bld 430 notes
TRANSCRIPT
BLD 430 Notes 1/12/12 5:31 PM
Eukaryotic vs. Prokaryotic cells
Organization
o Prokaryotic have circular chromosome
Size of genome
o Eukaryotic is larger (3.5 billion BP for humans)
Cell walls
Nucleus
o Structure: contains DNA found on chromosomes, contained by
nuclear membrane made of phospholipids
o Organization
Finite packet per cells
o Features
Mitosis
Cell makes copy of itself
Stages
o 1) Interphase
o 2a) Early prophase
o 2b) Middle prophase
o 2c) Late prophase
o 3) Metaphase
o 4a) Early anaphase
o 4b) Late anaphase
o 5) Telophase
o 6) Restart with interphase
Cytoplasm and components not evenly split
Mitochondria has its own DNA
o Uneven split, diseases
Meiosis
Daughter cells have half of the DNA from the parent cell
Daughter = haploid
First 1 cell replicates its DNA, then it divides into 2 daughter cells
Ploidy
Chromosome copies
Haploid and diploid
Humans are (normally) diploid = 2n
Bigger chromosome: more genes
o Greater chance of defect if deleted vs a small chromosome
Ex) n, 2n, 2n+1, 2n-1, XXY
Basic genetics
Mendel
o Segregation
o Independent assortment
o Dominant and recessive
o Co-dominance
o Sex linked (XX or XY)
Phenotype: what you see/measure
Genotype: what is on the genes
Allele: variation of the gene that can show up
Loci: location of the gene
Do not do testing for genes with little/no variation
Punnett squares for prediction
Linkage
o Gene frequency
o Genes move through the population together
Higher chance when closer together on chromosome
o Recombination: part of chromosome gets stuck to another
chromosome; rare with HLA
Less recombination when more linkage/closer together
on chromosome
o Linkage disequilibrium: less than predictable movement of 2
genes because of linkage
No random segregation
o Lod scores
Log of the odds of 2 genes or genes/diseases being
linked
Magic lod number = 3
If it’s almost 3, sample a larger population
Lod of 3 = 1/1000 chance the genes are not linked
Normal distribution
Hardy-Weinberg equilibrium: rarely fits a real life scenario
o Assumptions
No natural selection advantage
Large population
Random mating
Multigenic traits
o Chronic diseases
o Many loci
Epistasis: influences of genes on one another
Pedigree diagrams
o Family tree
Nucleic Acid Chemistry
Molecules of life: nucleic acids
ACGT for DNA
ACGU for RNA
A and G are purines
C and T are pyrimidines
Double helix
o C and G form a triple Hydrogen bond
o A and T form a double Hydrogen bond
Central dogma
o DNA replicates
o then transcribes to RNA
o then translates to protein
Introns and exons: only exons read into protein
Prokaryotes have no introns
Splicing
Codons are 3 base pairs, give code for amino acid
Single-nucleotide polymorphism
AUG: Methionine is the start codon
3 stop codons
Code is redundant but not ambiguous
DNA code
o 5’ 3’ is the direction of reading
o Sense vs anti-sense
5’ 3’ is usually sense
Nucleic Acid Chemistry
Secondary structure
o Impacts lab diagnostics
o DNA binding back onto itself
o Hairpin loops
5’ ACGTACGTCCCCACGTGGGGACGT 3’
ACGT is the looped portion, CCCC binds with GGGG
o RNA: loop structures, tRNA
Oligonucleotides
o Short nucleic acid polymer/strand
o Can bind to DNA strand, in multiple locations
o Usually multiple strands floating around
o If oligonucleotides bind to one another, it renders useless as a
reagent and this is BAD, results in improper secondary
structure
Temperature of Melting (TM)
o DNA wants to bind to something via Hydrogen bonding
o Good estimation for short strands
o A and T = 2, C and G = 4
o Ex) ACGTATATCGTGCAGT
9(AT) = 18
7(CG) = 28
18 + 28 = 46 degrees Celsius
Mutations
Want to detect for disease prediction
