ccpa causes repression of the phopr promoter through a ... · tical to the consensus sequence for...

JOURNAL OF BACTERIOLOGY, Feb. 2006, p. 1266–1278 Vol. 188, No. 40021-9193/06/$08.00�0 doi:10.1128/JB.188.4.1266–1278.2006Copyright © 2006, American Society for Microbiology. All Rights Reserved.

CcpA Causes Repression of the phoPR Promoter through aNovel Transcription Start Site, PA6

Ankita Puri-Taneja, Salbi Paul, Yinghua Chen,† and F. Marion Hulett*Laboratory for Molecular Biology, Department of Biological Sciences, University of Illinois at Chicago, Chicago, Illinois 60607

Received 25 August 2005/Accepted 23 November 2005

The Bacillus subtilis PhoPR two-component system is directly responsible for activation or repression of Phoregulon genes in response to phosphate deprivation. The response regulator, PhoP, and the histidine kinase, PhoR,are encoded in a single operon with a complex promoter region that contains five known transcription start sites,which respond to at least two regulatory proteins. We report here the identification of another direct regulator ofphoPR transcription, carbon catabolite protein A, CcpA. This regulator functions in the presence of glucose or otherreadily metabolized carbon sources. The maximum derepression of phoPR expression in a ccpA mutant comparedto a wild-type stain was observed under excess phosphate conditions with glucose either throughout growth in ahigh-phosphate defined medium or in a low-phosphate defined medium during exponential growth, a growthcondition when phoPR transcription is low in a wild-type strain due to the absence of autoinduction. Either HPr orCrh were sufficient to cause CcpA dependent repression of the phoPR promoter in vivo. A ptsH1 (Hpr) crh doublemutant completely relieves phoPR repression during phosphate starvation but not during phosphate replete growth.In vivo and in vitro studies showed that CcpA repressed phoPR transcription by binding directly to the cre consensussequence present in the promoter. Primer extension and in vitro transcription studies revealed that the CcpAregulation of phoPR transcription was due to repression of PA6, a previously unidentified promoter positionedimmediately upstream of the cre box. E�A was sufficient for transcription of PA6, which was repressed by CcpA invitro. These studies showed direct repression by CcpA of a newly discovered E�A-responsive phoPR promoter thatrequired either Hpr or Crh in vivo for direct binding to the putative consensus cre sequence located between PA6 andthe five downstream promoters characterized previously.

Bacteria respond to changes in environmental conditionsthrough various strategies, one of which is two-componentsignal transduction systems. The Pho regulon represents onesuch system and responds to the phosphate starvation condi-tions experienced by the gram-positive bacterium Bacillus sub-tilis. This system consists of the histidine kinase PhoR, whichsenses limited Pi (inorganic phosphate) conditions in the en-vironment, and the response regulator PhoP, which is phos-phorylated by the histidine kinase and regulates the transcrip-tion of a number of genes to create the cellular response tophosphate starvation (the Pho response) (21).

In addition to PhoP-PhoR, the Pho signal transduction net-work includes two parallel activation pathways for upstreamregulators, the ResDE two-component system and the transi-tion state regulator AbrB. A mutation in the response regula-tor resD leads to an approximately 80% reduction in the Phoresponse, while an abrB mutation causes an approximately20% reduction in Pho regulon gene expression. A resD-abrBdouble mutant is incapable of inducing Pho regulon genesupon phosphate starvation (54). The role of ResD is indirectvia its essential role in the production of a-type terminal oxi-dases that oxidize reduced quinones that were shown to inhibitPhoR autophosphorylation in vitro (50), suggesting that ResDis required for modulation of the Pho signal. The role of AbrB

remains unclear, but extensive protection of the phoPR pro-moter region by AbrB suggests that it may have a direct role inphoPR transcription (M. Strauch and F. M. Hulett, unpub-lished data).

The genes encoding the two regulatory proteins, PhoP andPhoR, are present in an operon transcribed from a commonpromoter region (33, 51). Primer extension analysis using RNAfrom a wild-type (JH642) and a �sigB mutant strain showedthat expression of the phoPR promoter was the sum of fivepromoter start sites and that each responded to specific growthphase and environmental controls (43). Several forms ofRNAP holoenzymes were required for expression from thesepromoters (Fig. 1; two promoters required E�A (PA3 and PA4),one E�B (PB1), and one E�E (PE2). Expression from PE2, PA3

and PA4 was enhanced by PhoP�P (phosphorylated PhoP).The form of RNAP required for a fifth transcription start site(called P5), observed using RNA from a sigB mutant strain,remains unknown (43).

Carbon catabolite regulation is a widespread phenomenonfound in bacteria where the expression of a number of genes isregulated by the presence of a preferred carbon source such asglucose. This regulation is typically mediated by a transcrip-tional regulator. In gram-positive bacteria such as B. subtilis,the regulation is through CcpA, a pleiotropic transcriptionalregulator belonging to the LacI/GalR family of transcriptionregulators (18). CcpA functions as a DNA binding protein,either activating or repressing a number of genes in the pres-ence of a preferred carbon source.

A consensus sequence called the cre (catabolite responseelement) box is typically present within the regulated promoter(20, 59) or in the coding region of a downstream gene or

* Corresponding author. Mailing address: Laboratory for MolecularBiology, Department of Biological Sciences, University of Illinois atChicago, 900 S. Ashland Ave. (M/C 567), Chicago, IL 60607. Phone:(312) 996-2280. Fax: (312) 413-2691. E-mail: [email protected].

† Present address: Department of Medicine, Section of Hematology-Oncology, University of Chicago, Chicago, Ill.

1266

on January 15, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

operon. Activation or repression of many CcpA-regulatedgenes requires HPr, a member of the phosphotransferase sys-tem (PTS) system or Crh, a protein with 45% identity to HPras a coeffector (13). HPr and Crh require phosphorylation atresidue Ser46 for the purpose of catabolite regulation (9, 14).This phosphorylation is achieved exclusively by a kinase calledHPr kinase (15, 49) that also has a phosphatase activity (31).HPr can function in the phosphotransferase system and thisactivity requires phosphorylation at the His15 residue by thePTS enzyme I. Crh lacks the His15 phosphorylation site, re-stricting it to function only in catabolite regulation (38).

The majority of the CcpA-regulated genes are affected neg-atively, for example, the genes involved in alternate carbonsource utilization (2, 11, 17, 30, 39, 40, 60) or certain genes ofthe tricarboxylic acid (TCA) cycle (26, 55). Positive regulationby CcpA is observed for genes that are involved in the carbonexcretion pathway, such as pta (46), ackA (41), acetoin biosyn-thesis (56), and certain genes encoding enzymes of glycolysis(37, 55).

The basic understanding of the phoPR operon regulatoryregion makes the mechanistic analysis of additional regulatorsfeasible, regulators such as AbrB and CcpA. A sequence iden-tical to the consensus sequence for the cre box (19, 59) in thephoPR promoter region has long been recognized. Recently,inclusion of phoPR among the genes repressed by CcpA in thetranscriptome studies of Stulke and colleagues (6) suggests apossible role for CcpA in phoPR regulation. The studies re-

ported here were initiated to determine if the apparent role ofCcpA is direct and, if so, which of the phoPR promoter(s) isregulated by CcpA. We demonstrate that CcpA plays a signif-icant role in the transcriptional regulation of the phoPR pro-moter, which is achieved by its direct binding to the cre boxconsensus sequence present in the phoPR promoter. Tran-scription of the phoPR promoter is controlled by CcpAthrough a previously unknown start site now referred to as PA6

which requires E�A.

MATERIALS AND METHODS

Bacterial strains and plasmids. All strains and plasmids used in this work arelisted in Table 1. ccpA, crh, and ptsH1 mutant strains were obtained by transformingQB5407, JZ4, or JZ8 chromosomal DNA, respectively, into MH6024 competentcells and selecting for spectinomycin resistance (Spcr) or chloramphenicol resistance(Cmr) as required. The parent strain for MH6024 was JH642. The transformantswere plated on tryptose blood agar base (TBAB) with glucose medium with theantibiotics mentioned above for selection.

Construction of isotopic phoPR-lacZ fusions. pMUTIN2 (57) was used tocreate lacZ fusion strains. pES2 contains the complete phoPR promoter and 494bp of the upstream gene mdh. pES2 was constructed by using the 802-bp EcoRI-BamHI fragment from pES1 (23) and cloning into the EcoRI and BamHI sitesof pUC19. The 802-bp EcoRI-BamHI fragment from pES2 was ligated intopMUTIN2 at complementary restriction sites giving rise to plasmid pAT3. Thisligation orients the promoter upstream of the lacZ reporter gene. pAT3 wastransformed into B. subtilis and was integrated into the phoPR locus by Campbellinsertion creating strain MH6024, which contained complete mdh gene upstreamof phoPR promoter-lacZ fusion and partial mdh gene and complete phoPRoperon under the control of its own promoter (see Fig. 2).

A point mutation in the cre box was created using QuikChange site-directed

TABLE 1. Bacterial strains and plasmids

Strain or plasmid Relevant genotype Source orreference

E. coli strainsDH5� Lab stockM15[pREP4] Qiagen

B. subtilis strainsJH642 pheA1 trpC2 J. A. HochBR151MA trpC2 lys3 Tina HenkinQB5407 ccpA::Tn917 Spcr Jorge StulkeJZ4 trpC2 crh::Spcr Susan FisherJZ8 trpC2 crh::Spcr ptsH1(cat) Susan FisherMH6018 pheA1 trpC2 ccpA::Tn917 Spcr This studyMH6021 trpC2 lys3 pAT3� phoP-lacZ Ermr This studyMH6024 pheA1 trpC2 pAT3� phoP-lacZ Ermr This studyMH6025 pheA1 trpC2 ccpA::Tn917 Spcr pAT3� phoP-lacZ Ermr This studyMH6032 pheA1 trpC2 crh::Spcr pAT3� phoP-lacZ Ermr This studyMH6033 pheA1 trpC2 ptsH1 Cmr pAT3� phoP-lacZ Ermr This studyMH6034 pheA1 trpC2crh::Spcr ptsH1 Cmr pAT3� phoP-lacZ Ermr This studyMH6038 trpC2 lys3 pAT3� phoP cre1-lacZ Ermr This studyMH6040 pheA1 trpC2 pAT3� phoP cre1-lacZ Ermr This studyMH6069 pheA1 trpC2 phoPR::Tet r pAT3� phoP-lacZ Ermr This studyMH6070 pheA1 trpC2 phoPR::Tet r ccpA::Tn917 Spcr pAT3� phoP-lacZ Ermr This study

PlasmidsPCR2.1 Ampr Kanr InvitrogenpMUTIN2 Ampr Ermr 57pES1 Full-length phoPR promoter with 494 bp of upstream mdh gene in pJM103 23pES2 Full-length phoPR promoter with 494 bp of upstream mdh gene in pUC19 This studypSB5 Ampr Kanr full-length phoPR promoter with 90 bp of mdh in pCR2.1 43pAT3 Full-length phoPR promoter from pES2 in pMUTIN2 This studypAT9 pES2 derivative with cre1 mutation in phoPR promoter This studypAT11 Full-length wild-type phoPR promoter in pCR2.1 This studypAT12 cre1 phoPR in pCR2.1 This studypAT14 cre1 phoPR promoter from pAT12 in pMUTIN2 This studyHis-ccpA pQE30 Vector for overexpression of His-CcpA Tina Henkin

VOL. 188, 2006 CcpA CATABOLITE REPRESSION OF phoPR 1267


.org/D

ownloaded from

http://jb.asm.org/

mutagenesis kit (Stratagene) using the following primers: FMH641 (TTTACTATAAATGAAAGCTCTATCATAAACGTCTTTATTTC) and FMH642 (GAAATAAAGACGTTTATGATAGAGCTTTCATTTATAGTAAA) for the cre1mutation using plasmid pES2 as a template. The mutated promoter was thenamplified using primers FMH735 (AAGCTTCAGGTGTGTTGATACG) andFMH079 (GTGGATCCGTAATGACATCATAGCCT), and the resulting PCRproducts were cloned into pCR2.1 (Invitrogen). FMH735 contains a HindIII siteat the 5� end and FMH079 contains a BamHI site. The phoPR promoter frag-ments were excised by digestion with BamHI and HindIII and cloned intocomplementary sites in pMUTIN2. Mutations were confirmed by DNA sequenc-ing (University of Chicago cancer research sequencing center).

Bacterial growth media and enzyme assays. For expression of the phoPR-lacZfusion, the cells were cultured in low-phosphate defined medium (LPDM) orhigh-phosphate defined medium (HPDM) as described previously (22). Whengrown in LPDM, ccpA mutant strains exhibited the characteristic severe growthdefect, which inhibited the study of the effect of the mutation in ccpA on oursystem. Addition of glutamate (5 mM), glutamine, valine, and isoleucine (all 0.5mg/ml) (36) to our medium helped the growth of ccpA mutant. Amino acidsroutinely added to our defined medium were leucine, methionine, phenylalanine,and tryptophan (each 0.5 mg/ml). After these additions the growth of the ccpA

mutant strain in LPDM was comparable to that of the wild-type strain andallowed us to study the effect of CcpA on phoPR promoter expression.

The strains were grown in HPDM and LPDM for a period of 12 h and sampleswere taken every hour. �-Galactosidase assays were conducted as per Ferrari etal. (10). The activity unit was defined as 0.33 nmol of ortho-nitrophenol producedper minute and the specific activity was calculated as activity per mg of protein.The alkaline phasphatase assays were conducted as described previously (22).LPCM (Low-Phosphate Complex Medium) contained 3 g/liter ammonium ace-tate, 0.25 g/liter MgSO4, 0.02 g/liter calcium acetate, 0.5 mM MnCl2, 10 g/literBacto peptone, 0.2 g/liter L-arginine, 50 mM Tris (pH 6.9), 0.5% glucose, 0.05 mg/mlamino acids (methionine, histidine, tryptophan, leucine, and phenylalanine), and0.05 mg/ml thiamine.

Overexpression and purification of proteins. (i) His-CcpA. CcpA was purifiedas described by Kim et al. (26). The plasmid for production of His-tagged CcpAwas a gift from T. Henkin.

Overexpression and purification of proteins. (ii) �A and RNAP and corepolymerase. These were purified as described previously (43).

Gel shift assays. The probe was prepared by digesting plasmid pAT11 (wildtype) and pAT12 (cre1) with BspHI and DraI enzymes to yield a fragment of109-bp length that was labeled with [-32P]ATP using polynucleotide kinase

FIG. 1. (A) phoPR promoter sequence and 5� PhoP coding sequence showing the various transcription start sites and PhoP binding sites. Grayshading identifies the region protected by both PhoP and PhoP�P. Stippled shading identifies the sequence protected only by PhoP�P.Transcription start sites for PB1, PE2, PA3, PA4, P5 and PA6 are indicated by bold sequences that are identified by a bent arrow followed by thepromoter number. The letters in each promoter name, B, E, and A, stand for E�B, E�E, and E�A, respectively. The 10 and 35 sites are alsomarked for each promoter. The consensus repeats for PhoP dimer binding, TT(A/C/T)A(C/T)A, are underlined with the sequence in bold print.The translational start codon ATG is boxed and identified by a bent arrow marked �1. Sequence numbering is relative to the A of ATG as �1.Arrows with half arrowheads identify primers used in primer extension and/or in vitro transcription. The DraI and BspHI sites indicate therestriction sites used for creating fragments for gel shift assays. The conserved cre box sequence is boxed and labeled. (B) Comparison of cre boxconsensus sequence and phoPR cre box sequence. 3� and 5� A�T-rich regions are separated from the cre sequence by a space. The mutation createdin the cre box is shown. Symbols for nucleotides in the consensus sequence: W, A or T; R, A or G; Y, C or T; N, A, G, C, or T.

1268 PURI-TANEJA ET AL. J. BACTERIOL.


.org/D

ownloaded from

http://jb.asm.org/

(Fermentas). In each reaction 20,000 cpm of labeled probe was incubated withvarious concentrations of CcpA in buffer containing 10 mM Tris-Cl (pH 7.5), 1mM EDTA (pH 7.5), 50 mM KCl, 0.05% NP-40, 10% glycerol, 1 mM dithio-threitol modified from Kim et al. (27) at room temperature for 15 min. Thesamples were then loaded and run on 6% polyacrylamide gel made in 1�Tris-borate-EDTA. The gel was run for 1 h at 4°C, vacuum dried and theradioactivity was detected using PhosphorImager or X-ray film.

Preparation of phoPR promoter probe for footprinting. Primer FMH464(M13Reverse: 5�-GGATAACAATTTCACACAGGA-3�) or FMH465 (M13Foward:5�-GTAAAACGACGGCCAGT-3�) was end labeled with T4 polynucleotide ki-nase (Fermentas) in the presence of [-32P]ATP and then purified by polyacryl-amide gel electrophoresis (PAGE) extraction followed by ethanol precipitation.PCR was conducted using the primer pair FMH464 and FMH465 and plasmidpSB5 as the template. pSB5 contains the complete promoter sequence shown inFig. 1. For radiolabeling of the noncoding or coding strand, radiolabeledFMH464 and FMH465, or FMH464 and radiolabeled FMH465 were used. ThePCR conditions were: denaturing at 94°C and 1 min, annealing at 55°C and 2min, and extension at 68°C and 3 min for 30 cycles. The PCR products wereextracted from PAGE, and purified by Elutip-D minicolumns (Schleicher &Schuell) as described in the instruction manual.

DNase I footprinting of the phoPR promoter. In each reaction, the requiredprotein and probes (20,000 cpm) were incubated at room temperature for 30 minin binding buffer containing 10 mM Tris (pH 7.5), 50 mM KCl, 1 mM EDTA, 1mM dithiothreitol, and 10% glycerol (same as the gel-shift binding buffer, exceptNP-40 was omitted). DNase I (3 �l of 0.04 U/�l in 5 mM MgCl2, 5 mM CaCl2)was added to each reaction mixture, and digestion was conducted for 60s forprotein-containing samples and 30s for protein-free samples. The reaction wasstopped and the DNA fragments were purified by phenol extraction followed byethanol precipitation. The DNA fragments were run on a 4% polyacrylamide gelcontaining 7 M urea and detected by PhosphorImager analysis and/or X-ray film(Fuji) radiography.

RNA preparation and primer extension analysis. Total RNA was isolatedusing the QIAGEN Rneasy kit, from B. subtilis strains MH6024 and MH6025grown in LPDM at various time intervals during the 12-h growth curve. A totalof 20 to 50 �g of RNA was used in each primer extension reaction. The primerextension solutions were the same as described previously (7). A sequencingladder was produced by end labeling primer FMH079 or FMH811 (CTTGTT

CATGCTGTGCCTCCAGTATT) with [-32P]ATP, annealing it to pSB5, andusing Sequenase (U.S. Biochemicals Corp.), according to the manufacturer’sinstructions.

In vitro transcription. The reactions were performed as described previously(43). The phoPR promoter from bp 300 to �92 as shown in Fig. 2 was used asand template (2 nM). In vitro transcription in the presence of CcpA was per-formed with various concentrations of CcpA (0.15, 0.5, 1.0, and 1.5 �M) addedto the in vitro transcription reaction prior to the addition of RNAP (0.4 �M).RNAP core (0.1 �M) was used with (0.8 �M) �A.

RESULTS

CcpA represses the transcription of the phoPR promoterunder excess phosphate conditions. Because the phoPR pro-moter contains a perfect match to the cre box consensus se-quence (59) upstream of the five previously identified phoPRpromoter start sites (43) (Fig. 1), we sought to determine ifCcpA had an affect on phoPR transcription. Isogenic wild-type(MH6024) and ccpA mutant (MH6025) strains containing anisotopic phoPR-lacZ fusion were constructed using the plasmidpMUTIN2 (57). The full-length phoPR promoter from pES2that contained 705 bp 5� of the translational �1 start site,including 494 bp of the upstream mdh (citH) gene and 92 bpdownstream of the �1, was ligated into the multiple cloningsite of pMUTIN2 downstream of the IPTG-inducible PSPAC

promoter and upstream of the lacZ gene. (Only 300 bp of the705 bp upstream of �1 are shown in Fig. 1.)

The construct was transformed into JH642 by insertion du-plication due to homology with the 3� region of the citHgene–3� region of the phoPR promoter (Fig. 2). This isotopicinsertion allowed expression of the phoPR-lacZ fusion underthe control of the phoPR promoter and also retained the intact

FIG. 2. Isotopic Campbell insertion of the phoP-lacZ fusion from a pMUTIN2 construct into the B. subtilis genomic DNA. (A) Structure ofpAT3. Single crossover through homologous recombination between plasmid DNA and genomic DNA. (B) Resultant insertion into the genomicDNA after the recombination event. The plasmid DNA is shown in black and the genomic DNA is shown in gray. Genes are shown as thick arrows,phoP and phoR are in solid colors and the mdh (citH) gene is shown in stripes. The promoters are shown as broken arrows.



.org/D

ownloaded from

http://jb.asm.org/

phoPR promoter element upstream of the operon to controlphoPR expression. The strains were grown in LPDM plusamino acids over a period of 12 h as described in Materials andMethods (Fig. 3A). When grown in LPDM containing glucoseas the carbon source, the wild-type strain JH642 (MH6024)exhibited low-level transcription from the phoPR promoterfusion during excess phosphate conditions (hours 0 to 5), buttranscription was induced when inorganic phosphate levels fellbelow 0.1 mM (1, 48) (hours 6 to 12). When grown in LPDMcontaining additional (5 mM) inorganic phosphate (HPDM),the wild-type strain (MH6024) exhibited a low level of phoPRexpression throughout growth.

The �-galactosidase assays revealed that transcription ofthe phoPR promoter was much higher in the ccpA mutant strain

(MH6025) relative to the wild-type strain (MH6024) (Fig. 3A)with the most significant elevated levels observed during theinitial stages of growth ( 8-fold; hours 0 to 5) when the phos-phate levels are sufficient to inhibit autoinduction of the phoPRoperon (Fig. 3A). When the strains were grown in HPDM (5mM Pi) where phosphate does not become limiting duringgrowth of the culture, the transcription level of phoPR-lacZ ina ccpA mutant strain (MH6025) was consistently high, roughly20-fold higher than that of the wild-type strain (MH6024)where transcription remained low (Fig. 3B). These data sug-gested a repressor function for CcpA on the phoPR promoter.

Mutation in the putative phoPR promoter cre box resulted inincreased levels of phoPR transcription. A single base pairchange (C to T) at a conserved base in the cre box sequence

FIG. 3. Effect of ccpA null mutation or a cre box mutation on phoPR transcription in (A) LPDM and (B) HPDM. Each medium is supplementedwith amino acids to support ccpA strain growth. The cells were cultured and the readings were taken for 12 h. Solid symbols represent growth andopen symbols represent �-galactosidase specific activity of the phoPR-lacZ fusion in each strain, wild type (MH6024, �); ccpATn917 (MH6025,E); phoPR cre1-lacZ (MH6040, ‚). (C) EMSA for phoPR promoter fragment with wild-type cre box with CcpA. (D) Promoter with phoPRcre1 typemutation. The promoter fragment in both cases is a 109-bp BspHI-DraI fragment from the phoPR promoter. Restriction site positions andsequences are given in Fig. 1.



.org/D

ownloaded from

http://jb.asm.org/

(Fig. 1B) was created by site-directed mutagenesis and themutant phoPRcre1 promoter was substituted for the wild-typepromoter in the B. subtilis JH642 chromosome as described inmaterials and methods. The presence of this cre1 mutation

(MH6040) resulted in an increase in phoPRcre1-lacZ transcrip-tional activity in LPDM (Fig. 3A) or HPDM (Fig. 3B) relativeto the level of wild-type phoPR expression, activity that wassimilar to that observed for the ccpA mutant strain (MH6025)grown in LPDM (Fig. 3A) or HPDM (Fig. 3B). Together theobserved effect of a ccpA mutation or the cre box mutation onthe expression of the phoPR promoter suggested strongly thatCcpA is a negative regulator of the phoPR promoter. That thecre1 mutation caused the phoPRcre1 promoter fusion expres-sion to resemble that of the wild-type promoter in a ccpAmutant background suggested further that CcpA may act bybinding directly to the phoPR cre box.

CcpA binds to the phoPR promoter. To determine if CcpAfunctions by binding to the phoPR promoter, we performed anelectrophoretic mobility shift assay (EMSA). Gel shift assaysshowed that purified CcpA bound efficiently to the 109-bpphoPR promoter fragment containing the wild-type cre box(Fig. 3C). CcpA formed two complexes with the wild-typefragment, one was observed at the lowest concentration ofCcpA used (0.46 nM), and a slower moving band appeared atconcentrations of 1.84 nM and higher. The CcpA binding af-finity to the phoPRcre1 fragment (Fig. 3D) was lower than atthe wild-type fragment, with binding first observed at 1.84 nMof CcpA, a concentration where the shift was nearly maximalfor the wild-type promoter. The slower migrating DNA-pro-tein complex observed with the wild-type promoter fragment atincreasing CcpA concentrations was absent with the phoPRcre1promoter fragment. These data indicated that CcpA directlybinds to the phoPR promoter fragment-containing cre box con-sensus sequence and that a single base pair change (C to T) ata conserved site in the consensus sequence reduces the affinityfor CcpA binding at either DNA-protein complex.

CcpA binds specifically to the phoPR promoter cre box. Todetermine the CcpA binding region in the phoPR promoter,DNase I footprinting assays were performed (Fig. 4). CcpAprotected one distinct region on both the coding and non-coding strands of the phoPR promoter that encompassed thecre sequence on each strand. Protection began at 0.5 nMCcpA on both strands, albeit protection is more completefor the coding strand. Nearly complete protection of theregion was observed at 2.3 nM of CcpA on both the strands.These data, in combination with the in vivo transcriptionstudies, suggest that CcpA exerts its effect directly on thephoPR promoter through this cre box.

Either HPr or Crh functions in the transcriptional regula-tion of the phoPR promoter. To further examine the mecha-nism of CcpA regulation at the phoPR promoter, a role for thecoeffectors of CcpA, HPr, and Crh (14), was investigated. Invivo transcription assays for the wild-type phoPR-lacZ fusionwere performed in a ptsH1 (MH6033), crh mutant (MH6032)or ptsH1 crh double mutant (MH6034) background and com-pared with wild-type (MH6024) and ccpA (MH6025) strains inLPDM. ptsH1 is an allele of the ptsH gene that encodes theHPr protein with an S46A substitution (9).

The �-galactosidase activity assays showed that neither theptsH1 (MH6033) nor the crh mutation (MH6032) alone had aneffect on the transcription of the phoPR promoter (Fig. 5)compared to the wild type (MH6024). When both the muta-tions were introduced into the same strain (MH6034), phoPRtranscription was observed during the initial 6 h of growth in

FIG. 4. DNase I footprinting of the phoPR promoter by CcpA.Labeled DNA fragments are the PCR products using primers FMH464and FMH465, with pSB5 as the template. The CcpA concentration(nM) is shown at the top of each lane. F, free of CcpA; G, Maxam-Gilbert G-sequencing reaction lane as a marker. (A) Footprinting onthe noncoding strand. End-labeled FMH465 was used to create theprobe. (B) Footprinting on the coding strand. End-labeled FMH464was used to create the probe. (C) Sequence showing the region pro-tected by CcpA shown as a shaded area. The cre box sequence isunderlined on both the coding and the noncoding sequence. * indicatesthe dotted G’s on the marker lanes from A and B.



.org/D

ownloaded from

http://jb.asm.org/

LPDM at a level roughly 50% that of the ccpA mutant strain.Transcription from the phoPR promoter in the double mutantwas further elevated during hours 6 to 12 (Fig. 5) to levelsidentical to that seen in a ccpA mutant strain (MH6025). Theseobservations suggest that either HPr or Crh was sufficient forCcpA repression activity because the absence of both of theseproteins was required to relieve the catabolite repression fromthe phoPR promoter to a level similar to that of a ccpA mutantstrain during phosphate starvation.

Presence of poor carbon sources in the medium leads tohigher expression from the phoPR promoter. When the carbonsource for the wild-type strain growing in low-phosphate com-plex medium was changed from glucose to either succinate orlactate, both at 0.5%, the transcription level of the phoPR-lacZpromoter fusion increased compared to levels expressed dur-ing growth in the presence of glucose (Fig. 6). These levelswere comparable to that of the ccpA mutant strain (MH6025)growing in glucose, consistent with involvement of carbon source-mediated regulation of phoPR operon transcription. LPCM wasused for these studies because the wild-type strain was unable togrow in LPDM with low levels of a poor carbon source. Inductionof pho regulon genes occurs at the same decreased Pi concentra-

tion in LPCM as in LPDM (47) but the maximum phoPR induc-tion is routinely three- to fourfold lower than in LPDM.

CcpA represses the expression of a previously unknown pro-moter in the complex phoPR promoter. Because the phoPR pro-moter contained five transcriptional start sites and each re-sponded to specific growth phase and environmental controls(43), we performed primer extension to determine which ofthese promoters was directly regulated by CcpA. Primer ex-tension using RNA from a ccpA mutant strain revealed thepresence of an unknown 5� mRNA end, in addition to thosereported previously for the phoPR promoter (Fig. 7). Theexpression of four start sites using RNA from a wild-type strainis shown in Fig. 7A (lanes 5 to 7) as a control. P5, which wasfirst observed in RNA from a sigB mutant strain, is absent inthe wild-type control experiment shown in Fig. 7A (lanes 5, 6,and 7), and had much weaker expression relative to the otherfour promoters in the ccpA mutant strain (lanes 8 to 14) com-pared to that reported for the sigB deletion strain (43).

The unique 5� mRNA end observed in RNA from a ccpAmutant strain grown in LPDM (lanes 8 to 14) was upstream ofall five promoters described above (Fig. 7A) and 15 bp up-stream of the cre box (Fig. 7B and Fig. 1A). RNA samples forthe ccpA mutant strain were taken 3 hours before (T3) Pho

FIG. 5. Effect of a ptsH1 or crh or ptsH1 crh double mutations onphoPR promoter expression. Solid symbols are growth and open sym-bols are �-galactosidase specific activity of the phoPR-lacZ fusion ineach strain. All the strains were grown in LPDM over a period of 12 h.Wild type (MH6024, �); ccpA Tn917 (MH6025, E); ptsH1 (MH6033,‚); crh SpcR (MH6032, ƒ); ptsH1 crh Spcr (MH6034, {).

FIG. 6. Effect of alternate carbon sources on phoPR transcription.All strains were grown in LPCM for 11 h. Solid symbols representgrowth and open symbols represent �-galactosidase specific activity ofthe phoPR-lacZ fusion in each strain. Wild-type (MH6024) with glu-cose, �; ccpA (MH6025) with glucose, �; wild type with lactate, ‚;wild type with succinate, ƒ.



.org/D

ownloaded from

http://jb.asm.org/

induction, at Pho induction (T0) and then each hour afterinduction (T1 through T4). RNA samples taken at T3 (Fig.7A) showed the dramatic appearance of P6 which was located81 bp upstream of P5 (Fig. 7B and Fig. 1). Although the P6

transcript persisted throughout growth, the relative intensitydecreased after T2 (Fig. 7A). The absence of P6 in RNA iso-lated from a wild-type strain can be attributed to its repressiondue to the presence of active CcpA.

To further characterize this newly identified 5� mRNA end,in vitro transcription studies were conducted. RNAP purifiedfrom B. subtilis (43) grown in LPDM was used for in vitrotranscription studies from the phoPR promoter template(shown in Fig. 1A). Core RNAP plus �A was sufficient for theexpression of PA6 (Fig. 8A). Using RNAP holoenzyme isolated(T4) from a �sigE strain (a strain that retains �A RNAP, (25)also showed expression from PA6 (Fig. 8B, lane 1). Whenincreasing amounts of CcpA were added to the in vitro tran-scription reaction (lanes 3 to 6), transcription from PA6 de-creased, and at 1.5 �M of CcpA no transcript from PA6 wasobserved (Fig. 8B). These data confirmed that CcpA is func-tioning as a direct negative regulator of the phoPR promoterwith the primary effect being exerted on a newly identifiedpromoter, PA6. PhoP and PhoP�P did not enhance PA6 tran-scription in vitro (data not shown).

Elevated phoPR transcription in a CcpA mutant strain isPhoP independent during Pi-replete growth but cumulativeduring Pi starvation. In a wild-type strain PhoP�P is requiredfor full induction of the phoPR operon during Pi limitation viaenhanced transcription from the phoPR promoters PE2, PA3

and PA4 (43). In the PA6 promoter region PhoP, PhoP�P, andCcpA binding sites overlap (see Fig. 1) raising questions con-cerning a role for PhoP or Pho�P in derepression in a ccpAmutant strain. To determine if PhoP was required for the ccpAtranscription phenotype, the following strains were used. AphoPR deletion strain containing the phoPR-lacZ fusion with(MH6070) or without a ccpA (MH6069) mutation was grownin LPDM and HPDM along with wild-type (MH6024) andccpA (MH6025) strains containing the phoPR-lacZ fusion. Thetranscription level of phoPR-lacZ in the phoPR mutant straingrown in HPDM was very low and is similar to levels observedin a wild-type strain (Fig. 3B and Fig. 9A). However, a phoPRccpA double mutant (MH6070) exhibited high transcriptionlevels that were similar to transcription levels observed in accpA mutant strain (MH6025) (Fig. 9A). The similarity be-tween phoPR-lacZ transcription in MH6025 (ccpA) andMH6070 (phoPR ccpA) grown in HPDM suggested that theelevated levels of phoPR transcription were independent ofPhoP and resulted from derepression in the ccpA mutant.

When grown in LPDM (Fig. 9B), low-level phoPR-lacZ tran-scription was observed in the phoPR mutant strain (MH6069)throughout growth, as expected due to the absence of auto-induction. Compared to the wild-type strain during exponen-tial growth (hours 0 to 5), a phoPR ccpA double mutant exhib-ited derepressed phoPR transcription that was similar to that ina ccpA mutant strain. During phosphate-limited growth (hours6 to 12) transcription from the phoPR-lacZ fusion decreased inthe phoPR ccpA double mutant strain but not in the ccpA singlemutant strain. The reduction of total phoPR-lacZ transcriptionin the phoPR ccpA double mutant strain, compared to the ccpAmutant strain, during stationary-phase growth is approximatelyequal to the increase in transcription in the wild-type straindue to phoPR-dependent autoinduction (43).

Together, these data suggested that during stationary-phasegrowth provoked by phosphate starvation (hours 6 to 12),

FIG. 7. Primer extension analysis using RNA from a ccpA mutantstrain shows appearance of a new 5� mRNA end in the phoPR promoterregion. (A) Primer extension of the phoPR promoter. Lanes 1 to 4 are thesequencing ladder. Lanes 5 to 7 are the primer extension of RNA samplestaken from a wild-type strain growing in LPDM at times T0, T2, and T3,respectively. T0 is the time of Pho induction and T2 and T3 are 2 and 3 h,respectively, after Pho induction. Lanes 8 to 14 are primer extension ofRNA samples grown in LPDM at times between T3 and T4. The posi-tions of all the promoter start sites are given by arrows labeled PB1, PE2,PA3, PA4, and P-5, and P6 identifies the mRNA5� ends. Primer FMH079was used (Fig. A1). (B) Portion of the primer extension enlarged to showthe position of PA6 on the phoPR promoter. RNA from a ccpA mutantstrain at times T2 and T1 was used. Primer FMH811 (Fig. 1) was usedfor better resolution of the 5� mRNA location.



.org/D

ownloaded from

http://jb.asm.org/

phoPR transcription in the ccpA mutant strain is cumulative,due to both derepression of the CcpA repressed promoter andPhoPR autoinduction of the PA3, PA4 and PE2 promoters.These data were consistent with the in vitro transcription datawhich showed that PA6 expression was independent of PhoP(data not shown).

DISCUSSION

Carbon catabolite regulation of phoPR expression involvesCcpA repression of PA6, the newly discovered promoter locatedmost 5� among the six phoPR promoters. The importance ofPho regulon gene expression to survival of B. subtilis underphosphate stress was underscored when a basic understandingof the complexity of the phoPR regulatory region was recentlyreported (43). Assurance of the availability of phoPR expres-sion was provided during vegetative growth from two promot-

ers, PA3 and PA4, and during stage two of sporulation from PE2.These three promoters provide maintenance-level expres-sion during phosphate-replete conditions but each of thesethree promoters is enhanced by PhoP�P during phosphatestarvation.

Two additional promoters revealed a portion of the inter-dependent regulation of the SigB and PhoPR regulons duringphosphate starvation. One was a SigB-dependent phoPR pro-moter, P1B. The other promoter, P5, was expressed only in asigB mutant when the phosphate starvation-induced SigB regu-lon is not available. Knowledge of the basic architecture of thephoPR promoter made possible initiation of the studies re-

FIG. 8. Core RNAP plus �A is sufficient for in vitro transcription ofPA6. (A) In vitro transcription using core RNAP alone or core plus �A.Lane 1: marker; lane 2: in vitro transcription with core RNAP alone;lane 3: in vitro transcription with core and �A. (B) In vitro transcrip-tion of PA6 in the presence of CcpA. All reactions were done withRNAP holoenzyme (0.4 �M) isolated from a �sigE strain. Lane 1:marker; lanes 2 to 6: in vitro transcription reactions performed in thepresence of increasing amounts of CcpA. FIG. 9. Absence of PhoP-PhoR in phoPR ccpA double mutant affects

phoPR transcription specifically during phosphate-limited growth.(A) HPDM. (B) LPDM. Solid symbols represent growth and open sym-bols represent �-galactosidase specific activity of the phoPR-lacZ fusion ineach strain. Wild-type (MH6024), �; ccpA (MH6025), �; phoPR(MH6069), ‚; phoPR ccpA (MH6070), ƒ.



.org/D

ownloaded from

http://jb.asm.org/

ported here to determine if and how carbon regulation mightaffect the promoters of this complex phoPR regulatory region.

This study promised to be interesting because the 100%conserved cre sequence in the phoPR promoter region physi-cally maps upstream of the previously identified five phoPRpromoters (43), a position usually reserved for CcpA bindingto activated promoters (41, 46). Contrary to this idea, ourinitial studies of phoPR expression in a ccpA mutant suggestedthat CcpA was a repressor (4) and that result was corroboratedby the transcriptome studies of Stulke and colleagues (6). Thequandary was resolved when primer extension analysis of thephoPR promoter using mRNA from a ccpA mutant identifieda sixth 5� mRNA end (Fig. 7A) positioned upstream of the creconsensus sequence and all five of the promoters identifiedpreviously. Because E�A initiated transcription at this 5� startsite in vitro, we now refer to it as the PA6 transcription start siteof the phoPR promoter. The identification of a carbon catab-olite regulation phoPR promoter expands the possible impor-tance of Pho regulon gene expression to include survival dur-ing carbon nutrient stress.

Relief of CcpA repression of phoPR transcription in a crhptsH1 double mutant differs during phosphate-sufficient growthand phosphate starvation. Binding of CcpA to a cre site in vivousually requires complex formation between CcpA and theseryl-phosphorylated forms of the coeffector HPr or Crh. Gelshift and DNA protection studies indicated that CcpA alonebinds efficiently to the phoPR promoter in vitro. A Kd of �0.5nM was calculated for CcpA binding to the phoPR cre site fromthe footprint data (data not shown) using the procedure de-scribed by Kim et. al (28). This Kd was lower than for thosecalculated for CcpA binding at other cre sites, including ccpC(12 nM) (26), amyE (28 nM), gnt (100 nM), and xyl (330 nM)(29). Other cre sites that bind CcpA without coeffectors but forwhich no Kd was reported include the cre2 site of ackA (41) andthe cre site of rocG (3).

The fact the in vitro CcpA-DNA interaction did not requirethe presence of Hpr phosphorylated on serine (Hpr-Ser-P) orCrh-Ser-P does not diminish the importance of Hpr and Crh invivo. Either coeffector was sufficient for full in vivo repressionof phoPR by CcpA because a single mutation in ptsH (HPr) orcrh was not sufficient to relieve the CcpA-mediated repressionof phoPR transcription, but a double mutant strain exhibitedderepressed transcription levels comparable to that observedin a ccpA mutant strain during phosphate limited growth. Asimilar discrepancy between in vivo and in vitro data concern-ing the role of Crh and Hpr has been noted at another pro-moter with a highly conserved cre site, the rocG promoter (3).

Interestingly, repression of phoPR transcription during Pi-replete exponential growth (hours 1 to 5, Fig. 5) was lessrelieved in the ptsH crh double mutant than in a ccpA mutant.Because CcpA is present in the double mutant, the partialrelief of repression may indicate an affinity of the uncomplexedCcpA for the cre site in the promoter or enhancement of CcpAbinding by a yet unknown effector(s) or metabolic factor(s)other than HPr and Crh. However, the absence of CcpA re-pression in the ptsH crh double mutant during phosphate-limiting growth, but not during phosphate-replete growth, sug-gests that the latter condition may provide another factor(s)that promotes CcpA binding to the phoPR cre site. Such afactor(s) would provide an additional level of protection to

assure that phoPR transcription remains low in the presence ofadequate levels of environmental phosphate. The identified cresite is implicated in this repression because in the wild-typestrain the cre1 mutation was sufficient to restore expression tothe level exhibited by a ccpA mutant strain despite the pres-ence of CcpA.

Media composition has been shown to affect the mechanismof carbon catabolite regulation at other promoters. In minimalmedia carbon catabolite regulation of the hut operon by glu-cose was relieved only in a crh ptsH1 double mutant but duringgrowth in LB mutation in ptsH1 (Hpr) was sufficient to relieveglucose repression (62). Also, complete relief of repressionof citM was observed in a crh ptsH1 double mutant grown inCSE medium (C medium plus Succinate and Glutamate) butonly partial relief occurred in CI medium (C medium plusmyo-Inositol), leading to the proposal that other metabolicintermediates promote CcpA binding to the cre site in CImedium (58).

The proposed coeffector required for only partial repressionof phoPR expression by CcpA during Pi-replete growth of a crhptsH double mutant (Fig. 5) remains unknown. In addition toCrh and Hpr, other effectors of CcpA have been identified,including fructose-1,6-diphosphate (12), glucose-6-phosphate(16), and NADP (28). Unlike other effectors, including Hprand Crh, NADP had little effect on CcpA DNA binding butrather increased CcpA’s ability to inhibit transcription in vitro,possibly via enhanced interaction with the transcription ma-chinery (28).

NADP may be an attractive candidate for the hypotheticalCcpA coeffector active during Pi-replete exponential growth ina crh ptsH double mutant (Fig. 5) for several reasons. (i) CcpAwithout cofactors binds efficiently to the phoPR promoter cresite (Kd � 0.5 nM) but required more than 1 �M CcpA toinhibit PA6 transcription in vitro in the absence of coeffectors.(ii) Hpr was shown to antagonize the CcpA mediated tran-scription inhibition caused by NADP in vitro (28). (iii) NADPwas most abundant during exponential growth in a minimalglucose medium (similar to our growth conditions) in a relatedBacillus species (52).

Single point mutation in the cre site completely relievesCcpA-mediated repression of phoPR expression in vivo andsignificantly reduces binding in vitro. The footprinting analysisshowed a single protected region on the phoPR promoter thatencompasses the cre consensus sequence region. Because asingle base pair change in the cre consensus (cre1) causedelevated phoPR transcription levels similar to that observed ina ccpA deletion strain, it can be argued that this cre sequenceis the site of CcpA regulation. The appearance of a secondcomplex (Fig. 3C) observed in the EMSA at increasing con-centrations of CcpA suggested the formation of an additionalDNA-protein complex or multimerization of protein as CcpAconcentrations were increased.

The phoPR promoter fragment containing the cre1 mutationrequired higher concentrations of CcpA than the wild-typeprobe to form the faster-moving complex, while the slower-migrating complex failed to form. These data suggest thatformation of both complexes require the proposed cre site andthat a certain concentration of the smaller complex is requiredbefore the larger complex is formed. A second cre box muta-tion (data not shown) that caused only partial derepression of



.org/D

ownloaded from

http://jb.asm.org/

phoPR transcription in vivo allowed the formation of bothcomplexes at CcpA concentrations intermediate between thatrequired for the nonmutated and the cre1 probe in EMSAstudies. Although the nature of the CcpA-DNA complexesformed is not yet clear, the EMSA data, together with thefootprinting on the complete promoter, suggest that there is asingle CcpA binding site in the phoPR promoter and that it isat the cre consensus shown in Fig. 1A.

PA6, one of three phoPR operon �A-responsive promoters,may require an unknown activator during exponential growth.E�A was sufficient for transcription from the 5� start site andwe now refer to it as the PA6 promoter. However, it appearsthat PA6 may require an additional activator protein for fullpromoter activity because the relative abundance of the PA6

transcript compared to PA4 in vivo is much higher than in thein vitro studies. That activator does not appear to be PhoP�Pbecause (i) addition of PhoP or PhoP�P did not increase PA6

transcription in vitro in the presence or absence of CcpA (datanot shown), (ii) the PA6 transcript was most abundant in vivo atT3 (Fig. 7), 3 hours before Pho induction, and (iii) a phoPRdeletion mutation did not affect derepression of phoPR tran-

scription in a ccpA mutant strain during phosphate-repletegrowth while the decrease observed upon phosphate starvationwas roughly equal to the autoinduction of phoPR via PA3, PA4

and PE2 in the wild-type strain (43). The last observation in-dicates that during phosphate starvation ccpA derepressionand autoinduction of phoPR transcription are additive in accpA-defective strain.

The other �A-dependent promoters for this operon, PA3 andPA4, are also expressed during exponential growth although atlow levels, and are responsible for the low-level constitutivetranscription from the phoPR promoter before autoinductionin a wild-type strain (43, 45) but unlike PA3 and PA4, PA6

expression is not enhanced by PhoP�P upon phosphate star-vation. Several hours after cultures enter the stationary phase,E� E displaces E�A from RNAP (24, 32), which results indecreased transcription from the E�A promoters and in-creased transcription from PE2, which is an E�E promoter. Apost-exponential-phase decrease in PA3 and PA4 transcripts ina wild-type strain was reported by Paul et al. (43) in LPDM-grown cultures where stationary phase is provoked by phos-

FIG. 10. Model for the coordinated regulation of B. subtilis Pho, Res, and carbon catabolite regulation responses during Pi-starved growthconditions. Solid lines represent a direct role in transcriptional activation (with arrowheads) or repression (with flat heads). The activated andrepressed genes are indicated above lines. Dashed lines indicate the indirect role of ResD (via terminal oxidases) in full Pho activation.(A) Phosphate starvation in the presence of 2% glucose. Relatively low concentrations of active PhoPR and ResDE proteins activate thetranscription of the resABC/DE operon to provide sufficient active ResDE to induce genes required for terminal oxidase synthesis (OX). Terminaloxidases oxidize the reduced quinones (QH2), an inhibitor of PhoR autophosphorylation activity (50). Three CcpA-activated genes, phospho-transacetylase (pta), acetate kinase (ackA), and acetoin biosynthesis operon (alsSD), that are involved in the carbon overflow metabolism providethe primary dissipating flux of ATP equivalents and contribute to low carbon flux through the TCA cycle during phosphate starvation. Direct andindirect repression of certain TCA genes by CcpA may contribute further to low carbon flux through the TCA cycle. Thus, CcpA provides afine-tuning mechanism for terminal oxidase synthesis via direct repression of the phoPR PA6 promoter to provide sufficiently active terminaloxidases to accommodate the low flux of reducing equivalents. Balance refers to balancing total cellular energy flux based on conversion of energyand energy equivalents (8). (B) Phosphate and carbon starvation in the absence or presence of poorly metabolized C sources. CcpA no longeractivates the carbon overflow metabolism, leading to higher carbon flow through the TCA cycle. In order to accommodate the increased reducingequivalents produced from the TCA cycle, the CcpA-mediated repression of the PhoPR-ResDE positive feedback loop involving terminal oxidasesynthesis is released. The line thickness in B depicts the increased activities caused by CcpA inactivation compared to that in A, when CcpA isactive.



.org/D

ownloaded from

http://jb.asm.org/

phate starvation, conditions where a sigE mutant strain showedprolonged transcription from PA3 and PA4. PA6 showed a sim-ilar decrease in transcription levels during the postexponentialphase (Fig. 7) in a wild-type stain.

Regulatory coordination between phosphate and carbon de-ficiency responses. PA6 is the second phoPR promoter identi-fied that was not expressed in a wild-type strain under standardlow-phosphate culture conditions. In this case carbon starva-tion or the presence of a poor carbon source was required forPA6 expression because in the presence of a readily metabo-lized carbon source, CcpA repressed PA6. When additionalPhoP-PhoR is not required, repression of PA6 by CcpA is notonly energy efficient, it also avoids placing the cells at a selec-tive disadvantage as has been observed when cellular concen-trations of PhoP were increased inappropriately by expressionfrom multicopy plasmids (34, 42) or in spo0 mutants (23). Thepoor growth phenotype and/or rapid accumulation of sponta-neous phoP or phoR mutations in cells overexpressing phoPRor phoP may be the result of inappropriate gene activation orinhibition by higher concentrations of PhoP or PhoP�P, re-spectively, as observed in vitro (1).

Because PhoPR are part of a signal transduction networkincluding ResDE, Spo0A, and now CcpA, interdependent reg-ulation of these systems is a reasonable requirement. We arenow beginning to understand the codependency between thePho and Res systems during phosphate-limited growth, wherephoPR is essential for resABCDE transcription exclusively dur-ing phosphate starvation (5) and terminal oxidase productionby ResD is essential for full Pho induction via modulation ofthe PhoR signal (50).

The data presented here provide evidence for the direct roleof CcpA in regulation of phoPR transcription via PA6, thusestablishing a link between carbon regulation and phosphatestarvation regulation, two important yet different signaling sys-tems interconnected for cell survival under nutrient depriva-tion conditions. Although the physiological significance ofthese findings is still under investigation, recent reports pro-vide clues concerning the interdependence of carbon and phos-phate regulation. CcpA is known to repress the transcription ofgenes required for utilization of secondary carbon sources andactivate genes involved in carbon excretion via acetate (pta andackA) or acetoin (alsSD) in the presence of a readily metabo-lized carbon source. CcpA also has a direct and indirect rolevia repression of ccpC in regulation of TCA cycle genes (27).

It was proposed (8, 53) that CcpA-activated transcription ofgenes required for acetate or acetoin excretion (pta, ackA, andalsSD) (41, 46, 56) contributed to extensive overflow metabo-lism that resulted in low Kreb’s cycle carbon flux in Pi-limitedcultures relative to that of carbon- or nitrogen-limited cultureswhich had high Kreb’s cycle flux and low overflow metabolism.During Pi starvation it was shown that terminal oxidases wererequired for full Pho induction (50) and that the cellular con-centration of ResD is dependent on PhoPR exclusively duringphosphate starvation (5). ResD is the response regulator re-quired for heme a biosynthesis necessary for a-type terminaloxidases (35, 44, 54, 63) and for activation of the operonencoding bd oxidase (Schau and Hulett, unpublished data).Further, the structural genes for caa3 (35, 61) and bd oxidase(Schau and Hulett, unpublished data) are repressed by CcpA.

Together these observations suggest that simultaneous starva-tion for carbon and phosphate may result in several metabolicchanges that could all be accommodated by silencing CcpAactivation (overflow metabolism) and repression (terminal oxi-dases and phoPR) of genes. Decreased overflow metabolism asa result of carbon limitation should increase the availability ofpyruvate and acetyl coenzyme A for increased carbon flux intothe Kreb’s cycle that would contribute to increased reducingpower that would require additional terminal oxidase synthesisfor ATP synthesis. Removal of CcpA repression of phoPRtranscription would ensure the presence of PhoPR for synthe-sis of ResD necessary for terminal oxidase production for moreefficient use of the available carbon and phosphate sources.

The two cartoons in Fig. 10 illustrate our current under-standing of the PhoPR, ResDE, carbon catabolite regulation-integrated signal transduction network in a wild-type strainprovided glucose or a poor carbon source.

ACKNOWLEDGMENTS

We thank Tina Henkin, Jorg Stulke, Michiko Nakano, and SusanFisher for the strains. We thank W. Abdel-Fattah for proteins for invitro transcription studies and for helpful discussions.

This work was supported by Public Health Service grant GM 33471from the National Institutes of Health.

REFERENCES

1. Abdel-Fattah, W. R., Y. Chen, A. Eldakak, and F. M. Hulett. 2005. Bacillussubtilis phosphorylated PhoP: direct activation of the E�A and repression of theE�E-responsive phoB PS�V promoters during Pho response. J. Bacteriol.187:5166–5178.

2. Atkinson, M. R., L. V. Wray, Jr., and S. H. Fisher. 1990. Regulation ofhistidine and proline degradation enzymes by amino acid availability inBacillus subtilis. J. Bacteriol. 172:4758–4765.

3. Belitsky, B. R., H. J. Kim, and A. L. Sonenshein. 2004. CcpA-dependentregulation of Bacillus subtilis glutamate dehydrogenase gene expression. J.Bacteriol. 186:3392–3398.

4. Birkey, S. M. 1998. Regulation of the phoPR operon of Bacillus subtilisduring phosphate starvation and sporulation. Ph.D. thesis. University ofIllinois at Chicago, Chicago, Ill.

5. Birkey, S. M., W. Liu, X. Zhang, M. F. Duggan, and F. M. Hulett. 1998. Phosignal transduction network reveals direct transcriptional regulation of onetwo-component system by another two-component regulator: Bacillus subtilisPhoP directly regulates production of ResD. Mol. Microbiol. 30:943–953.

6. Blencke, H. M., G. Homuth, H. Ludwig, U. Mader, M. Hecker, and J. Stulke.2003. Transcriptional profiling of gene expression in response to glucose inBacillus subtilis: regulation of the central metabolic pathways. Metab. Eng.5:133–149.

7. Chesnut, R. S., C. Bookstein, and F. M. Hulett. 1991. Separate promotersdirect expression of phoAIII, a member of the Bacillus subtilis alkalinephosphatase multigene family, during phosphate starvation and sporulation.Mol. Microbiol. 5:2181–2190.

8. Dauner, M., T. Storni, and U. Sauer. 2001. Bacillus subtilis metabolism andenergetics in carbon-limited and excess-carbon chemostat culture. J. Bacte-riol. 183:7308–7317.

9. Deutscher, J., J. Reizer, C. Fischer, A. Galinier, M. H. Saier, Jr., and M.Steinmetz. 1994. Loss of protein kinase-catalyzed phosphorylation of HPr, aphosphocarrier protein of the phosphotransferase system, by mutation of theptsH gene confers catabolite repression resistance to several catabolic genesof Bacillus subtilis. J. Bacteriol. 176:3336–3344.

10. Ferrari, E., S. M. Howard, and J. A. Hoch. 1986. Effect of stage 0 sporulationmutations on subtilisin expression. J. Bacteriol. 166:173–179.

11. Fujita, Y., and Y. Miwa. 1994. Catabolite repression of the Bacillus subtilisgnt operon mediated by the CcpA protein. J. Bacteriol. 176:511–513.

12. Fujita, Y., Y. Miwa, A. Galinier, and J. Deutscher. 1995. Specific recognitionof the Bacillus subtilis gnt cis-acting catabolite-responsive element by a pro-tein complex formed between CcpA and seryl-phosphorylated HPr. Mol.Microbiol. 17:953–960.

13. Galinier, A., J. Deutscher, and I. Martin-Verstraete. 1999. Phosphorylationof either Crh or HPr mediates binding of CcpA to the Bacillus subtilis xyn creand catabolite repression of the xyn operon. J. Mol. Biol. 286:307–314.

14. Galinier, A., J. Haiech, M. C. Kilhoffer, M. Jaquinod, J. Stulke, J. Deutscher,and I. Martin-Verstraete. 1997. The Bacillus subtilis crh gene encodes aHPr-like protein involved in carbon catabolite repression. Proc. Natl. Acad.Sci. USA 94:8439–8444.



.org/D

ownloaded from

http://jb.asm.org/

15. Galinier, A., M. Kravanja, R. Engelmann, W. Hengstenberg, M. C. Kilhoffer,J. Deutscher, and J. Haiech. 1998. New protein kinase and protein phos-phatase families mediate signal transduction in bacterial catabolite repres-sion. Proc. Natl. Acad. Sci. USA 95:1823–1828.

16. Gosseringer, R., E. Kuster, A. Galinier, J. Deutscher, and W. Hillen. 1997.Cooperative and non-cooperative DNA binding modes of catabolite controlprotein CcpA from Bacillus megaterium result from sensing two differentsignals. J. Mol. Biol. 266:665–676.

17. Grundy, F. J., A. J. Turinsky, and T. M. Henkin. 1994. Catabolite regulationof Bacillus subtilis acetate and acetoin utilization genes by CcpA. J. Bacteriol.176:4527–4533.

18. Henkin, T. M., F. J. Grundy, W. L. Nicholson, and G. H. Chambliss. 1991.Catabolite repression of alpha-amylase gene expression in Bacillus subtilisinvolves a trans-acting gene product homologous to the Escherichia coli lacland galR repressors. Mol. Microbiol. 5:575–584.

19. Hueck, C., A. Kraus, and W. Hillen. 1994. Sequences of ccpA and twodownstream Bacillus megaterium genes with homology to the motAB operonfrom Bacillus subtilis. Gene 143:147–148.

20. Hueck, C. J., W. Hillen, and M. H. Saier, Jr. 1994. Analysis of a cis-activesequence mediating catabolite repression in gram-positive bacteria. Res.Microbiol. 145:503–518.

21. Hulett, F. M. 2002. The Pho regulon, p. 193–202. In A. L. Sonenshein, J. A.Hoch and R. Losick (ed.), Bacillus subtilis and its closest relatives: fromgenes to cells. ASM Press, Washington, D.C.

22. Hulett, F. M., C. Bookstein, and K. Jensen. 1990. Evidence for two structuralgenes for alkaline phosphatase in Bacillus subtilis. J. Bacteriol. 172:735–740.

23. Jensen, K. K., E. Sharkova, M. F. Duggan, Y. Qi, A. Koide, J. A. Hoch, andF. M. Hulett. 1993. Bacillus subtilis transcription regulator, Spo0A, decreasesalkaline phosphatase levels induced by phosphate starvation. J. Bacteriol.175:3749–3756.

24. Ju, J., T. Mitchell, H. Peters 3rd, and W. G. Haldenwang. 1999. Sigma factordisplacement from RNA polymerase during Bacillus subtilis sporulation. J.Bacteriol. 181:4969–4977.

25. Kenney, T. J., and C. P. Moran, Jr. 1987. Organization and regulation of anoperon that encodes a sporulation-essential sigma factor in Bacillus subtilis.J. Bacteriol. 169:3329–3339.

26. Kim, H. J., C. Jourlin-Castelli, S. I. Kim, and A. L. Sonenshein. 2002.Regulation of the Bacillus subtilis ccpC gene by CcpA and CcpC. Mol.Microbiol. 43:399–410.

27. Kim, H. J., A. Roux, and A. L. Sonenshein. 2002. Direct and indirect roles ofCcpA in regulation of Bacillus subtilis Krebs cycle genes. Mol. Microbiol.45:179–190.

28. Kim, J. H., M. I. Voskuil, and G. H. Chambliss. 1998. NADP, corepressor forthe Bacillus catabolite control protein CcpA. Proc. Natl. Acad. Sci. USA95:9590–9595.

29. Kim, J. H., Y. K. Yang, and G. H. Chambliss. 2005. Evidence that Bacilluscatabolite control protein CcpA interacts with RNA polymerase to inhibittranscription. Mol. Microbiol. 56:155–162.

30. Kraus, A., C. Hueck, D. Gartner, and W. Hillen. 1994. Catabolite repressionof the Bacillus subtilis xyl operon involves a cis element functional in thecontext of an unrelated sequence, and glucose exerts additional xylR-depen-dent repression. J. Bacteriol. 176:1738–1745.

31. Kravanja, M., R. Engelmann, V. Dossonnet, M. Bluggel, H. E. Meyer, R.Frank, A. Galinier, J. Deutscher, N. Schnell, and W. Hengstenberg. 1999.The hprK gene of Enterococcus faecalis encodes a novel bifunctional enzyme:the HPr kinase/phosphatase. Mol. Microbiol. 31:59–66.

32. Kroos, L., and Y. T. Yu. 2000. Regulation of sigma factor activity duringBacillus subtilis development. Curr. Opin. Microbiol. 3:553–560.

33. Lee, J. W., and F. M. Hulett. 1992. Nucleotide sequence of the phoP geneencoding PhoP, the response regulator of the phosphate regulon of Bacillussubtilis. Nucleic Acids Res. 20:5848.

34. Liu, W. 1997. Biochemical and genetic analysis establish a dual role for PhoPin Bacillus subtilis Pho regulation. Ph.D. thesis. University of Illinois atChicago, Chicago, Ill.

35. Liu, X., and H. W. Taber. 1998. Catabolite regulation of the Bacillus subtilisctaBCDEF gene cluster. J. Bacteriol. 180:6154–6163.

36. Ludwig, H., C. Meinken, A. Matin, and J. Stulke. 2002. Insufficient expres-sion of the ilv-leu operon encoding enzymes of branched-chain amino acidbiosynthesis limits growth of a Bacillus subtilis ccpA mutant. J. Bacteriol.184:5174–5178.

37. Ludwig, H., N. Rebhan, H. M. Blencke, M. Merzbacher, and J. Stulke. 2002.Control of the glycolytic gapA operon by the catabolite control protein A inBacillus subtilis: a novel mechanism of CcpA-mediated regulation. Mol.Microbiol. 45:543–553.

38. Martin-Verstraete, I., J. Deutscher, and A. Galinier. 1999. Phosphorylationof HPr and Crh by HprK, early steps in the catabolite repression signalingpathway for the Bacillus subtilis levanase operon. J. Bacteriol. 181:2966–2969.

39. Martin-Verstraete, I., J. Stulke, A. Klier, and G. Rapoport. 1995. Two

different mechanisms mediate catabolite repression of the Bacillus subtilislevanase operon. J. Bacteriol. 177:6919–6927.

40. Miwa, Y., K. Nagura, S. Eguchi, H. Fukuda, J. Deutscher, and Y. Fujita.1997. Catabolite repression of the Bacillus subtilis gnt operon exerted by twocatabolite-responsive elements. Mol. Microbiol. 23:1203–1213.

41. Moir-Blais, T. R., F. J. Grundy, and T. M. Henkin. 2001. Transcriptionalactivation of the Bacillus subtilis ackA promoter requires sequences upstreamof the CcpA binding site. J. Bacteriol. 183:2389–2393.

42. Ogura, M., H. Yamaguchi, K. Yoshida, Y. Fujita, and T. Tanaka. 2001. DNAmicroarray analysis of Bacillus subtilis DegU, ComA and PhoP regulons: anapproach to comprehensive analysis of B. subtilis two-component regulatorysystems. Nucleic Acids Res. 29:3804–3813.

43. Paul, S., S. Birkey, W. Liu, and F. M. Hulett. 2004. Autoinduction of Bacillussubtilis phoPR operon transcription results from enhanced transcription fromE�A- and EsE-responsive promoters by phosphorylated PhoP. J. Bacteriol.186:4262–4275.

44. Paul, S., X. Zhang, and F. M. Hulett. 2001. Two ResD-controlled promotersregulate ctaA expression in Bacillus subtilis. J. Bacteriol. 183:3237–3246.

45. Pragai, Z., N. E. Allenby, N. O’Connor, S. Dubrac, G. Rapoport, T. Msadek,and C. R. Harwood. 2004. Transcriptional regulation of the phoPR operon inBacillus subtilis. J. Bacteriol. 186:1182–1190.

46. Presecan-Siedel, E., A. Galinier, R. Longin, J. Deutscher, A. Danchin, P.Glaser, and I. Martin-Verstraete. 1999. Catabolite regulation of the pta geneas part of carbon flow pathways in Bacillus subtilis. J. Bacteriol. 181:6889–6897.

47. Qi, Y. 1998. Identification and regulation of new Pho regulon genes inBacillus subtilis. Ph.D. thesis. University of Illinois at Chicago, Chicago, Ill.

48. Qi, Y., Y. Kobayashi, and F. M. Hulett. 1997. The pst operon of Bacillussubtilis has a phosphate-regulated promoter and is involved in phosphatetransport but not in regulation of the pho regulon. J. Bacteriol. 179:2534–2539.

49. Reizer, J., C. Hoischen, F. Titgemeyer, C. Rivolta, R. Rabus, J. Stulke, D.Karamata, M. H. Saier, Jr., and W. Hillen. 1998. A novel protein kinase thatcontrols carbon catabolite repression in bacteria. Mol. Microbiol. 27:1157–1169.

50. Schau, M., A. Eldakak, and F. M. Hulett. 2004. Terminal oxidases areessential to bypass the requirement for ResD for full Pho induction inBacillus subtilis. J. Bacteriol. 186:8424–8432.

51. Seki, T., H. Yoshikawa, H. Takahashi, and H. Saito. 1987. Cloning andnucleotide sequence of phoP, the regulatory gene for alkaline phosphataseand phosphodiesterase in Bacillus subtilis. J. Bacteriol. 169:2913–2916.

52. Setlow, B., and P. Setlow. 1977. Levels of oxidized and reduced pyridinenucleotides in dormant spores and during growth, sporulation, and sporegermination of Bacillus megaterium. J. Bacteriol. 129:857–865.

53. Stulke, J., and W. Hillen. 2000. Regulation of carbon catabolism in Bacillusspecies. Annu. Rev. Microbiol. 54:849–880.

54. Sun, G., S. M. Birkey, and F. M. Hulett. 1996. Three two-component signal-transduction systems interact for Pho regulation in Bacillus subtilis. Mol.Microbiol. 19:941–948.

55. Tobisch, S., J. Stulke, and M. Hecker. 1999. Regulation of the lic operon ofBacillus subtilis and characterization of potential phosphorylation sites of theLicR regulator protein by site-directed mutagenesis. J. Bacteriol. 181:4995–5003.

56. Turinsky, A. J., T. R. Moir-Blais, F. J. Grundy, and T. M. Henkin. 2000.Bacillus subtilis ccpA gene mutants specifically defective in activation ofacetoin biosynthesis. J. Bacteriol. 182:5611–5614.

57. Vagner, V., E. Dervyn, and S. D. Ehrlich. 1998. A vector for systematic geneinactivation in Bacillus subtilis. Microbiology 144:3097–3104.

58. Warner, J. B., B. P. Krom, C. Magni, W. N. Konings, and J. S. Lolkema.2000. Catabolite repression and induction of the Mg2�-citrate transporterCitM of Bacillus subtilis. J. Bacteriol. 182:6099–6105.

59. Weickert, M. J., and G. H. Chambliss. 1990. Site-directed mutagenesis of acatabolite repression operator sequence in Bacillus subtilis. Proc. Natl. Acad.Sci. USA 87:6238–6242.

60. Wray, L. V., Jr., F. K. Pettengill, and S. H. Fisher. 1994. Catabolite repres-sion of the Bacillus subtilis hut operon requires a cis-acting site locateddownstream of the transcription initiation site. J. Bacteriol. 176:1894–1902.

61. Yoshida, K., K. Kobayashi, Y. Miwa, C. M. Kang, M. Matsunaga, H.Yamaguchi, S. Tojo, M. Yamamoto, R. Nishi, N. Ogasawara, T. Nakayama,and Y. Fujita. 2001. Combined transcriptome and proteome analysis as apowerful approach to study genes under glucose repression in Bacillus sub-tilis. Nucleic Acids Res. 29:683–692.

62. Zalieckas, J. M., L. V. Wray, Jr., and S. H. Fisher. 1999. trans-acting factorsaffecting carbon catabolite repression of the hut operon in Bacillus subtilis. J.Bacteriol. 181:2883–2888.

63. Zhang, X., and F. M. Hulett. 2000. ResD signal transduction regulator ofaerobic respiration in Bacillus subtilis: ctaA promoter regulation. Mol. Mi-crobiol. 37:1208–1219.



.org/D

ownloaded from

http://jb.asm.org/

ccpa causes repression of the phopr promoter through a ... · tical to the consensus sequence for...

Documents