cellular biology - circulation researchcircres.ahajournals.org/content/117/12/1024.full.pdf · 1024...

1024

Cardiovascular disease causes myocyte death and the re-duction in the number of functional cardiac myocytes

ultimately results in poor cardiac pump function and heart failure. Because adult cardiac myocytes have extremely lim-ited proliferative capacity, replacing lost myocytes and their supporting vasculature will require the use of cells with the capacity to differentiate into the lost cell types. Several mo-lecular and cellular approaches have been tested to replace lost cardiomyocytes and restore myocardial function after in-jury. Research from several laboratories, including ours, sug-gests that stem cells hold immense potential for cardiac repair and regeneration.1–4 Clinical use of adult stem cells is a reality today and many stem cell types, including bone marrow–de-rived mesenchymal stem cells (MSCs),5 bone marrow cells,7,8 cardiac-derived cardiac progenitor,6 and cardio-sphere derived cells9 have been tested. The beneficial effects of tested cell therapies on cardiac structure and function have been modest

and most studies to date have not been adequately powered to document efficacy. The emerging consensus from these stud-ies suggests that the donated stem cell population falls short of fully restoring normal cardiac functional capacity because of a combination of issues, such as poor survival, lack of prolif-eration, engraftment, and differentiation. In addition, it seems that much of the benefit derived from cell therapy has come from the release of paracrine factors acting on the host myo-cardium rather than from differentiation of infused/injected stem cells into new cardiac tissue.

In This Issue, see p 979The success of cell therapy critically depends on how well

the adoptively transferred stem cells survive within the harsh milieu of the diseased heart. Stem cells must be resistant to the apoptotic, necrotic, and hypoxic environment prevalent within the damaged heart.10 Most or all of the donated stem cells die

Cellular Biology

© 2015 American Heart Association, Inc.

Circulation Research is available at http://circres.ahajournals.org DOI: 10.1161/CIRCRESAHA.115.307362

Rationale: Adoptive transfer of multiple stem cell types has only had modest effects on the structure and function of failing human hearts. Despite increasing the use of stem cell therapies, consensus on the optimal stem cell type is not adequately defined. The modest cardiac repair and functional improvement in patients with cardiac disease warrants identification of a novel stem cell population that possesses properties that induce a more substantial improvement in patients with heart failure.

Objective: To characterize and compare surface marker expression, proliferation, survival, migration, and differentiation capacity of cortical bone stem cells (CBSCs) relative to mesenchymal stem cells (MSCs) and cardiac-derived stem cells (CDCs), which have already been tested in early stage clinical trials.

Methods and Results: CBSCs, MSCs, and CDCs were isolated from Gottingen miniswine or transgenic C57/BL6 mice expressing enhanced green fluorescent protein and were expanded in vitro. CBSCs possess a unique surface marker profile, including high expression of CD61 and integrin β4 versus CDCs and MSCs. In addition, CBSCs were morphologically distinct and showed enhanced proliferation capacity versus CDCs and MSCs. CBSCs had significantly better survival after exposure to an apoptotic stimuli when compared with MSCs. ATP and histamine induced a transient increase of intracellular Ca2+ concentration in CBSCs versus CDCs and MSCs, which either respond to ATP or histamine only further documenting the differences between the 3 cell types.

Conclusions: CBSCs are unique from CDCs and MSCs and possess enhanced proliferative, survival, and lineage commitment capacity that could account for the enhanced protective effects after cardiac injury. (Circ Res. 2015;117:1024-1033. DOI: 10.1161/CIRCRESAHA.115.307362.)

Key Words: adult stem cells ■ engraftment ■ histamine ■ paracrine factors ■ proliferation ■ survival

Original received August 6, 2015; revision received October 14, 2015; accepted October 15, 2015. In September 2015, the average time from submission to first decision for all original research papers submitted to Circulation Research was 12.75 days.

