virus type 1,whereas virus types 2 and 3 were absent from all of the 1,640 sera.

In the literature, the recently discovered erythrovirus variants(types 2 and 3) have been encountered infrequently. Of 120,000Danish and 140,000 Finnish contemporary blood donors, many hadvirus type 1 in plasma, but none had type 2 or 3 (13, 18). Also, inthe sera of symptomatic European patients, the occurrence of virustype 2 has been sporadic (9, 13–16). Furthermore, in plasma-derived coagulation factor concentrates, type 2 DNA has beendetected rarely, yet more often in older preparations (37). Virustype 3 was recently encountered, at a low level, in blood donorsamples from Ghana, but not from Malawi, South Africa, or theUnited Kingdom (38). Occasional French or Brazilian patientscarried virus type 3 in their blood or bone marrow (14, 17).

Our approach to investigate single-stranded DNA virus genomesnaturally stored in live human tissues, with storage capacity hereshown to extend over decades, permitted us to view lifelongvariations in the circulation of the three virus types. We found that

the ‘‘new’’ variant (virus type 2) is, in fact, ‘‘older’’ than theprototype (virus type 1); the subjects persistently carrying theformer were born on average 20 years earlier than those carryingthe latter. Therefore, assuming for virus type 2 preferential acqui-sition during childhood and adolescence, as holds for the virusprototype (39, 40), both types have circulated in Northern andCentral Europe widely, and in equal frequency, from the 1930s tothe 1950s. However, type 2 appears to have disappeared from widecirculation by the 1970s and remained absent thereafter, as con-firmed by our patient sera drawn during the 1980s and 1990s. Theabsence of virus type 3 from the samples studied (220 tonsils and1,640 sera) rules out widespread occurrence of this variant inNorthern Europe for the past �70 years. The occurrence of virustype 3 endemically in Ghana (38) and occasionally in the twoWestern countries (France and Brazil) with a significant influx ofpeople of West African origin (14, 17) is in line with the absence oftype 3 DNA from the tissues and sera of our Nordic population withonly small-scale African immigration.

An entirely different explanation for the occurrence of DNA ofvirus type 2 exclusively among the elderly could be their selectivesusceptibility for primary infections of this type, as opposed to thepreferential susceptibility of children and young adults for theprototype virus (39, 40). However, such an ‘‘inverse chronologicaltropism’’ is highly unlikely because it (i) would imply continuedcirculation of virus type 2, a condition ruled out by the presentstudy; and (ii) has not been disclosed for any human virus known.

Indeed, our data indicate that human tissues possess, regard-ing the genomes of single-stranded DNA viruses, a storagemechanism of lifelong (�70 years) capacity. For this concept, wepropose the term Bioportfolio.

Because of the absence of type 2 genomes from both the seraand tissues of the recent decades, the Bioportfolio cannot bemaintained by exogenous replenishment (reinfection). Also, thefact that the genoprevalence of erythroviral DNA was notdiminished in the older generations (Fig. 1) points to extremepermanence in human tissue, either since primary infection or byendogenous replenishment. Should the latter storage mecha-nism be operational, it would need to be nonviremic and

Table 1. Numbers of tissue samples and serum pools studied andof erythrovirus types (DNA) found

Tissue

Genotype

Negative Total1 2 3

Skin 43 (31) 24 (17) ND 73 (52) 140Synovia 30 (35) 7 (8) ND 49 (57) 86Tonsil 36 (16) 3 (1) 0 (0) 181 (82) 220Liver 25 (32) 24 (31) ND 28 (36) 77Serum pools 28 (17) 0 (0) 0 (0) 136 (83) 164

ND, not determined. Numbers in parentheses are percentages.

Fig. 1. Altogether, 303 samples of skin, synovium, or liver were assayed for DNA of erythrovirus types 1 and 2, and 220 samples of tonsil were assayed for DNAof erythrovirus types 1, 2, or 3. The DNA findings were plotted according to the corresponding year of birth, and the arithmetic mean of which for virus type1 was 1965 and for virus type 2 was 1945. Virus type 3 was not found.