Change in base pairchange in codonchange in amino
acidchange in proteinmutation
1) Point Missense: results in amino acid change
2) Silent Point Missense: no change in amino acid
3) Frameshift: single base pair insertion
4) Frameshift: single base pair deletion
5) Nonsense: premature stop codon
Nucleic Acid Isolation
Match isolation to assay needs
o DNA and RNA properties, high molecular weight for assay
Nucleic acid source = anywhere
o Preferred (except for tumors): peripheral blood
10-20 micrograms DNA per 1mL whole blood
o Buccal swabs = mouth cheeks, no RBCs
o Back of tooth near root area
o Fresh or frozen tissue, forensics
Main steps
o Cell lysis
o Partition away proteins and lipids from DNA
o Extract nucleic acids
Cell isolation
o Tissue samples
Fixed: needs deparaffinisation with hear or solvents
Fresh: easier to work with, dissociate cells
o Peripheral blood: remove RBCs
Membrane lysis
o Use SDS detergent (found in shampoo)
o Remove hemoglobin (protein)
o Disrupt lipid association
Protein removal
o Most proteins are enzymes (some destroy DNA)
o Use Proteinase K to render proteins nonfunctional and
partition them from DNA
Nucleic acid extraction
o Organic: old method
Phenol/chloroform: burns
Precipitate with alcohol (alcohol and salt pairing is key)
o Inorganic
Salt precipitation
Silica adsorption
Anion exchange chromatography
Isolating DNA (durable)
o Binding to silica or glass
Guandium tiocynate
Inhibit nucleases
Promotes binding
Eluate using low salt buffer
Uses gradients
o Magnetic isolation: popular
High throughput (6-384 samples, automated)
DNA binds to magnetic bead
Need to keep proper orientation/alignment of well/plate
Isolating RNA
o Splicing & infectious disease problems
RNA contains only exons, so it’s shorter than DNA
(introns + exons)
o RNA is delicate
o Rnases big problem
.1% DEPC blocks Rnase activity
Bake glassware at 150 degrees Celsius for 4 hours
Pretreat with .5M NaOH for 10 minutes
Contaminants
o Affects purity/quality
o From sample or environment
o Proteins: block assay enzymes = bad; slow the migration
o Lipids
o Carbohydrates
o Phenol if organic extraction used
Quality
o 260#/280# = unitless ratio
o 260 = true DNA optical density/peak absorbance
o 280 = 50% pure DNA absorbance
o Measure quality of DNA that comes out of isolation
o Want high molecular weight DNA for assays (instead of
sheared – electrophoresis)
o Ratio of 2 is 100% pure
Acceptable as low as 1.4, generally 1.8-2
Ratio over 2 indicates RNA contamination
o Mitochondrial DNA also isolated in addition to isolating
cellular/nuclear DNA
o Look at temperature and salt (sodium) concentration of assay
solution when adding DNA, as it wants to form secondary
structure
Nucleic Acid Isolation
Quantity
o Need X amount of DNA for given assay
o Spectrometry: OD#
o Fluorometry
o Spot on a gel against standards with ethidium bromide stain
o Spot on parafilm against standards with ethidium bromide
stain
o 1mL whole blood = 10-20mmg DNA
o OD260 of 1.0 = 50 micrograms/mL
o OD260 x 50mmg/mL x Dilution Factor = microgram/mL
Convert to microgram/microliter
THIS IS A CONCENTRATION: MAY NEED TO FIND
VOLUME THAT ASSAY REQUIRES
Storage
o DNA: short term = 4 degrees Celsius, long term = frozen
100mM tris or tris EDTA (TE)
Water
o RNA best frozen at -80 degrees Celsius
o Protect DNA from light and hydrolysis
o Avoid re-freezings
Example Problem
OD260 = .09
OD280 = .05
Dilution = 1/200
1) What is purity?
o .09/.05 = 1.8 good purity
2) What is concentration in microgram/microliter?
o (.09*50*200)/1000 = .9 microgram/microliter
3) Have 200 microliter stock, how much total DNA?
o .9ug/uL*200uL = 180 micrograms DNA
4) Assay needs 250ng DNA, how much to add?
