cardiomyocyte differentiation of mouse and human embryonic stem cells

J. Anat.

(2002)

200

, pp233–242

© Anatomical Society of Great Britain and Ireland 2002

Blackwell Science Ltd

REVIEW

Cardiomyocytes from embryonic stem cells

Cardiomyocyte differentiation of mouse and human embryonic stem cells*

C. Mummery,

1

D. Ward,

1

C. E. van den Brink,

1

S. D. Bird,

1

P. A. Doevendans,

2

T. Opthof,

3

A. Brutel de la Riviere,

4

L. Tertoolen,

1

M. van der Heyden

3

and M. Pera

5

1

Hubrecht Laboratory, Utrecht, the Netherlands

2

Interuniversity Cardiology Institute of the Netherlands, Utrecht, the Netherlands

3

Department of Medical Physiology, and

4

Department of Cardiothoracic Surgery, University Medical Centre, Utrecht, the Netherlands

5

Monash Institute of Reproduction and Development, Melbourne, Australia

Abstract

Ischaemic heart disease is the leading cause of morbidity and mortality in the western world. Cardiac ischaemia

caused by oxygen deprivation and subsequent oxygen reperfusion initiates irreversible cell damage, eventually

leading to widespread cell death and loss of function. Strategies to regenerate damaged cardiac tissue by cardio-

myocyte transplantation may prevent or limit post-infarction cardiac failure. We are searching for methods for

inducing pluripotent stem cells to differentiate into transplantable cardiomyocytes. We have already shown that

an endoderm-like cell line induced the differentiation of embryonal carcinoma cells into immature cardiomyoctyes.

Preliminary results show that human and mouse embryonic stem cells respond in a similar manner. This study

presents initial characterization of these cardiomyocytes and the mouse myocardial infarction model in which we

will test their ability to restore cardiac function.

Key words

cardiomyocyte markers; differentiation; electrophysiology.

Introduction

Pluripotent stem cells from various sources could be

used to replace specialized cells lost or malfunctioning

as a result of disease. Transplantation of cardiomyocytes

could thus be a treatment for cardiac failure. However,

much basic research will be required before cell trans-

plantation therapy is transformed from a media item

into serious clinical practice. For example, for most

potential clinical applications, it is entirely unclear what

the most suitable source of pluripotent stem cells for

the derivation of transplantable cells might be. Human

embryonic stem cells are one option but it will be

necessary to generate large numbers of functionally

mature cells either

in vitro

or after transplantation

in

vivo

for cardiac function (for example) to be restored.

The first step is to control differentiation. Molecular

pathways that lead to specification and terminal differ-

entiation of cardiomyocytes from embryonic mesoderm

during development are not entirely clear but data largely

derived from amphibian and chick, and more recently

from mouse, have suggested that signals emanating

from endoderm in the early embryo may be involved in

both processes. Tissue recombination experiments have

shown that, for example, in chick, primitive hypoblast

(endoderm) induces cardiogenesis in posterior epiblast

(ectoderm) (Yatskievych et al. 1997), while in

Xenopus,

endoderm and Spemann organizer synergistically induce

cardiogenesis in embryonic mesoderm undergoing

erythropoiesis (Nascone & Mercola, 1995). In addition,

the zebrafish mutant

casanova

, which lacks endoderm,

also exhibits severe heart anomalies.

We have previously isolated various cell lines by clon-

ing from a culture of P19 EC cells treated as aggregates

Correspondence

Dr C. Mummery, Hubrecht Laboratory, Netherlands Institute for Developmental Biology, Uppsalalaan 8, 3584 CT Utrecht, the Netherlands. E-mail: [email protected]*From a paper presented at the International Symposium on Embryonic Stem Cells – Prospects for Human Health, at the University of Sheffield, UK, 10 September 2001.

Accepted for publication

18 January 2002

JOA_031.fm Page 233 Tuesday, March 26, 2002 9:41 AM

Cardiomyocytes from embryonic stem cells, C. Mummery et al.


