ccctc-binding factor controls the homeostasis of epidermal langerhans cells … · 2019-06-28 · i...
TRANSCRIPT
저 시-비 리- 경 지 2.0 한민
는 아래 조건 르는 경 에 한하여 게
l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.
다 과 같 조건 라야 합니다:
l 하는, 저 물 나 포 경 , 저 물에 적 된 허락조건 명확하게 나타내어야 합니다.
l 저 터 허가를 면 러한 조건들 적 되지 않습니다.
저 에 른 리는 내 에 하여 향 지 않습니다.
것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.
Disclaimer
저 시. 하는 원저 를 시하여야 합니다.
비 리. 하는 저 물 리 목적 할 수 없습니다.
경 지. 하는 저 물 개 , 형 또는 가공할 수 없습니다.
CCCTC-binding factor
controls the homeostasis of
epidermal Langerhans cells and
adult hematopoietic stem cells
Taegyun Kim
Department of Medical Science
The Graduate School, Yonsei University
i
CCCTC-binding factor
controls the homeostasis of
epidermal Langerhans cells and
adult hematopoietic stem cells
Directed by Professor Hyoung-Pyo Kim
The Doctoral Dissertation
submitted to the Department of Medical Science,
the Graduate School of Yonsei University
in partial fulfillment of the requirements for the degree of
Doctor of Philosophy
Taegyun Kim
December 2016
ii
This certifies that the Doctoral
Dissertation of Taegyun Kim is approved.
_________________________________________
Thesis Supervisor: Hyoung-Pyo Kim
_________________________________________
Thesis Committee Chair: Kwang Hoon Lee
_________________________________________
Thesis Committee Member: Jongsun Kim
_________________________________________
Thesis Committee Member: Chae Gyu Park
_________________________________________
Thesis Committee Member: Sun-Young Chang
The Graduate School
Yonsei University
December 2016
iii
“Never Lose A Holy Curiosity”
Albert Einstein
iv
ACKNOWLEDGEMENT
First of all, I thank God for his love and guidance on my life.
I am deeply indebted to my supervisor, professor Hyoung-Pyo Kim,
whose stimulating suggestion and encouragement helped me
throughout my work. His invaluable scientific inputs and our exciting
discussions were the highlight during my PhD life. Thank you for
guiding me how to ask questions and do the science.
I wish to express my sincere thanks to my committee members,
professors Kwang Hoon Lee, Jongsun Kim, Chae Gyu Park, and Sun-
Young Chang for their constructive advices and guidance.
I would like to deeply thank my dermatology mentor, professor Min-
Geol Lee, who firstly showed me the importance of basic science in
medicine and encouraged me to accomplish this research career.
I could not forget the warm supports from the lab members, Sueun
Kim, Mikyoung Kim, Soyeon Jung, Min-Ji Song, Yeeun Choi, Jong-
Joo Lee, Youn Wook Chung, Keunhee Park, and Joo-Hong Park. I
sincerely wish their great success in science.
I would like to thank my parents and parents-in-law for their never-
ending support. Their generous sacrifices have greatly allowed my
scientific pursuits and led me to devoting myself to the nature of
science.
v
Last but not least, I wish to deeply thank my beloved wife, Sue and
adored daughter, Saeon for their generous understanding and endless
belief on my choices in life. Without their personal sacrifices and
supports, I could not finish this long journey. I love you.
vi
TABLE OF CONTENTS
Title ····················································································i
Signature page ······································································ ii
Proverb ·············································································· iii
Acknowledgement ································································· iv
Table of contents ·································································· vi
List of figures ······································································ xi
List of tables ······································································xiv
ABSTRACT ········································································· 1
I. INTRODUCTION ····························································· 3
1. Langerhans cells····························································· 3
2. Hematopoietic stem cells··················································· 5
3. CCCTC-binding factor ···················································· 8
II. MATERIALS AND METHODS···········································10
1. Mice···········································································10
2. Generation of human monocyte-derived Langerhans cells·········11
vii
3. Viruses and Vpx-containing virus-like particle production ········12
4. Tissue preparation ·························································13
5. Antibodies and flow cytometry ··········································13
6. Whole-mount epidermal sheet staining ································15
7. Immunofluorescence ······················································15
8. Electron microscopy ·······················································15
9. Whole-skin explant culture···············································16
10. In vivo bromodeoxyuridine labeling and analysis ····················17
11. Fluorescein isothiocyanate-induced cutaneous DC migration ·····17
12. Contact hypersensitivity and hapten-specific T-cell responses ····17
13. Croton oil-induced irritant dermatitis ·································18
14. Epicutaneous sensitization and T cell adoptive-transfer············18
15. Clinical and histological evaluation of epicutaneously sensitized
skin············································································19
16. Enzyme-linked immunosorbent assay for OVA-specific antibody
detection ·····································································19
17. Chemotaxis migration assay ·············································20
18. Quantitative real-time polymerase chain reaction ···················20
19. Western blot·································································21
viii
20. Blood cell count·····························································22
21. Bone marrow transplantation ···········································22
22. Cell cycle assays ····························································23
23. Measurement of reactive oxygen species·······························23
24. Colony-forming unit assay ···············································23
25. Microarray ··································································24
26. Statistics ·····································································24
III. RESULTS ·····································································26
PART A. CCCTC-binding factor controls the homeostatic maintenance
and migration of Langerhans cells ············································26
1. Decreased pool of multiple DC lineages in DC-specific CTCF-
deficient mice································································26
2. Reduced cell number with distinct morphological and surface
phenotypes of CTCF-deficient LCs ·····································33
3. CTCF-deficient LCs exhibit reduced homeostatic self-turnover ··36
4. CTCF deficiency impairs the emigration of LCs from the epidermis
·················································································41
ix
5. CTCF inactivation in LCs augments cell adhesion molecule gene
expression····································································49
6. CTCF-dependent LC homeostasis is required for optimal immunity
of the skin····································································53
PART B. CCCTC-binding factor regulates adult hematopoietic stem cell
quiescence in mouse ·····························································60
1. Loss of CTCF leads to rapid BM failure·······························60
2. Acute depletion of CTCF results in rapid shrinkage of c-Kithi HSC
and progenitor pool························································64
3. Loss of CTCF in hematopoietic compartment results in rapid
exhaustion of HSCs ························································68
4. Defective HSC-driven myeloid lineage development by deletion of
CTCF in vivo································································73
5. CLPs and lymphoid lineage cells are less sensitive to CTCF
ablation in vivo ·····························································77
6. CTCF-deficient HSCs are unable to maintain quiescence··········79
IV. DISCUSSION·································································83
V. CONCLUSION·······························································89
x
REFERENCES·····································································90
ABSTRACT (IN KOREAN)··················································· 105
PUBLICATION LIST ·························································· 107
xi
LIST OF FIGURES
Figure 1. Schematic diagram showing Ctcffl/fl mice generation
and CTCF deletion efficiency········································· 27
Figure 2. Decrease in the general pool of DCs in mice with DC-
specific CTCF depletion in vivo ······································ 30
Figure 3. DC-selective CTCF deletion results in a decreased
general DC lineage ······················································ 32
Figure 4. LC-selective loss of CTCF leads to decreases in
epidermal LC numbers and distinct phenotypic characteristics
of LCs ······································································ 34
Figure 5. CTCF-deficient LCs exhibit self-proliferation
impairment································································ 37
Figure 6. Early epidermal LC network formation is comparable
between WT and huLang-cKO mice································ 40
Figure 7. CTCF-deficient LCs are significantly less distributed
in their sequential migratory compartments······················ 42
xii
Figure 8. CTCF-deficient LCs fail to egress from the epidermis
··············································································· 44
Figure 9. CTCF-silenced MDLCs showed a migration defect
toward CCL19 ··························································· 47
Figure 10. CTCF-deficient LCs express higher levels of cell
adhesion molecules ······················································ 51
Figure 11. Prolonged and exaggerated CHS responses with
higher priming of IFN-γ-producing CD8+ T cells in huLang-
cKO mice ·································································· 55
Figure 12. Attenuated epicutaneous sensitization to OVA in
huLang-cKO mice······················································· 58
Figure 13. Acute CTCF ablation leads to hematopoietic failure
··············································································· 62
Figure 14. Acute depletion of CTCF results in severe decrease
in c-Kithi stem/progenitors············································· 66
xiii
Figure 15. CTCF loss in the hematopoietic system leads to
severe BM failure and consequent lethality ······················· 69
Figure 16. CTCF deficiency-mediated HSC depletion is a cell-
autonomous effect ······················································· 72
Figure 17. Loss of CTCF results in exhaustion of myeloid
progenitors and their differentiation ······························· 75
Figure 18. CLP-derived lymphoid differentiation is less
sensitive to CTCF depletion··········································· 78
Figure 19. CTCF-deficiency leads to an augmented cell cycle
progression in HSCs ···················································· 81
xiv
LIST OF TABLES
Table 1. Primer sequences used for real-time qPCR············ 21
1
ABSTRACT
CCCTC-binding factor controls the homeostasis of
epidermal Langerhans cells and adult hematopoietic stem cells
Taegyun Kim
Department of Medical Science
The Graduate School, Yonsei University
(Directed by Professor Hyoung-Pyo Kim)
CCCTC-binding factor (CTCF) is a highly conserved DNA-binding zinc-finger protein
that regulates higher order chromatin organization and is involved in various gene
regulation processes. Although its DNA occupancy is widely distributed throughout the
mammalian genome, there exist cell type-specific CTCF binding patterns which partly
explain its heterogeneous biological functions. Therefore, a functional analysis of CTCF in
each cell type would further expand our knowledge of CTCF. In this dissertation, we focus
on the homeostatic role of CTCF in epidermal Langerhans cells (LCs) and adult
hematopoietic stem cells (HSCs).
LCs are skin-resident dendritic cells (DCs) that orchestrate skin immunity mainly
through presenting cutaneous antigens to T lymphocytes. By using DC- and LC-specific
2
CTCF conditional knockout (cKO) mouse, we demonstrate that CTCF regulates the
homeostatic maintenance of LCs via supporting LC self-turnover in situ. Functionally,
CTCF is required for the efficient cellular emigration of LCs both in the steady and
inflammatory state by suppressing the transcriptional expression of cell adhesion
molecules. This functional feature is closely associated with the enhanced mouse contact
hypersensitivity, but also with the reduced epicutaneous protein sensitization.
Hematopoiesis is a series of lineage differentiation programs initiated from HSCs in the
bone marrow (BM). To maintain lifelong hematopoiesis, HSCs should undergo tightly
regulated self-proliferation and cellular differentiation. By using a tamoxifen-induced
CTCF cKO mouse system and BM transplantation approaches, we demonstrate that CTCF
is a critical regulator for the homeostatic maintenance of adult HSCs by retaining HSC cell
cycle quiescence.
Our study uncovers that CTCF is a pivotal molecular determinant in the homeostatic
maintenance of epidermal LCs and adult HSCs in vivo.
Key words: CCCTC-binding factor, conditional knockout mouse, dendritic cells,
hematopoietic stem cells, homeostasis, Langerhans cells
3
CCCTC-binding factor controls the homeostasis of
epidermal Langerhans cells and adult hematopoietic stem cells
Taegyun Kim
Department of Medical Science
The Graduate School, Yonsei University
(Directed by Professor Hyoung-Pyo Kim)
I. INTRODUCTION
1. Langerhans cells
Langerhans cells (LCs) are migratory dendritic cells (DCs) that reside in the epidermis.
Although LCs were first described as neuronal cells, it is now clear that they are a member
of the antigen-presenting cell family.1 The outermost residence of LCs among the
cutaneous DC subsets may be evolutionally associated with their primary immune-
surveillance of the skin surface where they directly contact with the environmental phase.2
Accordingly, LCs extend their dendrites toward the breaches of epidermal barrier and
actively uptake exterior antigens.2 By doing this, LCs can induce a strong humoral
immunity which confers our body to be protected against certain pathogenic microbial
4
challenges.3 However, this immunological process is also involved in particular allergic
inflammations of the skin including atopic eczema.4
LCs had been the most extensively studied cutaneous DC subset until dermal Langerin+
DCs were characterized. LCs are strong antigen-presenting and T cell-stimulating DCs in
the in vitro system, and these cardinal properties led us to consider that LCs were solely
immunogenic.5 However, the resultant contact hypersensitivity (CHS) studies using
genetically engineered LC-ablating mouse strains have suggested that LCs are not only
immunogenic but also tolerogenic.6,7 In addition, other key studies indicate that there is a
functional compensation and/or redundancy between LCs and Langerin+ dermal DCs in
CHS settings, and both LCs and Langerin+ dermal DCs are somehow involved in CHS
induction. Thus, the role for LCs in diverse skin immune responses is quite context
dependent and further elaboration is still needed to elucidate a categorized function of LCs.
Unlike other cutaneous DC populations, which are continuously replaced by bone
marrow-derived precursors entering the skin, LCs have distinct developmental and
homeostatic properties. LCs are derived from skin-infiltrating myeloid precursors that seed
fetal epidermis at the late stage of embryogenesis.8,9 After birth, LC precursors actively
proliferate and start to gain mature LC markers such as MHC-II and Langerin within the
first week of postnatal period. Subsequent elegant lineage-tracing study showed that those
LC precursors derive from at least two cellular origins, embryonic fetal liver monocytes
and yolk-sac macrophages. After completion of epidermal LC network formation, LCs
maintain their cellular pool by slow self-turnover without any blood precursor input.8,10
5
LCs also demonstrate a unique cytokine dependency for their development and
homeostasis different from those of other conventional DCs. Although most of
conventional DC homeostasis largely depends on Fms-like tyrosine kinase 3 (Flt3) ligand
cytokine signaling, LCs are independent of Flt3 ligand for their homeostasis and
development. Rather, similar to tissue-resident macrophages, LC development strictly
depends on colony-stimulating factor 1 (CSF-1) signaling.11 Recent studies have revealed
that IL-34 was specifically expressed in the stromal components of skin and brain, and IL-
34 was an actual ligand for CSF-1 receptor that supports LC and brain microglia
development in situ.12,13 Another major cytokine that supports LC development and
homeostasis is transforming growth factor beta 1 (TGF-β1). TGF-β1 null mice showed a
lack of epidermal LC, and both LC autocrine and paracrine sources of TGF-β1 were
essential for LC homeostasis.14,15 Interestingly, TGF-β1 signaling on LCs is not only
involved in LC development but also in actively suppressing homeostatic LC migration out
of the epidermis.16 TGF-β1 dependency in LCs has further been supported as a result of
defective LC development in Id2, Runx3, and PU.1 knockout mouse strains, the genes that
are TGF-β1-associated signaling transcription factors.17-19
2. Hematopoietic stem cells
Hematopoiesis in our body is primarily maintained by a complex differentiation
program beginning in hematopoietic stem cells (HSCs).20 The unique and defining
characteristic of HSCs is the ability for self-renewal and multi-lineage differentiation.
6
HSCs give rise to multiple differentiated progenies following a series of hierarchical
differentiation steps through the multipotent progenitors and lineage-restricted precursors.