Norja et al. PNAS � May 9, 2006 � vol. 103 � no. 19 � 7451

MIC

ROBI

OLO

GY

Dow

nloa

ded

by g

uest

on

July

19,

202

0

nontransmitting, as shown by the absence of virus type 2 fromour sera over the past two decades and from the tissues of theyoung. On the other hand, lifelong DNA persistence without anyreplication is not entirely easy to envision, in light of the rapidityof in vivo turnover of human cells of most types (41). Indeed,exceptionally slow erythrovirus DNA replication was recentlydocumented in a nonerythroid human cell line (42). In light ofthe infrequency of human parvovirus reinfections in general,virus types 2 and 3 have been encountered in blood of immu-nodeficient individuals conspicuously often (13, 14, 16, 17),suggesting that they might have been released from tissuepersistence. In accordance with this view, the maintenance of theBioportfolio could involve a dynamic interplay between viralreplication and the immune surveillance of the host, as has beendiscussed for the occasional erythrovirus persistence in blood(38, 10). We nevertheless believe that an immunological differ-ence does not explain the restrictive occurrence of type 2 viralDNA in tissues of the elderly because of the similarity among thethree virus types (15, 43) and the paucity of viremic (15, 16) type2 infections during recent years, as shown here.

Because of its remarkable longevity, the Bioportfolio hasinteresting potential utilities. As shown here, at the level of anindividual patient, it provides a lifelong registry of one’s infec-tious encounters. At the global and epidemiological level, itprovides a database for analysis of the occurrence and circulationof viruses and their variants. Moreover, in light of the wellpreserved integrity and full-length coding potential of the per-sistent macromolecular viral DNA genomes (27), the Bioport-folio might provide the desired long-term permanence for genetherapy vectors, which, in the future, could be designed inaccordance with this innate characteristic of the human body.

MethodsTissue and Serum Samples. Biopsies of synovial tissue (n � 86)were obtained in Finland during arthroscopy from healthy adults(birth year range, 1931–1992; mean � SD, 1964 � 15) with jointtrauma and simultaneously from skin of the arthroscopy woundedge (hereafter referred to as skin–synovial tissue pairs). Biop-sies of skin (n � 54) were obtained from patients with B19-unrelated dermatological lesions and from healthy hospital orlaboratory staff (range, 1913–1991; mean, 1951 � 19). Biopsiesof tonsillar tissue (n � 220) were obtained during tonsillectomy

from patients (range, 1929–2000; mean, 1979 � 15) with ton-sillitis or tonsillar hypertrophy (44).

Biopsies of liver tissue (n � 77; range, 1915–1981; mean, 1948 �14) were collected in Germany for diagnostic purposes and treatedas described in ref. 26. Of these tissues, 53 had been testedpreviously for virus type 1 (26) and were studied here for virus type2. Additionally, 19 specimens were obtained in transplantation fromthe explanted livers and 5 from diagnostic biopsies.

The study included 1,640 sera (donor birth year range, 1907–1993; mean, 1966 � 19) collected in Finland for virus diagnosis. Thespecimens comprised (i) 1,393 sera collected during 1983–1997from 1,393 patients with rash, fever, or other constitutional symp-toms, initially studied with negative results for rubella and measles(45), Sindbis virus (46), or hantavirus disease (47); and (ii) 247 seracollected during 1992–1993 from 247 patients with serologicallyconfirmed erythema infectiosum (48, 49). The sera were studied inpools of 10 (10 �l each), taking 20 �l per pool for DNA purification.

Plasmid Clones. The plasmid clone of virus type 1 (nucleotides180-5416) has been described by Brunstein et al. (50). Virus type2 from skin was amplified in five overlapping areas by PCR andcloned (18). After several restriction and ligation steps, a singleclone covering nucleotides 202-5147 was constructed. Virus type3 clone (AJ249437) covering nucleotides 282-5314 was kindlyprovided by A. Garbarg-Chenon (51). These clones were usedfor validation of and as positive controls in the PCRs. Nucleotidenumbering is according to the GenBank sequence AY504945.

DNA Purification and PCR. DNA from the skin biopsies, the skin–synovial sample pairs (collected before 2003), and from the serumpools was isolated by proteinase K digestion followed by phenol–chloroform extraction and ethanol precipitation and finally wasresuspended into 20 �l of water. DNA from the tonsillar and liverbiopsies and from the skin–synovial tissue pairs (collected from2003 to date) was isolated with the QIAamp DNA Mini kit (Qiagen,Hilden, Germany). All of the DNA preparations were studied byPCR undiluted and at 1:10 dilution.