o 900ng/uL = 250ng/X uL, X = .278 microliters
Enzyme Modification: from bacterial/biological enzymes, mimic environment
Ligase
o Single strand antisense DNA
o Oligonucleotides added as complement
o Ligase connects oligonucleotides together/closes gap
Polymerase
o Reads template and makes more DNA
o Start with single strand antisense DNA
o Elongates in the 5’3’ by adding complementary bases
o Runs until the template strand runs out
Adds an Adenosine at the end
Reverse Transcriptase
o Turn RNAcDNA
o RNA has poly-A tail
o Enzyme starts with poly-T
Binds, then runs 5’3’
Does not include introns
Restriction Endonuclease
o Cut within sequence
o Uses recognition sequence: specific DNA base sequence
o Cuts double stranded DNA into smaller segments
o Sticky and blunt ends/cuts
o # base cutter: lower number gives more cuts/bands
¼^base cutter #
4 base cutter would be ¼^4
o Bacteria use this as protective mechanism
o Segments allowed to reassemble, may get different order
Exonuclease
o Opposite of endonuclease
o Cuts its way in
o Moves down a strand and removes bases
o 5’ or 3’ exonucleases
Other
o Phosphatase: remove phosphate group
o Kinase: adds phosphoryl group, labeling, 5’ usually
o Terminal Transferase: adds bases to 3’, template independent
o Cleavase: cuts unbound flaps of DNA in artificial structure
Storage
o Avoid re-freezing
o Enzymes added in excess to avoid having the enzyme
be the limiting reagent
o Re-create environment that enzyme is found in (bacteria)
o Comes in glycerol
Need 1/10 dilution
Unit: how much enzyme to affect 1 microgram in 1 hour
Comes as Units/microliter
o Buffers
Need 1/10 dilution
Lab Math: Restriction Endonuclease Digest
Amounts of
o DNA
o Enzyme
o Buffer
o Water: dilution
o Adjust temperature: mimic bacterial environment; range
o Adjust time: do excess
Example 1
o Need to digest 5 micrograms DNA
o DNA stock is .1 micrograms/microliter
o Enzyme: EcoRI at 10 Units/microliter & assumed buffer is 10x
o Use 4 Units/microgram DNA
o How much of each reagent is needed in the test tube?
5 ugram / (.1 ugram/uliter) = 50 microliters DNA
5 ugram * 4 Units/ugram = 20 units enzyme
20 Units / (10 Units/uliter) = 2 microliters enzyme
Add 6 microliters buffer 60 uliter total volume
Add 2 microliters water
Example 2
o DNA stock is 1 microgram/microliter
o Need to digest 10 micrograms
o Enzyme is 6 units/microgram
o Enzyme stock is 40 units/microliter
o Buffer is assumed 10x
o How much of each reagent is needed in the test tube?
10 ugram / (1 ugram/uliter) = 10 microliters DNA
10 ugram * 6 units/ugram = 60 units enzyme
60 units / (40 units/uliter) = 1.5 microliters enzyme
Add 1.5 microliters buffer 15 uliter total volume
Add 2 microliters water
Example Problem
OD260 = .04
OD280 = .02
Dilution = 1/200
Digest 10 micrograms DNA with 4 unit/microgram enzyme EcoRI at
stock 4 unit/microliter; buffer assumed 10x
How much DNA, enzyme, buffer, and water to add?
o (.04 * 50 * 200) / 1000 = .4 microgram/microliter DNA
o 10 microgram/(.4 microgram/microliter)=25 microliter DNA
o 4 units/microgram * 10 micrograms = 40 units enzyme
o 40 units / (4 unit/microliter) = 10 microliters enzyme
o Minimum total volume: microliters of Enzyme * 10
Total volume: 100 microliters
o 100 micoliters total / 10x = 10 microliters buffer
o Make up the remaining difference with water: 55 microliter
Electrophoresis
Separate molecules by
o Size: LMW migrates more than HMW; migration is exponential
scale, origin
o Charge
o Secondary structure: acts like HMW, slinky
Matrices
o Agarose: protein, like jell-o
o Polyacrylamide: plastic, longs changes cross-linked (not fully)
Neurotoxin when liquid form
o Proprietary: secret
o Density in relation to separation/resolution
Best at middle of the gel
Location of fragments on gel relative to size
Formats
o Flat bed (submerged): agarose
o Vertical (sandwich): polyacrylamide
o Capillary: don’t set – stays liquid
Selection based on needs
o Size of interest
o Number of samples
o Range of resolution: mid-section of gel is best
o Method of detection
Process
o Cast: pour and wait at least 30min
Polyacrylamide: mix and polymerize
Agarose: melt then gel
o Load: including capillary
o Run/electrophorese
o Stain: to make visible
o Document