The most primitive HSCs with the highest multipotent activity are long-term repopulating
HSCs (LT-HSCs) which show self-renewal capacity. In contrast to LT-HSCs, short-term
repopulating HSCs (ST-HSCs) reveal the capacity to contribute transiently to the
production of lymphoid and myeloid cells. The group of heterogeneous multipotent
progenitors (MPPs) is featured by a more limited proliferative potential, but retained
ability to differentiate into various lineage of cells.
HSCs and MPPs can be distinguished by the surface marker expression within the
lineage-negative and Sca-1/c-Kit-positive population which is called LSK fraction
(Lin−Sca-1+c-Kit+) in bone marrow (BM). The SLAM (signaling lymphocyte activation
molecule) family receptors CD150 and CD48 are useful surface markers allowing us to
characterize LT-HSCs (CD150+CD48−), ST-HSCs (CD150−CD48−), and the more lineage-
restricted MPPs (CD48+). Under homeostatic conditions, about 60- 70% of LT-HSCs
remain in a quiescent G0 phase that contributes to their long-term maintenance. The small
fraction of LT-HSCs is in an active dividing state and differentiates into all hematopoietic
cells. This cycling population not only maintains HSC pool by self-renewal but also
produces all blood cells.
The highly regulated differentiation process of the quiescent HSCs is associated with a
variety of cell fate-determining factors. Lifelong HSC perpetuation and function is
preserved by a specific set of transcription factors such as RUNX1, GATA2, GFI1, and
7
TAL1,20-22 and several signaling pathways including Wnt/β-catenin and Notch
pathway.23,24
HSCs should undergo a tightly coordinated molecular regulation to support both HSC
self-renewal and differentiation, and in this regards, there have been several reports
emphasizing the critical role for epigenetic and chromatin modifications.25-27 DNA-
methyltransferases such as Dnmt1 and Dnmt3a are required for HSC homeostasis and
differentiation via down-regulation of myeloid
progenitor-related factors comprising Gata1, Id2, and Cepba.28-30 Dnmt1 was crucial for
HSC self-renewal and lineage-commitment. The ablation of reduced expression of Dnmt1
in murine HSCs led to diminished repopulating capacity of HSCs and decreased
production of lymphoid progenitors accompanied with retained myeloid progenitor
development.28,29 In contrast to Dnmt1, Dnmt3a/3b deficiency affected only the long-term
reconstituting ability of HSCs, but not their differentiation.31 Polycomb group proteins
represent a major class of epigenetic regulators in diverse developmental contexts and
participate in transcriptional repression process.32 The components of polycomb-repressive
complexes including Bmi1,33 Rae28,34 and Ring1B35 have been identified to modulate HSC
fate and function. In addition, histone H2A deubiquitinase Mysm1 is also unveiled to be
necessary to maintain the function of HSCs.36 In line with an emerging importance of
epigenetic changes in the pathogenesis of myelodysplastic syndrome and acute myeloid
leukemia,37 further molecular understanding how HSC homeostasis is maintained by other
8
epigenetic processes would be important for developing new therapeutic strategies in
hematologic diseases.
3. CCCTC-binding factor
CCCTC-binding factor (CTCF) is a highly conserved, 11-zinc finger protein that
contains a DNA-binding domain which shows about 100% homology among the different
mammals.38 Its DNA occupancy is widely distributed throughout the mammalian genome,
and 30–60% of binding is cell type specific, partly due to differences in DNA
methylation.39 It is thought that the extent of CTCF occupancy relies on intrinsic zinc
finger clusters that recognize specific DNA sequences and extrinsic factors that either
support or destabilize its DNA-binding affinity which likely underlies the diverse functions
of CTCF in different cell types.40 CTCF was originally identified as a negative regulator of
Myc gene expression41 and was subsequently proven to function as an insulator42 and
recently it has been shown as a coordinator of higher-order chromatin structure at beta-
globin locus.43 A growing body of evidence highly supports the idea that CTCF function is
largely attributed to its specific ability to mediate long-range DNA interactions that affect
the three-dimensional chromatin structure.38,44 Topological genetic remodeling can
potentially regulate the expression of cell differentiation- and function-associated genes.
Functional implications of CTCF in the mammalian biology have been discovered by
using conditional CTCF gene knockout mouse line as CTCF-null embryos displays
prenatal lethality.45 CTCF plays multiple roles in hematopoietic cell lineages; it regulates
9
early thymocyte development,46 T cell differentiation,47 and cytokine production in helper
T cells,47,48 as well as T-cell receptor alpha gene recombination.49 A CTCF-mediated
chromatin organization essentially modulates immunoglobulin gene rearrangement in B
lymphocytes.50,51 In myeloid lineage, CTCF is involved in common myeloid progenitor
differentiation52 and macrophage development and function.53 It also has been shown that
overexpression of CTCF alters DC survival, proliferation, and differentiation.54 However,
currently the possible role for CTCF in regulating LC and HSC homeostasis is largely
unknown. Therefore, we focus on the functional role of CTCF in epidermal LCs and BM
HSCs in vivo by generating conditional knockout mouse system.
10
II. MATERIALS AND METHODS
1. Mice
Mice carrying the targeted CCCTC-binding factor (Ctcf) allele, Ctcftm1a(EUCOMM)Wtsi, were
purchased from European Conditional Mouse Mutagenesis Consortium. For deletion of the
lacZ-neomycin-resistance cassette and the generation of mice with a loxP-flanked Ctcf
allele (Ctcffl/+), Ctcftm1a(EUCOMM)Wtsi mice were bred to ACT-FLPe C57BL/6 mice (Jackson
Laboratory, Bar Harbor, ME, USA), which express a transgene of an enhanced form of the
recombinase FLP that is driven by a chicken β-actin-rabbit β-globin hybrid promoter and
the human cytomegalovirus-IE enhancer.55 Ctcffl/+ mice were intercrossed to generate
Ctcffl/fl mice. Mice were genotyped by polymerase chain reaction (PCR) with the following
oligonucleotides: forward primer 5’- AACTCCCTGGTTCCACTCCT -3’ and reverse
primer 5’- GACCCTAGTGCTGTTTCGGC -3’; wild-type product, 420 bp; Ctcffl product,
539 bp. To generate mice with DC-specific Ctcf deficiency (CD11c-cKO), Ctcffl/fl mice
were crossed with CD11c-Cre BAC transgenic mice.56 To generate mice with LC-specific
Ctcf deficiency (huLang-cKO), we crossed Ctcffl/fl mice with human Langerin-Cre BAC
transgenic mice (obtained from NCI Mouse Repository).15 After crossing Ctcffl/fl mice with
Cre mice, the deletion efficiency of the conditional Ctcf allele was confirmed by genomic
DNA PCR with the following oligonucleotides: forward primer 5’-
AACTCCCTGGTTCCACTCCT-3’ and reverse primer 5’-
TGGAGACCCAGATTCAAATG-3’; Ctcffl product, 1226 bp; CtcfΔ product, 435 bp.
CD45.1 congenic mice and OT-II transgenic mice expressing T-cell receptor specific for
11
OVA323-339 were purchased from the Jackson Laboratory. CD45.1 and OT-II mice were
interbred to obtain CD45.1+OT-II mice. Ctcffl/fl mice were crossed to Rosa26-CreER mice
(CreER, kindly provided by Weonsang Ro, Institute of Gastroenterology, Yonsei
University College of Medicine) to generate a tamoxifen-induced systemic Ctcf
conditional knockout strain (CTCF-cKO).57 For inducing Cre-mediated recombination in
CreER mice, tamoxifen (Sigma, St. Louis, MO, USA) was dissolved in corn oil (Sigma)
and intraperitoneally injected for four to five consecutive days (2mg/day). Wild-type
C57BL/6 (CD45.2) mice were purchased from The Jackson Laboratory. Six- to 12-week-
old mice that were bred in specific pathogen-free facilities at Yonsei University College of
Medicine were used for all experiments. Age- and sex-matched Ctcffl/fl or CreER littermate
mice were used as wild-type (WT) controls throughout the study. All animal studies were
approved by the Department of Laboratory Animal Resources Committee of Yonsei
University College of Medicine.
2. Generation of human monocyte-derived Langerhans cells (MDLCs)
Peripheral blood mononuclear cells (PBMCs) were obtained from normal volunteers
(n=15; age range 25-40) under the Yonsei University IRB-approved protocol. Written
informed consent was obtained and study was performed following the Declaration of
Helsinki Principles. PBMCs were isolated by gradient centrifugation with Ficoll-Paque
PLUS (GE Healthcare, Piscataway, NJ, USA) and CD14+ monocytes were purified by
anti-human CD14 microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany). Cell purity
12
was confirmed by flow cytometry (>92%). Total 1 x 106 monocytes were placed in 24-well
tissue culture plates (SPL, Seoul, Korea) and cultured in complete RPMI medium, which
consisted of RPMI 1640 (HyClone, Logan, UT, USA) that was supplemented with 10%
heat-inactivated fetal bovine serum (FBS) (HyClone), 50 μM 2-mercaptoethanol, 2 mM L-
glutamine, 1 mM nonessential amino acids, 1 mM sodium pyruvate, 100 units/mL
penicillin, and 100 μg/mL streptomycin. For MDLC differentiation, 100 ng/ml rhGM-CSF,
20 ng/ml rhIL-4 (Creagene, Seoul, Korea), and 10 ng/ml TGF-β1 (Peprotech, Rocky Hill,
NJ, USA) were used. MDLCs were harvested at day 6 and stimulated with 1 μg/ml of
lipopolysaccharide (LPS) (Invivogen, San Diego, CA, USA) for additional 2 days.
3. Viruses and Vpx-containing virus-like particle (Vpx-VLP) production
Due to the strikingly low transduction efficiency of monocytes and DCs with HIV-1-
derived lentiviruses, we took advantage of co-transduction of Vpx-VLP which drastically
assisted MDLCs with lentiviral infection.58 The pGIPz and pGIPz-shCTCF lentiviral
vectors were obtained from Dr. Jianrong Lu (University of Florida College of Medicine).59
pSIV3+ plasmid was kindly provided by Dr. Kwangseog Ahn (Seoul National
University).60 Lentiviruses were generated from HEK-293 cells co-transfected with
psPAX2 and pMD2.G (Addgene, Cambridge, MA, USA) using polyethylenimine
(Polysciences, Warrington, PA, USA). Vpx-VLP was generated by co-transfection of
pSIV3+ with pMD2.G.61 Lentiviral infections were carried out during the first 2 days of
monocyte culture in the presence of 8 μg/mL polybrene (Sigma). Green fluorescent protein
13
(GFP)-positive transduced MDLCs were underwent FACS sorting and used for further
analyses.
4. Tissue preparation
For epidermal and dermal single-cell suspensions, excised ears were placed in 2.5
mg/mL dispase II (Roche Diagnostics, GmbH, Mannheim, Germany) for 30 min at 37°C.
Isolated epidermal and dermal sheets were incubated in 1 mg/mL collagenase IV
(Worthington, USA) for 1 hr at 37°C. In some experiments, mouse ears were treated with
20 μL of 1% oxazolone (Sigma) dissolved in acetone/olive oil (4:1), and after 24 hr, the
skins were prepared and subsequently examined. Total cells from the skin-draining lymph
nodes (SDLNs) and spleen were incubated in 1 mg/mL collagenase IV for 1 hr at 37°C.
5. Antibodies
Fluorochrome-conjugated anti-mouse CD11b, CD11c, CD40, CD44, CD45, CD45.1,
CD69, CD80, CD86, CD103, CD115 (colony-stimulating factor-1 receptor [CSF-1R]),
CD135, CD207 (Langerin), Annexin V, C-C chemokine receptor 7 (CCR7), E-cadherin,
epithelial cell adhesion molecule (EpCAM), F4/80, Foxp3, I-Ab (MHC II), interferon
(IFN)-γ, Ki-67, Siglec-H, and signal-regulatory protein alpha (Sirpα) monoclonal
antibodies (mAbs) were obtained from eBioscience (San Diego, CA, USA), and anti-
mouse CD4 and CD8α antibodies were from BD Biosciences (San Jose, CA, USA).
Biotin-conjugated anti-mouse CD3, CD19, NK1.1, Ter119, and B220 mAbs were used for
14
discriminating lineage-positive populations in the bone marrow to analyze pre-cDCs
(eBioscience). Anti-mouse CTCF (Abcam, Cambridge, MA, USA) and transforming
growth factor-beta receptor II (TGF-βRII; R&D Systems, Minneapolis, MN, USA)
antibodies were also used in this study. For analyzing HSCs in BM, total BM cells were
flushed and harvested from two hind legs. Fluorochrome-conjugated anti-mouse B220,
CD3, CD4, CD8, CD11b, CD11c, CD19, CD16/32, CD34, CD45.1, CD45.2, CD48,
CD117/c-Kit, CD135/Flt3, CD150, F4/80, IL-7Rα, Ki-67, Ly-6G, Sca-1, Siglec-H were
used for the surface immunephenotyping (eBioscience). Lineage-positive cells in the BM
were excluded using the following biotinylated antibodies followed by APC-Cy-
conjugated streptavidin: B220, CD3, CD4, CD8, CD11b, CD11c, CD19, Gr-1, NK1.1, and
Ter119 (all from eBioscience). Tissue suspensions containing cells were incubated in
violet fluorescent live/dead dye (Molecular Probes, Eugene, OR, USA) for 30 min on ice
and stained with the antibodies described above at the appropriate dilutions using FACS
buffer (phosphate-buffered saline supplemented with 1% bovine serum albumin). For the
intracellular detection of IFN-γ and Langerin, cells were fixed and permeabilized with BD
Cytofix/Cytoperm (BD Biosciences) and incubated for 30 min on ice with antibodies
diluted in Perm/Wash buffer (BD Biosciences). Intracellular detection of Foxp3 and Ki-67
was performed using Foxp3/Transcription Factor Staining Kit (eBioscience). Cell death
and apoptosis were analyzed by Annexin V/PI staining kit (eBioscience). For human
MDLC staining, we used fluorochrome-conjugated anti-human CCR7, CD11c, CD14,
CD80 (BD Biosciences), CD86, and E-cadherin (eBioscience) mAbs. Stained cells were
15
acquired by the FACSVerse or LSRFortessa flow cytometer (BD Biosciences). All flow
cytometry data were analyzed with the FlowJo software (Treestar, Ashland, OR, USA).
6. Whole-mount epidermal sheet staining
Separated epidermal sheets were fixed with cold acetone for 15 min at room temperature.
Epidermal sheets were incubated with a purified anti-mouse I-Ab mAb (clone M5/114,
Biolegend, San Diego, CA, USA), and signals were amplified by Alexa 488-conjugated
goat anti-rat IgG (Invitrogen, Carlsbad, CA, USA). After staining, sheets were mounted on
glass slides with mounting medium (Vector Laboratories, Burlingame, CA, USA). Images
were acquired with the LSM 700 confocal microscope (Zeiss, Oberkochen, Germany) and
analyzed with the ZEN software (Zeiss).
7. Immunofluorescence
Tissue sections (6 μm thick) from frozen ear samples that were preserved in optimal
cutting temperature (Sakura, Tokyo, Japan) were prepared by cryostat. Skin sections were
fixed in ice-cold acetone and blocked in 10% goat serum. After antibody staining, images
were generated with the LSM 700 confocal microscope (Zeiss) and analyzed with the ZEN
software (Zeiss). The TUNEL assay was performed using the In Situ Cell Death Detection
Kit, according to the manufacturer’s instructions (Roche Diagnostics).
8. Electron microscopy
16
For immersion-fixation, mouse ear tissues were fixed with a mixture of 3%
formaldehyde (freshly prepared from paraformaldehyde) and 1% glutaraldehyde (vacuum
distilled) in 0.1 M cacodylate buffer (pH 7.2) for 15 min at 37°C. Afterwards, the tissues
were sliced into thin pieces, followed by immersion fixation in the same fixative at
ambient temperature for 4 hr. To stop fixation, free aldehyde groups were blocked by
soaking the tissue slices in 50 mM NH4Cl in buffer for 1 hr. The tissue slices were then
post-fixed with 1% osmium tetroxide in distilled water for 1 hr, followed by en bloc
staining with 1% aqueous uranyl acetate for 1 hr. After dehydrations in a series of graded
ethanol, embedding in Epon-Araldite (Fluka) was performed, according to the standard
protocol. Ultrathin 80-nm sections were prepared on copper slot grids, stained with uranyl
acetate and lead citrate, and observed with a Hitachi H-7650 electron microscope (Hitachi,
Tokyo, Japan) at 80 kV. Electron micrographs were taken with an 11-megapixel CCD
XR611-M digital camera (Advanced Microscopy Techniques, Woburn, MA, USA).
9. Whole-skin explant culture
Ears of mice were cut off the base and split into dorsal and ventral halves. Both skin
halves were cultured in 12-well plates containing complete RPMI culture medium. After 3
days, supernatants were pooled from the four skin explants and analyzed by flow
cytometry. Epidermal sheets were prepared from the cultured explants and subsequently
assessed by whole-mount epidermal sheet staining.
17
10. In vivo bromodeoxyuridine (BrdU) labeling and analysis
Each mouse received daily intraperitoneal injections of 1 mg BrdU (Sigma) for 7 days.
One day after the final injection, isolated LCs were stained using the BrdU Flow Kit,
according to the manufacturer’s instructions (BD Pharmingen).
11. Fluorescein isothiocyanate (FITC)-induced cutaneous DC migration
Mice were shaved on the abdomen, and 200 μL of the 0.5% FITC (Sigma) solution in
acetone/dibutylphthalate (1:1) was applied to the shaved area. The draining axillary and
inguinal LNs were harvested, and cells were analyzed by flow cytometry at the indicated
time points.
12. Contact hypersensitivity and hapten-specific T-cell responses
2,4-dinitrofluorobenzene (DNFB; Sigma) was used to induce CHS. Mice were
sensitized by the application of 25 μL of 0.5% (wt/vol) DNFB in acetone/olive oil (4:1) to
their shaved abdomens on day 0 and challenged on the right ear on day 5 with 20 μL of 0.3%
(wt/vol) DNFB. Ear thickness was measured before and after challenge using a thickness
gauge. For hapten-specific T-cell responses, mice were sensitized with 25 μL of 0.5%
DNFB, and inguinal and axillary LNs were harvested 5 days later. Total LN cells were
stained with 2.5 μM carboxyfluorescein succinimidyl ester (CFSE; Molecular Probes) for
15 min at 37°C and washed, and 1×106 LN cells/well in a 96-well plate were cultured in
the complete RPMI medium with or without 50 μg/mL 2,4-dinitrobenzene sulfonic acid
18
(DNBS; Alfa Aesar, Ward Hill, MA, USA), which is a water-soluble compound with the
same antigenicity as DNFB, for 3 days. The cells were then harvested and re-stimulated
with 50 ng/mL phorbol myristate acetate (PMA; Sigma) and 500 ng/mL ionomycin (Sigma)
in the presence of GolgiStop (BD Biosciences) for 5 hr at 37°C, and subsequent
intracellular staining for IFN-γ was performed. The secretion of IFN-γ was examined by
using the Cytometric Bead Array (BD Biosciences) following the manufacturer’s
instructions.
13. Croton oil-induced irritant dermatitis
Twenty μL of 1% (vol/vol) croton oil (Sigma) in acetone was applied to ear skin and ear
thickness was measured before and after treatment at the indicated time points.
14. Epicutaneous sensitization and T cell adoptive-transfer
Mice were shaved on the back with an electric razor and a 1 x 1 cm size of skin site was
tape-stripped at least 4 times using cellophane tape (Nichiban, Tokyo, Japan). One hundred
μg of ovalbumin (OVA) (Sigma) in 50 μL of normal saline was applied using Finn
Chamber (SmartPractice). A total of three 2 days exposures separated by 1 day intervals
were performed. For T cell adoptive-transfer, CD4+ T cells were isolated from
CD45.1+OT-II mice using beads-conjugated anti-CD4 mAb and magnetic bead separation
(Miltenyi Biotec), and labeled with 10 μM of CFSE. Totally, 4 x 106 labeled cells were
adoptively transferred into recipient mice via retro-orbital routes and mice were
19
epicutaneously sensitized with OVA 24 hr later. Brachial SDLNs were harvested 72 hr
after OVA sensitization, and cell suspensions were analyzed for diminution of CFSE by
flow cytometry.
15. Clinical and histological evaluation of epicutaneously sensitized skin
The sum of severity of each clinical category for skin lesions was calculated, graded as 0
(none), 1 (mild), 2 (moderate), and 3 (severe), for the symptoms of erythema, edema,
erosion, scaling, and pruritus. Skin tissues were fixed in 10% formalin and embedded in
paraffin for the histological assessment. Skin sections (6 μm thick) were prepared and
stained with hematoxylin and eosin. As epicutaneously sensitized skins revealed the
features of eczematous dermatitis, we added a score for epidermal spongiosis for the
histological grading system. A grading scale we used is as follows: 0, no response; 1,
minimal response; 2, mild response; 3, moderate response; and 4, marked response.
16. Enzyme-linked immunosorbent assay (ELISA) for OVA-specific antibody
detection
OVA-specific IgE/IgG1/IgG2a levels were measured by an indirect ELISA method
using mouse IgE/IgG1/IgG2a ELISA kit (eBioscience) with some modifications. ELISA
plates were coated with OVA (500 ng/well) at 4˚C overnight. After blocking, 50 μL of 20x
diluted serum was added to each well and incubated for 2 hr. IgE levels were determined
using biotin-conjugated anti-mouse IgE Abs and streptavidin-conjugated horseradish
20
peroxidase (eBioscience). Alkaline phosphatase-conjugated anti-mouse IgG1/IgG2a Abs
(Santa Cruz Biotechnology, Santa Cruz, CA, USA) were also used to detect OVA-antibody
complex. Optical density was measured at 450nm.
17. Chemotaxis migration assay
Cell migration was evaluated using the 24-well, 5 μm pore size polycarbonate Transwell
system (Costar, Cambridge, MA, USA). Total of 1 x 105 LPS-stimulated GFP+ MDLCs
were placed on the top of the Transwell in complete RPMI medium and incubated with or
without the indicated concentrations of recombinant human C-C chemokine ligand 19
(CCL19) (Peprotech) in the bottom chamber for 3 hr at 37˚C. The number of migrating
cells was counted for a fixed time period of 1 min using flow cytometry. Chemotaxis index
was calculated as the ratio of the number of cells migrating toward CCL19 divided by the
number of migrating cells in the negative control medium.
18. Quantitative real-time polymerase chain reaction
Total RNA from purified cells was isolated with the Hybrid-R Total RNA kit (GeneAll
Biotechnology, Seoul, Korea). cDNA was synthesized using PrimeScript™ RT Master
Mix (Takara Bio, Shiga, Japan). Quantitative real-time PCR reaction was performed with
the ABI StepOnePlus real-time PCR system (Applied Biosystems, Foster City, CA, USA)
by monitoring the synthesis of double-stranded DNA during the various PCR cycles using
SYBR Green (Takara Bio). For each sample, duplicate test reactions were analyzed for the
21
expression of the gene of interest, and results were normalized to Gapdh mRNA. Primer
sequences are listed in Table 1.
Table 1. Primer sequences used for real-time qPCR
Genes Forward Reverse
Bub1 GAGATGCTCAGTAACAAGCCA GGTTTCCAGACTCCTCCTTCA
Cadm3 AGGGATTGTGGCTTTCATTG TCGCTTCGTGTGTCAGGTAG
Ccl3 GTACCATGACACTCTGCAACC GTCAGGAAAATGACACCTGGCTG
Ccnd1 CCCCAACAACTTCCTCTCCT GGCTTCAATCTGTTCCTGGC
Ccr7 CCAGCAAGCAGCTCAACATT GCCGATGAAGGCATACAAGA
Cd69 GGATTGGGCTGAAAAATGAA CTCACAGTCCACAGCGGTAA
Cdh17 CACGACCAATGCAGGATATG CACCAGTGGCTCAGGATTTT
Cdk1 CATCCCACGTCAAGAACCTG GGTGCTTCAGGGCCATTTTG
Ctcf (mouse) AGCGCTATCATGATCCCAAC CGGCTCAGCATTTTCTTCAC
CTCF (human) TGACACAGTCATAGCCCGAAAA TGCCTTGCTCAATATAGGAATGC
Dmc1 GTGGACACATTCTGGCTCAC CATTTTCAGGCATCTCGGGG
Emb CCCCGGTACAGAAAAACTGA ACGTTGAGGGCATCTTTGTC
Gapdh (mouse) TGGCCTTCCGTGTTCCTAC GAGTTGCTGTTGAAGTCGCA
GAPDH (human) AGCCAAAAGGGTCATCATCTC GGACTGTGGTCATGAGTCCTTC
Klrc1 TGCAAAGGTTTTCCATCTCC TGCTTCGGTATATGGTGTGG
Mnd1 GGAGGAAAAGAGAACCCGGA CTTCCTTCACTGACATGGCG
Nid1 TGGTTCCTCCTACACCTGCT TGTTGTAGCAGAAGGCATCG
Sema7a GGCGGAAGCTCTATGTGACC GACTGCAGCACTGATCGTTGG
19. Western blot
Total splenocytes were labeled with magnetic bead-conjugated anti-CD11c mAb
(Miltenyi Biotec), and DCs were purified by two rounds of positive selection on
paramagnetic columns (Miltenyi Biotec). Cells were lysed in 100 μL cell lysis buffer
22
containing 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% nonyl
phenoxypolyethoxylethanol, 1 mM ethylenediaminetetraacetic acid, 5% glycerol, and
protease inhibitor cocktail (Sigma). Whole cell lysates were resolved on sodium dodecyl
sulfate-polyacrylamide gels and transferred onto a polyvinylidene fluoride membrane.
After blocking with 5% skim milk, the membrane was incubated with the antibodies,
followed by incubation with the horseradish peroxidase-conjugated secondary antibody.
Target proteins were visualized using SuperSignal West Pico Chemiluminescent Substrate
(Pierce, Rockford, IL, USA).
20. Blood cell count
Whole blood was collected from the superficial facial vein into EDTA-treated tube at
the indicated time points. Total blood cell count was evaluated by HEMAVET 950FS
(Drew Scientific).
21. Bone marrow transplantation
Total 5 x 106 BM cells from CreER and CTCF-cKO mice (CD45.2) were transplanted
into lethally irradiated (10Gy) B6.SJL mice (CD45.1). For generating mixed BM chimeras,
2.5 x 106 BM cells from CreER or CTCF-cKO mice (CD45.2) were mixed with equal
numbers of BM cells from B6.SJL (CD45.1) mice and transferred into the irradiated
B6.SJL (CD45.1) mice. Six to eight weeks after transplantation, Cre-mediated
23
recombination was induced by daily tamoxifen injection, and BM and spleen cells were
harvested from reconstituted mice and analyzed.
22. Cell cycle assays
Cells were incubated in the complete RPMI medium containing 10 μg/ml of Hoechst
33342 (Molecular Probes) for 45 min at 37°C. After surface antigen staining, cells were
fixed and permeabilized using the Foxp3 staining kit (eBioscience) and subsequent nuclear
staining of Ki-67 was performed.
23. Measurement of reactive oxygen species
Total BM cells were incubated with 1 μM of 5-(and-6)-carboxy-2’,7’-
Dichlorofluorescein diacetate (carboxy-DCFDA; Molecular Probes) for 30 min at 37°C in
the dark. Then, cells were stained for lineage and HSCs markers at 4°C and assayed by
flow cytometer.
24. Colony-forming unit assay
Colony-forming unit assay was performed using Methocult (M03434, Stem Cell
Technologies, Vancouver, Canada). The number of rising colonies was counted for CFU-
GEMM, CFU-GM, and BFU-E at the indicated time points according to the
manufacturer’s instructions. In brief, 2 x 104 total BM cells were plated in methylcellulose
24
medium containing recombinant mouse SCF, IL-3, IL-6, and erythropoietin and cultured in
the 37℃ and 5% CO2 incubator for 10 to 14 days.
25. Microarray
Epidermal LCs and BM LSKs were sorted by the FACSAria II cell sorter (BD
Biosciences) at the flow cytometry core in the Avison Biomedical Research Center
(Yonsei University College of Medicine). Sorted cells were immediately collected in 500
μL TRIzol (Invitrogen), and total RNA was extracted using the isopropanol precipitation
method. Isolated RNA was linearly amplified by the WT Expression Kit (Ambion, Austin,
TX, USA) and labeled using WT Terminal Labeling Kit (Ambion). Labeled cRNA was
hybridized on the Affymetrix Mouse GeneChip 2.0 ST Arrays (Affymetrix, Santa Clara,
CA, USA). Acquired expression data were analyzed by the R software (www.R-
project.org). Quality control was done using a different R package from the Bioconductor
project (www.bioconductor.org). The Significance Analysis of Microarray (SAM) was
used to determine genes that were significantly and differentially expressed between WT
and CTCF-deficient LCs (FDR; q<5%). We performed functional annotation with the
Gene Ontology biological process using the DAVID Functional Annotation tool
(http://david.abcc.ncifcrf.gov) from an expanded subset of gene whose expression differed
by at least 1.5-fold.
26. Statistics
25
Data were analyzed with the unpaired Student’s two-tailed t-test, unless otherwise stated,
using the Prism software (GraphPad Software Inc., San Diego, CA, USA). P < 0.05 was
considered to be significant.
26
III. RESULTS
PART A. CCCTC-binding factor controls the homeostatic maintenance and
migration of Langerhans cells
1. Decreased pool of multiple DC lineages in DC-specific CTCF-deficient mice
To examine the role of CTCF in the DC lineage in vivo, we generated DC-specific
CTCF-deficient mice (CD11c-cKO) (Figure 1A). Depletion of endogenous CTCF in the
DC lineage was confirmed in purified splenic CD11c+ DCs (Figure 1B).
