SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

CANCER

1Guangzhou Key Laboratory of Translational Medicine on Malignant Tumor Treat-ment, Affiliated Cancer Hospital and Institute of Guangzhou Medical University,Guangzhou 510095, China. 2Department of Lymphoma/Myeloma, Division ofCancer Medicine, and the Center for Cancer Immunology Research, Universityof Texas MD Anderson Cancer Center, Houston, TX 77030, USA. 3Department ofPhysiology and Pathology, Tianjin Medical University, Tianjin 300070, China. 4De-partment of Hematopathology, Division of Pathology and Laboratory Medicine,University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA. 5Depart-ment of Cancer Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, OH44195, USA. 6Department of Hematology, The Myeloma and Lymphoma Center,Changzheng Hospital, The Second Military Medical University, Shanghai 200085,China. 7Department of Systems Medicine and Bioengineering, Houston MethodistResearch Institute, Houston, TX 77030, USA.*These authors contributed equally to this work.†Corresponding author. Email: yiq@ccf.org (Q.Y.); jiyang@mdanderson.org (J.Y.)

Yang et al., Sci. Signal. 10, eaan6282 (2017) 12 December 2017

Copyright © 2017

The Authors, some

rights reserved;

exclusive licensee

American Association

for the Advancement

of Science. No claim

to original U.S.

Government Works

C-reactive protein promotes bone destruction in humanmyeloma through the CD32–p38 MAPK–Twist axisJing Yang,1,2*† Zhiqiang Liu,2,3* Huan Liu,2* Jin He,2 Jianling Yang,2 Pei Lin,4 Qiang Wang,5

Juan Du,6 Wencai Ma,2 Zheng Yin,7 Eric Davis,2 Robert Z. Orlowski,2 Jian Hou,6 Qing Yi5†

Bone destruction is a hallmark ofmyeloma and affects 80% of patients. Myeloma cells promote bone destruction byactivating osteoclasts. In investigating the underlyingmechanism, we found that C-reactive protein (CRP), a proteinsecreted in increased amounts by hepatocytes in response to myeloma-derived cytokines, activated myeloma cellsto promote osteoclastogenesis and bone destruction in vivo. In mice bearing human bone grafts and injected withmultiple myeloma cells, CRP bound to surface CD32 (also known as FcgRII) on myeloma cells, which activated apathway mediated by the kinase p38 MAPK and the transcription factor Twist that enhanced the cells’ secretionof osteolytic cytokines. Furthermore, analysis of clinical samples from newly diagnosed myeloma patients revealeda positive correlation between the amount of serum CRP and the number of osteolytic bone lesions. These find-ings establish a mechanism by which myeloma cells are activated to promote bone destruction and suggest thatCRP may be targeted to prevent or treat myeloma-associated bone disease in patients.

Do

on May 17, 2019

http://stke.sciencemag.org/

wnloaded from

INTRODUCTIONMore than 80% of patients with multiple myeloma (MM) develop bonedisease or destruction that causes pathological fractures, severe bonepain, spinal cord compression, and hypercalcemia (1, 2). In healthyadults, bone is a dynamic tissue that is constantly being remodeled bybone-resorbing osteoclasts (OCs) and bone-forming osteoblasts. Inpatients withmyeloma, bone destruction results from increased OC-mediated bone resorption and decreased osteoblast-mediated boneformation. In particular, the resorbed bone that usually occurs inclose proximity tomyeloma cells is greatly enhanced and rarely heals(3). OCs arise from hematopoietic monocytic precursors. The for-mation of OCs requires the presence of soluble cytokines such as re-ceptor activator of nuclear factor kB (NF-kB) ligand (RANKL) andmacrophage colony-stimulating factor (M-CSF), which areproduced primarily from bone marrow stromal cells. Myeloma cellsenhance osteoclastogenesis by producing a number of cytokinessuch as RANKL, macrophage inflammatory protein–1a (MIP-1a),and monocyte chemoattractant protein–1 (MCP-1), which can in-crease OC differentiation and bone resorption activity (4, 5). How-ever, the mechanism underlying how and what activates myelomacells to produce these cytokines remains unknown.

C-reactive protein (CRP) is an ancient andhighly conserved proteinof the pentraxin family. It has five identical subunits forming a planarring that makes the protein highly stable. In healthy young adults, themedian concentration of CRP is 0.8 mg/liter, with a range of 0 to6 mg/liter, but after an acute-phase stimulus, values may increase

10,000-fold, from less than 50 mg/liter tomore than 500mg/liter (6). Plas-ma CRP is produced primarily in the liver, synthesized by hepatocytesin response to intermediary inflammatory cytokines such as interleukin(IL)–1b and IL-6. CRP can bind to a variety of ligands, including pneu-mococcal polysaccharides, membrane phospholipids, apoptotic cells,fibronectin, and ribonuclear particles (6). It also binds to C1q and di-rectly activates the classical complement cascade, or binds to Fc gammareceptors (FcgRs), leading to indirect (via classical complement) and di-rect opsonization (via FcgRs) (7). Through these mechanisms, CRPplays a direct role in a wide range of inflammatory processes andcontributes to innate host immunity (8).

Increased levels ofCRP are also present inmany diseases, includingmalignancies such as myeloma (9–11), lymphoma (12, 13), and carci-noma (14). High levels of circulating CRP correlate with poor prog-nosis in myeloma (9, 11) and lymphoma (12). Our previous studyshowed that CRP enhancedmyeloma cell proliferation under stressedconditions and protected myeloma cells from chemotherapy drug–induced apoptosis in a model of human myeloma (15).

Here, through a combination of in vitro, in vivo, and patient studies,we report that CRP has a unique role in myeloma-induced bonedisease. Our results show that human CRP binds to CD32/FcgRIIon myeloma cells, activates downstream signaling through the p38mitogen-activated protein kinase (MAPK) and the transcription factorTwist, and promotes the production of osteolytic cytokines from mye-loma cells, leading to enhanced myeloma cell–mediated OC differenti-ation and severe bone resorption in vivo.

RESULTSCRP promotes lytic bone lesions in myeloma-bearing miceTo determine the effect of CRP on bone destruction under physiolog-ical conditions, we injected human recombinant CRP, serum amyloidP component (SAP; an inactive analog of CRP), or phosphate-bufferedsaline (PBS) (vehicle) into tumor-free severe combined immuno-deficient (SCID) or SCID-hu mice in which the SCID mice were im-planted with human bone chips. None caused bone destruction inthe implanted human bones in the mice (Fig. 1A, left).

We then examined the effects of human CRP on bones in SCIDmice xenografted with human myeloma cells. CRP, SAP, or PBS was

1 of 10

SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

on May 17, 2019

http://stke.sciencemag.org/

Dow

nloaded from

injected into SCID-hu mice bearing primary human myeloma cellsor SCID mice bearing myeloma cell lines. Lytic bone lesions weredetected in the implanted humanbone chips of SCID-humice 8weeksafter tumor inoculation (Fig. 1A, right), whereas in mice injected withCRP but not SAP or PBS, lytic bone lesions were detected at week 4after tumor injection. CRP not only accelerated the appearance ofbone lesions but also caused more bone destruction, evident by thegreater number of lytic bone lesions (Fig. 1A, right), larger lytic area(Fig. 1B), and lower trabecular bone volume (Fig. 1C) compared withcontrols. Similarly, CRP also resulted in more bone lesions in murinefemurs of SCID mice bearing human myeloma cells (Fig. 1, D to F).The earlier appearance and larger number of bone lesions in CRP-injected myeloma-bearing mice were not due to higher tumor burdenbecause no difference in tumor burden, detected as circulating humanimmunoglobulin G (IgG) secreted by myeloma cells, was detected inmyeloma-bearing SCID-hu (fig. S1A) or SCID (fig. S1B)mice injectedwith or without CRP, indicating that CRP affected not myelomagrowth but rather bone destruction in vivo. We injected 20 mg ofCRP per mouse twice a week continuously for 8 weeks, which main-

Yang et al., Sci. Signal. 10, eaan6282 (2017) 12 December 2017

tained CRP concentrations of 3 to 8 mg/ml in mouse serum (fig. S1, Cand D). Mean values of serum CRP in myeloma patients reported fordifferent studies range from 3.8 to 12.0mg/liter, with measured valuesranging from 1.5 to 120 mg/liter (9, 11, 16). Therefore, the CRP con-centrations in the mice were comparable to those seen in myelomapatients.

To confirm the results, we generated human myeloma cell lines(ARP-1 and MM.1S) that stably produced (fig. S2A) and secreted(fig. S2B) humanCRP protein. Aftermyelomawas established in SCIDmice, these cells also caused more lytic bone lesions in the femurs ofSCID mice as compared with control myeloma cells (Fig. 1, G and H).Injection of a neutralizing antibody against human CRP diminishedthe ability of CRP-producing, but not control, myeloma cells to causelytic bone lesion in the mice (Fig. 1I). Because these CRP-expressingmyeloma cells secreted much lower amounts of CRP than those ob-served in myeloma patients, it is possible that this autocrine CRP, al-though at low concentrations but constantly secreted, may accumulateon myeloma cells to effectively bind with the surface receptors to acti-vate signaling inmyeloma cells. Thus, these results indicate that human

Fig. 1. CRP enhances induction of bone lesions in myeloma-bearing mice. (A) Representative radiographic images of lytic lesions in the implanted human bones ofprimary myeloma-bearing severe combined immunodeficient (SCID)-hu mice before (0 w) or at week 4 (4 w) and week 8 (8 w) after injection of primary myeloma cellsfrom one of five patients [Pt MM(multiple myeloma)] and treatment with phosphate-buffered saline (PBS), C-reactive protein (CRP) (20 mg per mouse), or serum amyloidP component (SAP) (20 mg per mouse). Tumor-free mice (no MM) served as controls. (B and C) Histomorphometric analysis of the osteolytic area (B) and bone volumedensity [(C); assessed as percentage of bone volume over total volume (BV/TV)] in the implanted human bones from the mice described in (A) at 8 weeks. (D) Represen-tative radiographic images of lytic bone lesions in the distal femurs of SCIDmice injected with one of twomyeloma cell lines (ARP-1 or MM.1S) and treated with PBS or CRP(n = 10 mice per group). (E and F) Histomorphometric quantitative analysis of the femurs from the mice described in (D), assessing osteolytic area (E) and BV/TV (F). (G andH) Representative radiographic images of bone lesions (G) and histomorphometric quantitative analysis of osteolytic area (H) in the distal femurs of SCID mice (n = 10 pergroup) injected with CRP-expressing or vector-control myeloma cells. Arrows indicate osteolytic lesions in mouse femurs. (I) Micro–computed tomography scanninganalysis of BV/TV in the femurs of SCID mice bearing CRP-expressing or vector-control myeloma cells, treated with neutralizing antibodies against CRP (aCRP) or control[immunoglobulin G (IgG)]. *P < 0.05, **P < 0.01 by Student’s t test. Images are representative and data are means ± SD of three independent experiments shown.

2 of 10

SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

http://stke.sciencD

ownloaded from

CRP is capable of promoting mye-loma cell–mediated lytic bone dis-ease in vivo.

CRP enhances OCdifferentiation and boneresorption activityMyelomamanifests as an osteolyticbonediseasemainlydue to enhancedOC activity (17). To determinewhether CRP affected osteoclasto-genesis, primary myeloma-bearingmice were sacrificed 8 weeks aftertumor injection, and sections ofmurine femurs or implanted hu-man bone chips were stained forTartrate-resistant acid phospha-tase (TRAP) to identify OCs. CRPinjection resulted in significantlymore TRAP+ OCs localized on thetrabecular bone surface of the bone-tumor interface (Fig. 2, A and B)and more erosion on trabecularbones (Fig. 2C) in the implantedhuman bones of myeloma-bearingSCID-humice comparedwith con-trols. Similarly, more OCs (Fig. 2D)or bone erosion (Fig. 2E)were foundin the femurs of myeloma-bearing,CRP-injected SCIDmice than those

on May 17, 2019

emag.org/

injectedwithPBSand inmicebearingCRP-producingmyeloma cells than those injectedwith controlmy-eloma cells (Fig. 2F). Injection of CRP-neutralizingantibodies but not control IgG abrogated theenhanced bone destruction produced by CRP-producing myeloma cells (Fig. 2G).

Because the in vivo findings suggested that CRPaffected osteoclastogenesis in myeloma-bearingmice, we investigated the role of CRP in OC differ-entiation in vitro. We observed that adding CRP(5 mg/ml, equal to the average serum levels of CRPin myeloma patients) to cultured OC precursorcells did not induce the formation ofmature (mul-tinuclear, TRAP+) OCs (Fig. 3A) or increase thelevels of TRAP5b (Fig. 3B), which is an active com-ponent of TRAP and is secreted only by matureOCs; the TRAP5b level reflects OC-mediated boneresorption activity (18). However, coculture of OCprecursors with myeloma cells, without addition ofRANKL in the medium, induced formation ofmature OCs, and addition of CRP (5 mg/ml) to thecoculture further and significantly enhanced thegeneration of mature OCs (Fig. 3, A and B). In linewith these results, the expression of OC-associatedgenes, such as TRAP and those encoding calcitoninreceptor (CALCR) and cathepsin K (CTSK) (19),was highly enhanced in OCs cocultured with mye-loma cells in the presence of CRP (Fig. 3C), as com-pared with controls. Coculturing OC precursors

Yang et al., Sci. Signal. 10, eaan6282 (2017)

Fig. 2. CRP enhances osteoclastogenesis in myeloma-bearing mice. (A) Representative images of Tartrate-resistantacid phosphatase (TRAP)+ osteoclasts (OCs) in human trabecular bones from SCID-hu mice or 8 weeks after inoculationwith patient myeloma cells (Pt 1) and treatment with CRP or PBS. Arrows indicate OCs in bone sections. No MM, tumor-freemice. Scale bars, 10 mm. (B and C) Histomorphometric quantitative analysis of (B) the number of OCs on the bone surface(Oc. S/BS) and (C) OC-mediated erosion of bone surface, expressed as a percentage of total bone surface (ES/BS), in theimplanted human bones of SCID-hu mice that were either tumor-free (−) or bearing primary myeloma cells from one offive patients (Pt MM) and treated with CRP (+) or PBS (−). (D and E) Histomorphometric analysis of (D) Oc. S/BS and (E) ES/BS in the femurs of SCID mice (n = 10 per group) bearing myeloma cells and treated with CRP or PBS. (F) Oc. S/BS in thefemurs of SCID mice bearing CRP-expressing (MM-CRP) or vector-control (MM-Vector) cells. (G) Oc. S/BS in the femurs ofSCID mice bearing MM-CRP or MM-Vector cells treated with antibodies against CRP (aCRP) or control (IgG). Tumor-freemice (no MM) treated with agents or antibodies served as controls for baseline levels. Data from three independentexperiments are shown. *P < 0.05, **P < 0.01 by Student’s t test.