As shown in Table 2, the DNA preparations from skin,synovia, tonsils, and sera were studied first by nested or non-nested VP1-PCRs detecting all three virus types. The prepara-tions from liver were studied for virus type 1 with nested PCRas described in refs. 37 and 53. In the PCR-positive dermal,synovial, liver, and serum preparations, virus type 2 was iden-

Table 2. PCR primers used and their ability to detect erythrovirus types

PCR PrimersVirus types detectable

(sensitivity) Skin Synovium Tonsil Liver Serum

Non-nested VP1-PCR (52) p6: GGAGAATCATTTGTCGGAAG 1, 2, and 3 (5 DNA X Xp5: AGGCTTGTGTAAGTCTTCAC copies each)*

Nested VP1-PCR (24) p6: GGAGAATCATTTGTCGGAAG 1, 2, and 3 (15 DNA X Xp3: CTTCTGCAGAATTAACTGAAGTC copies each)p8: TGTGCTTACCTGTCTGGATTG

p5: AGGCTTGTGTAAGTCTTCAC

Nested K71-PCR (12) of: TTTACTGAAGACAAATGGAAGT 2 (1.5 DNA copies) X X X X Xor: CACTGGGACAGTTTTGGCAATA

if: AGTGGATTTCAATCAATATACA

ir: TCATAATTTTGGCATAATAATAG

Genotype 1 PCR (53) p1: AATACACTGTGGTTTTATGGGCCG 1, 3 (1.5 and 15 Xp6: CCATTGCTGGTTATAACCACAGGT copies, resp.)p2: AATGAAAACTTTCCATTTAATGATGTAG

p5: CTAAAATGGCTTTTGCAGCTTCTAC

Real Art Parvo B19 LCPCR (18)

VP1 area 1, 2, and 3 (5 DNAcopies each)†

X X

*For the type 3 variant D91.1., 500 DNA copies.†For the type 3 variant D91.1., 5,000 DNA copies.

7452 � www.pnas.org�cgi�doi�10.1073�pnas.0602259103 Norja et al.

Dow

nloa

ded

by g

uest

on

July

19,

202

0

tified by the K71-PCR (12). Virus types 1, 2, and 3 in theVP1-PCR-positive tonsillar and serum preparations were dis-tinguished by the Real Art Parvo B19 LC PCR (Artus, Hilden,Germany) followed by melting curve analysis (18). Besidesidentification, the method quantifies the three virus types.

The detection sensitivities of all five of the PCRs were examinedwith the plasmid clones in a series of 10-fold dilutions and withconstant template volumes of 1.5 and 5 �l for the nested andnon-nested PCRs, respectively. All of the PCRs were observed toamplify their corresponding targets at a very high efficiency andwith detection sensitivities within 1 log (Table 2). This finding, alongwith the highest sensitivity of the K71-PCR for virus type 2, rulesout the possibility of a detection artifact caused by differences insensitivity between detection of genotype 1 and 2 in tissues withvery low viral load. Because of the high sensitivity of all of the PCRs,stringent precautions were taken to avoid contamination. As before(12, 24, 26), the samples and PCR mixtures were handled underlaminar flow hoods in separate rooms, using disposable racks andaerosol-resistant tips. Water was used as a negative control duringDNA isolation and in each PCR run.

DNA Sequences and Statistical Analysis. For additional confirma-tion of virus typing, some of the PCR amplicons of this study (all

from the livers) were sequenced by cycle sequencing at theHaartman Institute (University of Helsinki) core facility or theInstitute of Medical Microbiology, Immunology, and Parasitol-ogy (University of Bonn), with ABI BigDye Terminator kits(Applied Biosystems). The reactions were run on an ABI 3100capillary sequencer or ABI PRISM 3130 Genetic Analyzer,respectively.

Statistical analysis was performed with STATXACT (Cytel, SanDiego) with a linear-by-linear trend test.

The tissue samples were obtained with informed consent, andthe studies were approved by the Ethical Committee of theHelsinki University Central Hospital.

We thank the many volunteers for participation in this study; Heidi Bondenand Helena Service for cloning; Lea Hedman, Laura Pukkila, MariaPesonen, Sesilja Aranko, and Ulrike Reber for assistance with the clinicalsamples; Seppo Sarna for statistical analysis; and Malcolm Richardson forlanguage revision. The study was supported by Commission of the EuropeanCommunity Grant QLK2-CT-2001-00877, Finnish Academy Project 76132,the Jenny and Antti Wihuri Foundation, the Medical Society of Finland(FLS), the Finnish Technology Advancement Fund, and the HelsinkiUniversity Central Hospital Research and Education Fund.

1. Siegl, G., Bates, R. C., Berns, K. I., Carter, B. J., Kelly, D., Kurstak, E. &Tattersall, P. (1985) Intervirology 23, 61–73.

2. Deiss, V., Tratschin, J. D., Weitz, M. & Siegl, G. (1990) Virology 175, 247–254.3. Weigel-Kelley, K. A., Yoder, M. C. & Srivastava, A. (2003) Blood 102, 3927–3933.4. Kaufmann, B., Simpson, A. A. & Rossmann, M. G. (2004) Proc. Natl. Acad. Sci.