27
Figure 1. Schematic diagram showing Ctcffl/fl mice generation and CTCF deletion
efficiency. (A) Mice carrying the targeted Ctcftm1a(EUCOMM)Wtsi allele were bred to ACT-
FLPe transgenic mice to remove the LacZ/NeoR cassette and generate mice carrying a
conditional Ctcffl allele in which exon 8 was flanked by loxP sites. Mice carrying a
conditional Ctcffl allele were bred to Cre-expressing transgenic mice to generate
conditional Ctcf-deleted (CtcfΔ) knockout mice. Exons are represented by black boxes. (B)
28
The efficiency of CTCF deletion was determined by western blotting of sorted CD11c+
cells of the spleen from WT and CD11c-cKO mice. Beta-actin served as the protein
loading control. Data represent two independent experiments with three mice per group.
29
To assess whether CTCF deletion influenced overall DC homeostasis, we compared the
proportions of individual DC subsets in the lymphoid and non-lymphoid organs. Lymphoid
conventional DCs (cDCs) in the spleen and skin-draining lymph nodes (SDLNs) were
decreased by ~50% in CD11c-cKO mice as compared with wild-type (WT) mice, and the
numbers of plasmacytoid DCs (pDCs) were slightly reduced (Figure 2A, C, Figure 3).
Despite a decrease in lymphoid cDCs, their subset division into CD8α+ and CD11b+ cells
was comparable. We then analyzed heterogeneous DC populations in the skin and their
corresponding migratory counterparts as a representative of non-lymphoid tissue DCs,
which are comprised of epidermal LCs and dermal DCs (dDCs) (Figure 2B, C, Figure 3).
LCs were diminished by up to 40% in the epidermis of CD11c-cKO mice. Interestingly,
they exhibited far greater declines in the dermis and SDLNs, indicating impaired
distribution of CTCF-deficient LCs in their migrating compartments. CD103+ and CD103−
dDCs were also reduced in the dermis of cKO mice and were further decreased in SDLNs.
Lymphoid cDCs commonly develop from pre-cDCs, which are late-stage committed
progenitors. However, the percentage of pre-cDCs was unchanged in WT and CD11c-cKO
bone marrow (BM), suggesting that CTCF-deficient cDC quantities are not affected by
pre-cDC level (Figure 2D). These findings demonstrate a critical role for CTCF in
maintaining the overall population size of terminally differentiated DCs in vivo.
30
Figure 2. Decrease in the general pool of DCs in mice with DC-specific CTCF
depletion in vivo. (A) Lymphoid organ DCs including pDCs (Siglec-H+CD11cint), cDCs
(Siglec-H−CD11c+MHC II+), CD8α+ cDCs (Siglec-H−CD11c+MHC II+CD8α+CD11b−),
31
and CD11b+ cDCs (Siglec-H−CD11c+MHC II+CD8α−CD11b+) from the spleen and SDLNs
were analyzed by flow cytometry. (B) Population frequencies of cutaneous DCs in single-
cell suspensions derived from the epidermis, dermis, and SDLNs were analyzed by flow
cytometry. Epidermal LCs (CD45+MHC II+), DC populations among CD45+ leukocytes in
the dermis (including LCs [CD11c+MHC II+Langerin+CD103−], CD103+ dDCs
[CD11c+MHC II+Langerin+CD103+], and CD103− dDCs [CD11c+MHC
II+Langerin−CD103−]), and migratory skin DCs (CD11c+MHC IIhi) in SDLNs were
analyzed. (C) Normalized ratios (relative frequencies) of the percentages of DCs in
CD11c-cKO mice against the percentages of the corresponding WT DC subsets. (D) The
proportion of pre-cDCs (Lin−CD11c+MHC II–CD135+Sirpαlo) in the BM. Lin, lineage
(CD3, CD19, NK1.1, Ter119, and B220). Data were pooled from two independent
experiments with four to five mice per group. Error bars indicate standard error of the
mean (SEM).
32
Figure 3. DC-selective CTCF deletion results in a decreased general DC lineage. The
proportion of lymphoid DCs in the spleen and SDLNs and non-lymphoid skin DCs were
analyzed by flow cytometry. Error bars represent the mean±SEM of pooled data from two
experiments with four to five mice per group. *, P<0.05; **, P<0.01; ***, P<0.001; ns, not
significant.
33
2. Reduced cell number with distinct morphological and surface phenotypes of
CTCF-deficient LCs
Because the homeostasis of LCs is distinct from that of other DCs, we next established
LC-specific CTCF-deficient mice (huLang-cKO). The efficient excision of the Ctcf locus
was confirmed by genomic DNA polymerase chain reaction (PCR) using LCs sorted by
flow cytometry (Figure 4A). Whole epidermal sheet staining revealed fewer epidermal
MHC II+ LCs in huLang-cKO mice, which was similar to results obtained in the CD11c-
cKO epidermis (Figure 4B). The reduced number of LCs did not affect the frequency of
dendritic epidermal T cells (DETCs), in accordance with a previous report (Figure 4C).
CTCF-deficient LCs increased in cell size and projected more elongated dendrites, and the
MHC II staining intensity was higher in cKO LCs than WT cells. In the steady state,
CTCF-deficient LCs displayed slightly lower basal levels of CD86 but profoundly higher
CD80 and CD40 expressions (Figure 4D). Moreover, in vivo oxazolone (Oxa) treatment
also led to an altered pattern of CD86 and CD80 expression in cKO LCs, indicating that
CTCF differentially regulates each costimulatory molecule in LCs (Figure 4E). Langerin,
which is a marker of LCs, was decreased in CTCF-deficient LCs, and a sparse number of
Birbeck granules (BGs) in CTCF-ablated LCs was observed, thus confirming a positive
relationship between langerin and BG formation (Figure 4F).
34
Figure 4. LC-selective loss of CTCF leads to decreases in epidermal LC numbers and
distinct phenotypic characteristics of LCs. (A) FACS gating strategies for isolating LCs
35
and dendritic epidermal T cells (DETCs). Genomic DNA PCR for isolated DNA from LCs
and DETCs from WT and huLang-cKO mice as separated by agarose gel electroporation.
(B) Epidermal whole mounts from WT and huLang-cKO mice were stained for MHC II
(green), and the cellular densities for MHC II+ LCs were calculated (bar graph). (C) The
epidermal CD103+ DETC population was assessed by flow cytometry. (D) Expression of
MHC II, CD86, CD80, CD40, and Langerin in WT and CTCF-deficient LCs
(CD45+CD11c+). The shaded line represents the fluorescence minus one (FMO) control. (E)
Surface CD86 and CD80 expressions of LCs were assessed by flow cytometry with or
without 1% oxazolone (Oxa) treatment for 24 hr. (F) Tennis-racket-like Birbeck granules
(black arrows) from WT and CTCF-deficient LCs in the epidermis were examined by
electron microscopy. Bar=100 nm. Data represent at least two independent experiments
with three to six mice per group. Error bars indicate SEM. *, P<0.05; **, P<0.01; ***,
P<0.001; ns, not significant.
36
3. CTCF-deficient LCs exhibit reduced homeostatic self-turnover
Since CTCF deletion led to fewer epidermal LCs, we determined whether CTCF was
responsible for maintaining the epidermal LC pool. CTCF variably contributes to apoptosis
in a cell type-specific manner. Enhanced CTCF expression leads to an increase in the
apoptosis of BM-derived DCs in vitro. However, no increases in apoptosis were observed
in CTCF-ablated LCs in situ (Figure 5A). Moreover, we did not observe differences
between annexin V+ population of WT and cKO LCs regardless of LC activation,
indicating that apoptosis does not contribute to the decrease of CTCF-deficient LCs
(Figure 5B). LCs sustain their pool via slow self-renewal in the steady-state epidermis.
Notably, significantly lower numbers of bromodeoxyuridine (BrdU)-incorporated LCs
were quantified in huLang-cKO mice (Figure 5C). Intracellular Ki-67 staining revealed a
lower proportion of cells within the active phases of the cell cycle in CTCF-deficient LCs
(Figure 5D). However, surface TGF-βRII and CSF-1R were similarly expressed in WT and
cKO LCs. This suggests that the CTCF deficiency-induced reduction in LC number is due
to an intrinsic defect of self-perpetuation, rather than insensitivity to external cytokine
signals.
37
Figure 5. CTCF-deficient LCs exhibit self-proliferation impairment. (A) In situ
TUNEL assays were performed using MHC II and DAPI co-staining in frozen ear skin
sections from WT and huLang-cKO mice. Original magnification, ×200. (B) LC activation
was induced by 1% Oxa treatment, and apoptosis of LCs (CD45+MHC II+) in epidermal
single-cell suspensions from mouse ears was analyzed by flow cytometry. (C) Intracellular
BrdU levels in LCs (CD45+MHC II+Langerin+) were assessed by flow cytometry. (D) The
actively cycling LC subpopulation was analyzed by detecting Ki-67 positivity. (E) TGF-
βRII and CSF-1R expression levels in LCs were analyzed. Data represent at least two
38
independent experiments with three to seven mice per group. Error bars indicate SEM. **,
P<0.01.
39
We next examined the initial phase of LC development. Similar infiltrations of
CD11b+F4/80+ myeloid precursors were observed in the WT and huLang-cKO postnatal
day 1 epidermis (Figure 6A, B). Equivalent expansion of MHC II+ cells was seen in day 7
epidermis, and almost all epidermal myeloid leukocytes strongly expressed MHC II and
Langerin (Figure 6B, C). Thus, the decreased number of CTCF-deficient LCs was largely
attributed to reduced LC proliferation capacity after completion of the LC network.
40
Figure 6. Early epidermal LC network formation is comparable between WT and
huLang-cKO mice. (A) The frequency of myeloid LC precursors (CD45+CD11b+F4/80+)
in the epidermis on postnatal day 1 was assessed by flow cytometry. (B and C) The
numbers of MHC II+ cells (green) in the epidermis from postnatal days 1 and 7 were
quantified by immunofluorescence (B), and the expressions of MHC II and intracellular
langerin were examined by flow cytometry (C). Data were pooled from three experiments
with four to six mice per group. Error bars indicate SEM. ns, not significant.
41
4. CTCF deficiency impairs the emigration of LCs from the epidermis
As the relative LC frequencies in the dermis and SDLNs were lower than those in the
epidermis of CD11c-cKO mice, we next examined the efficacy of LC migration. In
huLang-cKO mice, discordant relative ratios of LCs in the epidermis (~30%), dermis
(<10%), and SDLNs (<10%) were found, suggesting hampered migration of CTCF-
deficient LCs out of the epidermis (Figure 7).
42
Figure 7. CTCF-deficient LCs are significantly less distributed in their sequential
migratory compartments. (A-C) DC populations in the epidermis (A), dermis (B), and
SDLNs (C) from WT and huLang-cKO mice were analyzed by flow cytometry, using the
same gating strategies described in Fig 1. (D) Normalized ratios (relative frequencies) of
the percentages of LCs in huLang-cKO mice against the percentages of corresponding WT
LCs in the epidermis, dermis, and SDLNs. Data were pooled from five experiments (n=11).
Error bars indicate SEM. ***, P<0.001; ns, not significant.
43
To assess the full migratory capacity of CTCF-deficient LCs in vivo, we evaluated
antigen-bearing LCs in regional LNs by painting the skin with fluorescein isothiocyanate
(FITC). Consistent with a previous report, the number of FITC+ migrating LCs gradually
increased in WT mice (peak at 72 to 96 hr) (Figure 8A, B). Importantly, the draining LNs
of huLang-cKO mice had a remarkably smaller number of FITC+ LCs, whereas similar
proportions of FITC+ dDC migrants were observed. C-C chemokine receptor 7 (CCR7) is
critical for peripheral DC migration toward draining LNs. Notably, CTCF-deficient LCs
expressed a significantly lower level of surface CCR7 (Figure 8C).
Next, we sought to examine whether CTCF-deficient LCs could leave the epidermis. We
cultured mouse ear skin explants for 72 hr to induce LC migration and performed flow
cytometry for crawl-out cells and epidermal sheet staining for remnant ear tissues. The
number of crawl-out LCs from cultured huLang-cKO ear skins was strikingly reduced
compared with WT skin cultures (Figure 8D). Moreover, CTCF-deficient LCs were
retained in the cultured epidermis, while WT epidermal LCs considerably disappeared after
72 hr of skin culture (Figure 8E). Therefore, our in vivo and in vitro findings demonstrate a
critical role for CTCF in efficient LC egress from the epidermis.
44
Figure 8. CTCF-deficient LCs fail to egress from the epidermis. (A, B) SDLNs were
analyzed by flow cytometry to quantify migrating DCs after FITC application.
Representative FACS plots for the migrating cutaneous DCs at the indicated time points
are presented (three to four mice per group). (C) Surface CCR7 expression of
45
CD45+CD11c+MHC II+ LCs. The number indicates the mean fluorescence intensity ± SEM
for CCR7 staining. (D) Mouse ear skin explants were cultured for 72 hr, and crawl-out
cells in the supernatants were analyzed by flow cytometry to quantify migrating LCs
(MHC II+CD103–CD11c+Langerin+). (E) Epidermal sheets were prepared from resting and
cultured skin, and the number of LCs in the epidermis was assessed by
immunofluorescence after staining for MHC II (green). Data are representative of two to
three independent experiments with three to six mice per group. Error bars indicate SEM.
**, P<0.01; ***, P<0.001.
46
Human LCs can be derived from peripheral monocytes in vitro (Figure 9A). We further
assessed the role of CTCF in human LCs using a lentiviral vector-mediated RNA
interference of CTCF. The use of Vpx-containing virus like particles (Vpx-VLP)
significantly enhanced lentiviral transduction efficiency, and human monocyte-derived
LCs (MDLCs) that were green fluorescent protein (GFP)-positive (indicative of successful
viral transduction) were subjected to fluorescence-activated cell sorting (FACS) (Figure
9B). The expressions of CTCF mRNA and protein were significantly decreased in MDLCs
infected with lentiviruses containing shRNA against CTCF (Figure 9C, D). Although the
transduction efficiencies between control and shCTCF-expressing lentiviruses were
comparable, the recovered MDLC number was reduced in the CTCF knockdown group
(Figure 9E). CTCF-diminished human MDLCs showed greater increases in CD80
expression after treatment with lipopolysaccharide (LPS), but CD86 levels were modestly
affected by CTCF silencing (Figure 9F). Notably, CTCF knockdown in LPS-treated
MDLCs resulted in a lower level of surface CCR7 compared to the control cells, similar to
results obtained with murine CTCF-deficient LCs (Figure 9G). Moreover, in vitro
chemotaxis assay revealed that MDLC migration toward C-C chemokine ligand 19
(CCL19) was significantly abrogated by CTCF knockdown (Figure 9H). These data
suggest that CTCF plays an important role in the CCR7-dependent migration of LCs in
both humans and mice.
47
Figure 9. CTCF-silenced MDLCs showed a migration defect toward CCL19. (A)
Differentiation of MDDCs and MDLCs assessed by flow cytometry. (B) MDLCs were
infected with pGIPz control lentivirus in the absence or presence of Vpx-VLP, and
transduction efficiency was determined by frequency of GFP+ populations at day 8
(multiplicity of infection=2.0). (C and D) Transduced MDLCs were sorted, and the
knockdown efficiency of CTCF was determined by real-time qPCR (C) and
immunoblotting (D). (E) Representative FACS plot for the transduction efficiency of
MDLCs with control and shCTCF-containing lentiviruses (left), and the number of
recovered MDLCs after gene transduction (right). (F) Surface CD80 and CD86 levels of
FACS-sorted GFP+ MDLCs were analyzed after 2 days of LPS treatment. Data are
48
representative of five individuals. (G) CCR7 levels of the transduced human MDLCs
stimulated with lipopolysaccharide (LPS) (representative data of three individuals). (H)
Chemotaxis indices of the GFP+ MDLCs migrating toward the indicated concentrations of
human CCL19 (pooled data from four individuals). Error bars indicate SEM. *, P<0.05.