12 December 20

Fig. 3. CRP enhances myeloma-induced OC formation and activity in vitro. (A and B) The number ofmultinuclear TRAP+ cells (A) and the amount of secreted TRAP5b (B) in cultures of OC precursor cellscultured alone or with either primary myeloma cells isolated from five myeloma patients (Pt MM) or withhuman myeloma cell lines (MM) in medium without receptor activator of nuclear factor kB (NF-kB) ligand(RANKL) in the presence of CRP (5 mg/ml) or PBS. (C) Real-time polymerase chain reaction (PCR) analysis ofthe expression of CALCR, CTSK, and TRAP in mature OCs cocultured with OC precursors and ARP-1 orMM.1S cells with or without CRP (5 mg/ml). (D) TRAP staining for the number of multinuclear TRAP+ cellsin cocultures of OC precursors with vector- or CRP-expressing ARP-1 orMM.1S cells (MM-Vector or MM-CRP)without RANKL. (E) As in (D), in the presence of antibodies against CRP (aCRP; 5 mg/ml) or control (IgG). *P <0.05, **P < 0.01 by Student’s t test. Data from four independent experiments are shown.

17 3 of 10

SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

hD

ownloaded from

with CRP-producing humanmyeloma cells also enhancedmature OCformation (Fig. 3D). Once again, neutralizing CRP in the cocultureabrogated CRP-induced, myeloma-mediated OC formation (Fig. 3E).Together, these results indicate that CRP enhances myeloma cell–mediated osteoclastogenesis in vitro.

CRP stimulates the production of OC activators bymyeloma cellsBecause our results showed that addition of CRP to the transwellcoculture of OC precursors and myeloma cells induced OC differ-entiation (Fig. 3), we hypothesized that CRP mediates this effect byup-regulating myeloma cell secretion of cytokines that activate OCdifferentiation. Microarray analysis of gene profiling identified morethan 500 genes with twofold increased expression in CRP-treatedmyeloma cells compared to PBS-treated cells, including 11 that en-code cytokines known to activate osteoclastogenesis: IL-1, MCP-1,IL-11, IL-6, HGF, IL-17, RANKL, M-CSF, BAFF, DcR3, and MIP-1a (fig. S3A). Real-time polymerase chain reaction (PCR) validatedthat among these cytokines, RANKL, MCP-1, and MIP-1a werehighly expressed in CRP-treated myeloma cells, including patient-derived primary myeloma cells and myeloma cell lines ARP-1 andMM.1S, as compared with control myeloma cells (fig. S3B). Not sur-prisingly, CRP-expressing ARP-1 and MM.1S cells also expressed ahigher level of these cytokines as compared with vector-control my-eloma cells (fig. S3C).

Yang et al., Sci. Signal. 10, eaan6282 (2017) 12 December 2017

Todetermine the involvement of these cytokines inCRP-enhancedOC differentiation, we added neutralizing antibodies against thesecytokines to the coculture of OC precursors and myeloma cells in thepresence of CRP. The neutralizing antibodies significantly reduced thenumber of TRAP+ multinuclear OCs (fig. S4A) and level of TRAP5b(fig. S4B). These results indicate that CRP enhances OC differentiationby up-regulating myeloma cell production of OC activators such asRANKL, MCP-1, and MIP-1a.

CRP binds to CD32 on myeloma cells, promotes cytokineproduction, and induces OC differentiationBecause CRP has been shown to bind to FcgRs such as CD32 on hu-man cells including myeloma cells (7, 15), we hypothesized thatCD32 expressed on myeloma cells may be involved in CRP-inducedmyeloma-mediated OC differentiation.We generated stable myelomacell lines (ARP-1 andMM.1S) with significantly reduced expression ofCD32 [herein called CD32-knockdown (CD32-KD); Fig. 4A]. CD32-KDmyeloma cells were less able to promote OC differentiation in re-sponse to CRP (Fig. 4, B and C). Moreover, CD32-KD myeloma cellscaused less bone disease in mice injected with CRP (Fig. 4, D and E),although similar numbers or percentages of CD32-KDand controlMMcells were found in the bone marrow of mice (Fig. 4F). As expected,CD32-KDmyeloma cells had lower CD32 expression in vivo comparedwith control cells (Fig. 4G). We then added CRP to cultures of CD32-KD or control ARP-1 or MM.1S cells. The CD32-KD myeloma cells

on May 17, 2019

ttp://stke.sciencemag.org/

Fig. 4. Knockdown of CD32 in myeloma cells reduces CRP-induced OC differentiation. (A) Western blot analysis for the abundance of CD32 in cultured wild-type(wt) ARP-1 or MM.1S cells and those transfected with nontargeted short hairpin RNA (shRNA) (Ctrl) or CD32 shRNA [CD32-knockdown (CD32-KD)]. b-Actin served as loadingcontrol. (B) The number of multinuclear TRAP+ cells in cocultures of OC precursors with control or CD32-deficient myeloma cells in the presence of CRP (5 mg/ml) or PBS.(C) Real-time PCR of gene expression in OCs cocultured with control or CD32-deficient ARP-1 myeloma cells and CRP (5 mg/ml) or PBS. (D to G) Histomorphometric analysisof (D) BV/TV, (E) Oc. S/BS, and immunohistochemical examination for (F) the percentage of CD138+ cells (myeloma marker) in the bone marrow and (G) staining for CD32and CD138 by myeloma cells in bone sections of distal femurs from SCID mice (n = 10 per group) injected with Ctrl or CD32-KD ARP-1 cells. Mice receiving no CRP injectionserved as control in (D) and (E). Scale bar, 50 mm. ns, not significant. *P < 0.05, **P < 0.01 by Student’s t test. Data from three independent experiments are shown.

4 of 10

SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

on May 17, 2019

http://stke.sciencemag.org/

Dow

nloaded from

had significantly reduced expression (Fig. 5, A and B) and secretion(Fig. 5, C and D) of MCP-1, MIP-1a, and RANKL in response toCRP as compared with control cells.

Because CD32 is involved in various cellular responses, we wantedto exclude the possibility that knockdown of CD32 in myeloma cellsaffected myeloma cell growth and survival and thereby compromisedtheir ability to secrete osteolytic cytokines that enhance OC differen-tiation. Our results showed that knockdown of CD32 did not affectmyeloma cell growth (fig. S5A) or survival (fig. S5B) in vitro or tumorformation and burden in vivo (fig. S5C).

We also generated stable myeloma cell lines with significantlyenhanced CD32 expression (fig. S6, A and B) to confirm the role ofthis molecule. CD32-overexpressing myeloma cells expressed (Fig. 5,E and F) and secreted (Fig. 5, G andH)more osteolytic cytokines anddisplayed enhanced ability to promote OC differentiation in vitro(fig. S6, C and D), which resulted in severe bone disease in vivo(fig. S6, E and F) in the presence of CRP. Overexpression of CD32did not affect myeloma growth and survival in vitro or tumor forma-tion in vivo.

CRP regulates the expression of osteolytic cytokines inmyeloma cells through p38 MAPK–Twist signalingNext, we sought to elucidate the molecular mechanism underlyingCRP-CD32–mediated signaling pathways that regulate the produc-tion of osteolytic cytokines in myeloma cells. First, we analyzed theexpression of transcriptional factors in myeloma cell lines by micro-array and identified 31 genes that were at least twofold increased inresponse to CRP (Fig. 6A). We used the software Genomatix (20) toanalyze the transcription factor binding sites on the promoter re-gions of the osteolytic cytokine genes and predicted several potential

Yang et al., Sci. Signal. 10, eaan6282 (2017) 12 December 2017

Twist binding sites. To confirm the results of microarray analysis, weperformed a chromatin immunoprecipitation (ChIP) assay to exam-ine the ability of Twist to bind to the promoters of two relevant cy-tokine (RANKL and MCP-1) genes. We found that Twist wasenriched on RANKL and MCP-1 promoters in ARP-1 and MM.1S(Fig. 6B). To investigate the importance of Twist in CRP-inducedcytokine production by myeloma cells, we used short hairpin RNA(shRNA) to knock down Twist (Twist-KD) abundance in myelomacells (Fig. 6C). CRP induction of myeloma cell expression of the os-teolytic cytokines MCP-1 and RANKL was significantly reduced inTwist-KD myeloma cells as compared to control cells (Fig. 6C). Wealso cloned the Twist-containing transcription start site of theRANKL and MCP-1 promoters into a luciferase reporter vector.Adding CRP increased the luciferase activity of Luc-RANKL andLuc-MCP-1 in ARP-1 or MM.1S, and truncation of the Twist bindingsites in theMCP-1 or RANKL gene promoters significantly reduced theactivity (Fig. 6, D and E), suggesting that the potential Twist bindingsites for RANKL locate at −1500 to −800 base pairs (bp) of its startcodon and those for MCP-1 locate at −350 to −150 bp of its startcodon. Next, we performed site-directed mutagenesis on the two pu-tative binding sites for RANKL and three putative binding sites forMCP-1 within each region. Not surprisingly, mutating a singlebinding site for either RANKL orMCP-1 blocked the transcriptionalactivation induced byCRP (Fig. 6, D andE). Furthermore, CRP-treatedTwist-KD myeloma cells were less able to induce the expression ofOC genes in cocultured OC progenitor cells (Fig. 6F), indicating thatTwist is crucial to myeloma cell–mediated OC differentiation in re-sponse to CRP.

To further examine the effect of CRP on Twist expression, we treatedARP-1 or MM.1S cells with various concentrations (1 to 10 mg/ml) of

Fig. 5. Through myeloma cell CD32, CRP enhances the production of cytokines that mediate OC formation and activation. (A to D) Real-time PCR analysis ofMCP-1,MIP-1a, and RANKLmRNA expression (A and B) and enzyme-linked immunosorbent assay (ELISA) analysis of secreted protein (C and D) in CD32-KD ARP-1 or MM.1S cellscultured with CRP (5 mg/ml) comparedwith those in nontarget control shRNA-transfected (Ctrl) cells. (E toH) Analysis of cytokine [monocyte chemoattractant protein–1 (MCP-1),macrophage inflammatory protein–1a (MIP-1a), and RANKL] abundance at the mRNA (E and F) and protein (G and H) levels in cultures of vector- or CD32-transfected (CD32)ARP-1 or MM.1S cells cultured with or without CRP (5 mg/ml). *P < 0.05, **P < 0.01 by Student’s t test. Data from three independent experiments are shown.

5 of 10

SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

on May 17, 2019

http://stke.sciencemag.org/

Dow

nloaded from

CRP and assessed Twist expression by Western blot. CRP enhancedTwist expression in a dose-dependent manner (Fig. 7A). In contrast,Twist expression was reduced in CRP-treated CD32-KDmyeloma cells(Fig. 7B). To further investigate the potential downstream targets ofTwist, we added various concentrations (1 to 10 mg/ml) of CRP tocultures of myeloma cells and found that CRP enhanced phosphoryl-ation of p38MAPK but not extracellular signal–regulated kinase (ERK)or NF-kB in a dose-dependent manner (Fig. 7C). CRP promoted thelevels of phosphorylated p38 MAPK in control and in CD32-over-expressingmyeloma cells but not in CD32-KDmyeloma cells (Fig. 7D),indicating that CRP activates the p38MAPK pathway in myeloma cellsthrough surface CD32. To examine the importance of p38 MAPK inCRP-induced cytokine production in myeloma cells, we added thep38 MAPK–specific inhibitor SB202190 to cultures of myeloma cellsalong with CRP. SB202190 significantly reduced the expression of oste-olytic cytokine mRNAs (Fig. 7E) and reduced CRP-induced Twist pro-tein abundance (Fig. 7F). These results showed that CRP binds to CD32and activates p38 MAPK–Twist signaling pathways, leading toincreased production of osteolytic cytokines by myeloma cells.

Serum CRP levels significantly and positively correlate withbone lesions in patients with newly diagnosed myelomaFinally, we examined the relationship between serum CRP and devel-opment of bone disease in patients withmyeloma. In newly diagnosedmyeloma patients, serum CRP was quantified by enzyme-linked im-munosorbent assay (ELISA), and bone disease and the number of

Yang et al., Sci. Signal. 10, eaan6282 (2017) 12 December 2017

bone lesions were detected by x-ray and magnetic resonance imaging.As shown in Fig. 8A, serum CRP level significantly and positivelycorrelated with the number of bone lesions (n = 244; r = 0.6096; P <0.0001). We examined bone marrow biopsies frommyeloma patientswith high (≥6 bone lesions) or low (<3 bone lesions) numbers of bonelesions and found thatmoreCRPproteinwas present in the bonemar-row of myeloma patients withmore bone disease (Fig. 8B). Moreover,positive correlations were also found between the levels of serumRANKL (Fig. 8C) or MCP-1 (Fig. 8D) and CRP level. We quantifiedserum collagen type I C-telopeptide (CTx)–1, which reflects the boneresorption activity of OCs, and observed that CTx-1 and CRP level(Fig. 8E) also positively correlated. These results are clinically signifi-cant because they suggest that high levels of CRP may be a key caus-ative factor in the development of the bone disease observed in 80% ofpatients with myeloma.

DISCUSSIONMyeloma is accompanied by bone disease in the vast majority of pa-tients (1, 2). Myeloma cells disrupt the delicate balance between boneformation and resorption, leading to debilitating osteolytic bone lesions(3). Although it is well established that myeloma cells enhance OC dif-ferentiation and activity via secreting osteolytic cytokines (17), themechanism underlying howmyeloma cells are regulated and activatedto secrete these cytokines remains elusive. Here, we showed that hu-man CRP, which is secreted in elevated amounts by hepatocytes in

Fig. 6. Twist transcriptionally regulates CRP-induced cytokine expression in myeloma cells. (A) Heat map of the expression of transcriptional factors in myelomacell lines treated with or without CRP (5 mg/ml) for 24 hours. (B) Chromatin immunoprecipitation (ChIP) assay for the interaction of Twist with the promoters of MCP-1 orRANKL using anti-Twist antibody or rabbit IgG. The input proteins served as controls. (C) Western blot for Twist abundance (top) and real-time PCR for MCP-1 and RANKLmRNAs in Twist-knockdown (Twist-KD) myeloma cells and nontargeted shRNA control (Ctrl) cells, cultured with or without CRP. (D and E) Luciferase activity in culturedARP-1 (D) or MM.1S (E) cells transfected with a luciferase (Luc) reporter containing wild type, truncated mutants, or Twist binding site mutant RANKL or MCP-1 genepromoters. (F) Real-time PCR for gene expression in OC precursors cocultured with Twist-KD or control ARP-1 cells cultured with or without CRP. *P < 0.05, by Student’s t test.Data from four independent experiments are shown.

6 of 10

SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

Yang et al., Sci. Signal. 10, eaan6282 (2017) 12 December 2017

http://stke.sciencemD

ownloaded from

response to cytokines (IL-1 or IL-6) derived frommyeloma cells in patients(6), may be responsible, atleast in part, for activatingmyeloma cells to promoteosteoclastogenesis and in-ducing bone destructionin vivo. CRP binds withsurface CD32/FcgRII, ac-tivates p38 MAPK–Twistpathways, and stimulatesthe secretion of osteolyticcytokinesbymyelomacells.Ourprevious studyshowedthat CRP at a much higherconcentration (25 mg/ml)activated ERK and NF-kBbut inhibited p38 MAPK(15). Our clinical analysesexamining the relation-ship between the level ofserum CRP and the num-ber of osteolytic bone le-sions in newly diagnosedpatients support this con-clusion. Thus, this studyreveals a previously un-known mechanism thatexplains how myelomacells are activated to pro-

on May 17, 2019

ag.org/

mote osteoclastogenesis and induce bone de-struction in human myeloma. Our study alsosuggests that CRP may be a therapeutic targetfor preventing or treating bone disease in pa-tients with myeloma.

CRP is a sensitive systemic marker of in-flammation and tissue damage (6). Its level inthe serum is increased in patients with infection,inflammatory disease, necrosis, or malignancy,including myeloma, lymphoma, and carcino-ma, and high levels of circulating CRP correlatewith poor prognosis in patients with myelomaor lymphoma (9–13). We hypothesized that CRPmay not be just a surrogate for tumor burden inmyeloma but also plays a central role in myelo-ma growth, survival, and drug resistance. We re-ported that adding human CRP to myelomacultures at levels seen in patients with myelomaor other tumors promoted tumor cell prolifer-ation under stressed conditions and protectedtumor cells from apoptosis induced by chemo-therapy, IL-6 withdrawal, or serum deprivationin vitro and in vivo (15). The results of thisstudy further showed that CRP may be an im-portant player in myeloma-mediated bone de-struction in human myeloma. As inflammationhas long been hypothesized to be linked to cancer(21), our studies suggest a possible link between

Fig. 7. Cross-linking CD32 by CRP activates p38 MAPK–Twist in myeloma cells. (A) Western blot for Twist abundance in ARP-1 orMM.1S cells treated with various doses of CRP for 24 hours. (B) Real-time PCR for TWIST mRNA levels in CD32-KD or control myelomacells cultured with or without CRP. (C) Western blot analysis for dose-dependent effects of CRP on the phosphorylation (p) of p38mitogen-activated protein kinase (MAPK), extracellular signal–regulated kinase (ERK), and NF-kB in myeloma cells. (D) Western blotanalysis for effects of CRP on the phosphorylation of p38 MAPK in CD32-overexpressing (CD32) or knockdown (CD32-KD) ARP-1 cellscompared with the respective controls. (E) Real-time PCR analysis of the expression of MCP-1, MIP-1a, and RANKL in ARP-1 cellscultured with or without CRP and the p38 MAPK inhibitor SB202190 (SB20). (F) Western blot analysis for the effect of SB20 onCRP-induced Twist abundance. *P < 0.05, **P < 0.01 by Student’s t test. Data from three independent experiments are shown.

Fig. 8. Relationship between serum CRP level and osteolytic bone lesion number in patients withnewly diagnosed myeloma. (A) Correlation between serum CRP level and the number of lytic bone lesions(BLs) in 244 patients with newly diagnosed myeloma. CRP was measured by ELISA, and BLs were detected byradiography (x-ray or magnetic resonance imaging). (B) Representative images of immunohistochemical stain-ing for CRP accumulation in the bone marrow of myeloma patients (three per group) with low (BL < 3) or high(BL ≥ 6) numbers of BLs. Scale bar, 50 mm. (C to E) Correlations between the level of circulating CRP and (C)MCP-1, (D) RANKL, and (E) CTx-1 in 28 randomly selected patients with newly diagnosed myeloma, calculatedby Pearson’s correlation coefficient analysis.

7 of 10

SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

http://stke.sciencD

ownloaded from

inflammation or its products and the pathogenesis and bone destruc-tion in myeloma.

Twist is a basic helix-loop-helix (bHLH) transcriptional factor es-sential in embryological morphogenesis, and it belongs to the HLHsuperfamily of proteins, which are involved in a variety of regulatoryprocesses in organisms (22). Initially identified inDrosophila where itis involved in mesodermal patterning and morphogenetic movement(23), Twist is a highly conserved protein and a master regulator ofmorphogenesis. Previous studies have also shown that Twist is impor-tant in bone development and is expressed in primary osteoblasticcells (24) and preosteoblasts (25). In situ analysis of murine embry-onic development provided evidence that Twist abundance is reducedduring endochondral and intramembranous fetal bone development(26). Twist proteins inhibit skeletal development through direct andindirect inhibition of Runx2 (27, 28), a key regulator of osteogenicdifferentiation. Finally, expression of Twist1 and Twist2 in mesen-chymal cells may promote adipogenesis (29). Together, these obser-vations suggest that Twist proteins are important to normal bonemarrow stromal cell function. However, Twist is also essential to tumormetastasis. Ectopic expression of Twist results in loss of E-cadherin–mediated cell-cell adhesion, activation of mesenchymal markers, andinduction of cell motility; it contributes to metastasis by promotingan epithelial-mesenchymal transition. In human breast cancers, highTwist expression correlates with the presence of invasive lobular car-cinoma (30). The role of Twist in bone destruction in myeloma isunclear. Our results indicate that Twist mediates CRP-induced up-regulation of MCP-1, RANKL, and MIP-1a expression in myelomacells, leading to enhanced OC-mediated bone resorption. Furtherstudies are needed to elucidate its effect on pathogenesis of myeloma-associated bone disease.

on May 17, 2019

emag.org/

MATERIALS AND METHODSPrimary myeloma cells and myeloma cell linesThis study was approved by the institutional review board at Univer-sity of Texas MDAnderson Cancer Center (UTMDACC), and all pa-tients provided written informed consent. Bone marrow aspirateswere obtained from newly diagnosed patients with myeloma as partof their routine clinical workup. Patient CD138+ myeloma cells wereisolated from the aspirates bymagnetic bead sorting (Miltenyi Biotec).Themyeloma cell lines ARP-1 andARKwere provided by theArkansasCancer Research Center. Other cell lines were purchased from theAmerican Type Culture Collection. All myeloma cells were culturedin RPMI-1640 medium supplemented with 10% fetal bovine serum(FBS) (Life Technologies).

Antibodies and reagentsNeutralizing antibodies against CRP, MIP-1a, MCP-1, RANKL, andcontrol IgG, and recombinant human CRP, M-CSF, RANKL, andSAP were purchased from R&D Systems. The p38 MAPK–specificinhibitor was purchased from Axon Medchem BV. Except wherespecified, antibodies for Western blotting analysis were purchasedfrom Cell Signaling Technology.

In vitro OC formation and function assaysHuman OCs were generated from peripheral blood, CD14 antibody–coatedmagnetic bead–purified (Miltenyi Biotec) monocytes of healthyblood donors, and cultured in a–minimum essential medium sup-plemented with 10% FBS with M-CSF (25 ng/ml) (R&D Systems) for

Yang et al., Sci. Signal. 10, eaan6282 (2017) 12 December 2017

7 days to obtain the precursors of OCs as we previously reported (5).The precursors were then cocultured with myeloma cells in mediumwithout or with a low dose of RANKL (10 ng/ml) for an additional7 days to induce mature OC formation. To examine the effects ofmyeloma cells and CRP on OC differentiation, OC precursors (1 ×105 cells/ml) were seeded in the wells and cocultured with myelomacells (0.5 × 106 cells/ml) in transwell inserts for 7 days, in OCmediumwithout the addition of RANKL, in the presence or absence of CRP.Cells were fixed with 4% formaldehyde and stained for TRAP by usingthe Leukocyte Acid Phosphatase Kit (Sigma-Aldrich). At the end of the2-week culture, culture supernatants were collected and used for quanti-fying by ELISA (CrossLaps, Biosciences Diagnostics) secreted TRAP5b.

Knockdown and overexpression in myeloma cellsThe shRNAs specific for CD32 or Twist were purchased from SantaCruz Technology according to the manufacturer’s instructions. Afterlentiviral infection, transduced cells were harvested to examine CD32or Twist expression or used for experiments. The cells with CD32 orTwist knockdown were drug-selected. CRP and CD32 overexpressionwas achieved using the retroviral expression vector pBABEhybro,according to the manufacturer’s instructions.

Western blotting analysisCells were harvested and lysed with lysis buffer [50 mM tris (pH 7.5),140 mMNaCl, 5 mM EDTA, 5 mMNaN3, 1% Triton X-100, 1% NP-40, and 1× protease inhibitor cocktail]. Cell lysates were subjectedto SDS–polyacrylamide gel electrophoresis, transferred to a poly-vinylidene difluoride membrane, and immunoblotted with antibodiesagainst CRP (R&D Systems) and phosphorylated or nonphosphoryl-ated p38 MAPK (Cell Signaling Technology) at 4°C overnight. Anti-bodies were diluted according to the manufacturer’s recommendations.The membrane was stripped and reprobed with anti–b-actin anti-bodies (Sigma-Aldrich) to ensure equal protein loading. Secondary anti-bodies conjugated to horseradish peroxidase were used for detectionand followed by enhanced chemiluminescence (Pierce Biotechnology)and autoradiography.

Real-time PCRTotal RNAwas isolatedwith anRNeasy kit (Qiagen). An aliquot of 1 mgof total RNAwas subjected to reverse transcription (RT)with SuperScriptII (Invitrogen) RT-PCR kit, and 1 ng of the final complementary DNAwas applied to real-time PCR amplification with SYBR Green usingStepOnePlus real-time PCR system (Life Technologies). The primersused are listed in table S1.

Myeloma cell apoptosisThe fraction of apoptotic cells was determined by staining with fluo-rescein isothiocyanate–conjugated annexin V and propidium iodideand analyzed by flow cytometry (BD LSRFortessa, BD Biosciences)according to the manufacturer’s instructions.

Mouse models, radiography, histology, andbone histomorphometryCB.17 SCID mice were purchased from Harlan. All mice were main-tained inAmericanAssociation of LaboratoryAnimal Care–accreditedfacilities, and the studies were approved by the Institutional AnimalCare and Use Committee of the UTMDACC. Six- to 8-week-old micewere injected intravenously with (1 × 106 cells per mouse) human my-eloma cell lines ARP-1 and MM.1S, and myeloma-bearing mice were

8 of 10

SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

on May 17, 2019

http://stke.sciencemag.org/

Dow

nloaded from

then treated with CRP (20 mg permouse; twice a week for 6 to 8 weeks)or vehicle (PBS). Serumwas collected frommice daily during the treat-ment and tested formyeloma-secretedM-proteins (human Ig) or theirlight chains by ELISA.

SCID-hu hosts were developed as described previously (31). Fetalbones (10-mm pieces, purchased from Advanced Bioscience ResourcesInc.) were implanted subcutaneously and allowed to become vascular-ized (6 to 10weeks). Purifiedmyeloma cells (≥106 cells permouse)wereinjected into implanted human bones to establish myeloma (4 to6 weeks) (n = 5 per group). After 7 days, mice were treated with CRPor SAP (20 mg per mouse) or equal volume of PBS twice a week for8 weeks. Serum was obtained from the mice weekly and assayed byELISA for the human M-component.

Mice were x-rayed weekly starting at 1 to 2 weeks after tumorinjection. To measure the size of lytic bone lesions, radiographs werescanned with a Faxitron x-ray cabinet (Faxitron x-ray). The total num-ber of osteolytic lesions or area was quantified using ImageJ software(National Institutes of Health). For histological and bone histomor-phometric analyses, mice were euthanized, and mouse femurs werefixed in 10% neutral-buffered formalin for 18 hours. To detect matureOCs, a leukocyte acid phosphatase staining kit (Sigma-Aldrich) wasused to stain sections with TRAP according to the manufacturer’s in-structions. The number of TRAP-positive, multinuclear (>3) OCs permillimeter of bone at the bone-tumor interface was calculated using acomputerized image analysis system.

ImmunohistochemistryFormalin-fixed, paraffin-embedded sections of SCID mouse femurswere deparaffinized with xylene and rehydrated to water through agraded alcohol series. Endogenous peroxidase activity was quenchedwith 3% hydrogen peroxide. Expression of CD138 and CD32 was de-tected using specific antibodies (R&D Systems and LifeSpan BioSciencesInc.). Signal was detected using secondary biotinylated antibodies andstreptavidin/horseradish peroxidase. Chromagen 3,3-diaminobenzidine/H2O2 (Dako) was used, and slides were counterstained with hematox-ylin. All slides were observed under light microscopy, and images werecaptured with a SPOT RT camera (Diagnostic Instruments).

ChIP assaysChIP analysis with anti-Twist was performed using a commerciallyavailable kit (Upstate Biotechnology). Immunoprecipitates and totalchromatin input were reverse cross-linked, DNA was isolated, and 1-mlDNAwas used for PCRwith primers specific for the gene promoter regionfor RANKL and for MCP-1. The primer sequences were as follows: (i)RANKL: forward, CTTGGACCTCCAGAAAGACAG; reverse, ACTCT-TATAAACCGCTTGGAGAG; (ii)MCP-1: forward, CTGCTAGGCTTC-TATGATGCTAC; reverse, TCACTGCTGAGACCAAATGAG.

Transfection and luciferase assayCells at 50% confluence were transfected in 12-well petri dishes usingLipofectamine (Gibco-BRL). The total amount of DNAwas adjustedto 1.0 mg by adding empty vector. We determined luciferase activityby using a luciferase assay system (Promega). As a reference plasmidto normalize transfection efficiency, 25 ng of pRL-CMV plasmid(Promega) was cotransfected in all experiments.

Microarray analysisWe performed the microarray analysis as described previously (32).At least a twofold difference between control myeloma cells and

Yang et al., Sci. Signal. 10, eaan6282 (2017) 12 December 2017

CRP-treated myeloma cells was required. Microarray data havebeen deposited in the Gene Expression Omnibus (GEO) database(GSE103697).

Statistical analysisAll data are shown as means ± SD. Student’s t test was used to com-pare various experimental groups; significance was set at an a levelof 0.05.

SUPPLEMENTARY MATERIALSwww.sciencesignaling.org/cgi/content/full/10/509/eaan6282/DC1Fig. S1. Injection of CRP does not affect tumor growth in vivo.Fig. S2. Generation of CRP-expressing myeloma cells.Fig. S3. CRP up-regulates myeloma cell production of cytokines important for OC activation.Fig. S4. Antibodies specific for OC-activating cytokines inhibit CRP-induced OC activation.Fig. S5. Knockdown or overexpression of CD32 does not affect myeloma cell proliferation orsurvival.Fig. S6. Overexpression of CD32 in myeloma cells enhances CRP-induced OC differentiation.Table S1. Primers used for real-time PCR.

REFERENCES AND NOTES1. R. A. Kyle, S. V. Rajkumar, Multiple myeloma. N. Engl. J. Med. 351, 1860–1873 (2004).2. E. Tian, F. Zhan, R. Walker, E. Rasmussen, Y. Ma, B. Barlogie, J. D. Shaughnessy Jr., The role

of the Wnt-signaling antagonist DKK1 in the development of osteolytic lesions inmultiple myeloma. N. Engl. J. Med. 349, 2483–2494 (2003).

3. N. Giuliani, V. Rizzoli, G. D. Roodman, Multiple myeloma bone disease: Pathophysiology ofosteoblast inhibition. Blood 108, 3992–3996 (2006).

4. G. D. Roodman, Biology of osteoclast activation in cancer. J. Clin. Oncol. 19, 3562–3571(2001).

5. J. He, Z. Liu, Y. Zheng, J. Qian, H. Li, Y. Lu, J. Xu, B. Hong, M. Zhang, P. Lin, Z. Cai,R. Z. Orlowski, L. W. Kwak, Q. Yi, J. Yang, p38 MAPK in myeloma cells regulatesosteoclast and osteoblast activity and induces bone destruction. Cancer Res. 72, 6393–6402(2012).

6. M. B. Pepys, G. M. Hirschfield, C-reactive protein: A critical update. J. Clin. Invest. 111,1805–1812 (2003).

7. M. P. Stein, C. Mold, T. W. Du Clos, C-reactive protein binding to murine leukocytesrequires Fcg receptors. J. Immunol. 164, 1514–1520 (2000).

8. M.-P. Stein, J. C. Edberg, R. P. Kimberly, E. K. Mangan, D. Bharadwaj, C. Mold, T. W. Du Clos,C-reactive protein binding to FcgRIIa on human monocytes and neutrophils isallele-specific. J. Clin. Invest. 105, 369–376 (2000).

9. R. Bataille, M. Boccadoro, B. Klein, B. Durie, A. Pileri, C-reactive protein and beta-2microglobulin produce a simple and powerful myeloma staging system. Blood 80,733–737 (1992).

10. H. Ludwig, B. G. Durie, V. Bolejack, I. Turesson, R. A. Kyle, J. Blade, R. Fonseca,M. Dimopoulos, K. Shimizu, J. San Miguel, J. Westin, J. L. Harousseau, M. Beksac,M. Boccadoro, A. Palumbo, B. Barlogie, C. Shustik, M. Cavo, P. R. Greipp, D. Joshua, M. Attal,P. Sonneveld, J. Crowley, Myeloma in patients younger than age 50 years presents withmore favorable features and shows better survival: An analysis of 10 549 patients from theInternational Myeloma Working Group. Blood 111, 4039–4047 (2008).

11. A. Tienhaara, K. Pulkki, K. Mattila, K. Irjala, T.-T. Pelliniemi, Serum immunoreactiveinterleukin-6 and C-reactive protein levels in patients with multiple myelomaat diagnosis. Br. J. Haematol. 86, 391–393 (1994).

12. E. Legouffe, C. Rodriguez, M. C. Picot, B. Richard, B. Klein, J. F. Rossi, T. Commes, C-reactiveprotein serum level is a valuable and simple prognostic marker in non Hodgkin’slymphoma. Leuk. Lymphoma 31, 351–357 (1998).

13. L. M. Pedersen, O. J. Bergmann, Urinary albumin excretion and its relationship toC-reactive protein and proinflammatory cytokines in patients with cancer and febrileneutropenia. Scand. J. Infect. Dis. 35, 491–494 (2003).

14. A. Reichle, K. Bross, T. Vogt, F. Bataille, P. Wild, A. Berand, S. W. Krause, R. Andreesen,Pioglitazone and rofecoxib combined with angiostatically scheduled trofosfamide in thetreatment of far-advanced melanoma and soft tissue sarcoma. Cancer 101, 2247–2256(2004).

15. J. Yang, M. Wezeman, X. Zhang, P. Lin, M. Wang, J. Qian, B. Wan, L. W. Kwak, L. Yu,Q. Yi, Human C-reactive protein binds activating Fcg receptors and protects myelomatumor cells from apoptosis. Cancer Cell 12, 252–265 (2007).

16. B. Barlogie, G. J. Tricot, F. van Rhee, E. Angtuaco, R. Walker, J. Epstein, J. D. Shaughnessy,S. Jagannath, V. Bolejack, J. Gurley, A. Hoering, D. Vesole, R. Desikan, D. Siegel,

9 of 10

SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

http://stke.sciencemD

ownloaded from

J. Mehta, S. Singhal, N. C. Munshi, M. Dhodapkar, B. Jenkins, M. Attal, J.-L. Harousseau,J. Crowley, Long-term outcome results of the first tandem autotransplant trial formultiple myeloma. Br. J. Haematol. 135, 158–164 (2006).

17. G. D. Roodman, Treatment strategies for bone disease. Bone Marrow Transplant.40, 1139–1146 (2007).

18. S. L. Alatalo, J. M. Halleen, T. A. Hentunen, J. Monkkonen, H. K. Väänänen, Rapid screeningmethod for osteoclast differentiation in vitro that measures tartrate-resistant acidphosphatase 5b activity secreted into the culture medium. Clin. Chem. 46, 1751–1754 (2000).

19. M. Asagiri, H. Takayanagi, The molecular understanding of osteoclast differentiation.Bone 40, 251–264 (2007).

20. M. Scherf, A. Klingenhoff, K. Frech, K. Quandt, R. Schneider, K. Grote, M. Frisch,V. Gailus-Durner, A. Seidel, R. Brack-Werner, T. Werner, First pass annotation of promoterson human chromosome 22. Genome Res. 11, 333–340 (2001).

21. S. I. Grivennikov, F. R. Greten, M. Karin, Immunity, inflammation, and cancer. Cell 140,883–899 (2010).

22. Y. N. Jan, L. Y. Jan, Functional gene cassettes in development. Proc. Natl. Acad. Sci. U.S.A.90, 8305–8307 (1993).

23. B. Thisse, M. El Messal, F. Perrin-Schmitt, The twist gene: Isolation of a Drosophila zygoticgene necessary for the establishment of dorsoventral pattern. Nucleic Acids Res. 15,3439–3453 (1987).

24. S. S. Murray, C. A. Glackin, K. A. Winters, D. Gazit, A. J. Kahn, E. J. Murray, Expression ofhelix-loop-helix regulatory genes during differentiation of mouse osteoblastic cells.J. Bone Miner. Res. 7, 1131–1138 (1992).

25. D. P. Rice, T. Aberg, Y. Chan, Z. Tang, P. J. Kettunen, L. Pakarinen, R. E. Maxson, I. Thesleff,Integration of FGF and TWIST in calvarial bone and suture development.Development 127, 1845–1855 (2000).

26. A. Alborzi, K. Mac, C. A. Glackin, S. S. Murray, J. H. Zernik, Endochondral andintramembranous fetal bone development: Osteoblastic cell proliferation, and expressionof alkaline phosphatase, m-twist, and histone H4. J. Craniofac. Genet. Dev. Biol. 16,94–106 (1996).

27. P. Bialek, B. Kern, X. Yang, M. Schrock, D. Sosic, N. Hong, H. Wu, K. Yu, D. M. Ornitz,E. N. Olson, M. J. Justice, G. Karsenty, A twist code determines the onset of osteoblastdifferentiation. Dev. Cell 6, 423–435 (2004).

28. S. Isenmann, A. Arthur, A. C. W. Zannettino, J. L. Turner, S. Shi, C. A. Glackin, S. Gronthos,TWIST family of basic helix-loop-helix transcription factors mediate human mesenchymalstem cell growth and commitment. Stem Cells 27, 2457–2468 (2009).

29. H. Miraoui, P. J. Marie, Pivotal role of Twist in skeletal biology and pathology. Gene 468,1–7 (2010).

Yang et al., Sci. Signal. 10, eaan6282 (2017) 12 December 2017

30. J. Yang, S. A. Mani, J. L. Donaher, S. Ramaswamy, R. A. Itzykson, C. Come, P. Savagner,I. Gitelman, A. Richardson, R. A. Weinberg, Twist, a master regulator of morphogenesis,plays an essential role in tumor metastasis. Cell 117, 927–939 (2004).

31. S. Yaccoby, B. Barlogie, J. Epstein, Primary myeloma cells growing in SCID-hu mice: Amodel for studying the biology and treatment of myeloma and its manifestations.Blood 92, 2908–2913 (1998).

32. W. Ma, M. Wang, Z.-Q. Wang, L. Sun, D. Graber, J. Matthews, R. Champlin, Q. Yi,R. Z. Orlowski, L. W. Kwak, D. M. Weber, S. K. Thomas, J. Shah, S. Kornblau, R. E. Davis,Effect of long-term storage in TRIzol on microarray-based gene expression profiling.Cancer Epidemiol. Biomarkers Prev. 19, 2445–2452 (2010).

Acknowledgments: We thank C. Talerico (Department of Cancer Biology, Cleveland Clinic)for helpful editorial assistance and the MD Anderson Myeloma Tissue Bank for providingpatient samples. Funding: This work was supported by grants from National Cancer Institute(NCI) R01s (CA190863 and CA193362 to Jing Y. and CA138398, CA200539, CA211073, andCA214811 to Q.Y.); an American Cancer Society Research Scholar Grant (127337-RSG-15-069-01-TBG); grants from UTMDACC Institutional Research Grant-Basic Research, LeukemiaResearch Foundation, and American Society of Hematology and National Natural ScienceFoundation of China grant no. 81470356 to Jing Y., as well as The Leukemia & LymphomaSociety Translational Research Program (6469-15) and Multiple Myeloma Research FoundationSenior Investigator Award to Q.Y. This work was also supported by NIH/NCI under awardnumber P30CA016672 and used the Small Animal Imaging Facility for radiography and ResearchHistopathology Facility for histological studies. Author contributions: Conceptualization:Q.Y. and Jing Y.; methodology: Jing Y., Z.L., H.L., J. He, Jianling Y., Q.W., and E.D.; microarrayanalysis: W.M. and E.D.; providing samples and critical suggestions: P.L., J.D., R.Z.O., and J. Hou;statistical consultation: Z.Y.; writing: Jing Y., H.L., and Q.Y; funding acquisition: Q.Y. and Jing Y.Competing interests: The authors declare that they have no competing interests. Data andmaterial availability: Microarray data have been deposited in the GEO database (GSE103697).

Submitted 10 May 2017Accepted 9 November 2017Published 12 December 201710.1126/scisignal.aan6282

Citation: J. Yang, Z. Liu, H. Liu, J. He, J. Yang, P. Lin, Q. Wang, J. Du, W. Ma, Z. Yin, E. Davis,R. Z. Orlowski, J. Hou, Q. Yi, C-reactive protein promotes bone destruction in human myelomathrough the CD32–p38 MAPK–Twist axis. Sci. Signal. 10, eaan6282 (2017).

ag

10 of 10

on May 17, 2019

.org/

Twist axis−MAPK p38−C-reactive protein promotes bone destruction in human myeloma through the CD32

Robert Z. Orlowski, Jian Hou and Qing YiJing Yang, Zhiqiang Liu, Huan Liu, Jin He, Jianling Yang, Pei Lin, Qiang Wang, Juan Du, Wencai Ma, Zheng Yin, Eric Davis,

DOI: 10.1126/scisignal.aan6282 (509), eaan6282.10Sci. Signal. 

findings suggest that targeting the cyclical CRP signaling axis may reduce or prevent MM-associated bone loss.expression and secretion of osteoclast-activating cytokines from MM cells, thereby driving bone loss in patients. These

. found that CRP is not merely a diagnostic marker for MM but that rather it feeds back on MM cells to stimulate theet alMM. Using samples from patients, as well as human cell lines and mice bearing human bone grafts and MM cells, Yang liver in response to cytokines associated with tissue inflammation and physiological stress, including those secreted bybone. The sera of MM patients typically have increased amounts of C-reactive protein (CRP), which is secreted by the

Bone loss is common in patients with multiple myeloma (MM). MM cells activate osteoclasts, cells that degradeLiver protein instructs bone loss in myeloma

ARTICLE TOOLS http://stke.sciencemag.org/content/10/509/eaan6282

MATERIALSSUPPLEMENTARY http://stke.sciencemag.org/content/suppl/2017/12/08/10.509.eaan6282.DC1

CONTENTRELATED

http://stke.sciencemag.org/content/sigtrans/12/576/eaaw4847.fullhttp://stke.sciencemag.org/content/sigtrans/11/535/eaau4685.fullhttp://stke.sciencemag.org/content/sigtrans/11/525/eaao3428.fullhttp://stm.sciencemag.org/content/scitransmed/9/374/eaai9338.fullhttp://stke.sciencemag.org/content/sigtrans/9/444/ra88.full

REFERENCES

http://stke.sciencemag.org/content/10/509/eaan6282#BIBLThis article cites 32 articles, 12 of which you can access for free

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

registered trademark of AAAS.is aScience Signaling Association for the Advancement of Science. No claim to original U.S. Government Works. The title

York Avenue NW, Washington, DC 20005. 2017 © The Authors, some rights reserved; exclusive licensee American (ISSN 1937-9145) is published by the American Association for the Advancement of Science, 1200 NewScience Signaling

on May 17, 2019

http://stke.sciencemag.org/

Dow

nloaded from