From the Cardiovascular Research Center, Temple University School of Medicine, Philadelphia, PA (S.M., C.D.T., T.S., T.E.S., E.J.A., S.S., J.M.D., N.Z., H.K., R.M.B., S.R.H.); and Biostatistics and Bioinformatics Facility, Fox Chase Cancer Center, Philadelphia, PA (Y.Z.).

The online-only Data Supplement is available with this article at http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA. 115.307362/-/DC1.

Correspondence to Steven R. Houser, PhD, Cardiovascular Research Center, Temple University, 3500 N Broad St, Philadelphia, PA 19140. E-mail [email protected]

Unique Features of Cortical Bone Stem Cells Associated With Repair of the Injured Heart

Sadia Mohsin, Constantine D. Troupes, Timothy Starosta, Thomas E. Sharp, Elorm J. Agra, Shavonn Smith, Jason M. Duran, Neil Zalavadia, Yan Zhou, Hajime Kubo, Remus M. Berretta,

Steven R. Houser

by guest on April 17, 2018

http://circres.ahajournals.org/D

ownloaded from

by guest on A

pril 17, 2018http://circres.ahajournals.org/

Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from

http://circres.ahajournals.org/content/117/12/979.full.pdf+html

http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA.115.307362/-/DC1

http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA.115.307362/-/DC1

http://circres.ahajournals.org/










Mohsin et al Bone-Derived Stem Cells Augments Cardiac Repair 1025

after injection and those that do survive fail to engraft in the damaged organ.11 Current beneficial effects of cellular therapy seem to be mediated by the remaining of 1% of the donated population a week after transplantation. Improving the reten-tion of donated stem cells should enhance their reparative effects. Another stem cell feature that could augment their reparative properties would be enhanced proliferation, which would increase the number of engrafted cells. Furthermore, a hypothesis of the current research is that enhanced myocardial repair is contingent on communication between injected stem cells and the cells within the heart.12–14 This communication could come from secretion of cardioprotective factors (para-crine signaling) or from direct contact between stem cells and cardiomyocytes. Paracrine signaling between the donated stem cell population and host myocardium is important to promote cell-based myocardial repair.15,16 Stem cells with en-hanced paracrine signaling should enhance cardiac repair. In addition, improved electric coupling between injected stem cells and cardiac myocytes, via gap junctions, could enhance or induce the commitment of stem cells to the cardiac lineage, and thereby improve their ability to repair the damaged heart.

Recently, we have shown, in a mouse myocardial infarction (MI) model, that cortical bone–derived stem cells (CBSCs) improve cardiac function after MI. However, CBSCs have not been fully characterized and their reparative potential relative to other stem cell types currently being tested in human trials is unknown. In this study, 2 stem cell types are used as standards to evaluate the potential of CBSCs. Cardiac-derived stem cells (CDCs) are used as a gold standard because they are resident cardiac stem cells and are primed to commit toward cell types that constitute the heart. In addition, MSCs are used for com-parison, as they are isolated from bone marrow, lying in close proximity to hard bone that is the source for CBSCs. We aim to investigate if CBSCs share any properties with MSCs. This research will determine if CBSCs have enhanced proliferation, survival, and differentiation versus the 2 other stem cells types (CDCs and bone marrow MSCs). Our results show proof of concept that these cells have properties that support the idea that they have greater potential to repair the damaged heart than other cells that are currently being tested clinically.

MethodsCortical Bone Stem Cell IsolationCortical bone stem cells (CBSCs) were isolated from biopsies ob-tained from hard bone of miniswine (Gottingen, female 4–6 months

of age), or tibias and femurs of enhanced green fluorescent protein (eGFP)+C57BL/6 mice. Bone marrow was flushed out before taking the bone biopsies (3 mm). The bone biopsy was digested in collage-nase for an hour and passed through 100 and 40 μm. The remaining cells were plated in CBSCs growth media until homogenous popula-tion of stem cells was obtained as described previously.1

Cardiac-Derived Stem Cell IsolationHeart biopsy was obtained from Gottingen miniswine or eGFP+C57BL/6 mice for isolation of CDCs. Heart tissue was digest-ed in collagenase and c-kit sorted as described earlier.1 CDCs were cultured in CBSCs media.