234

in suspension (embryoid bodies) with retinoic acid, before

replating (Mummery et al. 1985). One of these cell

lines, END-2, has characteristics of visceral endoderm

(VE), expressing alpha fetoprotein and the cytoskeletal

protein ENDO-A. When undifferentiated P19 EC cells are

plated on to a confluent monolayer of these END-2

cells, they aggregate spontaneously and within a week

differentiate to cultures containing areas of beating

muscle at high frequency (Mummery et al. 1991). This

was not observed in co-cultures with other differentiated

clonal cell lines from P19 EC that did not express

characteristics of VE. Differentiation to beating muscle,

however, was observed when aggregates of P19 EC cells

were grown in conditioned medium from END-2 cells,

although not in the absence of conditioned medium.

This effect was inhibited by activin A (van den Eijnden-van

Raaij et al. 1991). More recently, we have observed similar

effects on mouse embryonic stem (mES) cells, as reported

previously by Rohwedel et al. (1994) using the same

END-2 cells. In addition, Dyer et al. (2001) have shown that

END-2 cells also induce the differentiation of epiblast

cells from the mouse embryo to undergo hematopoie-

sis and vasculogenesis and respecify prospective

neurectodermal cell fate, an effect they show to be

largely attributable to Indian hedgehog (Ihh), a factor

secreted by END-2 cells and VE from the mouse embryo.

Here we present preliminary results showing similar

effects in hES cells (Reubinoff et al. 2000) co-cultured

with END-2 cells, including the appearance of beating

muscle. By contrast, in a pluripotent hEC cell line, GCT27X

(Pera et al. 1989), aggregation takes place in the co-

culture, but we found no evidence of beating muscle.

Characterization of the hES-derived cardiomyocytes has

been initiated. Although the spontaneous differenti-

ation to cardiomyocytes of a subclone of one other hES

cell line in embryoid bodies has also recently been reported

(Kehat et al. 2001), we believe that the present study is

the first description of the induction of cardiomyocyte

differentiation in hES cells. The myocardial infarction

(MI) model in mice, in which we will test cardiomyocyte

function after transplantation, is described.

Materials and methods

Co-culture

END-2 cells, P19 EC, hEC and hES cells were cultured as

described previously (Mummery et al. 1985, 1991; van

den Eijnden-van Raaij et al. 1991; Slager et al. 1993;

Reubinoff et al. 2000). The hES2 cell line from ESI

(Reubinoff et al. 2000) was used in all experiments. To

initiate co-cultures, mitogenically inactive END-2 cell

cultures, treated for 1 h with mitomycin C (10

µ

g mL

–1

),

as described previously (Mummery et al. 1991), replaced

mouse embryonic fibroblasts (MEFs) as feeders for hEC,

mES and hES. Co-cultures with P19EC, which are feeder-

independent, were initiated and maintained as described

previously (Mummery et al. 1991). Cultures were then

grown for 2–3 weeks and scored for the presence of

areas of beating muscle from 5 days onwards.

Isolation of primary human adult cardiac cells

Human atrial cells from surgical biopsies served as a

control for antibody staining, electrophysiology and

characterization of ion channels by RT-PCR. Cardiac tissue

was obtained with consent from patients undergoing

cardiac surgery. Atrial appendages routinely removed

during surgery were immediately transferred to ice cold

Krebs–Ringer (KR) saline solution. Tissues were trimmed

of excess connective and adipose tissue and washed

twice with sterile KR solution. Myocardial tissue was

minced with sterile scissors, then dissociated to release

individual cells by a three-step enzymatic isolation pro-

cedure using published methods (Peeters et al. 1995).

The first step involved a 15-min incubation with

4.0 U mL

–1

protease type XXIV (Sigma, St Louis, MO,

USA) at 37

°

C. Tissues were then transferred to a

solution consisting of collagenase 1.0 mg mL

–1

and

hyaluronidase 0.5 mg mL

–1

, followed by three further

incubations with collagenase (1.0 mg mL

–1

) for 20 min

each at 37

°

C. Tissue extracts were combined and the

calcium concentration restored to 1.79 mmol L

–1

. Cardio-

myocytes were transferred to tissue culture medium

M199 enriched with 10% FBS, penicillin (100 U mL

–1

)/

streptomyocin (100

µ

g mL

–1

), 2.0 mmol L

–1

L-carnitine,

5.0 mmol L

–1

creatine, 5.0 mmol L

–1

taurine and seeded

directly on to glass cover-slips coated with 50

µ

g mL

–1

poly L-lysine and cultured overnight.

Immunocytochemistry

Attached primary cardiomyocytes, mES (E14 and R1)

and hES-derived cardiomyocytes were fixed with 3.0%

paraformaldehyde in PBS with Ca

2+

and Mg

2+

for 30 min

at room temperature, then permeabilized with 0.1%

triton X 100 in PBS for 4 min. Immunocytochemistry

was performed by standard methods using monoclonal

JOA_031.fm 34 Tuesday, March 26, 2002 9:41 AM



235

antibodies directed against sarcomeric proteins including

α

-actinin and tropomyosin (Sigma). Antibodies specific

for isoforms of myosin light chain (MLC2a/2v) were

used to distinguish between atrial and ventricular cells

(gift of Dr Ken Chien) (Table 1). Secondary antibodies

were from Jackson Immunoresearch Laboratories. Cul-

tured cardiac fibroblasts served as a negative control

for sarcomeric proteins and cells were visualized using

a Zeiss Axiovert 135M epifluorescence microscope (Carl

Zeiss, Jena GmbH, Germany). Images were pseudocol-

oured using image processing software.

Semi-quantitative RT-PCR for ion channel expression

P19EC cells were differentiated into beating muscle

by the aggregation protocol in the presence of 1%

dimethyl sulphoxide (Rudnicki & McBurney, 1987). After

16 days in these culture conditions, beating areas were

excised and RNA was isolated using Trizol (Gibco) and

reversed transcribed using M-MLV-RT (Gibco). Primers

for cardiac actin (Lanson et al. 1992), MLC2v (Meyer

et al. 2000), ERG (Lees-Miller et al. 1997) and Kir2.1

(Vandorpe et al. 1998), were used as described previ-

ously. Primers for mouse

L

-type calcium channel sub-

unit

α

1c (sense 5

′

-CCAGATGAGACCCGCAGCGTAA;

antisense 5

′

-TGTCTGCGGCGTTCTCCATCTC; GenBank

accession no. L01776; product size 745 bp), Scn5a

(sense 5

′

-CTTGGCCAAGATCAACCTGCTCT; antisense 5

′

-

CGGACAGGGCCAAATACTCAATG; AJ271477; 770 bp)

and

β

-tubulin (sense 5

′

-TCACTGTGCCTGAACTTACC;

antisense 5

′

-GGAACATAGCCGTAAACTGC; X04663;

319 bp) were designed using VectorNTI software

(InforMax, North Bethesda, MD, USA).

Patchclamp electrophysiology

Experiments were performed at 33

°

C, using the whole

cell voltage clamp configuration of the patch-clamp

technique. After establishment of the gigaseal the action

potentials were measured in the current clamp mode.

The data were recorded from cells in spontaneously

beating areas using an Axopatch 200B amplifier (Axon

Instruments Inc., Foster City, CA, USA). Output signals

were digitized at 2 kHz using a Pentium III equipped

with an AD/DAC LAB PC+ acquisition board (National

Instruments, Austin, TX, USA). Patch pipettes with a

resistance between 2 and 4 M

Ω

were used. Composition

of the bathing medium was 140 m

M

NaCl, 5 m

M

KCl,

2 m

M

CaCl

2

, 10 m

M

HEPES, adjusted to pH 7.45 with

NaOH. Pipette composition: 145 m

M

KCl, 5 m

M

NaCl,

2 m

M

CaCl

2

, 10 m

M

EGTA, 2 m

M

MgCl

2

, 10 m

M

HEPES,

adjusted to pH 7.30 with KOH.

Myocardial infarction model in mice

In order to test the ability of stem-cell-derived cardio-

myocytes to restore cardiac function, a MI model is

being developed in mice. In pentobarbital anaesthet-

ized adult mice, the chest is opened through a

midsternal approach. The anterior descending branch

is identified and ligated. Successful procedures induce

a discoloration of the distal myocardium. The chest is

closed with three sutures and the animal is allowed

to recover. In total, 17 animals have been operated on

to date. Seven received a sham procedure including

positioning of the suture and 10 were ligated. Four

weeks after MI the mice were anaesthetized again

using the same medication by intraperitoneal injection.

For the haemodynamic study the animals were

intubated, and connected to a rodent respirator

(Hugo Sachs Electronics, March – Hugstetten Germany).

Instrumentation was performed with the chest

closed by introducing a catheter into the jugular vein.

A 1.4 French conductance-micromanometer (Millar

Instruments, Houston, TX, USA) was delivered to the

left ventricle through the carotid artery. Pressure

and conductance measurements were recorded using

Sigma SA electronic equipment (CDLeycom, Zoetermeer,

the Netherlands) and stored for offline analysis. A typ-

ical pressure volume (PV) loop recorded in a normal

heart is presented in Fig. 5(a). From the PV-loops many

haemodynamic parameters can be deduced including

Table 1 Antibodies used to stain atrial cardiomyocytes

Primary antibody Dilution Secondary antibody Dilution

Mouse anti-α-actinin IgG 1 : 800 Goat anti-mouse IgG-cy3/FITC conjugated 1 : 250Mouse anti-tropomyosin IgG 1 : 50 Goat anti-mouse IgG-cy3 conjugated 1 : 250Polyclonal rabbit anti-mouse mlc-2a (atrial) 1 : 500 Goat anti-rabbit IgG-cy3 conjugated 1 : 250Hoechst (nucleic acid) 1 : 500




236

the end-systolic PV relationship (ESPVR) and preload

recruitable stroke work (PRSW).

Results

mEC – END-2 co-cultures

Two days after initiation of co-cultures with END-2 cells,

P19 EC cells aggregated spontaneously and 7–10 days

later many of the aggregates contained areas of beating

muscle (Fig. 1a), as described previously (Mummery

et al. 1991). Electrophysiology and RT-PCR showed that

functional ion channels characteristic of embryonic cardio-

myocytes were expressed in these cells (Fig. 2a, Table 2).

mES – END-2 co-cultures

Two independent mouse ES cell lines (E14 and R1)

were tested for their response to co-culture conditions.

The cultures were initiated as single cell suspen-

sions, but within 3 days large aggregates were evident

for both cell lines (Fig. 1b,c). Almost simultaneously,

extensive areas of spontaneously beating cardio-

myocytes were evident in the R1 ES cell cultures,

although only 7 days later were (smaller) areas of beat-

ing muscle found in the E14 ES cells. Cells in beating

areas exhibited the characteristic sarcomeric banding

pattern of myocytes when stained with

α

-actinin (see

Fig. 4d).

hEC – and END-2 co-cultures

The human EC cell line GCT27X is a feeder-dependent,

pluripotent EC cell line, with characteristics similar to

human ES cells (Pera et al. 1989). In co-culture with END-2

cells, formation of large aggregates was observed (Fig. 1d).

However even after 3 weeks, there was no evidence of

beating muscle.

hES – END-2 co-cultures

During the first week of co-culture, the small aggragates

of cells gradually spread and differentiated to cells with

mixed morphology but with a relatively high propor-

tion of epithelial-like cells. By the second week, these

swelled to fluid-filled cysts (not shown). Between these,

distinct patches of cells become evident which begin to

beat a few days later. Between 12 and 21 days, more

of these beating patches appear (e.g. Fig. 1e). Overall,

15–20% of the wells contains one or more areas of

beating muscle. Beating rate is approximately 60 min

–1

and is highly temperature sensitive, compared with mouse

ES-derived cardiomyocytes. These cells stain positively

with

α

-actinin, confirming their muscle phenotype

(Fig. 4e). In contrast to mES and P19EC-derived cardio-

myocytes, however, the sarcomeric banding patterns

were poorly defined but entirely comparable with prim-

ary human cardiomycytes grown for only 2 days in

culture (Figs 3 and 4a–c). It is clear that while primary

human cardiomycytes initially retain the sarcomeric

structure, standard culture conditions result in its rapid

deterioration (Fig. 3). It may be assumed that hES cul-

ture conditions are not optimal for cardiomyocytes so

that the hES-derived cardiomyocytes similarly exhibit a

deterioration in their characteristic phenotype. It will

be essential to optimize these conditions to obtain fully

functional cardiomyocytes from stem cells in culture.

Despite deterioration in sarcomeric structure, hES-

derived cardiomyocytes continued to beat rhythmically

over several weeks and action potentials were detect-

able by current clamp electrophysiology (Fig. 2b),

performed by inserting electrodes into aggregates, as

shown in Fig. 2(c). However, carrying out electrophysio-

logy in this manner, i.e. in aggregates rather than

single cells, yields action potentials that are the accu-

mulated effects of groups of cells. They are therefore

difficult to interpret and to attribute to either ventri-

cular, atrial or pacemaker cells. Work is currently in

progress to dissociate and replate aggregates to allow

single cell determinations.

