Upload File

bu schraml et al. nature 000 , 1- 5 (2009) doi:10.1038/nature08114

  • Home
  • Documents
  • BU Schraml et al. Nature 000 , 1- 5 (2009) doi:10.1038/nature08114
1
BU Schraml et al. Nature 000, 1-5 (2009) doi:10.1038/nature08114 Loss of IL17 production in Batf –/– T cells.

Upload: halden

Post on 21-Jan-2016

26 views

Category:

Documents


1 download

Report

Tags:

DESCRIPTION

Loss of IL17 production in Batf –/– T cells. BU Schraml et al. Nature 000 , 1- 5 (2009) doi:10.1038/nature08114. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: BU Schraml et al. Nature 000 , 1- 5 (2009) doi:10.1038/nature08114

BU Schraml et al. Nature 000, 1-5 (2009) doi:10.1038/nature08114

Loss of IL17 production in Batf–/– T cells.

doi:10.1038/nature12886 Neanderthal from the Altai

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

DOI: 10.1038/NPHYS3211 Supplementary Information for

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Nature Biotechnology: doi:10.1038/nbt

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

17 September 2009 doi:10.1038/nature08355 LETTERS

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

doi:10.1038/nature06481 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo31

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

GI Motility online (May 2006) | doi:10.1038/gimo12

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

1 November 2007 doi:10.1038/nature06221 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo48

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

doi:10.1038/nature05202 LETTERS

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

DOI: 10.1038/ncomms1280 molecular dynamics of single

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

doi:10.1038/nature05150 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo6

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization