c e n t r e introduction to bioinformatics · 2008. 2. 12. · • bioinformatics and molecular...

56
Introduction to bioinformatics Lecture 2 Genes and Genomes C E N T R F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U E

Upload: others

Post on 28-Mar-2021

4 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Introduction to bioinformaticsLecture 2

Genes and Genomes

CENTR

FORINTEGRATIVE

BIOINFORMATICSVU

E

Page 2: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Organisational• Course website:

http://ibi.vu.nl/teaching/mnw_2year/mnw2_2008.phpor click on http://ibi.vu.nl(>teaching >Introduction to Bioinformatics)

• Course book:• Bioinformatics and Molecular Evolution by Paul G.

Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN (Pbk) 1-4051-0683-2

• Essential Bioinformatics by Jin Xiong, Cambridge University Press, 2006, ISBN 0521840988

• Lots of information about Bioinformatics can be found on the web.

Page 3: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

.....acctc ctgtgcaaga acatgaaaca nctgtggttctcccagatgg gtcctgtccc aggtgcacct gcaggagtcgggcccaggac tggggaagcc tccagagctc aaaaccccacttggtgacac aactcacaca tgcccacggt gcccagagcccaaatcttgt gacacacctc ccccgtgccc acggtgcccagagcccaaat cttgtgacac acctccccca tgcccacggtgcccagagcc caaatcttgt gacacacctc ccccgtgcccccggtgccca gcacctgaac tcttgggagg accgtcagtcttcctcttcc ccccaaaacc caaggatacc cttatgatttcccggacccc tgaggtcacg tgcgtggtgg tggacgtgagccacgaagac ccnnnngtcc agttcaagtg gtacgtggacggcgtggagg tgcataatgc caagacaaag ctgcgggaggagcagtacaa cagcacgttc cgtgtggtca gcgtcctcaccgtcctgcac caggactggc tgaacggcaa ggagtacaagtgcaaggtct ccaacaaagc aaccaagtca gcctgacctgcctggtcaaa ggcttctacc ccagcgacat cgccgtggagtgggagagca atgggcagcc ggagaacaac tacaacaccacgcctcccat gctggactcc gacggctcct tcttcctctacagcaagctc accgtggaca agagcaggtg gcagcaggggaacatcttct catgctccgt gatgcatgag gctctgcacaaccgctacac gcagaagagc ctctc.....

DNA sequenceDNA sequence

Page 4: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Genome sizeGenome sizeOrganism Number of base pairs

φX-174 virus 5,386

Epstein Bar Virus 172,282

Mycoplasma genitalium 580,000

Hemophilus Influenza 1.8 × 106

Yeast (S. Cerevisiae) 12.1 × 106

Human Human 3.2 3.2 ×××××××× 101099

Wheat 16 × 109

Lilium longiflorum 90 × 109

Salamander 100 × 109

Amoeba dubia 670 × 109

Page 5: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Four DNA nucleotide building blocks

G-C is more strongly hydrogen-bonded than A-T

Page 6: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

A gene codes for a protein

�������

� �

� �

�� ����������

�� ��� ����

CCTGAGCCAACTATTGATGAA

PEPTIDE

CCUGAGCCAACUAUUGAUGAA

Page 7: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

������������ ���������������

���������� ��������������

��������������

������

������������ �������������� �������������������

���������� ���������������������

������������������������� �������������

���������������������������������������

�������������������������� �!"�������

Page 8: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

����������������������������#�������$�#��������%

q ���� ����������������������������������������������������������� ��������

q���� �������������������������������������������������������� ��������

q����� �������������������� ���������������!����������������������������������

q����� �����������������������������������������!������������������������������������������������

q"� ����������������������������������������!���������������������������������������

q#��������������$�����$�����$������ �����

Page 9: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

!�&�������'�(��������#�������%

q ������� �����������������������������������%#&�����!��������������

q � �������������������������

q ����� �!��������������������������������������������������

q ������������������������������ ������������� ������

q ���������������� ���������������������������������������������������������� $���������������������������

Page 10: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

�������� ���������� ������

Page 11: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

DNA makes RNA makes Protein

… yet another picture to appreciate the above statement

Page 12: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Transcription Factors

mRNA transcription

TF binding site (open)

TF binding site (closed)

TATA

mRNA transcription

TF binding site (TFBS)

TATA

TF

Pol II

Transcription Factor (TF): protein that binds to DNA and to a polymerase (PolII)

Polymerase: complex protein that transcribes DNA into mRNA

Transcription factor –polymerase interaction sets off gene transcription…

… many TFBSs are possible upstream of a gene

Nucleosomes (chromatin structures composed of histones) are structures round which DNA coils. This blocks access of TFs

Page 13: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

)��� ����������'����������

q %�������������'(�(((�) '*�(((��������������������������+�,-�������������

q �����������������������+�.�(((���

q ����������*!/�������������

q ���������������������+�'((���

q �����������������������+�'(((���

q .-������������������������������

q "��������������������������0���,���

Page 14: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

�*��'����������&�+��'���������

q %�����������1������������������2�$�����������������3� ���������������� ����� $�������� ����4��1���� ����5

q %��������������������������� �����������������6����7����+�'�8������ ������9:�����

q ;!���1������������������������������� ��

q %�������������������!� �� ��2����������1��!� �� �42��

q �������!� ��������������$�����������!�������

4��1��!� ��������������� ��$�3��������5! �������

�����������������������������

��������� �������� ����� �

Page 15: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

�����������#�������

q ������������������� ����

q <��������������������,��������

��������

��������

Page 16: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

�����������#���������,�

q ����������������*������ q ����� ���� �����������������!������=����!>���1�������

=���������>���1$�0:*,�

Page 17: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

�����������#����'����$�������

q ���������$����������

�����������$�

������������

�'6!��� �����������$�

������������

�'6!��� ��� ������ ���!

��������$����������

q �������������������

�!�!��!�*

ü ��?��� ������������@���?������������ �AB!���������

����'6 �������

ü ������� #�������������������*6!,6C�,6!*6���������*6!,6�

ü ����?��$�D$�>$�� @�����?��$�D$�>$�-

Page 18: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

)�%

��� ���

Page 19: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

)��������� �����$�������

q >!D����������������������������������!%���!E���������������������

q ,��������������������������������� �� �����������

q "���������������������������������D!>�����������������������������D>�������������������������������

������������� �$�����!��������������

Page 20: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN
Page 21: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

TAA, TAG, TGA Stop Stop codons

CGT, CGC, CGA, CGG, AGA, AGGRArginine

AAA, AAGKLysine

GAT, GACDAspartic acid

GAA, GAGEGlutamic acid

CAT, CACHHistidine

AAT, AACNAsparagine

CAA, CAGQGlutamine

TGGWTryptophan

TAT, TACYTyrosine

TCT, TCC, TCA, TCG, AGT, AGCSSerine

ACT, ACC, ACA, ACGTThreonine

CCT, CCC, CCA, CCGPProline

GGT, GGC, GGA, GGG GGlycine

GCT, GCC, GCA, GCG AAlanine

TGT, TGCcCysteine

ATGM,

StartMethionine

TTT, TTCFPhenylalanine

GTT, GTC, GTA, GTGVValine

CTT, CTC, CTA, CTG, TTA, TTGLLeucine

ATT, ATC, ATA IIsoleucine

DNA codons

Single Letter Code

Amino Acid

Page 22: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

��������������������

q 4������������������������DF>��������������������F%����������������������������������������

q %���D>!�������������������������������� �������� ��������

q B��� DF>��������������������������������������� �!����� ��������� ������9'-

G�DF>�������������������������!���� �+'(-�

q A��������������

*(-�������������������������

,/-"�� ���!������������������

,.- ����������� ��#���� � �����

Page 23: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

.�������#�������*�������� ������

q H������������� ����� ����3>����������5�

q ������$����������$���������� ����������>����9�

q " ������

q <������������������������������������������

q �����������������

q ��������� ��������

q ��������������� ������������������������������

/01000

/1000,01000

Page 24: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

������� ��������,�

q D�����������>#%���� ��������������������������������������������

q >#%���������4>���% !���������������������������������������% �����

q %������������������������������������������$���������$������������������$��������$��������������������������������������������

q >#%�������������������������>�!���������������������������������������������$������$���������$����������������$�����������������$������1���

Page 25: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

������� ��������/�

q >#������>#%������,!������������������������*(.�� �������08.(��� �������������������>�! ��������

q ������������������<��������������������<���������������������������������������

%��������#*(.�������������������������

�������� ��������������%����������� �I�������

�����������������*(9������������������

������������%>������%%����������������

����������������������������������������>#%�������������������"��������0:::���

%����������2�������4�0�� �4������������0�4�������������� ������<������������&&����������������

Page 26: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

2��3����������������#�����

����������%

q E���1�������������������������������������$����������������������������������������������������������������������J������

q %���������������1���������������������������������������������������� ����$�� ����$������ ���4$���������������������������������

q �������������������$����������������������������������������$��������������������������������� �����

q %��������� ����������������������������������������������������������������������������������������������������������������������������������� �����%�������5��#B ���������

q I������$������������������������������������������� ���������������

Page 27: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

�'����#��������������������� �#�����'������

�������*��$��1��$��1�4$��

� ����*��$��1��$��1�4$��

)����$ ��������#���� ��1�����#�4$ ��

Page 28: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

��6����#��������(��

Page 29: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

7������'����������8�������������#�

#�����'���"

q %��������������K�������������������������������� �����������������

ü B ��������������������!�������

ü B ��������������������������������1���

��

��

��

��

�������� �������

������� �������

Page 30: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

������ ����#�����'���"

q % ����

��K���������������

������������������

���'�$'��#�#�'���"

)'�����#����#

q % ���4

��K���������������

���'�$'��#�#�'���"

2�����#��'��

q % ���L

������������������

2� �$'��#�#�'���"

2�������#��'�����

Page 31: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

)���#��������������� ������������#�

q ��������������� �������������

q ������������� ������������������������������������������������������� ��������������������������

q ��������������������� �����������1����������

q ����������������� ��������4!���$��������������������������!����

q ��������������������������

Page 32: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

����$���)���#��������������

q >����������

q %�����������������

q "����������

$��%�� ��!����

"�����M����������������0:::��$������ ��������&����%� 9$�.*8�! .*:

Page 33: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

����)���#��������������

q ��������1��� q >������������� �������

"�����>������=����� ���K���D��������$����#��������1���$�N��#���0::,��%B<�����=A�G���>���"������B�����G������ � ������

0/"����� "������ �"�������4�������'��������� ����

Page 34: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

/������������ �����*

����� ��$��������������

q "������ ��������������������������

q %������ ���������������

Page 35: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

/������������ �����*

�������$��������������

q "������ ����������������������0/"�

q %������ ��������������������������

Ban et al., Science 289 (905-920), 2000

Page 36: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

/������������ �����*�������������

q "������ ���������������!������������

q %������ ���������������!������������

Page 37: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

)��������������������%

q 4���!������������������7���

q E�!������������������������������7�

q ,�������������������������������1������������

Page 38: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Three main principles

• DNA makes RNA makes Protein

• Structure more conserved than sequence

• Sequence Structure Function

Page 39: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

How to go from DNA to protein sequence

A piece of double stranded DNA:

5’ attcgttggcaaatcgcccctatccggc 3’3’ taagcaaccgtttagcggggataggccg 5’

DNA direction is from 5’ to 3’

Page 40: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

How to go from DNA to protein sequence

6-frame conceptual translation using the codon table:

5’ attcgttggcaaatcgcccctatccggc 3’

3’ taagcaaccgtttagcggggataggccg 5’

So, there are six possibilities to make a protein from an unknown piece of DNA, only one of which might be a natural protein

Page 41: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Remark

• Identifying (annotating) human genes, i.e. finding what they are and what they do, is a difficult problem– First, the gene should be delineated on the genome

• Gene finding methods should be able to tell a gene region from anon-gene region

• Start, stop codons, further compositional differences

– Then, a putative function should be found for the gene located

Page 42: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Dean, A. M. and G. B. Golding: Pacific Symposium on Bioinformatics 2000

Evolution and three-dimensional protein structure information

Isocitratedehydrogenase:

The distance fromthe active site(in yellow) determinesthe rate of evolution(red = fast evolution, blue = slow evolution)

Page 43: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Genomic Data Sources

• DNA/protein sequence

• Expression (microarray)

• Proteome (xray, NMR,

mass spectrometry)

• Metabolome

• Physiome (spatial,

temporal)

Integrativebioinformatics

Page 44: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Dinner discussion: Integrative Bioinformatics & Genomics VUDinner discussion: Integrative Bioinformatics & Genomics VU

metabolomemetabolome

proteomeproteome

genomegenome

transcriptometranscriptome

physiomephysiome

Genomic Data SourcesVertical Genomics

Page 45: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

DNA makes RNA makes Protein(reminder)

Page 46: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

DNA makes RNA makes Protein:Expression data

• More copies of mRNA for a gene leads to more protein

• mRNA can now be measured for all the genes in a cell at ones through microarraytechnology

• Can have 60,000 spots (genes) on a single gene chip

• Colour change gives intensity of gene expression (over- or under-expression)

Page 47: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN
Page 48: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Proteomics

• Elucidating all 3D structures of proteins in the cell

• This is also called Structural Genomics

• Finding out what these proteins do

• This is also called Functional Genomics

Page 49: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN
Page 50: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Protein-protein interaction networks

Page 51: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Metabolic networks

Glycolysisand

Gluconeogenesis

Kegg database (Japan)

Page 52: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

High-throughput Biological Data

• Enormous amounts of biological data are being generated by high-throughput capabilities; even more are coming– genomic sequences

– arrayCGH (Comparative Genomic Hybridization) data, gene expression data

– mass spectrometry data

– protein-protein interaction data

– protein structures

– ......

Page 53: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Protein structural data explosion

Protein Data Bank (PDB): 14500 Structures (6 March 2001)10900 x-ray crystallography, 1810 NMR, 278 theoretical models, others...

Bioinformatics databases grow exponentially…

Page 54: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Dickerson’s formula: equivalent to Moore’s law

Dickerson predicted that the Protein Data Bank (PDB) of protein three-dimensional structures would grow, starting with the first protein in 1960, as indicated by the above exponential growth function. On 27 March 2001 there were 12,123 3D protein structures in the PDB: Dickerson’s formula predicts 12,066 (within 0.5% -- not a bad prediction)!

n = e0.19(y-1960)

with y the year.

Page 55: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Sequence versus structural data• Structural genomics initiatives are now in

full swing and growth is still exponential.

• However, growth of sequence data is even more rapidly. There are now more than 600 completely sequenced genomes publicly available.

Increasing gap between structural and sequence data (“Mind the gap”)

Page 56: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN

Bioinformatics• Offers an ever more essential input to

– Molecular Biology– Pharmacology (drug design)– Agriculture– Biotechnology– Clinical medicine– Anthropology– Forensic science– Chemical industries (detergent industries, etc.)

This list is from a molecular biology textbook – so not a self-absorbed bioinformatician is saying this…