BIOTECHNOLOGYAKA DNA TECHNOLOGY

Biotechnology

Often referred to as genetic engineering, it’s basically how scientist and researchers manipulate genes.

Recall, DNA is the genetic material of all living organisms that carry genetic code that may code for proteins.

Genes from one kind of organism can be transcribed and translated (protein synthesis!) when put into another kind of organism.

For example, human and other genes are routinely put into bacteria in order to synthesize products for medical treatment and commercial use. Human insulin, human growth hormone, and vaccines are produced by bacteria.

First, What is………………• Recombinant DNA DNA from different sources sliced then

spliced together.• Called transgenic

• Plasmid Vector Circular, double-stranded DNA used to transfer genes into a host bacterial

• Viral Vector Harmless virus typically used in gene therapy

• Bacterial Transformation The host bacterium, such as E. coli, takes up the plasmid, which includes the foreign gene. Bacteria will replicate the foreign DNA along with their own DNA producing wanted protein such as human insulin

• Restriction Enzymes proteins that digest DNA at specific regions for preparation of bacterial transformation

Recombinant DNA– Insertion of a Functional gene from one organism into Bacterial Plasmid Transformation

*This process is pretty involved but here’s the basic idea

*Recombinant DNA Technology – Bacterial Transformation and Cloning of a target gene

*Insulin is created this way

First Step – “cut” DNA OF PLASMID VECTOR AND HUMAN (IN THE CASE OF INSULIN GENE) WITH THE

SAME ENZYME

EcoRI

** These enzymes, CALLED RESTRICTION ENZYMES, recognize a very specific, single palindrome nucleotide sequence.

** Palindromes are sequences that are the same forwards as they are backwards…like the word racecar

CTTAAG Backwards

CTTAAG Forwards

Step 1: A Restriction Enzyme Cleave DNA of Vector and Foreign

DNA Restriction enzyme (green guy called

EcoRI) recognizes nucleotide sequence specific to that enzyme

When it recognizes the palindrome, it cuts the DNA

ATTCGCGGAATTCATTACGCATCGTAAGCGCCTTAAGTAATGCGTAGC

ATTCGCGGTAAGCGCCTTAA

AATTCATTACGCATCG GTAATGCGTAGC

Restriction Enzyme

EcoRI

**The black letters represent the palindrome recognition site

** “Sticky” ends are created (the black letters) that stick out. This allows a gene, or other segment of DNA, to be inserted by base-pairing

Step 2. Inserting the Gene Into Bacterial Plasmid

Vector The human insulin gene is inserted at the “Sticky” ends of the plasmid at the palindrome through base-pairing

Another enzyme “glues” (ligates) them together

GAATTGCTAACTTACGCATGGCAATTCCTTAACGATTGAATGCGTACCGTTAAG

ATTCGCGGTAAGCGCCTTAA

AATTCATTACGCATCG GTAATGCGTAGC

Ligase

**The black letters represent the binding site of the plasmid

**The yellow letters represent the gene for human insulin (of course it is much larger than this, you get the idea!). The white letters are just the restriction site.

Step 3. Host Cell (E. coli here) Takes Up The Plasmid Vector

*NOTICE…Plasmid vector also carries a gene that makes them resistant to ampicillin, an antibiotic that kills bacteria!! This is important in the next step, cloning and the production of insulin!!

Step 4. Bacteria Growth ??

**Bacteria are spread out on petri dishes that contain a medium (food) and ampicillin. (or other antibiotic) They grow, creating clones of themselves.

**No growth..bacteria were killed by ampicillin thus contained NO vector and NO insulin gene

**Growth!! Bacteria were ampicillin resistant thus contained the vector that carried the insulin gene!!

Step 5. Collecting Cloned Product

**Those colonies that contain plasmid vector are allowed to grow, cloning themselves. As they do so, the gene for insulin is expressed (protein synthesis!!!) thus the protein is produced. Eventually, the crude protein can be extracted, purified and you’ve got insulin!