Running Buffer
o Tris acetic acid EDTA
o Tris boric acid EDTA
o Tris = buffer
o Acid = current source
o EDTA = chelate
o Made as stock then diluted
o Do not use water
Gel Loading
o Calculate volume to be loaded
Calculate volume of loading well, volume of comb
Agarose can have multiple combs
o Loading dye/buffer: colors and salt
Colors: HMW and LMW
Salt: dense, sinks in the wells
Usually 6x
o Total amount to load/5 = amount of dye (usually)
o Heat is bad for resolution
Less heat = less time, but less samples
Agar Example Problem (w/v)
Comb specific dimensions
How thick of a gel needed to load sample plus loading dye
Volume: 3 dimensions, given 2; 1 cm3 = 1mL
Comb dimensions
o .5 cm thick
o 1.5mm wide = .15cm
o ? cm depth
Dye is 6x
Want to load 120 microliters of sample and dye (100 sample, 20
dye) (from most recent example)
o .12 mL = .5cm * .15cm * ?cm
o Depth = 1.6cm: pour
How to make matrix
o Plate: 15cm by 15cm
o 1.6 cm * 15cm *15cm = 360 mL will hold exactly 120
microliters…(round to 400mL for added buffer)
o Need to know density of gel (.5-4%) (w/v)
Determines resolution
Denser = better resolution for LMW
o Gel is 1% = 1gram/100mL
Have 400mL, need 4 gram Agar
Buffer (TAE: 50x)
o V1C1 = V2C2
400mL * 1x = ? mL * 50x
8mL buffer
o 4 gram Agar, 8 mL buffer, 392 mL water
Polyacrylamide Example Problem (v/v)
Volume of well: 8cm * 7cm * .075cm = 4.2 mL
Density: 6-30% (w/v)
o Have 10% from 30% stock
Buffer TAE is stock 50x
How much water, buffer, and gel to add?
o Gel: 4.2mL(10%) = ?mL(30%) 1.4 mL Poly Gel
o 4.2ml * 1x = ? mL * 50x
.084 mL buffer
o 4.2 - .084 – 1.4 = 2.716 mL water
Also add Ammonium Persulfate and TEMED
Electrophoresis
Prepare gel
o Agar is w/v
o Poly is v/v
o Empirical calculations
Staining
o Smear: bad separation; not banded pattern
o Protein remains at origin
o Ethidium bromide: carcinogen, teratogen
Intercalates with DNA (perma-bond)
o SybrGreen: new, safer, no intercalation; grooves (dsDNA)
o Silver: more sensitive, can’t use agar; small fragments
Documentation
o Make assessments
o Digital picture
Capillary
o No stain or documentation
Already built in with lasers
o Looks like heart monitor read out
Pulsed Field
o Non-clinical
o For very big chunks of DNA: loop and break
Use hexagonal CHEF to help this issue
Done in .5% agar
Similar to mechanical shearing
BLD 430 Notes 1/12/12 5:31 PM
Electrophoresis
Denaturing Gels
o Formamide
o Temperature (melting)
Held constant
o Denature dsDNA ssDNA
o % formamide at which the dsDNA ssDNA
Based on temperature of melting per DNA sequence
o Large segments DNA
Single stranded conformational polymorphism
o Secondary structure
Heteroduplex
o Based on migration
RFLP
o Restriction fragment length polymorphism
o Using restriction endonuclease
o Cannot use for whole genomic
o Fragments are additive
Recovery of fragments
o Generate reagent
o Be careful with UV light on DNA stained with Ethidium
Bromide
o Diffusion
o Electrophoresis is not end point
Hybridization
Gel or blot
Get DNA onto solid medium: gels do not work well
Membrane
Plastic: never fully cross-link
Prepare gel for transfer
o Poor transfer using polyacrylamide
o Denature dsDNA to ssDNA with NaOH
o Break ribose backbone
Transfer
o Vacuum: negative pressue
o Capillary
o Positive pressure
Immobilize: permanent; storage
o Bake: vacuum
o UV: faster, crosslink
o Select size (basepairs) to transfer
Block non-specific binding
o Block open space
Block reactive side chains
o Non-fat dried milk
Actual hybridization with probe
o Probe is DNA RNA: made or bought
Stringency/annealing
o Want probe to bid with specificity: bind target
o Let all bind then wash away
o Let only the correct bind
o Sensitivity: detect small amount
o Specificity :
o Signal strength: trade off
Buffer
o Blocking agent: milk, etc.
o Dextran sulfate: help probe bind to target
o Salt: buffer, sodium
o EDTA: chelate Mg – cofactor in DNase
o SDS: detergent – reduce non-specific binding
o Reduce temperature per % formamide
o Higher Tm with more G-C, L = length
Example problem
o Digest 15 micrograms DNA with 4 unit/microgram EcoRI. DNA
stock is 2.5 microgram/microliter, enzyme stock is 5
unit/microliter, and buffer is assumed 10x. Comb is .5cm
by .15cm and gel thickness is .85cm. Will it fit?