Cardiac ion channel expression during stem cell

differentiation

The order in which ion currents, responsible for the

subsequent phases of the adult action potential, appear

during heart development has been established in elec-

trophysiological studies (Davies et al. 1996; Yasui et al.

2001). Inward

L

-type Ca

2+

currents play a dominant role

during early cardiac embryogenesis, whereas inward

Na

2+

currents increase only just before birth (An et al.

1996; Davies et al. 1996). Mouse ES and P19 EC cells dis-

play similar timing in ion current expression (Maltsev

et al. 1994; Wobus et al. 1994). To unravel the sequence

of ion-channel expression at the molecular level during

differentiation of P19 EC cells, we performed RT-PCR on

RNA isolated from undifferentiated and 16-day-old

beating clusters of P19-derived cardiomyocytes and




237

Fig. 1 Co-cultures of stem cells with the mouse visceral endoderm-like cell line END-2. (a) P19 EC in normal monolayer culture, 3 days after initiation of co-culture with END-2 cells and after 10 days, when beating muscle (B.M.) is evident. (b) mES cell line R1 in monolayer on its normal ‘feeder’ cells (SNL), 3 days after initiation of co-culture and 2 days later, when beating muscle is evident. (c) as (b), with the exception that B.M. is evident on day 7 after aggregation. (d) GCT27X human EC cell line on mouse embryonic fibroblast (MEF) feeder cells, 3 days after initiation of co-culture and after 16 days. No beating muscle is present. (e) hES cells on MEF feeders, 3 days after initiation of END-2 co-culture and beating muscle formed after 11 days.




238

Fig. 2 Electrophysiological characteristics of cardiomyocytes from stem cells. Repetitive action potentials recorded from spontaneously beating areas. (a) In mouse P19 EC cell-derived cardiomyocytes. (b) In an aggregate of hES-derived cardiomyocytes. (c) Phase contrast image of the beating area in the hES culture from which the recording showed in (b) was derived. (Note the height of the protruding structure where the beating region is located, 20× objective.)

Fig. 3 Isolated cardiomyocytes: (a) exhibiting sharp edges and well-defined sarcomeres in contrast with cells cultured for 2 days (b) which had disorganized sarcomeric patterning. (a) is a phase contrast image of multiple cells after isolation and fixation. (b) represents a single cell, digitally magnified 2× compared with (a).




239

compared these with expression in adult mouse heart

(Table 2). Expression of cardiac markers cardiac actin

and MLC2v is detected in EC cell cultures but increases

in P19-derived cardiomyocytes. At the protein level, no

MLC2v is detected in EC cells, while prominent expres-

sion is found in P19-derived cardiomyocytes (data not

shown). Likewise, RNA for calcium, sodium and potas-

sium channels can be detected in EC cells. Calcium

channel RNA level (

α

1c) is up-regulated in P19-derived

cardiomyocytes, while sodium channel RNA (Scn5a)

remains at initial levels. Furthermore, RNA for the delayed

rectifier potassium channel (ERG) also remains unchanged.

Inward rectifier Kir2.1 RNA cannot be detected in EC

cells, but becomes expressed after cardiomyocyte

differentiation, albeit at low levels compared to adult

heart. These data are compatible with the action

potential of day 16 P19 cardiomyocytes (Fig. 2a), i.e.

a low upstroke velocity (I

Ca

mainly instead of I

Na

), a

EC CMC Heart Ion channel and current

cardiac actin + + + + + + + +MLC2v + + + + + + + + +α1c + + + + + + + + L-type calcium channel, ICa

Scn5a + + + + + + + Heart specific sodium channel, INa

ERG + + + + + + + + Delayed rectifier potassium channel, IKr

Kir2.1 – + + + + + Voltage-gated potassium channel, IK1

Tubulin + + + + + + + + +

Table 2 Relative levels of cardiac marker and ion channel mRNA expression as determined by semiquantitative RT-PCR. Identical amounts of cDNA of undifferentiated P19 (EC), differentiated P19 cardiomyocytes (CMC) and adult mouse heart (Heart) were PCR amplified for the indicated gene products. Relative levels for each product are indicated