Mesenchymal Stem Cells IsolationMSCs were isolated from swine and obtained from University of Miami. The cells were cultured in DMEM (Invitrogen, contain-ing 20% fetal bovine serum [Gibco Life Technologies, NY], 1% Penicillin/Streptomycin/l-glutamine (Gibco Life Technologies) as described earlier.17

Proliferation and Survival AssaysCyQuant assay involves plating cells in quadruplicate (2000 cells/well) in a 96-well plate and incubation CyQuant reagent (Life Technologies, CA) as previously described.2 pCBSCs, CDCs, and MSCs were plated in a 6-well dish (30 000 cells/well) and incubated in their respective medium without serum overnight and then treated with 10, 20, 30, 40, and 50 μmol/L H

2O

2 overnight. Cell death was

confirmed by visualizing the cells under a light microscope before collection. Cells were harvested and stained with Annexin-V (Life Technologies) and propidium iodide (Life Technologies) according to manufacturer’s protocol. Data were acquired with the BD Caliber and analyzed by Flow Jo software (BD Biosciences). All experiments were done using cells from passage numbers around 12 to 18.

Morphometric AnalysispCBSCs, CDCs, and MSCs were plated in a permenox chamber slides, and bright field images were obtained using Nikkon TS100 microscope. Cell morphology was measured by tracing the outline of the cells using ImageJ software; 200 cells were used to quantify cell morphology per stem cell type.

Real-Time Reverse Transcriptase-Polymerase Chain ReactionTotal RNA was isolated from multiple stem cell type using Quick-RNA MiniPrep (Zymo Research, CA) according to manufacturer’s protocol. cDNA was prepared using iScript cDNA Synthesis Kit (Bio Rad, CA). Real-time polymerase chain reaction was performed on samples in triplicate using iQ SYBER Green (Qiagen, CA). Primer sequences are listed in online Table II.

Lineage Commitment and ImmunostainingFor differentiation pCBSCs, CDCs, and MCS were treated with dexamethasone 10 nmol/L for 7 days as previously described.2 Cells were fixed with 4% paraformaldehyde and immunostaining was performed as described earlier stained for paracrine factors, in-cluding fibroblast growth factor (bFGF; ABCAM, Cambridge MA), hepatocyte growth factor (HGF; ABCAM), insulin-like growth fac-tor (IGF-1; ABCAM), vascular endothelial growth factor (VEGF; ABCAM), platelet-derived growth factor (ABCAM) before and af-ter differentiation.

Chemotaxis in Response to Growth FactorspCBSCs, CDCs, and MSCs were exposed to different concentrations (50, 100, and 200 ng/mL) of bFGF, HGF, VEGF, IGF-1, stromal- derived growth factor 1, platelet-derived growth factor, and transform-ing growth factor-β (TGF-β; Peprotech; Rocky Hill, NJ) for 24 hours in a Boyden chamber (Biocell Laboratories, CA). The migration was estimated by light microscopy. The migrated cell were stained and dissociated following manufacturer’s guidelines. The measurements were obtained at OD 560 using plate reader (Tecan, CA).

Nonstandard Abbreviations and Acronyms

sCBSCs cortical bone–derived stem cells isolated from miniswine

CDCs cardiac-derived stem cells

MSCs mesenchymal stem cells

AVM adult ventricular myocytes

HGF hepatocyte growth factor

bFGF fibroblast growth factor

MI myocardial infarction

TGF-β transforming growth factor-β

VEGF vascular endothelial growth factor



ownloaded from


1026 Circulation Research December 4, 2015

Adult Ventricular Myocytes Coculture and Fluorescence Recovery After Photobleaching AssayAdult ventricular myocyte (AVM) were isolated from feline hearts as described earlier.18 AVM’s were coculture with pCBSCs, CDCs, and MSCs stained with vybrant DIL labeling solution (Life technologies) following manufacture’s protocol. Fluorescence recovery after photo-bleaching assay was developed to quantify diffusion of a fluorescent dyes between 2 cells forming connections to study cell–cell coupling and as described previously.19

Cytoplasmic Ca2+ Level Measurement in Stem CellsCytoplasmic Ca2+ was measured as described earlier.18

RNA SequencingThe sequencing libraries were constructed from 500 ng of total RNA using the Illumina’s TruSeq RNA Samplepre kit V2 (Illumina) follow-ing the manufacturer instruction. The fragment size of RNAseq librar-ies was verified using the Agilent 2100 Bioanalyzer (Agilent) and the concentrations were determined using Qubit instrument (LifeTech). The libraries were loaded onto the Illumina HiSeq 2500 at 6 to 10 pmol/L on the rapid mode for 2×100 bp paired end read sequencing. The fastq files were generated on the Illumina’s BaseSpace service or locally using the Casava software package for further analysis.

Statistical AnalysisAll data were expressed as a mean±SEM. Comparison between mul-tiple groups were done by 1- or 2-way ANOVA. P<0.05 was con-sidered as statistically significant. Statistical analysis was performed using GraphPad prism version 5.0 software.

ResultsCharacterization of CBSCsCBSCs were isolated from Gottingen miniswine (sCB-SCs) to confirm the feasibility of CBSCs isolation, pu-rification, and expansion from a large animal model. Immunophenotypic characterization of sCBSCs document-ed the presence of a distinct cell surface receptor signature compared with CDCs and MSCs. RNA-sequencing data re-vealed sCBSCs, which have a unique marker profile with high expression of CD55, integrin β4, integrin β3 (CD61), CD82, NT5E (CD73), and endoglin, compared with CDCs and MSCs (Online Figure I). sCBSCs express lower levels of CD59 compared with CDCs and MSCs. Expression of CD96 was extremely low in sCBSCs and CDCs, compared with MSCs. Similarly, CD248 was expressed on sCBSCs and CDCs. All 3 cells types expressed CD276, CD109, and were negative for PTPRC (protein tyrosine phosphatase, re-ceptor type, C; also known as CD45) and CD11b (Online Figure I). Expression of some of these markers was also confirmed using real-time reverse transcriptase polymerase chain reaction analysis (Online Table I). Single-cell clon-ing was performed by FACS (fluorescence-activated cell sorting) sorting in a 96-well dish. Each well was carefully assessed under a microscope to confirm the presence of a single cell per well. CBSCs could generate colonies within 5 to 7 days (Online Figure II). These data established that despite the close proximity of origin for MSCs and CBSCs, CBSCs exhibit an extremely distinct cell surface profile and are highly clonogeneic.

Morphology and Growth Kinetics of CBSCssCBSCs isolated exhibited a unique morphometry compared with CDCs and MSCs. CBSCs were thin spindle-shaped cells

and share some similar morphology with CDCs. MSCs were broad flat cells with distinct differences in morphology when compared with CBSCs (Figure 1A–1C), as seen under bright field microscopy. There were significant differences in the overall area of CBSCs versus CDCs and MSCs. In addition, CBSCs showed significantly reduced roundness compared with CDCs and MSCs (Figure 1D–E).

sCBSCs showed significantly increased proliferation at day 3 compared with CDCs (P<0.001) and MSCs (P<0.001; Figure 1F). Concurrently, the enhanced accumulation of sCBSCs in S-phase (20.50%) together with a significant re-duction of the G1-phase (64.6%) compared with CDCs (G1-phase 79.7%, S-phase 11.6%) and MSCs (G1-phase 83.7%, S-phase 7.95%; Figure 1G) documents differences in the pro-liferative potential of CBSCs versus CDCs and MSCs. Genes involved in proliferation and cell cycle clustered in a heat map indicates increased expression of cyclin D2, guanine nucleotide–binding protein-like 3. Similarly, replication pro-tein A3 that plays an essential role both in DNA replication and in the cellular response to DNA damage, was upregulated in CBSCs. CDK2A (cylin-dependent kinase 2A), involved in G1-S transition in a cell cycle, was also increased in CBSCs compared with CDCs and MSCs (Figure 1H). Taken together, these data suggest that CBSCs possess higher proliferative capacity than CDCs and MSCs.

Improved Survival, Immunomodulatory, and Migration CapacitysCBSCs and CDCs exhibit greater survival when compared with MSCs after apoptotic challenge with H

2O

2. MSCs showed

a 27.9-fold increase in cell death compared with CBSCs and CDCs (P<0.01) at 50 μmol/L of H

2O

2 treatment for 4 hours

(Figure 2A-D). Co-culture experiments with AVM showed that sCBSCs and CDCs improved myocyte survival with a 1.16-fold increased survival of CBSCs versus MSCs (P<0.01) and a 1.25-fold increase in CDCs versus MSCs (P<0.001; Figure 2E). These data suggest that sCBSCs have a greater ability that the comparator cells to withstand apoptotic stimuli and like CDCs they enhance myocyte survival under hostile conditions.

There are new data suggesting that the cardioprotective effects of stem cells could result from modulation of the immune response. sCBSCs expressed extremely low lev-els of interleukin (IL)-1α that is mainly responsible for the production of inflammation and secreted phosphoprotein-1 that is expressed on immune cells, including macrophages, neutrophils, dendritic cells, and T and B cells, with varying kinetics (P<0.001 CBSCs versus MSCs). CD86, a protein present on antigen presenting cells that provides signals to activate T cells, was expressed at low levels in sCBSCs when compared with CDCs and MSCs. IL-33 that is thought to drive expression of T-helper cells was also expressed at lower levels in CBSCs (P<0.01 CBSCs versus MSCs and CDCs). IL-18 (interferon-γ [IFN-γ]-inducing factor) ex-pression is also lower in CBSCs when compared with CDCs and MSCs. IL-18 after stimulation activates natural killer cells and certain T cells, which release IFN-γ or type II IFN that plays an important role in activating the macro-phages. CBSCs had increased expression of TGF-β1 when compared with CDCS and MSCs. (P<0.05 CBSCs versus



ownloaded from



CDCs; Figure 2F). There was no significant difference in expression of immune markers detected in undifferentiated or differentiated states in sCBSCs. These preliminary data suggest that CBSCs will influence the immune response af-ter cardiac injury.

Migration of stem cells toward sites of injury is impor-tant to augment cardiac repair after injury. Several growth, paracrine, and autocrine factors are released by stem cells if/when they arrive at the site of injury.20 sCBSCs, CDCs, and MSCs all showed chemotaxis for most of the paracrine factors, including bFGF, HGF, VEGF, IGF-1, stromal-de-rived growth factor 1, platelet-derived growth factor, and TGF-β. CBSCs showed increased migration toward TGF-β compared with CDCs and MSCs (CBSCs versus CDCs and MSCs; P<0.001; Figure 2G). To test the migration and engraftment capacity of donor stem cell population in re-sponse to injury in an in vivo setting, CBSCs and CDCs isolated from eGFP+C57/BL6 mice were injected in mice after MI. Mice that received cortical bone stem cells iso-lated from mice, showed robust mobilization from border zone to injury site versus CDCs that were present as a clus-ter in a border zone area at 2 weeks. Cortical bone stem cells isolated from mice showed engraftment in the infarct area with some cells showing organization after 2 weeks (Figure 2H).

Paracrine Factor Expression and Enhanced Lineage CommitmentStem cells injected into injured hearts could improve cardiac function by the secretion of paracrine factors that stimulate cardiomyocyte survival or angiogenesis, by recruitment of en-dogenous stem cells that enhance cardiac repair into the dam-aged region, or by differentiation into new cardiac tissue (blood vessels and myocytes). We assessed paracrine factors known to play a role in cardiac repair process, including bFGF, HGF, IGF-1, VEGF, and platelet-derived growth factor, in sCBSCs, CDCs, and MSCs via immunolabeling before and after treat-ment with differentiation media. The expression levels of these paracrine factors changed in response to differentiation stimuli. sCBSCs expressed high levels of HGF, VEGF, and PGDF af-ter differentiation with dexamethasone treatment (Figure 3E). Markers of cardiac lineage commitment, including GATA-4 and MEF2C (myocyte enhancer factor 2C; transcription fac-tors that play an important role in cardiac development), von Willebrand factor (involved in vasculogenesis), and cardiac troponin T (myogenesis) were increased in sCBSCs relative to MSCs and CDCs after dexamethasone treatment. These results were confirmed by quantitative real-time polymerase chain reaction analysis (Figure 3A-D). Morphological remodeling (flattening of cells) was observed after dexamethasone treat-ment in CBSCs as previous observed in CDCs.2

Figure 1. Morphology and enhanced proliferation. A–C, Morphometric differences between cortical bone stem cells (CBSCs), cardiac-derived stem cells (CDCs), and mesenchymal stem cells (MSCs) from mini swine: Bright field images showed distinct morphometric differences between 3 cell types. D–E, Differences in roundness and area measured by image J. *P<0.05, ***P<0.001 compared with CBSCs. F, Enhanced proliferation rate is observed in mini swine CBSCs compared with CDCs (##P<0.01) and MSCs (***P<0.001) by CyQuant assay (n=3). G, Increased cell cycle progression in mini swine CBSCs vs CDCs and MSCs; increased S Phase is observed in CBSCs compared with CDCs and MSCs when stained with propidium iodide using FACS (fluorescence-activated cell sorting)-based cell cycle analysis (n=3). H, Comparative analysis of genes involved in cell cycle regulation by RNA seq analysis.



ownloaded from



Functional Gap Junctions With the Neighboring MyocytesImproved cardiac function induced by autologous cell therapy is thought to involve integration of transplanted stem cells with the host myocardium. Direct interaction of the transplanted stem cells with the host myocardium could be involved in cardioprotection. The potential of sCBSCs, CDCs, and MSCs to form cell–cell connections with the host myocardium was assessed by coculture with AVMs. DIL-labeled sCBSCs were cocultured with isolated AVMs for a week. In coculture, myocytes formed connexin-43 positive connections with CBSCs within 2 to 3 days (Online Figure III). Functional gap junctions between the 3 stem cell types and AVMs were significantly increased during the first week in coculture. We confirmed the presence of direct cellular communi-cation between AVMs and CBSCs, CDCs and MSCs using a fluo-rescence recovery after a photobleaching assay. FITC (fluorescein isothiocyanate)-calcein fluorescence signal of the photo-bleached AVM recovered during the 15 minutes recovery period, whereas the calcein signal of the neighboring stem cells declined indicating a functional gap junction with neighboring AVMs (Figure 4). In addition, electric coupling of CBSCs to AVMs was demonstrat-ing by recording membrane potential fluctuations in CBSCs that occurred during contractions of neighboring AVMs (n=3). These likely occurred by conduction of local currents from AVMs into CBSCs via gap junctions (Online Figure IV).

Differential Responses to Histamine and ATP Stimulus Between CBSCs, CDCs, and MSCs Measured by Cytosolic Calcium LevelsChanges in cytosolic Ca2+ were measured in sCBSCs, CDCs, and MSCs after exposure to histamine and nucleotide (ATP). The number of cells responding to histamine was greater (78.25%) in CBSCs than in MSCs (31.6%; P>0.01). CDCs did not response to histamine (Figure 5A–D). CBSCs, CDCs, and MSCs also had different responses to 200-μmol/L ATP. ATP caused a transient rise in Ca2+ followed by a steady state elevation. The relative Ca2+ peak was greatest for CBSCs fol-lowed by CDCs and then MSCs, respectively (Figure 5E–G; 100% of CBSCs and CDCs showed response to ATP com-pared with 58% for MSCs (P<0.05 CBSCs and CDCs versus MSCs; Figure 5H).

DiscussionCellular therapy for patients with heart failure has progressed from preclinical studies to early clinical trials during the past decade.6,9,21 However, results from cellular therapy trials us-ing multiple stem cell types have shown little or no positive effect on cardiac structure and function.10 Improved cardiac function is contingent on many factors, including the success-ful delivery of the therapeutic agent to the injury site. The goals of cell therapy for injured hearts include regeneration

Figure 2. Increased survival, migration, and immunmodulation. A–D, Mini swine cortical bone stem cells (CBSCs) and cardiac-derived stem cells (CDCs) showed reduction in Annexin-V+ and propidium iodide+ cells compared with mesenchymal stem cells (MSCs) in response to H2O2 challenge as evidenced by FACS (fluorescence-activated cell sorting)-based assay (n=3); **P<0.01 CBSCs vs MSCs, nonsignificant (NS) CBSCs vs CDCs. E, Increased myocyte survival in a coculture of mini swine CBSCs and CDCs with adult ventricular myocytes at 48 and 76 hours measured by viability dye (***P<0.001 CBSCs and CDCs coculture with AVM vs myocyte alone, NS MSCs coculture vs myocyte alone). F, Comparative analysis of genes involved in immunomodulation measured by RNA seq analysis (CBSCs vs MSCs; ##P<0.01, ###P<0.001), (CBSCs vs CDCs; *P<0.05, **P<0.01). G, Migration assay showed enhanced migration of CBSCs toward transforming growth factor-β (TGF-β) 50 ng (CBSCs vs MSCs; ###P<0.001), (CBSCs vs CDCs; ***P<0.001). H, CBSCs and CDCs isolated from enhanced green fluorescent protein (eGFP)+C57/BL6 mice were transplanted in mice and euthanized 2 weeks after transplantation. Red, α-sarcomeric actin; Green, GFP-positive CBSCs; Blue, 4′,6-diamidino-2-phenylindole. Scale bar, 100 μm. by guest on A


Dow

nloaded from



of new tissue in place of damaged myocardium,22 salvaging myocytes that are at risk of death23 or immunomodulation of the inflammatory response after cardiac insult to improve post MI remodeling.24 Important factors for enhanced regenera-tion/repair that we explored in this study include the potency/potential of the transplanted cells,25 their capacity to survive,26 migrate and proliferate,27 engraft and make connections to the existing neighboring myocytes in the ischemic cardiac milieu. We simultaneously investigated stem cell–derived paracrine, autocrine and growth factors that play an important role in salvaging the existing myocytes and restrict infarct expansion to improve cardiac function.

In this study, a novel population of stem cell from the bone stroma has been characterized and compared with more exten-sively studied stem cell types that are currently being used for clinical trial, including CDCs and bone marrow–derived MSCs. Stem cell–derived from cortical bone (CBSCs) express a dis-tinctive cell surface marker profile, clearly separating them from MSCs derived from bone marrow and CDCs that was used as a standard in the study (Online Figure I). CBSCs also exhibit dif-ferent morphology when compared with MSCs and share some similarities with CDCs (Figure 1). A unique marker profile and differences in appearance confirm the novelty of CBSCs.

Poor survival and marginal retention of adoptively trans-ferred cells into the pathologically challenged heart is widely reported, massive loss of donated stem cells, and failure to engraft in the damaged organ occurs within the first few days after delivery and therefore pose a challenge in the field.11 The optimal stem cell should be able to endure apoptotic, necrotic and hypoxic conditions prevalent in host environment for de-sirable results. CBSCs and CDCs showed enhanced surviv-al after an apoptotic challenge compared with MSCs. Also, CBSCs and CDCs increased the survival of AVMs in a cocul-ture experiment, suggesting that their known beneficial effects are not only related to their enhanced survival capacity but also to an ability to salvage myocytes at the site of injury that have survived the acute insult (Figure 2). In addition to low survival, the poor mobility and engraftment of donated stem cell could also impede their therapeutic potential. CBSCs showed enhanced capacity to migrate from the injection site to the infarct border zone in vivo and engraft in the infarct zone within 2 weeks (Figure 2H). This enhanced engraftment may be because of their improved secretion of paracrine fac-tors or the response to the factors produced at the site of injury. To achieve more meaningful results from cellular therapy, do-nated stem cells that can proliferate should be more effective