USA 101, 11628–11633.5. Ozawa, K., Kurtzman, G. & Young, N. (1986) Science 233, 883–886.6. Musiani, M., Zerbini, M., Gentilomi, G., Plazzi, M., Gallinella, G. & Venturoli,

S. (1995) J. Infect. Dis. 172, 1360–1363.7. Knoll, A., Louwen, F., Kochanowski, B., Plentz, A., Stussel, J., Beckenlehner,

K., Jilg, W. & Modrow, S. (2002) J. Med. Virol. 67, 259–266.8. Lindblom, A., Isa, A., Norbeck, O., Wolf, S., Johansson, B., Broliden, K. &

Tolfvenstam, T. (2005) Clin. Infect. Dis. 41, 1201–1203.9. Enders, M., Schalasta, G., Baisch, C., Weidner, A., Pukkila, L., Kaikkonen, L.,

Lankinen, H., Hedman, L., Soderlund-Venermo, M. & Hedman, K. (2006)J. Clin. Virol. 35, 400–406.

10. Lefrere, J.-J., Servant-Delmas, A., Candotti, D., Mariotti, M., Thomas, I.,Brossard, Y., Lefrere, F., Girot, R., Allain, J.-P. & Laperche, S. (2005) Blood106, 2890–2895.

11. Hemauer, A., von Poblotzki, A., Gigler, A., Cassinotti, P., Siegl, G., Wolf, H.& Modrow, S. (1996) J. Gen. Virol. 77, 1781–1785.

12. Hokynar, K., Soderlund-Venermo, M., Pesonen, M., Ranki, A., Kiviluoto, O.,Partio, E. K. & Hedman, K. (2002) Virology 302, 224–228.

13. Nguyen, Q., Wong, S., Heegard, E. & Brown, K. (2002) Virology 301, 374–380.14. Servant, A., Laperche, S., Lallemand, F., Marinho, V., De Saint Maur, G.,

Meritet, J. F. & Garbarg-Chenon, A. (2002) J. Virol. 76, 9124–9134.15. Blumel, J., Eis-Hubinger, A. M., Stuhler, A., Bonsch, C., Gessner, M. & Lower,

J. (2005) J. Virol. 79, 14197–14206.16. Liefeldt, L., Plentz, A., Klempa, B., Kershaw, O., Endres, A. S., Raab, U.,

Neumayer, H. H., Meisel, H. & Modrow, S. (2005) J. Med. Virol. 75, 161–169.17. Sanabani, S., Neto, W. K., Pereira, J. & Sabino, E. C. (2006) J. Clin. Microbiol.

44, 604–606.18. Hokynar, K., Norja, P., Laitinen, H., Palomaki, P., Garbarg-Chenon, A., Ranki, A.,

Hedman, K. & Soderlund-Venermo, M. (2004) J. Clin. Microbiol. 42, 2013–2019.19. Baylis, S. A., Shah, N. & Minor, P. D. (2004) J. Virol. Methods 121, 7–16.20. Jones, M. S., Kapoor, A., Lukashov, V. V., Simmonds, P., Hecht, F. & Delwart,

E. (2005) J. Virol. 79, 8230–8236.21. Allander, T., Tammi, M. T., Eriksson, M., Bjerkner, A., Tiveljung-Lindell, A.

& Andersson, B. (2005) Proc. Natl. Acad. Sci. USA 102, 12891–12896.22. Lopez-Bueno, A., Mateu, M. G. & Almendral, J. M. (2003) J. Virol. 77,

2701–2708.23. Shackelton, L. A., Parrish, C. R., Truyen, U. & Holmes, E. C. (2005) Proc. Natl.

Acad. Sci. USA 103, 379–384.24. Soderlund, M., von Essen, R., Haapasaari, J., Kiistala, U., Kiviluoto, O. &

Hedman, K. (1997) Lancet 349, 1063–1065.25. Cassinotti, P., Burtonboy, G., Fopp, M. & Siegl, G. (1997) J. Med. Virol. 53,

229–232.26. Eis-Hubinger, A. M., Reber, U., Abdul-Nour, T., Glatzel, U., Lauschke, H. &

Putz, U. (2001) J. Med. Virol. 65, 395–401.27. Hokynar, K., Brunstein, J., Soderlund-Venermo, M., Kiviluoto, O., Partio,

E. K., Konttinen, Y. & Hedman, K. (2000) J. Gen. Virol. 81, 1017–1025.

28. Kingsley, G. (1997) Lancet 349, 1038–1039.29. Soderlund-Venermo, M., Hokynar, K., Nieminen, J., Rautakorpi, H. & Hed-

man, K. (2002) Pathol. Biol. 50, 307–316.30. Takahashi, Y., Murai, C., Shibata, S., Munakata, Y., Ishii, T., Ishii, K., Saitoh,

T., Sawai, T., Sugamura, K. & Sasaki, T. (1998) Proc. Natl. Acad. Sci. USA 95,8227–8232.

31. Tolfvenstam, T., Papadogiannakis, N., Andersen, A. & Akre, O. (2002) J. Gen.Virol. 83, 2321–2324.

32. Wong, S., Young, N. S. & Brown, K. E. (2003) J. Infect. Dis. 187, 1581–1586.33. Mehraein, Y., Lennerz, C., Ehlhardt, S., Remberger, K., Ojak, A. & Zang, K. D.

(2004) Mod. Pathol. 17, 781–789.34. LaMonte, A. C., Paul, M. E., Read, J. S., Frederick, M. M., Erdman, D. D.,

Han, L. L. & Anderson, L. J. (2004) J. Infect. Dis. 189, 847–851.35. Poole, B. D., Karetnyi, Y. V. & Naides, S. J. (2004) J. Virol. 78, 7775–7783.36. Kuhl, U., Pauschinger, M., Noutsias, M., Seeberg, B., Bock, T., Lassner, D.,

Poller, W., Kandolf, R. & Schultheiss, H. P. (2005) Circulation 111, 887–893.37. Schneider, B., Becker, M., Brackmann, H. H. & Eis-Hubinger, A. M. (2004)

Thromb. Haemostasis 92, 838–845.38. Candotti, D., Etiz, N., Parsyan, A. & Allain, J. P. (2004) J. Virol. 78,

12169–12178.39. Nunoue, T., Okochi, K., Mortimer, P. P. & Cohen, B. J. (1985) J. Pediatr. 107,

38–40.40. Adler, S. P., Manganello, A. M., Koch, W. C., Hempfling, S. H. & Best, A. M.

(1993) J. Infect. Dis. 168, 361–368.41. Spalding, K. L., Bhardwaj, R. D., Buchholz, B. A., Druid, H. & Frisen, J. (2005)

Cell 122, 133–134.42. Munakata, Y., Kato, I., Saito, T., Kodera, T., Ishii, K. K. & Sasaki, T. (2006)

Virology 345, 251–257.43. Parsyan, A., Kerr, S., Owusu-Ofori, S., Elliott, G. & Allain, J.-P. (2006) J. Clin.

Microbiol. 44, 1367–1375.44. Chen, R. W., Waterboer, T., Leivo, I., Pawlita, M., Vaheri, A. & Aaltonen,

L. M. (2005) J. Clin. Microbiol. 43, 1408–1410.45. Davidkin, I., Valle, M., Peltola, H., Hovi, T., Paunio, M., Roivainen, M.,

Linnavuori, K., Jokinen, S. & Leinikki, P. (1998) J. Infect. Dis. 178, 1567–1570.46. Brummer-Korvenkontio, M., Vapalahti, O., Kuusisto, P., Saikku, P., Manni, T.,

Koskela, P., Nygren, T., Brummer-Korvenkontio, H. & Vaheri, A. (2002)Epidemiol. Infect. 129, 335–345.

47. Hedman, K., Vaheri, A. & Brummer-Korvenkontio, M. (1991) Lancet 338,1353–1356.

48. Soderlund, M., Brown, K. E., Meurman, O. & Hedman, K. (1992) J. Clin.Microbiol. 2, 305–311.

49. Soderlund, M., Brown, C. S., Cohen, B. J. & Hedman, K. (1995) J. Infect. Dis.171, 710–713.

50. Brunstein, J., Soderlund-Venermo, M. & Hedman, K. (2002) Virology 274,284–291.

51. Nguyen, Q. T., Sifer, C., Schneider, V., Allaume, X., Servant, A., Bernaudin,F., Auguste, V. & Garbarg-Chenon, A. (1999) J. Clin. Microbiol. 37, 2483–2487.

52. Soderlund, M., Ruutu, P., Ruutu, T., Asikainen, K., Franssila, R. & Hedman,K. (1997) Scand. J. Infect. Dis. 29, 129–135.

53. Eis-Hubinger, A. M., Sasowski, U., Brackmann, H. H., Kaiser, R., Matz, B. &Schneweis, K. E. (1996) Thromb. Haemostasis 76, 1120 (lett.).

Norja et al. PNAS � May 9, 2006 � vol. 103 � no. 19 � 7453

MIC

ROBI

OLO

GY

Dow

nloa

ded

by g

uest

on

July

19,

202

0