**This is done on a much wider scale than we’ve learned here. Pharmaceutical companies produce enough insulin for millions of Americans who have insulin-dependent diabetes.

In Summary……

** “Slice” a gene from a donor and “Splice” it into the vector…bacteria in this illustration, but viruses can be used too!!

PCR – Performed before gel electrophoresis

Artificial “cloning” of DNA strands in a machine called a thermocycler

Heat separates the DNA strands from each other

Nucleotides (A,G,T,C) are added in reaction tubes Put into a PCR machine called a thermal cycler Added nucleotides find their compliments, and

millions of strands of DNA are cloned

GEL ELECTROPHORESIS

What is it?

Simply put, gel electrophoresis is a technique used to separate molecules such a DNA, RNA and proteins according to size (number of bases) Requires an electric current as these

molecules are negatively charged We’ll be looking at separating DNA

into strands of varying sizes to determine the sequence of a DNA fragment as well as determining DNA fingerprints

First, DNA is Extracted The same DNA is found in the nucleus of nearly all of

your cells (mature red blood cells have no nucleus). Mitochondrion have a totally different set of genes than what is in the

nucleus. You inherit them from your mother! Many studies use this DNA to determine how closely related different species of organisms are!

Nuclear DNA can be extracted from blood, cheek cells, hair follicles, tooth pulp or mostly any other tissue

There are quite a few protocols that use a variety of chemicals and buffers to isolate ONLY DNA and get rid of everything else

Restriction Enzymes

Long strands of DNA, restriction enzymes

Each enzyme recognizes different sites to cut

This results in many fragments of different sizes (number of bases long)

Prepare for gel electrophoresis

Power supply

Gel Chamber with buffer

After the gel cools and becomes jelly-

like, the comb is removed and is

placed in the chamber filled with

buffer

A compound called agarose is melted in a

buffer, poured into a mold and a tooth comb inserted

to create wells

Loading An Electrophoresis Gel

“running a gel”A loading dye (seen in

blue) is mixed with DNA sample and loaded into

a well

Electrical supply is turned on…DNA

fragments run through the gel from the

negative electrodes toward the positive

DNA Ladder (or size standard) is also loaded. This lets allows you to determine how

long each fragment is (in

kilobases)

The gel is stained and examined. The

smallest (shortest) fragments travel the farthest down the gel

DNA Sequencing in a Nutshell

DNA Sequencer (I used this one in grad school)

Reading an Electrophoresis Gel….DNA Sequence

Determine the sequence of bases in a gene, or DNA fragment…read from top to bottom

**This particular sequence is: ATGCTTCGGCAAGACTCAAAAAATA

**Notice it’s one stranded!

Longer Fragments at the Top, Smaller Fragment as the bottom

DNA FINGERPRINTS ARE UNIQUE TO EACH PERSON

Sequences That are Non-Coding

Can Be Used to Produce a DNA Fingerprint

ID of individuals ID of parents Crime scene applications

**Restriction enzymes cut DNA , fragments that contain repeats such as AGGTAGGTAGGT, over and over but the number of repeats differ among individuals. We can run these on a gel (CSI stuff) and see their DNA fingerprint!

Example of Fingerprint (Remember, these are not

genes)**Suspect 3’s Fingerprint is a perfect match of the blood stain!!!

Gel Electrophoresis uses an electric current. DNA fragments that have been cut by enzymes separate by size. The pattern gives you a “fingerprint”

+

-

ATTCGCGGTAAGCGCCTTAA

AATTCATTACGCATCG GTAATGCGTAGC

Largest Fragments

Smallest Fragments

Paternity A person should have ½ of their DNA fragments that match their mother, and ½ that match their father.

-

+

Mom

Child

AF1 AF3AF2The child received these fragments from its mother…

..which means that they must have received these from the father…

…so, which alleged father has the same size fragments as the child at these positions???

…So Alleged Father #2 is the father of the child.

Implications of Biotechnology

Lab Animals

• Mouse chromosomes are similar to humans’ chromosomes and used in many studies

Lab Organisms

• The roundworm Caenorhabditis elegans is another organism with well-understood genetics that is used for transgenic studies.