Fig. 4 Immunocytochemistry on adult human primary atrial cardiomyocytes and stem cell-derived cardiomyocytes. Primary atrial cardiomyocytes stained positive for sarcomeric proteins including (green) α-actinin, (red) mlc-2a (a) and tropomyosin (b). Cell DNA was stained with (blue) Hoechst to distinguish normal and apoptotic cells. Cells cultured for 2 days had a disorganized tropomyosin sarcomeric patterning and diffuse antibody staining (c). mES-derived cardiomyocytes also show sharp banding when stained with α-actinin (d) but in hES-derived cardiomyocytes α-actinin is diffuse and poorly banded (not shown). (e) shows overall extensive α-actinin staining in hES-derived cardiomyocytes at low magnification.




240

relatively positive resting membrane potential between

–40 and –60 mV (little to no IK1). These results indic-

ate that day 16 P19 cardiomyocytes resemble fetal

cardiomyocytes with respect to ion channel expression,

as has been described previously for mES-derived cardio-

myocytes (Doevendans et al. 1998, 2000).

MI model in mice

In order to test the effectiveness of cardiomyocyte

transplantation

in vivo

, it is important to have a repro-

ducible animal model with a measurable parameter of

cardiac function. The parameters used should clearly

distinguish control and experimental animals (see for

example Palmen et al. 2001) so that the effects of trans-

plantation can be adequately determined. PV relation-

ships are a measure of the pumping capacity of the

heart and could be used as a read-out of altered cardiac

function following transplantation. Here, we have tested

aspects of a procedure towards establishing an MI model

in immunodeficient mice as a ‘universal acceptor’ of

cardiomyocytes from various sources. The infarct size

obtained through occluding the anterior descending

coronary artery encompassed 30–50% of the left ven-

tricular circumference. The septum involvement can be

neglected in mice, resulting in more than 94% survival

after 4 weeks (one infarcted animal died). A 30% increase

in left ventricular volume was recorded with conserved

contractility post MI. There were significant differences

in ESPVR (22.6 sham vs. 10 post MI,

P

< 0.05), and PRSW

(81.2 sham vs. 43.5 post MI,

P

< 0.05). This is easily visu-

alized by comparing the shapes of the ‘PV loops’ in

sham-operated vs. infarcted mice in Fig. 5(a,b).

Despite maintained left ventricular contractile func-

tion, this mouse MI model provides a reproducible

system for studying left ventricular remodelling, making

it feasible to assess the extent of cardiac repair follow-

ing transplant interventions.

Conclusions

The results of the work described here show that VE-

like cells induce/promote differentiation of pluripotent

cells to cardiomyocytes. These cells include pluripotent

mouse EC cells, mouse ES as well as human ES cells, which

are now documented for the first time to respond to

inductive cues derived from cells similar to those norm-

ally adjacent to the region of heart development in

the embryo. The results also showed that the capacity

of different mES cell lines to differentiate to cardio-

myocytes is variable. We have so far tested only one hES

cell line for endoderm co-culture responses and it is not

unlikely that different hES cell lines equally show variable

capacities for differentiation. This remains to be tested.

Kehat et al. (2001) have also showed that subclone 9.2

of H9 hES cells (Thomson et al. 1998; Amit et al. 2000)

will also differentiate to cardiomyocytes. The H9.2 cells,

however, form embryoid bodies when grown as aggre-

gates in suspension, rather like mES cells but unlike

hES2 cells. The significance of differences between these

cell lines remains to be resolved. An interesting experi-

ment would be to subject the H9 cell line and/or its

subclones to our cardiomyocyte inductive conditions.

Pluripotent mouse stem cells differentiate to

cardiomyocytes with embryonic rather than mature

characteristics. It is unclear what the phenotype of

hES-derived cardiomyocytes precisely is and, indeed, the

phenotypic characteristics of primary human cardio-

myocytes (ventricular vs. atrial, fetal vs. adult) are

insufficiently detailed for comparisons to be made dir-

ectly between various human sources. Mouse and rat

cardiomycytes are at present the best reference tissues.