o 15microgram / 2.5ug/uL = 6 microliters DNA
o 4unit/ug * 15 ug = 60 units / 5unit/uL = 12 microliters enzyme
o Minimum total volume is 120 microliters
o Buffer is 12 microliters
o Water is 90 microliters
o 120/5 = 24 microliters loading dye
o New total volume = 144 microliters
o .85cm * .5cm * .15cm = .06375 mL
Short by 80.25 microliters for the well NO FIT
o First digest with initial volume, then add loading dye for new
volume
o How to make fit
Make gel thicker
Increase enzyme concentration
Precipitate DNA then resuspend in smaller volume
Use vacuum
Hybridization
o Labeling of the probes
Isotopes: phosphorous
Isotopes track certain bases
Enzymes: like EIA
Digoxygenin: color/light emission
o Protocols
Southern: DNA-DNA
Northern: RNA-DNA or RNA-RNA
Western: Protein-Ab (not in DNA labs)
DNA-Antibody
RFLP: Restriction fragment length polymorphism
“Southern”
Original cut
Need high molecular weigh DNA
Assay depends on specific recognition sequence: different enzymes
RE cuts
o At site: stable, linkage
o Outside of site: tracking, less stable
No banding pattern without probe to track
o 2/21/12: Example Problem
Probes
Only track probe
Look where cuts are made
Best to bind probe directly on gene
Extra gene (3 copies) is trisomy; normal is 2 copies
o Can also lack gene copy
o Should get karyotyping
Different offspring
o Has different father than one shown in RFLP test
o Genetic mutation
o Pre-analytic error: retest
Cut may not occur or person can be missing loci
Problems with RFLP
o Stringency: sensitivity and specificity
Look at traditional steps to see if there was error along
the way
Based on temperature of wash
High: blank/few bands
Low: many bands
o Pattern not correlating with clinical picture: penetrance
Amplification: PCR
Second generation nucleic acid testing
Need correct combination of enzyme and probe
Faster than RFLP
Making copies of DNA
Primer: oligonucleotides
Template
o DNA
o RNA (need to make cDNA – reverse transcriptase)
RNA is only exons
Polymerase
o Taq = enzyme
o From hot springs: bacteria
Primers
o Flank the region of interest
o Want specificity
dNTPs
o Any of the deoxy nucleotides/bp
o dCTP fails first (stability)
o Stabiligy: dilute solution is bad
o dUTP used as contamination control or RNA preview
Buffer
o 10x
o Enzyme came from bacteria
Typical reaction
o Proportions of reagents are most important
o Most materials in excess: easier sensitivity
o Low fidelity = losing specificity
o Robustness = sensitivity
Cycling
o Denature: separate strands; 95 deg C
o Anneal
o Extension: 72 deg C
o 25-25 cycles
Plateau at 34-40 cycles when reagents deplete
o Area of interest between 2 primers
o First round/cycle gives long product
o 3 step cycle is typical
2 step: denature and elongate
If annealing and elongation temps are close
o Very robust system
Works well, may have contamination
Need a reagent blank
Put everything in the tube except template
Contamination from carry over or extra template
Inhibition
Hemoglobin
Inhibits enzyme
Turns brownish
Variations: control 1st denature cycle
Manipulate specificity and sensitivity
Initial first cycle starts at room temp
Ramping: time between moving between temps;
want shorter time
Hot start, touch down, UNG=weight control
contamination for infectious disease testing
o Detection: resolution
Electrophoresis
Small: polyacrylamide
Large: agarose
Spot product on membrane and probe
Look for single band
SSO/SSOP
SSP: makes specific probe; product or no product
Multiplexing
Multiple reactions in same tube
Worry about allelic dropout
Polymerase favors smaller product
SSP uses larger HMW as control
PCR alternatives
Ligase/OLA
TMA or SDA/NASBA
From microbacteria
Natural amplification, isothermal
Rolling circle amplification
Branched chain
Adding detection molecules
Hybrid capture
Synthetic probe
In situ hybridization
As it is placed
On tissue
Infectious disease; cytogenetics
Cleavease: way to detect mutation
MLPA: couples with OLA with amplification
Real-time PCR
Third generation
1/12/12 5:31 PM