49
5. CTCF inactivation in LCs augments cell adhesion molecule gene expression
To identify CTCF-regulated genes in LCs, we purified WT and CTCF-deficient LCs by
FACS and performed microarray-based gene expression profiling (Figure 10A, B). We
found lower Ccr7 expression in cKO LCs, which was confirmed by flow cytometry. In
particular, systematic Gene Ontology analysis showed that cell adhesion-associated genes
were significantly different (Figure 10C). Among them, genes that promote cellular
adhesion such as cell adhesion molecule 3 (Cadm3), cadherin 17 (Cdh17), and nidogen-1
(Nid1) were highly expressed in CTCF-deficient LCs. To explore whether these adhesion
molecules were physiologically relevant to LC migration, we treated mouse ears with Oxa
to initiate LC migration and analyzed gene expression changes from the sorted LCs.
Notably, Cadm3, Cdh17, and Nid1 levels were significantly decreased in WT LCs upon
Oxa treatment. However, both resting and stimulated CTCF-deficient LCs expressed
strikingly higher levels of those adhesion molecules compared to WT LCs (Figure 10D).
Interestingly, the level of Ctcf in LCs was not significantly influenced by LC activation in
vivo (Figure 10E). This suggests that those adhesion molecules are not regulated by direct
changes in CTCF expression level, but possibly through other mechanisms such as a
differential protein interaction of CTCF which modulates its target gene’s chromatin
structures.
It has been known that LC motility in the epidermis is partly mediated by some adhesion
molecules including E-cadherin and epithelial cell adhesion molecule (EpCAM). Although
no differences in E-cadherin were observed, CTCF-deficient LCs expressed significantly
50
lower levels of EpCAM, which led to enhanced binding of LCs to keratinocytes (Figure
10F). Collectively, these results indicate that CTCF is indispensable for efficient LC
emigration by regulating the balanced expression of CCR7 and cell adhesion molecules.
51
Figure 10. CTCF-deficient LCs express higher levels of cell adhesion molecules. (A)
LCs (CD45+CD11c+MHC II+) were sorted from epidermal single-cell suspensions. Scatter
plots show raw expression levels (log2), and the selected genes are indicated in red
(upregulated in cKO LCs) or blue (upregulated in WT LCs). Green lines indicate the
twofold boundary. Black indicates the number of genes that exhibited greater than twofold
increases in WT (lower) or cKO (upper) LCs with a false discovery rate <0.05. (B)
52
Expressions of the indicated genes in FACS-sorted WT and cKO LCs (same gating
strategies from Fig E3, A) were analyzed by real-time qPCR (top). CD69 protein
expression in WT and cKO LCs was assessed by flow cytometry (bottom). (C) The heat
map shows genes that belong to the cell adhesion biological process, as revealed by the
Gene Ontology analysis. Genes that were confirmed by real-time quantitative polymerase
chain reactions (qPCR) are indicated in bold. (D and E) Epidermal LCs were sorted with or
without the treatment with 1% Oxa, and the expression levels of Cadm3, Cdh17, Nid1 (C),
and Ctcf genes (D) were examined by real-time qPCR. (F) Surface E-cadherin and EpCAM
levels in LCs. Data were pooled from two experiments with three to six mice. Error bars
indicate SEM. *, P<0.05; **, P<0.01; ***, P<0.001; ns, not significant.
53
6. CTCF-dependent LC homeostasis is required for optimal immunity of the
skin
Recent studies have proposed an immune-suppressive role for murine LCs by showing
enhanced delayed-type hypersensitivity (DTH) to contact allergens in mice with selective
LC deficiency and impaired LC migration, although the exact role for LCs remains
controversial. As our huLang-cKO mice showed decreases in LC number and defective LC
migration, we firstly assessed 2,4-dinitrofluorobenzene (DNFB)-induced contact
hypersensitivity (CHS) responses. DNFB treatment induced similar extents of ear swelling
in WT and huLang-cKO mice at 24 hr after challenge. However, cutaneous inflammation
was significantly sustained in huLang-cKO mice from 48 hr post-treatment (Figure 11A).
Ear swellings without DNFB sensitization and croton oil-induced irritant dermatitis were
equivalent between WT and cKO mice, indicating that the residual CTCF-deficient LCs
were sufficient to reduce irritant reaction as opposed to the results from mice with
complete LC depletion (Figure 11A, B). Because interferon (IFN)-γ-producing CD4+ and
CD8+ T cells mediate CHS in response to DNFB, we examined the effect of LC-specific
CTCF deficiency on the proliferation and priming of IFN-γ-producing T cells in draining
LNs. Antigen-specific T-cell proliferation was not significantly different between
sensitized LN cells from WT and cKO mice (Figure 11C). However, total sensitized LN
cells from huLang-cKO mice produced greater amounts of IFN-γ than those from WT
mice (Figure 11D). This was associated with significantly enhanced induction of IFN-γ-
producing CD8+ T cells in huLang-cKO LNs (Figure 11E). In contrast, the proportion of
54
the IFN-γ+ population within CD4+ T cells was marginally affected by LC-selective CTCF
deficiency. In addition, the frequency of Foxp3+ regulatory T cells in SDLNs was
comparable between WT and cKO mice irrespective of sensitization (Figure 11F). These
findings suggest that the migratory failure of LCs due to CTCF deficiency facilitates the
cross-priming of IFN-γ-producing effector CD8+ T cells and, in turn, enhances CHS
reactions, which indicate a suppressive role for LCs against the haptenized antigen.
55
Figure 11. Prolonged and exaggerated CHS responses with higher priming of IFN-γ-
producing CD8+ T cells in huLang-cKO mice. (A) Changes in ear thickness after DNFB
56
challenge were measured at the indicated time points. (B) Changes in ear thickness after
application of croton oil or vehicle were measured at the indicated time points. (C) DNFB-
sensitized total LN cells were labeled with CFSE and cultured with or without DNBS for
72 hr. CD44+CFSElow antigen-specific T-cell proliferation was examined by flow
cytometry. (D) DNFB-sensitized total LN cells were cultured for 72 hr with or without
DNBS. IFN-γ levels in the supernatants were evaluated. (E) Cultured total LN cells were
re-stimulated with PMA/ionomycin, and intracellular IFN-γ production among CD8+ and
CD4+ T cells was assessed by flow cytometry. (F) Foxp3+ regulatory T cells among the
CD4+ T cell population in SDLNs were analyzed by flow cytometry 5 days after treatment
with vehicle or DNFB. Data represent three independent experiments with five to seven
mice per group. Error bars indicate SEM. *, P<0.05; ***, P<0.001; ns, not significant.
57
Aside from a CHS response, LCs are known to elicit Th2 and humoral immunity to
protein antigens that encounter the epidermal barrier. To further understand the
consequence of CTCF deficiency in LCs, we epicutaneously sensitized mice with
ovalbumin (OVA) patches. Repeated OVA application led to local dermatitis in WT mice;
however, huLang-cKO mice showed a less severe inflammation, which correlated with the
reduced Th2-associated OVA-specific serum IgE and IgG1 levels in cKO mice (Figure
12A-C). Furthermore, huLang-cKO mice exhibited decreased OVA-specific T cell
proliferation after a single epicutaneous exposure to OVA (Figure 12D). Altogether, our
data demonstrate that CTCF-dependent LC homeostasis is functionally required for full
induction of cutaneous adaptive immunity to a protein antigen.
58
Figure 12. Attenuated epicutaneous sensitization to OVA in huLang-cKO mice. (A)
Total clinical severity scores. (B) Hematoxylin and eosin staining of the patch-applied
back skins. The sum of each histological score is presented. Scale bar=100 μm. (C) Serum
OVA-specific antibodies were assessed by ELISA. OD values for IgE, IgG1, and IgG2a
were measured at a wavelength of 450 nm. (D) CFSE-labeled CD45.1+OT-II T cells were
adoptively transferred to WT and huLang-cKO mice, and mice were treated with an OVA
59
patch. SDLNs were analyzed to measure OVA-specific T cell proliferation. Numbers in the
histogram indicate the number of CD45.1+OT-II T cell divisions. Data represent at least
two independent experiments with five to seven mice per group. Error bars indicate SEM.
*, P<0.05; ***, P<0.001.
60
PART B. CCCTC-binding factor regulates adult hematopoietic stem cell
quiescence in mouse
1. Loss of CTCF leads to rapid BM failure
To examine the relative expression levels of Ctcf mRNA in primitive hematopoietic
stem/progenitor cells, we analyzed the Immunological Genome microarray database,
which encompasses a large group of immune cell and their progenitor populations62. Ctcf
mRNA was expressed in all subsets of HSCs and progenitor cells examined, although
GMP expressed a slightly lower Ctcf expression level (Figure 13A). To determine whether
CTCF is required for general hematopoiesis in vivo, we used the Cre-loxP system to
deplete Ctcf gene by injecting tamoxifen (TMX) in adult mice. We crossed ROSA26-
CreER mice with conditional Ctcf-floxed mice63 (hence, CTCF-cKO) and induced an
efficient Ctcf ablation by intraperitoneal injection of TMX for 5 consecutive days (Figure
13B, C). Within 10 to 14 days after TMX treatment, all CTCF-cKO mice showed a rapid
lethality while the survival of WT mice was not affected by TMX (Figure 13D). To
evaluate the overall hematopoiesis in the absence of CTCF, we analyzed peripheral blood
cell counts. Although both genotypes of mice showed normal white blood cell and platelet
counts before CTCF deletion, TMX treatment led to a significant reduction of those
hematological parameters in CTCF-cKO mice (Figure 13E). Red blood cell counts were
slightly declined both in the TMX-treated WT and CTCF-cKO groups without a
significant difference between the groups, indicating that TMX alone would have a
61
possible adverse effect on erythropoiesis. Importantly, CTCF-ablated mice had a markedly
lower total BM cellularity than did the WT control mice (Figure 13F). These data indicate
that CTCF is critically involved in hematopoiesis and acute loss of CTCF results in rapid
hematopoietic failure.
62
Figure 13. Acute CTCF ablation leads to hematopoietic failure. (A) Relative
expression level of Ctcf gene among the various stem/progenitors (Data from ImmGen). (B,
C) WT and CTCF-cKO mice were treated with TMX for 5 consecutive days and genomic
DNA and total RNA were isolated at day 8. Efficient Ctcf gene deletion by TMX treatment
in CTCF-cKO mice at DNA (B) and RNA (C) level is shown. (D) Kaplan-Meier curve
plotting survival of WT and CTCF-cKO mice (n = 10) is shown. (E) Peripheral blood
63
counts of controls and CTCF-cKO mice 8 and 10 days after first TMX injection (n = 4−5)
are shown. (F) Bone marrow counts (femurs and tibia) of WT and CTCF-cKO mice 8 days
after TMX treatment (n = 5) are shown. Data were from at least three independent
experiments with four to five mice per group. Error bars indicate standard error of the
mean (SEM). **, P<0.01; ***, P<0.001; ns, not significant.
64
2. Acute depletion of CTCF results in rapid shrinkage of c-Kithi HSC and
progenitor pool
Since TMX-induced systemic depletion of CTCF led to rapid BM failure, we next
examined heterogeneous HSC population by flow cytometry. CD117/c-Kit is a stem cell
factor (SCF) receptor which is highly expressed on the most primitive stem/progenitor
cells in BM64,65. Surprisingly, within 8 days after CTCF ablation in vivo, we found a
marked shrinkage of Lineage−c-Kithi population in BM (Figure 14A). CTCF-ablated
lineage-negative BM cells also revealed a decreased expression of CD135/Flt3 and CD34,
but the level of surface Sca-1 and CD16/32 were rather increased than did WT cells
(Figure 14D). Lineage−c-Kithi population can be divided into LSK (Lineage− Sca-1+c-Kithi)
and LK (Lineage− Sca-1−c-Kithi) population which is HSC- and early myeloid progenitor
(CMP, GMP, and MEP)-enriched compartment, respectively. In line with the acute
hematopoietic failure, we found a marked decrease in both LSK and LK populations after
CTCF ablation (Figure 14B). Since HSCs are comprised of a hierarchical stage of stem
cells20, we further assessed HSCs in the LSK compartment using different surface markers.
The most primitive long-term reconstituting HSCs (LT-HSCs), which are able to be
determined by CD150+ CD48− surface characteristics within LSKs were profoundly
diminished in TMX-treated BM of CTCF-cKO mice (Figure 14C). In addition, the number
of short-term HSCs and other primitive progenitors in LSKs were also generally decreased
by CTCF deletion compared to those of WT controls. Thus CTCF is required for the
65
homeostatic maintenance of c-Kithi primitive stem/progenitor cells and regulates variable
surface receptor expressions of the undifferentiated hematopoietic compartment.
66
Figure 14. Acute depletion of CTCF results in severe decrease in c-Kithi
stem/progenitors. (A) Surface c-Kit level of lineage-negative population is shown (B) The
67
frequencies and absolute numbers of LSK (lineage− Sca-1+ c-Kithi) and LK (lineage− Sca-
1− c-Kithi) population of WT and CTCF-cKO mice 8 days after TMX injection are shown.
(C) LT-HSCs (CD150+ CD48−), ST-HSCs (CD150− CD48−), MPP1 (CD150+ CD48+), and
MPP2 (CD150− CD48+) populations within LSKs are shown. (D) Surface expression level
of Flt3, CD34, Sca-1, CD16/32 are evaluated by flow cytometry from lineage-negative
populations of TMX-treated WT and CTCF-cKO mice. Data were from at least three
independent experiments with three to four mice per group. Error bars indicate SEM. *,
P<0.05; **, P<0.01; ***, P<0.001; ns, not significant.
68
3. Loss of CTCF in hematopoietic compartment results in rapid exhaustion of
HSCs
Since TMX-responsible CreER is expressed in ubiquitous tissues in ROSA26-CreER
mice, the observed hematopoietic failure and rapid lethality after inducing CTCF depletion
in CTCF-cKO mice might result from dysfunction of non-hematopoietic compartment. To
determine this issue, we generated BM chimeras using lethally irradiated CD45.1+
recipients reconstituted by WT or CTCF-cKO BM, respectively. BM chimerism was
achieved constantly ~98% (Figure 15A). We found that TMX-treated chimeras
transplanted with CTCF-cKO BM revealed a markedly decreased survival and total BM
cellularity (Figure 15B, C) compared to those of control chimeras. Peripheral blood
analysis demonstrated a similar hematopoietic failure in TMX-treated CTCF-cKO BM
chimeras as seen in the systemic CTCF-deficient mice (Figure 15D). In line with the
decreased number of red blood cells and platelets in blood, CTCF-deficient BM-harboring
chimeras revealed severe anemic and hemorrhagic clinical features (Figure 15E).
Furthermore, TMX treatment led to a rapid loss of c-Kithi HSC/myeloid progenitor
populations and CD150+CD48− LT-HSCs in the BM-specific CTCF-null chimeras (Figure
15F). These results indicate that ablation of CTCF in hematopoietic compartment is
sufficient to induce rapid exhaustion of HSCs followed by resultant hematopoietic failure
and mortality.
69
Figure 15. CTCF loss in the hematopoietic system leads to severe BM failure and
consequent lethality. (A) Chimerism efficiency analyzed from lineage-negative BM cells
of CD45.1+ recipient transplanted with CD45.2+ donor BM. (B) Kaplan-Meier curve
plotting survival of WT → CD45.1 and CTCF-cKO → CD45.1 chimeric mice (n = 9) is
shown. (C) Total BM cellularity from each chimera is shown. (D) Peripheral blood counts
of controls and CTCF-cKO chimeric mice 9 days after first TMX injection (n = 5) are
70
shown. (E) Clinical pictures of WT and CTCF-cKO chimeras showing anemic (upper and
middle) and spontaneous hemorrhagic (lower) features. (F) The frequencies and absolute
numbers of LSK and LT-HSCs of WT and CTCF-cKO chimeras 8 days after TMX
injection are shown. Data were from at least two independent experiments with three to
four mice per group. Error bars indicate SEM. *, P<0.05; **, P<0.01; ***, P<0.001; ns, not
significant.
71
HSC homeostasis is finely regulated by heterogeneous cross-talk between HSCs and
surrounding stromal components within the BM niche.66 As TMX-induced ablation of
CTCF in ROSA26-CreER mice also occurred in BM stromal cells, CTCF deficiency-
mediated HSC exhaustion and accompanied BM failure might result from the HSC-
extrinsic effects. To exclude this possibility, we transplanted CD45.2+ WT or CTCF-cKO
BM cells together with CD45.1+ supporting BM cells at 1:1 ratio into the lethally irradiated
CD45.1+ recipient mice. Six weeks after reconstitution, the mixed BM chimeras were
injected with TMX for inducing CTCF depletion in vivo and BM cells were analyzed at
least after 4 wks (Figure 16A). We found a scarce number of LSKs and CD150+ CD48−
LT-HSCs derived from CTCF-null donor, indicating that exhaustion of CTCF-deficient
HSCs was not rescued by normal BM niche (Figure 16B, C). Thus, genetic loss of CTCF
results in HSC exhaustion in a cell-autonomous manner.
72
Figure 16. CTCF deficiency-mediated HSC depletion is a cell-autonomous effect. (A)
Experimental scheme for the generation and use of mixed BM chimeras. (B, C) The
frequencies of CD45.2+ BM-derived cells from the TMX-treated mixed chimeric mice are
shown. Data were from three independent experiments with four to five mice per group.
Error bars indicate SEM. ***, P<0.001.
73
4. Defective HSC-driven myeloid lineage development by deletion of CTCF in
vivo
Because CTCF depletion led to a marked reduction of c-Kithi stem/progenitor population
in BM, we next determined the development of HSC-driven early myeloid progenitors and
subsequent peripheral myeloid cells in the absence of CTCF. In the spleen, all subsets of
dendritic cells (DCs), including plasmacytoid (Siglec-H+ CD11c+), conventional CD8α+
(Siglec-H− CD11chi CD8α+ CD11b−), and CD11b+ (Siglec-H− CD11chi CD8α− CD11b+) DCs
derived from CTCF-deficient BM were profoundly decreased than did WT BM (Figure
17A, C). Splenic monocytes (CD11bhi F4/80− SSClo Ly-6G−) and neutrophils (CD11bhi
F4/80− SSChi Ly-6G+), which develop from HSC-CMP-GMP axis also showed a marked
reduction arising from CTCF-ablated BM cells (Figure 17B, C). However, F4/80+ red pulp
macrophages in the spleen (CD11bint F4/80+), which are maintained by self-renewal
without substantial monocyte input, demonstrated rather partial decline after inducing
CTCF depletion, confirming their distinct homeostasis in the steady-state.67,68 In line with
the diminution of HSC-driven myeloid compartment in the spleen after CTCF deletion,
there was a negligible population of CTCF-deficient LK cells in the BM (Figure 17D). To
determine the role of CTCF in colony-forming capacity of stem and myeloid progenitor
cells, we performed in vitro colony-forming unit assays. To adjust the starting number of
stem/progenitor cells, total untouched BM cells either from WT and CTCF-cKO mice were
plated in methylcellulose medium supplemented with SCF, IL-3, IL-6, and erythropoietin
followed by in vitro TMX treatment. TMX-treated CTCF-cKO BM cells showed markedly
74
decreased colony-forming units than did WT ones and there were no discernible sorts of
colonies derived from the CTCF-null BM cells (Figure 17E). These data indicate that
CTCF is critical for HSC-driven myeloid lineage development both in vivo and in vitro.
75
76
Figure 17. Loss of CTCF results in exhaustion of myeloid progenitors and their
differentiation. (A, B) Gating strategies for the dendritic cells (A), red pulp macrophages,
monocytes, and neutrophils (B) in spleen are shown. (C) The frequencies of CD45.2+ BM-
derived myeloid lineage cells from the spleen of TMX-injected mixed chimeric mice are
shown. (D) The proportion of CD45.2+ BM-derived LK cells is shown. (E) The number of
total colonies from WT and CTCF-cKO mice cultured in methylcellulose medium
supplemented with myeloid-driving factors at day 9 is shown. Data were from at least three
independent experiments with four to five mice per group. Error bars indicate SEM. **,
P<0.01; ***, P<0.001.
77
5. CLPs and lymphoid lineage cells are less sensitive to CTCF ablation in vivo
We next examined the role of CTCF in lymphoid lineage development in vivo.
Surprisingly, CTCF-ablated BM cells gave rise to both CD4+ and CD8+ T cells in the
spleen with a significant amount in contrast to the myeloid lineage (Figure 18A, C). B
lymphocyte development was also relatively preserved as the frequency of B cells from
CTCF-deficient BM was only reduced by 50% than that of WT CD45.2+ BM-derived B
cells (Figure 18B, C). Furthermore, we observed a discrete population of CTCF-deficient
CLPs from CTCF-ablated BM in the mixed chimeras similar to T and B lymphocytes
(Figure 18D). Therefore, our results implicate that the lymphoid lineage development is
only partially affected by CTCF depletion in vivo.
78
Figure 18. CLP-derived lymphoid differentiation is less sensitive to CTCF depletion.
(A, B) Gating strategies for the T cells (A) and B cells (B) in spleen are shown. (C) The
frequencies of CD45.2+ BM-derived lymphoid lineage cells from the spleen of TMX-
treated mixed chimeric mice are shown. (D) The proportion of CD45.2+ BM-derived CLPs
is shown. Data were from at least three independent experiments with four to five mice per
group. Error bars indicate SEM. *, P<0.05; **, P<0.01; ***, P<0.001.
79
6. CTCF-deficient HSCs are unable to maintain quiescence
To identify the genes regulated by CTCF in hematopoietic stem/progenitor cells, we
performed microarray-based gene expression analyses. LSK population was purely sorted
by flow cytometry after three times of TMX treatment and subjected to the microarray
experiment. Acute loss of CTCF led to changes in gene expression profile between WT
and CTCF-deficient LSKs (Figure 19A). Subsequent systematic gene ontology analysis
revealed that CTCF-depleted LSKs expressed high level of cell cycle-promoting gene
expression program (Figure 19B, C). In the steady state, maintenance of HSC quiescence
is critical for regulating the stem cell pool. To determine whether the HSC’s quiescence is
affected by CTCF deletion, we performed Ki-67/Hoechst staining. Importantly, in line
with the microarray results, CTCF-deficient LSKs showed a significantly increased
proportion of cells in the G1 and S-G2-M phases. In addition, CTCF deficiency led to a
marked reduction of G0 phase and an increased G1 and S-G2-M phases of LT-HSCs which
represented a quiescence defect (Figure 19D). Maintaining low ROS levels is essential to
HSC quiescence and apoptosis. Intracellular ROS production was examined using the CM-
H2DCFDA combined with flow cytometry. Importantly, CTCF-depleted CD150+ HSCs
displayed markedly increased levels of intracellular ROS both in acute systemic or BM-
confined CTCF ablation settings (Figure 19E, F). Furthermore, CTCF-deficient LSKs
demonstrated a significantly increased dead/apoptotic population than did WT cells
(Figure 19G). Therefore, our data indicate that CTCF is critically involved in maintaining
80
HSC pool through sustaining HSC quiescence possibly downregulating intracellular ROS
level in vivo.
81
Figure 19. CTCF-deficiency leads to an augmented cell cycle progression in HSCs. (A)
LSKs were sorted from BM 24 hr after the last TMX treatment. Scatter plots show raw
expression levels (log2), and the selected genes are indicated in red (upregulated in cKO
LSKs) or blue (upregulated in WT LSKs). Green lines indicate the twofold boundary. (B)
The heat map shows genes that belong to the cell cycle biological process, as revealed by
the Gene Ontology analysis. (C) Expression levels of the selected genes from (B) were
confirmed by real-time quantitative polymerase chain reactions (qPCR). (D) Ki-
82
67/Hoechst-based cell cycle analysis of LT-HSCs from WT and CTCF-cKO mice 8 days
after TMX treatment is shown. (E, F) Intracellular level or ROS was measured by CM-
H2DCFDA from TMX-treated straight cKO mice (e) and chimeric mice (f) at day 8. Mean
fluorescence intensity (MFI) of ROS levels were calculated. (G) Cellular death/apoptosis
was analyzed by Annexin V/propidium iodide staining. Data were from at least three
independent experiments with four to five mice per group. Error bars indicate SEM. *,
P<0.05; **, P<0.01; ***, P<0.001.
83
IV. DISCUSSION
In the steady state, most DCs, except for epidermal LCs and brain microglia, are
continuously replenished by precursors from the blood.51,52 Moreover, DCs undergo a
small number of divisions in the peripheries that are important for maintaining
homeostasis.69-71 In this study, we used DC-specific CTCF-deficient mice to demonstrate a
common but differential extent of reduction in each DC subset. As gene recombination in
CD11c-Cre mice fully occurs in differentiated DCs,56 an overall decrease in DC quantity
may result from CTCF deficiency in DCs. Similar proportions of pre-cDCs in the WT and
CD11c-cKO BM and decreases in pDCs and epidermal LCs, which develop independent
from pre-cDCs,72 highlight a critical role for CTCF in sustaining terminally differentiated
DC pools in vivo.
We then utilized a LC-specific CTCF-deficient mouse line to show that CTCF is
essentially involved in epidermal LC homeostasis. The reduction in epidermal LC number
in huLang-cKO mice was not attributed to a failure of the initial LC network formation or
a subsequent increase in cell apoptosis. Instead, CTCF-deficient LCs demonstrated a
significant deterioration in self-renewal capacity. Previous studies have shown that
conditional CTCF deletion in T cells leads to cell cycle blockage,46 and impaired
proliferation upon T-cell receptor stimulation.47 In line with those results from lymphoid
lineage cells, our findings suggest that CTCF played an important supporting role in
myeloid LC proliferation. However, CTCF overexpression during granulocyte macrophage
colony-stimulating factor (GM-CSF)-supplemented BMDC culture was reported to lead to
84
the diminished proliferation.54 These discrepant observations may be due to the fact that
LC development strictly depends on TGF-β and IL-34, but not GM-CSF.
CTCF-deficient LCs demonstrated unexpected impairments in their egress from the
epidermis. LC migration is initiated by the downregulation of cell adhesion molecules in
response to pro-inflammatory cues, which facilitates the release of LCs from the
epidermis.73 A previous report suggested a role for CTCF in the migration of transformed
corneal cell lines in vitro, but the exact regulatory mechanisms were unclear.74 In our
microarray experiments, the expression levels of cell adhesion molecules including Cadm3,
Cdh17, and Nid1 were significantly greater in CTCF-deficient LCs, which may augment
LC attachment within the epidermis. Cadm3 is associated with the cell-cell adhesion of
neuronal cells.75 Cdh17 is a non-canonical cadherin that is frequently up-regulated in
cancer cells and mediates their adhesion.76,77 Notably, CTCF-deficient LCs highly
expressed Nid1, which can bind to laminin and collagen IV in the basement membrane.78
Because CTCF-deficient LCs were unable to efficiently transmigrate the dermo-epidermal
junction, we speculate that cKO LCs may be entrapped within the epidermis by an
increased affinity to the juxtaposed keratinocytes and basement membrane structure.
Importantly, those adhesion molecules were consistently diminished in WT LCs following
in vivo activation. Collectively, these results strongly suggest that CTCF intrinsically
supports the efficient egress of LCs from the epidermis by negatively regulating LC
adhesion intensity. In addition to the adhesion molecules, both mouse and human CTCF-
depleted LCs showed lower levels of CCR7 expression and impaired migration toward
85
CCR7 ligand-rich areas. Thus, our findings provide relevant evidence supporting the
hypothesis that CTCF is involved in LC migration. At molecular level, the constitutive
expression of CTCF even after LC activation proposed that CTCF in LCs may work
through the differential DNA occupancy patterns16 and/or by collaboration with other
interacting proteins, such as transcription factors, cofactors, and cohesin complexes.79,80
Further studies will be necessary to dissect global CTCF binding profiles and its protein
interactomes in LCs to illuminate CTCF-dependent molecular mechanisms for regulating
its target genes.
Although there are conflicting results regarding the role of LCs, several recent studies
have shown that LCs can suppress CHS and other types of inflammation. In huLang-cKO
mice, few antigen-laden LCs could reach the draining LNs, whereas dDC migration was
comparable to that in WT mice. A recent study using a langerin-targeting antigen delivery
strategy demonstrated that priming of CD8+ T cells was mediated by langerin+ dDCs, but
surprisingly, LCs actively suppressed immunity.81 As our data revealed greater priming of
DNFB-specific IFN-γ+CD8+ T cells in huLang-cKO mice, LCs are likely to restrict the
cross-priming of cytotoxic T cells when antigens are captured and presented by both LCs
and dDCs. Another murine model that employed epicutaneous sensitization allowed us to
demonstrate a distinct role for migratory LCs in promoting allergic immunity to protein
antigens. In the skin, LCs are major players that uptake external protein antigens and
activate antigen-specific immune responses,2,82 but their function is somewhat redundant,
suggesting the potential contribution of other types of APCs.83 Nevertheless, our huLang-
86
cKO mice showed a lower degree of epicutaneous sensitization to OVA, indicating that
CTCF-dependent LC homeostasis is pivotal for cutaneous allergic responses to proteins.
Interestingly, an association between an increased risk of asthma and a disease-related
allele linked to changes in CTCF DNA-binding was reported, opening a possible causality
between allergic diseases and CTCF.84 Moreover, DCs in different barrier tissues possess
an important role in allergy pathogenesis.85 Therefore, future studies are needed to explore
the link between genome-wide binding patterns of CTCF and immunologic functions of
DCs from allergic patients to clarify the functional implications of the CTCF-DC axis in
allergic inflammation.86
Hematopoietic system differentiation is a multistep process tightly regulated and
controlled by complex molecular and cellular networks. Although CTCF has been shown
to regulate cellular development and differentiation of human erythroid cells,87 murine
thymocytes,46 mature T cells,46,48 B cells,50 and myeloid lineage cells including dendritic
cells,52,54,63 whether CTCF controls a homeostasis of adult HSCs has been unknown. As
CTCF-null embryo exhibited prenatal lethality,45 we generated a TMX-induced CTCF
cKO mouse system to conditionally ablate CTCF in the adult hematopoietic system.
Our combined genetic and BM transplantation approaches reveal that acute systemic and
hematopoietic-specific ablation of CTCF leads to a rapid hematopoietic failure. c-Kit is the
surface receptor of SCF, a cytokine essential for HSC self-renewal, growth, and survival.88
Importantly, CTCF ablation results in a severe decrease in heterogeneous c-Kithi
stem/progenitor populations including the most primitive LT-HSCs. A resultant exhaustion
87
of HSCs by CTCF depletion is a cell-autonomous effect as co-transplantation with
supporting BM was not able to revert a decreased frequency of c-Kithi cells after CTCF
deletion. To the best of our knowledge, these results are the first description which shows
the pivotal requirement of CTCF in maintaining HSC pool in vivo. Recent study has
revealed the requirement of MED12, which is a component of mediator, for the
transcriptional regulation of c-Kit in HSCs.89 As our CTCF-ablated mice show a similar
reduction of c-Kithi HSCs, it would be intriguing to assess whether CTCF regulates c-Kit
transcript expression in our model in association with mediator and/or chromatin modifiers.
In the absence of specific mitogenic stimuli, HSCs remain in a quiescent or dormant
state.90 Our microarray analyses demonstrated that CTCF-deficient hematopoietic
stem/progenitor cells showed a defective quiescence and a strikingly elevated level of cell
cycle-promoting gene expression, including Mnd1, Dmc1, Ccnd1, Cdk1, and Bub1. CTCF
has been associated with either cell cycle progression or cell cycle arrest in the cell type-
dependent manner. CTCF promotes cell cycle and proliferation of αβ T cells in the
thymus,46 epidermal Langerhans cells,63 and human embryonic stem cells,91 while it
negatively regulates the cell cycle in several types of tumor cells.92-94 As our transcriptome
analysis has been done using the LSK population prior to the loss of surface c-Kit
expression, an increased cell cycle program is in part directly regulated by CTCF-
deficiency at the transcription level. HSC quiescence is critically maintained together with
the low level of intracellular ROS under the hypoxic conditions in vivo.95-97 An increased
ROS level eventually results in HSC proliferation and differentiation.97,98 CTCF-ablated
88
HSCs demonstrated a highly elevated ROS level which is related to the considerably
decreased quiescence phase. In line with this, recent study has revealed a role for CTCF in
collaboration with Cockayne syndrome group B protein to protect cells from the oxidative
stress condition.99 Thus, CTCF exhibits an antioxidative activity in certain cell type
including HSCs, although the biological effects would be different according to its target
genes.
HSCs continuously give rise to both myeloid and lymphoid progenitor populations
through the intermediate multipotent progenitor cells.20,21 Interestingly, our mixed chimera
experiments demonstrate that CTCF-deficient HSCs fail to develop into multiple types of
myeloid populations, while lymphoid development is significantly preserved. Previous
study using CTCF-silenced CMPs shows that CTCF knockdown increases that rate of
CMP differentiation in vitro.52 Since CMPs directly differentiate from HSCs and there is a
lack of further input of HSC-derived CMPs from in vitro system, our data suggest that
CTCF is actually required for the myeloid lineage development through sustaining HSC
pool in vivo. It is currently unclear how lymphoid lineage development is maintained by
CTCF-deficient HSCs. It is possible that CTCF directs the balanced diversification
between myeloid and lymphoid lineage development. Therefore, future work will be
definitely needed to clarify an unexpected role for CTCF in the lineage commitment.
89
V. CONCLUSION
In Part A, we elucidate a role for CTCF in the DC lineage using genetic approaches.
CTCF supports quantitative maintenance of the systemic DC pool and promots LC self-
turnover. We also demonstrate that CTCF facilitates LC egress from the epidermis and
confers them to differentially regulate cutaneous immunity. In Part B, we elucidate a role
for CTCF in the HSC homeostasis using an inducible gene depletion system. CTCF
supports the homeostatic maintenance of HSC pool through sustaining HSC quiescence
likely in the ROS-dependent manner. This study expands our knowledge of CTCF, which
is actively involved in multiple facets of LC and HSC homeostasis. Further study is
required to fully understand the underlying mechanisms of CTCF in the control of the
development and function of each DC subset and their associations with inflammatory
disorders. Also we anticipate that our knowledge would be translated to the clinical
settings to improve the result of HSC transplantation or anti-leukemic therapies through
modulating CTCF activity in vivo.
90
REFERENCES
1. Merad M, Ginhoux F, Collin M. Origin, homeostasis and function of Langerhans
cells and other langerin-expressing dendritic cells. Nat Rev Immunol 2008;8:935-
47.
2. Kubo A, Nagao K, Yokouchi M, Sasaki H, Amagai M. External antigen uptake by
Langerhans cells with reorganization of epidermal tight junction barriers. J Exp
Med 2009;206:2937-46.
3. Ouchi T, Kubo A, Yokouchi M, Adachi T, Kobayashi T, Kitashima DY, et al.
Langerhans cell antigen capture through tight junctions confers preemptive
immunity in experimental staphylococcal scalded skin syndrome. J Exp Med
2011;208:2607-13.
4. Kubo A, Nagao K, Amagai M. Epidermal barrier dysfunction and cutaneous
sensitization in atopic diseases. J Clin Invest 2012;122:440-7.
5. Romani N, Clausen BE, Stoitzner P. Langerhans cells and more: langerin-
expressing dendritic cell subsets in the skin. Immunol Rev 2010;234:120-41.
6. Clausen BE, Kel JM. Langerhans cells: critical regulators of skin immunity?
Immunol Cell Biol 2010;88:351-60.
7. Kaplan DH. In vivo function of Langerhans cells and dermal dendritic cells.
Trends Immunol 2010;31:446-51.
8. Chorro L, Sarde A, Li M, Woollard KJ, Chambon P, Malissen B, et al. Langerhans
cell (LC) proliferation mediates neonatal development, homeostasis, and
91
inflammation-associated expansion of the epidermal LC network. J Exp Med
2009;206:3089-100.
9. Hoeffel G, Wang Y, Greter M, See P, Teo P, Malleret B, et al. Adult Langerhans
cells derive predominantly from embryonic fetal liver monocytes with a minor
contribution of yolk sac-derived macrophages. J Exp Med 2012;209:1167-81.
10. Merad M, Manz MG, Karsunky H, Wagers A, Peters W, Charo I, et al. Langerhans
cells renew in the skin throughout life under steady-state conditions. Nat Immunol
2002;3:1135-41.
11. Ginhoux F, Tacke F, Angeli V, Bogunovic M, Loubeau M, Dai XM, et al.
Langerhans cells arise from monocytes in vivo. Nat Immunol 2006;7:265-73.
12. Wang Y, Szretter KJ, Vermi W, Gilfillan S, Rossini C, Cella M, et al. IL-34 is a
tissue-restricted ligand of CSF1R required for the development of Langerhans cells
and microglia. Nat Immunol 2012;13:753-60.
13. Greter M, Lelios I, Pelczar P, Hoeffel G, Price J, Leboeuf M, et al. Stroma-derived
interleukin-34 controls the development and maintenance of langerhans cells and
the maintenance of microglia. Immunity 2012;37:1050-60.
14. Borkowski TA, Letterio JJ, Farr AG, Udey MC. A role for endogenous
transforming growth factor beta 1 in Langerhans cell biology: the skin of
transforming growth factor beta 1 null mice is devoid of epidermal Langerhans
cells. J Exp Med 1996;184:2417-22.
92
15. Kaplan DH, Li MO, Jenison MC, Shlomchik WD, Flavell RA, Shlomchik MJ.
Autocrine/paracrine TGFbeta1 is required for the development of epidermal
Langerhans cells. J Exp Med 2007;204:2545-52.
16. Bobr A, Igyarto BZ, Haley KM, Li MO, Flavell RA, Kaplan DH.
Autocrine/paracrine TGF-beta1 inhibits Langerhans cell migration. Proc Natl Acad
Sci U S A 2012;109:10492-7.
17. Fainaru O, Woolf E, Lotem J, Yarmus M, Brenner O, Goldenberg D, et al. Runx3
regulates mouse TGF-beta-mediated dendritic cell function and its absence results
in airway inflammation. EMBO J 2004;23:969-79.
18. Hacker C, Kirsch RD, Ju XS, Hieronymus T, Gust TC, Kuhl C, et al.
Transcriptional profiling identifies Id2 function in dendritic cell development. Nat
Immunol 2003;4:380-6.
19. Chopin M, Seillet C, Chevrier S, Wu L, Wang H, Morse HC, 3rd, et al.
Langerhans cells are generated by two distinct PU.1-dependent transcriptional
networks. J Exp Med 2013;210:2967-80.
20. Orkin SH, Zon LI. Hematopoiesis: an evolving paradigm for stem cell biology.
Cell 2008;132:631-44.
21. Wilson A, Trumpp A. Bone-marrow haematopoietic-stem-cell niches. Nat Rev
Immunol 2006;6:93-106.
93
22. Wilson NK, Foster SD, Wang X, Knezevic K, Schutte J, Kaimakis P, et al.
Combinatorial transcriptional control in blood stem/progenitor cells: genome-wide
analysis of ten major transcriptional regulators. Cell Stem Cell 2010;7:532-44.
23. Bigas A, Espinosa L. Hematopoietic stem cells: to be or Notch to be. Blood
2012;119:3226-35.
24. Bigas A, Guiu J, Gama-Norton L. Notch and Wnt signaling in the emergence of
hematopoietic stem cells. Blood Cells Mol Dis 2013;51:264-70.
25. Rebel VI, Kung AL, Tanner EA, Yang H, Bronson RT, Livingston DM. Distinct
roles for CREB-binding protein and p300 in hematopoietic stem cell self-renewal.
Proc Natl Acad Sci U S A 2002;99:14789-94.
26. Yoshida T, Hazan I, Zhang J, Ng SY, Naito T, Snippert HJ, et al. The role of the
chromatin remodeler Mi-2beta in hematopoietic stem cell self-renewal and
multilineage differentiation. Genes Dev 2008;22:1174-89.
27. Cedar H, Bergman Y. Epigenetics of haematopoietic cell development. Nat Rev
Immunol 2011;11:478-88.
28. Broske AM, Vockentanz L, Kharazi S, Huska MR, Mancini E, Scheller M, et al.
DNA methylation protects hematopoietic stem cell multipotency from
myeloerythroid restriction. Nat Genet 2009;41:1207-15.
29. Trowbridge JJ, Snow JW, Kim J, Orkin SH. DNA methyltransferase 1 is essential
for and uniquely regulates hematopoietic stem and progenitor cells. Cell Stem Cell
2009;5:442-9.
94
30. Trowbridge JJ, Orkin SH. DNA methylation in adult stem cells: new insights into
self-renewal. Epigenetics 2010;5:189-93.
31. Tadokoro Y, Ema H, Okano M, Li E, Nakauchi H. De novo DNA
methyltransferase is essential for self-renewal, but not for differentiation, in
hematopoietic stem cells. J Exp Med 2007;204:715-22.
32. Sauvageau M, Sauvageau G. Polycomb group proteins: multi-faceted regulators of
somatic stem cells and cancer. Cell Stem Cell 2010;7:299-313.
33. Park IK, Qian D, Kiel M, Becker MW, Pihalja M, Weissman IL, et al. Bmi-1 is
required for maintenance of adult self-renewing haematopoietic stem cells. Nature
2003;423:302-5.
34. Ohta H, Sawada A, Kim JY, Tokimasa S, Nishiguchi S, Humphries RK, et al.
Polycomb group gene rae28 is required for sustaining activity of hematopoietic
stem cells. J Exp Med 2002;195:759-70.
35. Cales C, Roman-Trufero M, Pavon L, Serrano I, Melgar T, Endoh M, et al.
Inactivation of the polycomb group protein Ring1B unveils an antiproliferative
role in hematopoietic cell expansion and cooperation with tumorigenesis
associated with Ink4a deletion. Mol Cell Biol 2008;28:1018-28.
36. Wang T, Nandakumar V, Jiang XX, Jones L, Yang AG, Huang XF, et al. The
control of hematopoietic stem cell maintenance, self-renewal, and differentiation
by Mysm1-mediated epigenetic regulation. Blood 2013;122:2812-22.
95
37. Quintas-Cardama A, Santos FP, Garcia-Manero G. Histone deacetylase inhibitors
for the treatment of myelodysplastic syndrome and acute myeloid leukemia.
Leukemia 2011;25:226-35.
38. Ong CT, Corces VG. CTCF: an architectural protein bridging genome topology
and function. Nat Rev Genet 2014;15:234-46.
39. Wang H, Maurano MT, Qu H, Varley KE, Gertz J, Pauli F, et al. Widespread
plasticity in CTCF occupancy linked to DNA methylation. Genome Res
2012;22:1680-8.
40. Nakahashi H, Kwon KR, Resch W, Vian L, Dose M, Stavreva D, et al. A genome-
wide map of CTCF multivalency redefines the CTCF code. Cell Rep 2013;3:1678-
89.
41. Lobanenkov VV, Nicolas RH, Adler VV, Paterson H, Klenova EM, Polotskaja AV,
et al. A novel sequence-specific DNA binding protein which interacts with three
regularly spaced direct repeats of the CCCTC-motif in the 5'-flanking sequence of
the chicken c-myc gene. Oncogene 1990;5:1743-53.
42. Bell AC, West AG, Felsenfeld G. The protein CTCF is required for the enhancer
blocking activity of vertebrate insulators. Cell 1999;98:387-96.
43. Splinter E, Heath H, Kooren J, Palstra RJ, Klous P, Grosveld F, et al. CTCF
mediates long-range chromatin looping and local histone modification in the beta-
globin locus. Genes Dev 2006;20:2349-54.
96
44. Vietri Rudan M, Hadjur S. Genetic Tailors: CTCF and Cohesin Shape the Genome
During Evolution. Trends Genet 2015;31:651-60.
45. Fedoriw AM, Stein P, Svoboda P, Schultz RM, Bartolomei MS. Transgenic RNAi
reveals essential function for CTCF in H19 gene imprinting. Science
2004;303:238-40.
46. Heath H, Ribeiro de Almeida C, Sleutels F, Dingjan G, van de Nobelen S, Jonkers
I, et al. CTCF regulates cell cycle progression of alphabeta T cells in the thymus.
EMBO J 2008;27:2839-50.
47. Ribeiro de Almeida C, Heath H, Krpic S, Dingjan GM, van Hamburg JP, Bergen I,
et al. Critical role for the transcription regulator CCCTC-binding factor in the
control of Th2 cytokine expression. J Immunol 2009;182:999-1010.
48. Sekimata M, Perez-Melgosa M, Miller SA, Weinmann AS, Sabo PJ, Sandstrom R,
et al. CCCTC-binding factor and the transcription factor T-bet orchestrate T helper
1 cell-specific structure and function at the interferon-gamma locus. Immunity
2009;31:551-64.
49. Shih HY, Verma-Gaur J, Torkamani A, Feeney AJ, Galjart N, Krangel MS. Tcra
gene recombination is supported by a Tcra enhancer- and CTCF-dependent
chromatin hub. Proc Natl Acad Sci U S A 2012;109:E3493-502.
50. Ribeiro de Almeida C, Stadhouders R, de Bruijn MJ, Bergen IM, Thongjuea S,
Lenhard B, et al. The DNA-binding protein CTCF limits proximal Vkappa
97
recombination and restricts kappa enhancer interactions to the immunoglobulin
kappa light chain locus. Immunity 2011;35:501-13.
51. Guo C, Yoon HS, Franklin A, Jain S, Ebert A, Cheng HL, et al. CTCF-binding
elements mediate control of V(D)J recombination. Nature 2011;477:424-30.
52. Ouboussad L, Kreuz S, Lefevre PF. CTCF depletion alters chromatin structure and
transcription of myeloid-specific factors. J Mol Cell Biol 2013;5:308-22.
53. Nikolic T, Movita D, Lambers ME, de Almeida CR, Biesta P, Kreefft K, et al. The
DNA-binding factor Ctcf critically controls gene expression in macrophages. Cell
Mol Immunol 2013; doi:10.1038/cmi.2013.41.
54. Koesters C, Unger B, Bilic I, Schmidt U, Bluml S, Lichtenberger B, et al.
Regulation of dendritic cell differentiation and subset distribution by the zinc
finger protein CTCF. Immunol Lett 2007;109:165-74.
55. Rodriguez CI, Buchholz F, Galloway J, Sequerra R, Kasper J, Ayala R, et al.
High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nat
Genet 2000;25:139-40.
56. Caton ML, Smith-Raska MR, Reizis B. Notch-RBP-J signaling controls the
homeostasis of CD8- dendritic cells in the spleen. J Exp Med 2007;204:1653-64.
57. Ventura A, Kirsch DG, McLaughlin ME, Tuveson DA, Grimm J, Lintault L, et al.
Restoration of p53 function leads to tumour regression in vivo. Nature
2007;445:661-5.
98
58. Berger G, Durand S, Goujon C, Nguyen XN, Cordeil S, Darlix JL, et al. A simple,
versatile and efficient method to genetically modify human monocyte-derived
dendritic cells with HIV-1-derived lentiviral vectors. Nat Protoc 2011;6:806-16.
59. Tang M, Chen B, Lin T, Li Z, Pardo C, Pampo C, et al. Restraint of angiogenesis
by zinc finger transcription factor CTCF-dependent chromatin insulation. Proc
Natl Acad Sci U S A 2011;108:15231-6.
60. Goujon C, Jarrosson-Wuilleme L, Bernaud J, Rigal D, Darlix JL, Cimarelli A.
With a little help from a friend: increasing HIV transduction of monocyte-derived
dendritic cells with virion-like particles of SIV(MAC). Gene Ther 2006;13:991-4.
61. Satoh T, Manel N. Gene transduction in human monocyte-derived dendritic cells
using lentiviral vectors. Methods Mol Biol 2013;960:401-9.
62. Heng TS, Painter MW, Immunological Genome Project C. The Immunological
Genome Project: networks of gene expression in immune cells. Nat Immunol
2008;9:1091-4.
63. Kim TG, Kim M, Lee JJ, Kim SH, Je JH, Lee Y, et al. CCCTC-binding factor
controls the homeostatic maintenance and migration of Langerhans cells. J Allergy
Clin Immunol 2015;136:713-24.
64. Huang E, Nocka K, Beier DR, Chu TY, Buck J, Lahm HW, et al. The
hematopoietic growth factor KL is encoded by the Sl locus and is the ligand of the
c-kit receptor, the gene product of the W locus. Cell 1990;63:225-33.
99
65. Edling CE, Hallberg B. c-Kit--a hematopoietic cell essential receptor tyrosine
kinase. Int J Biochem Cell Biol 2007;39:1995-8.
66. Mendelson A, Frenette PS. Hematopoietic stem cell niche maintenance during
homeostasis and regeneration. Nat Med 2014;20:833-46.
67. Yona S, Kim KW, Wolf Y, Mildner A, Varol D, Breker M, et al. Fate mapping
reveals origins and dynamics of monocytes and tissue macrophages under
homeostasis. Immunity 2013;38:79-91.
68. Hashimoto D, Chow A, Noizat C, Teo P, Beasley MB, Leboeuf M, et al. Tissue-
resident macrophages self-maintain locally throughout adult life with minimal
contribution from circulating monocytes. Immunity 2013;38:792-804.
69. Kabashima K, Banks TA, Ansel KM, Lu TT, Ware CF, Cyster JG. Intrinsic
lymphotoxin-beta receptor requirement for homeostasis of lymphoid tissue
dendritic cells. Immunity 2005;22:439-50.
70. Liu K, Waskow C, Liu X, Yao K, Hoh J, Nussenzweig M. Origin of dendritic cells
in peripheral lymphoid organs of mice. Nat Immunol 2007;8:578-83.
71. Henri S, Poulin LF, Tamoutounour S, Ardouin L, Guilliams M, de Bovis B, et al.
CD207+ CD103+ dermal dendritic cells cross-present keratinocyte-derived
antigens irrespective of the presence of Langerhans cells. J Exp Med
2010;207:189-206.
72. Liu K, Nussenzweig MC. Origin and development of dendritic cells. Immunol Rev
2010;234:45-54.
100
73. Jakob T, Ring J, Udey MC. Multistep navigation of Langerhans/dendritic cells in
and out of the skin. J Allergy Clin Immunol 2001;108:688-96.
74. Wang L, Deng SX, Lu L. Role of CTCF in EGF-induced migration of
immortalized human corneal epithelial cells. Invest Ophthalmol Vis Sci
2012;53:946-51.
75. Kakunaga S, Ikeda W, Itoh S, Deguchi-Tawarada M, Ohtsuka T, Mizoguchi A, et
al. Nectin-like molecule-1/TSLL1/SynCAM3: a neural tissue-specific
immunoglobulin-like cell-cell adhesion molecule localizing at non-junctional
contact sites of presynaptic nerve terminals, axons and glia cell processes. J Cell
Sci 2005;118:1267-77.
76. Liu LX, Lee NP, Chan VW, Xue W, Zender L, Zhang C, et al. Targeting cadherin-
17 inactivates Wnt signaling and inhibits tumor growth in liver carcinoma.
Hepatology 2009;50:1453-63.
77. Bartolome RA, Barderas R, Torres S, Fernandez-Acenero MJ, Mendes M, Garcia-
Foncillas J, et al. Cadherin-17 interacts with alpha2beta1 integrin to regulate cell
proliferation and adhesion in colorectal cancer cells causing liver metastasis.
Oncogene 2014;33:1658-69.
78. Sasaki T, Fassler R, Hohenester E. Laminin: the crux of basement membrane
assembly. J Cell Biol 2004;164:959-63.
101
79. Garber M, Yosef N, Goren A, Raychowdhury R, Thielke A, Guttman M, et al. A
high-throughput chromatin immunoprecipitation approach reveals principles of
dynamic gene regulation in mammals. Mol Cell 2012;47:810-22.
80. Ebert A, McManus S, Tagoh H, Medvedovic J, Salvagiotto G, Novatchkova M, et
al. The distal V(H) gene cluster of the Igh locus contains distinct regulatory
elements with Pax5 transcription factor-dependent activity in pro-B cells.
Immunity 2011;34:175-87.
81. Flacher V, Tripp CH, Mairhofer DG, Steinman RM, Stoitzner P, Idoyaga J, et al.
Murine Langerin+ dermal dendritic cells prime CD8+ T cells while Langerhans
cells induce cross-tolerance. EMBO Mol Med 2014;6:1191-204.
82. Nakajima S, Igyarto BZ, Honda T, Egawa G, Otsuka A, Hara-Chikuma M, et al.
Langerhans cells are critical in epicutaneous sensitization with protein antigen via
thymic stromal lymphopoietin receptor signaling. J Allergy Clin Immunol
2012;129:1048-55 e6.
83. Lee CH, Chen JS, Chiu HC, Hong CH, Liu CY, Ta YC, et al. Dermal dendritic
cells, but not Langerhans cells, are critical in murine single epicutaneous
sensitization. Exp Dermatol 2015;24:67-9.
84. Verlaan DJ, Berlivet S, Hunninghake GM, Madore AM, Lariviere M, Moussette S,
et al. Allele-specific chromatin remodeling in the ZPBP2/GSDMB/ORMDL3
locus associated with the risk of asthma and autoimmune disease. Am J Hum
Genet 2009;85:377-93.
102
85. Akdis CA, Akdis M. Mechanisms of allergen-specific immunotherapy. J Allergy
Clin Immunol 2011;127:18-27; quiz 8-9.
86. Lavin Y, Winter D, Blecher-Gonen R, David E, Keren-Shaul H, Merad M, et al.
Tissue-resident macrophage enhancer landscapes are shaped by the local
microenvironment. Cell 2014;159:1312-26.
87. Torrano V, Chernukhin I, Docquier F, D'Arcy V, Leon J, Klenova E, et al. CTCF
regulates growth and erythroid differentiation of human myeloid leukemia cells. J
Biol Chem 2005;280:28152-61.
88. Domen J, Weissman IL. Hematopoietic stem cells need two signals to prevent
apoptosis; BCL-2 can provide one of these, Kitl/c-Kit signaling the other. J Exp
Med 2000;192:1707-18.
89. Aranda-Orgilles B, Saldana-Meyer R, Wang E, Trompouki E, Fassl A, Lau S, et al.
MED12 Regulates HSC-Specific Enhancers Independently of Mediator Kinase
Activity to Control Hematopoiesis. Cell Stem Cell 2016;
doi:10.1016/j.stem.2016.08.004.
90. Trumpp A, Essers M, Wilson A. Awakening dormant haematopoietic stem cells.
Nat Rev Immunol 2010;10:201-9.
91. Balakrishnan SK, Witcher M, Berggren TW, Emerson BM. Functional and
molecular characterization of the role of CTCF in human embryonic stem cell
biology. PLoS One 2012;7:e42424.
103
92. Rasko JE, Klenova EM, Leon J, Filippova GN, Loukinov DI, Vatolin S, et al. Cell
growth inhibition by the multifunctional multivalent zinc-finger factor CTCF.
Cancer Res 2001;61:6002-7.
93. Qi CF, Martensson A, Mattioli M, Dalla-Favera R, Lobanenkov VV, Morse HC,
3rd. CTCF functions as a critical regulator of cell-cycle arrest and death after
ligation of the B cell receptor on immature B cells. Proc Natl Acad Sci U S A
2003;100:633-8.
94. Docquier F, Farrar D, D'Arcy V, Chernukhin I, Robinson AF, Loukinov D, et al.
Heightened expression of CTCF in breast cancer cells is associated with resistance
to apoptosis. Cancer Res 2005;65:5112-22.
95. Jang YY, Sharkis SJ. A low level of reactive oxygen species selects for primitive
hematopoietic stem cells that may reside in the low-oxygenic niche. Blood
2007;110:3056-63.
96. Owusu-Ansah E, Banerjee U. Reactive oxygen species prime Drosophila
haematopoietic progenitors for differentiation. Nature 2009;461:537-41.
97. Suda T, Takubo K, Semenza GL. Metabolic regulation of hematopoietic stem cells
in the hypoxic niche. Cell Stem Cell 2011;9:298-310.
98. Bigarella CL, Liang R, Ghaffari S. Stem cells and the impact of ROS signaling.
Development 2014;141:4206-18.
104
99. Lake RJ, Boetefuer EL, Won KJ, Fan HY. The CSB chromatin remodeler and
CTCF architectural protein cooperate in response to oxidative stress. Nucleic
Acids Res 2016;44:2125-35.
105
ABSTRACT (in Korean)
피랑게 한스 포 골수 포항상 지에 어
CCCTC-binding factor 역할
< 지도 수 >
연 학 학원 과학과
태균
CCCTC-binding factor (CTCF)는 진핵생물에 간에 보 어 는 DNA 결합
zinc-finger 단 질로 고차원 크로마틴 결 에 핵심 로 여하여 다양한
생물학 통해 한다고 알려 다. CTCF DNA
결합 체에 걸쳐 재하지만 포 특 CTCF 결합 가 재함
알려 는 CTCF 다양한 생물학 능 해하는 도움 다.
본 피 랑게 한스 포 골수 포 항상 지에 어 CTCF
단 질 생물학 능 연 하 다.
랑게 한스 포는 피에 재하는 수지상 포로 피 항원 T 포에
달하여 피 역 한다고 알려 다. 본 수지상 포
랑게 한스 포 특 CTCF 결핍 마우스 하여 CTCF가 랑게 한스 포
106
가 열 진하여 포수 지에 핵심 로 여함 하 다.
랑게 한스 포 특 CTCF 결핍 마우스 능 통해 CTCF 가
포 착 감 시켜 랑게 한스 포 동 진시킴 알 수
었다. CTCF 결핍 로 한 랑게 한스 포 수 포 동 감 는 증가
과민 감 경피 단 감 과연 하 다.
과 골수 포에 시 는 련 과 로
포가 생한다. 생 동안 과 해 골수 포 가증식
과 엄격하게 어야 한다. 본 타 시 에 한 CTCF 넉아웃
마우스 하고 골수 식 실험 통해 골수 포 항상 지에 어
CTCF가핵심 로 여함 하 다.
연 통해 CTCF 랑게 한스 포 골수 포 항상
지과 립할수 었 , 향후 CTCF 도 통해랑게 한스 포
골수 포 능 어하여 다양한 역피 질 골수 식치료에 할
수 시하 다.
핵심 는말: CCCTC-binding factor, CTCF 특 넉아웃 마우스, 수지상 포,
골수 포, 항상 , 랑게 한스 포
107
PUBLICATION LIST
1. Kim TG, Jee H, Fuentes-Duculan J, Wu WH, Byamba D, Kim DS, et al. Dermal
clusters of mature dendritic cells and T cells are associated with the CCL20/CCR6
chemokine system in chronic psoriasis. J Invest Dermatol 2014;134:1462-5.
2. Kim TG, Kim DS, Kim HP, Lee MG. The pathophysiological role of dendritic cell
subsets in psoriasis. BMB Rep 2014;47:60-8.
3. Song MJ, Lee JJ, Nam YH, Kim TG, Chung YW, Kim M, et al. Modulation of
dendritic cell function by Trichomonas vaginalis-derived secretory products. BMB
Rep 2015;48:103-8.
4. Kim TG, Kim M, Lee JJ, Kim SH, Je JH, Lee Y, et al. CCCTC-binding factor
controls the homeostatic maintenance and migration of Langerhans cells. J Allergy
Clin Immunol 2015;136:713-24.
5. Kim TG, Kim S, Jung S, Kim M, Lee MG, Kim HP. CCCTC-binding factor is
essential to the maintenance and quiescence of hematopoietic stem cells in mice.
(Submitted)