Fig. 5

Haemodynamic assessment of left ventricular function in mice. (a) Normal loop representing the relationship between volume and pressure changes in the mouse heart: indicated are the valvular events and stages during one cycle of contraction and relaxation. (b) Pressure volume relationship 4 weeks post-myocardial infarction: note the difference in the shape of the loop and the alterations in both contraction and relaxation.




241

We have also shown here that primary adult human

cardiomyocytes have a sharply defined morphology

and sarcomeric banding pattern in culture but within a

few days this deteriorates, presumably because culture

conditions are suboptimal for these highly sensitive cells.

Likewise, hES-derived cardiomycytes express appropriate

markers and display action potentials but under present

conditions have a relatively poor morphology. This con-

trasts with mouse ES-derived cardiomyocytes, which

maintain morphology under standard culture condi-

tions. An immediate aim is then to optimize culture

conditions for primary cardiomyocytes and apply these

to the hES derivatives. The MI model in mice provides a

means of functional analysis of cardiomyocytes after

transplantation. Transfer to immunodeficient mice will

make it suitable for comparing human and mouse

cardiomyocytes from different sources for their ability

to restore cardiac function after infarct. Once the

efficiency of cardiomyocyte differentiation and cul-

ture conditions for cardiomyocytes have been improved,

we will use this model to evaluate effects on cardiac

function

in vivo.

Acknowledgments

Part of this study (M.vdH.) is financed by NWO-MW,

Embryonic Stem Cell International (S.D.B.), Netherlands

Interuniversity Cardiology Institute (D.W.). hES cells

(lines 1 and 2) were supplied by Embryonic Stem Cell

International. We thank Daniel Lips (University of

Maastricht) and Teun de Boer for Fig. 5(b) and contri-

butions to the electrophysiology, respectively.

References

Amit M, Carpenter MK, Inokuma MS, Chiu CP, Harris CP,Waknitz MA

,

et al.

(2000) Clonally derived human embryonicstem cell lines maintain pluripotency and proliferativepotential for prolonged periods of culture.

Dev. Biol

.

227

,271–278.

An RH, Davies MP, Doevendans PA, Kubalak SW, Bangalore R,Chien KR

,

et al.

(1996) Developmental changes in beta-adrenergic modulation of 1-type Ca

2+

channels in embryonicmouse heart.

Circ. Res

.

78

, 371–378.

Davies MP, An RH, Doevendans P, Kubalak S, Chien KR, Kass RS

(1996) Developmental changes in ionic channel activity inthe embryonic murine heart.

Circ. Res

.

78

, 15–25.

Doevendans PA, Daemen M, de Muinck E, Smits J

(1998)Cardiovascular phenotyping in mice.

Cardiovasc. Res

.

39

,34–49.

Doevendans PA, Kubalak SW, An RH, Becker DK, Chien KR,Kass RS

(2000) Differentiation of cardiomyocytes in floating

embryoid bodies is comparable to fetal cardiomyocytes.

J. Mol. Cell Cardiol

.

32

, 839–851.

Dyer MA, Farrington SM, Mohn D, Munday JR, Baron MH

(2001) Indian hedgehog activates hematopoiesis and vasculo-genesis and can respecify prospective neurectodermal cellfate in the mouse embryo.

Development

128

, 1717–1730.

van den Eijnden-van Raaij AJ, van Achterberg TA, van derKruijssen CM, Piersma AH, Huylebroeck D, de Laat SW

,

et al.

(1991) Differentiation of aggregated murine P19embryonal carcinoma cells is induced by a novel visceralendoderm-specific FGF-like factor and inhibited by activin A.

Mech Dev

.

33

, 157–165.

Kehat I, Kenyagin-Karsenti D, Snir M, Segev H, Amit M,Gepstein A

,

et al.

(2001) Human em, bryonic stem cells candifferentiate into myocytes with structural and functionalproperties of cardiomyocytes.

J. Clin. Invest

.

108

, 407– 414.

Lanson Jr NA, Glembotski CC, Steinhelper ME, Field LJ,Claycomb WC

(1992) Gene expression and atrial natriureticfactor processing and secretion in cultured AT-1 cardiacmyocytes.

Circulation

85

, 1835–1841.

Lees-Miller JP, Kondo C, Wang L, Duff HJ

(1997) Electrophysio-logical characterization of an alternatively processed ERGK

+

channel in mouse and human hearts.

Circ. Res

. 81, 719–726.

Maltsev VA, Wobus AM, Rohwedel J, Bader M, Hescheler J(1994) Cardiomyocytes differentiated in vitro from embry-onic stem cells developmentally express cardiac specificgenes and ionic currents. Circ. Res. 75, 233–244.

Meyer N, Jaconi M, Landopoulou A, Fort P, Puceat M (2000) Afluorescent reporter gene as a marker for ventricular spe-cification in ES-derived cardiac cells. FEBS Lett. 478, 151–158.

Mummery CL, Feijen A, van der Saag PT, van den Brink CE,de Laat SW (1985) Clonal variants of differentiated P19embryonal carcinoma cells exhibit epidermal growth factorreceptor kinase activity. Dev. Biol. 109, 402–410.

Mummery CL, van Achterberg TA, van den Eijnden-van Raaij AJ,van Haaster L, Willemse A, de Laat SW, et al. (1991) Visceral-endoderm-like cell lines induce differentiation of murineP19 embryonal carcinoma cells. Differentiation 46, 51–60.

Nascone N, Mercola M (1995) An inductive role for the endo-derm in Xenopus cardiogenesis. Development 121, 515–523.

Palmen M, Daemen M, Bronsaer R, Smits J, Doevendans PA(2001) Cardiac remodeling but not cardiac function isimpaired in IGF-1 deficient mice after chronic myocardialinfarction. Cardiovasc. Res. 50, 516–524.

Peeters GA, Sanguinetti MC, Eki Y, Konarzewska H, RenlundDG, Karwande SV, et al. (1995) Method for isolation ofhuman ventricular myocytes from single endocardial andepicardial biopsies. Am. J. Physiol. 268, H1757–H1764.

Pera MF, Cooper S, Mills J, Parrington JM (1989) Isolation andcharacterization of a multipotent clone of human embryo-nal carcinoma cells. Differentiation 42, 10–23.

Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A (2000)Embryonic stem cell lines from human blastocysts: somaticdifferentiation in vitro. Nat. Biotechnol. 18, 399–404.

Rohwedel J, Maltsev V, Bober E, Arnold HH, Hescheler J,Wobus AM (1994) Muscle cell differentiation of embryonicstem cells reflects myogenesis in vivo: developmentally regu-lated expression of myogenic determination genes and func-tional expression of ionic currents. Dev. Biol. 164, 87–101.




242

Rudnicki MA, McBurney MW (1987) Cell culture methods ofinduction of differentiation of embryonal carcinoma celllines. Teratocarcinomas and Embryonic Stem Cells, a PracticalApproach (ed. Robertson EJ), pp. 19–49. Oxford: IRL Press.

Slager HG, Van Inzen W, Freund E, Van den Eijnden-Van RaaijAJ, Mummery CL (1993) Transforming growth factor-beta inthe early mouse embryo. implications for the regulation ofmuscle formation and implantation. Dev. Genet. 14, 212–224.

Thomson JA, Itskovitch-Eldor J, Shapiro SS, Waknitz MA,Swiergiel JJ, Marshall VS, et al. (1998) Embryonic stem celllines derived from human blastocysts. Science 282, 1145–1147.

Vandorpe DH, Shmukler BE, Jiang L, Lim B, Maylie J, Adelman JP,et al. (1998) cDNA cloning and functional characterization

of the mouse Ca2+-gated K+ channel, mIK1. J. Biol. Chem.273, 21542–21553.

Wobus AM, Kleppisch T, Maltsev V, Hescheler J (1994)Cardiomyocyte-like cells differentiated in vitro fromembryonic carcinoma cells P19 are characterized by functionalexpression of adrenoceptor and Ca2+ channels. In Vitro Cell.Dev. Biol. 30A, 425–434.

Yasui K, Liu W, Opthof T, Kada K, Lee J-K, Kamiya K, Kodama I(2001) If current and spontaneous activity in mouse embry-onic ventricular myocytes. Circ. Res. 88, 536–542.

Yatskievych TA, Ladd AN, Antin PB (1997) Induction of cardiacmyogenesis in avian pregastrula epiblast: the role of thehypoblast and activin. Development 124, 2561–2570.


cardiomyocyte differentiation of mouse and human embryonic stem cells

Documents