Lab Orgsanisms

• A third animal commonly used for transgenic studies is the fruit fly, Drosophila melanagaster

• Plants and animals that contain FUNCTIONAL foreign DNA from another organism are known as transgenic organisms

• Such as E. coli bacteria plasmid that contains the gene for human insulin.

Genetically Engineered (slice and splice) Transgenic Organisms Contain

Recombinant DNA

Genetically Engineered (slice and splice) Transgenic Organisms Contain

Recombinant DNA

Genetically Modified Foods

• Crops have been developed that are better tasting, stay fresh longer, and are protected from disease and insect infestations.

• Soybeans that contain a component that helps lower cholesterol

• Alfalfa that’s resistant to herbicides

Pros and Cons Pros:*More nutritious food*Tastier food*Disease- and drought-resistant plants that require fewer environmental *resources (water, fertilizer, etc.)*Decreased use of pesticides*Increased supply of food with reduced cost and longer shelf life*Faster growing plants and animals*Food with more desirable traits, such as potatoes that absorb less fat when fried*Medicinal foods that could be used as vaccines or other medications

Cons:*Modified plants or animals may have genetic changes that are unexpected and harmful.*Modified organisms may interbreed with natural organisms and out-compete them, leading to extinction of the original organism or to other unpredictable environmental effects.*Plants may be less resistant to some pests and more susceptible to others.

In Medicine

Transgenic bacterial used to produce insulin, hormones, antibodies, enzymes, vaccines…It’s crazy!

I Gots me a big ole rooster….

names Jethro

Other Genetically Modified Organisms (GMOs)

Transgenic Animals

Transgenic cattle were created to produce milk containing proteins that aid in the treatment of emphysema.

Transgenic Horses were once created to produce human insulin for diabetics; Now we us E. Coli

Mice that Glow

** insertion of a gene taken from coral and inserted it into the mouse genome

Mouse Growing a Human Ear

Meathead Salmon!!!

Featherless Chickens…No Plucking Necessary

Sheep Milk That Contains a Clotting Protein that is Isolated for People

with Hemophilia

Other Transgenics

Transgenic cattle were created to produce milk containing proteins that aid in the treatment of emphysema.

Transgenic Horses were once created to produce human insulin for diabetics; Now we us E. Coli

Hybrid Animals – Genetically Modified but

not Transgenic

Lion and Tiger hybrid

CLONING

Recall Bacterial Transformation

Transformed bacteria that contain a functional gene replicate creating millions of clones thus a lot of product (whatever the gene codes for)

Cloning of Entire Organisms

A clone is basically a copy of an organism that contains the same DNA…but, since the clone is carried by a surrogate organism, it won’t be exactly the same…

Dolly the sheep is the most famous cloned animal…although it took numerous tries!

What are the ethical aspects of cloning??

How it works…..

The Human Genome Project

Guide to Your Genome

Your genome consists of all of your DNA, collectively, found in most of your cells. We call this genomic DNA

Recall the mitochondria has its on Genes!!!

Consists of between 20-30 thousand genes

3 Billion bases!! (A, G, T and C)

Genome Project Uses

• Helped to create linkage maps shows relative location of genes

• DNA segments near each other on a chromosome tend to be inherited together

Prenatal diagnosis of human genetic disorders using amniocentesis (fluid drawn from pregnant female), use of gene therapy, vaccines, and development of new methods of crime detection

PCR, Gel electrophoresis, screening for drug resistance and diseases

Applications of the Human Genome Project

Genetic Disorder Diagnosis From the affected person, cells are

grown in a cell culture so that enough DNA can be obtained to run the necessary tests

Gene Therapy

The insertion of normal genes into an affected person in an attempt to correct genetic disorders

Gene Therapy of SCID, Severe Combined Immunodeficiency

syndrome Cell culture flask

Bone marrow cells

Bone marrow cell with integrated gene

Add virus with functioning SCID gene

Gene

Hip Bone