Figure 3. Increased lineage cardiac commitment. A–D, GATA-4, MEF2C (myocyte enhancer factor 2C), von Willibrand factor (vWF), and cardiac troponin T (cTnT-T), expression is increased compared with undifferentiated stem cells, with cortical bone–derived stem cells isolated from mini swine (sCBSCs) having the highest fold change expression of cardiac lineage commitment markers; *P<0.05, **P<0.01, ***P<0.001 compared with CBSCs. E, Immunolabeling of paracrine factor in CBSCs, CDCs, and MSCs from mini swine before and after differentiation: expression of fibroblast growth factor (bFGF), hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), and insulin-like growth factor 1 (IGF-1) is represented in green with nuclear staining in blue. DAPI indicates 4′,6-diamidino-2-phenylindole; and NS, nonsignificant.



ownloaded from



because the proliferation of surviving stem cells should com-pensate for the cells that die after injection and enhance their reparative effects after cardiac injury. Proliferation capacity is significantly enhanced in CBSCs versus MSCs and CDCs with increased numbers of cells in S-phase. Concurrently, CBSCs had greater gene expression of cyclin D2, guanine nucleotide–binding protein-like 3, replication protein A3, CDK2A, which are known regulators for cell cycle progression.

Stem cells could modulate the immune response in the in-jured heart to improve cardiac repair after injury. Tissue injury results in release of proinflammatory cytokines that triggers a cascade of events, involving attraction of T lymphocytes to the site of injury that then secrete proinflammatory factors, which increase influx of other immune cell types, including T, B, and antigen-presenting cells to the site of injury.28 However, prolonged intense inflammation can result in further damage eventually leading to organ failure. Immune modulatory prop-erties of stem cells may promote resolution of inflammation and facilitate tissue repair. Previously, MSCs have been well reported to have a beneficial role in immune modulation and are known to be immunoprivileged.29 Therefore, we aimed to determine if CBSCs possess markers that suggest that they are be involved in altering the immune response to injury. CBSCs expressed extremely low levels of IL-1α (interleukin 1 alpha), secreted phosphoprotein-1, and IL-18 compared with MSCs

and CDCs. These factors are known to play a proinflamma-tory role and trigger T, B cells, and antigen-presenting cells re-sponses. IL-1α is mainly produced by activated macrophages and neutrophils and is known to play central role in mediating an immune response.30 Diminished expression of these factors suggests CBSCs could play a positive role in modulating the immune response, which might lead to improve wound healing cardiac repair after infarction. Concurrently, CBSCs also ex-press increased TGF-β levels. TGF-β can inhibit T-lymphocyte proliferation31 and it has been demonstrated that anti-TGF-β antibodies can restore T-lymphocyte proliferation.32 These pre-liminary findings suggest that CBSCs might have a potential role in regulating immune suppression after CBSCs delivery.

Stem cell–mediated myocardial repair could involve com-munication between the injected stem cells and the cells within the heart.12,14,33 Communication between the stem cells and my-ocytes can be achieved by secretion of cardioprotective or an-giogenic factors (paracrine signaling)34 or from direct stem cell, cardiac myocyte, contact.35 CBSCs can form direct gap junc-tional connections with AVMs that could enhance their repara-tive properties. Stem cells with enhanced paracrine signaling should be able to augment cardiac repair mitigating direct pro-tection36 on the existing myocyte or stimulating the endogenous pool of stem cells to replicate and contribute in repair process-es.37 After lineage commitment, all 3 stem cell types expressed

Figure 4. Cortical bone stem cells (CBSCs) form functional gap junctions in coculture with adult ventricular myocytes (AVMs). Fluorescence recovery after photobleaching assay after 5 days of coculture. A1, B1, and C1, Bright field images demonstrating connections between mini swine CBSCs, CDCs, and MSCs with AVM, respectively (red arrows). Cells were loaded with FITC (fluorescein isothiocyanate)-calcein for 15 minutes. A2, B2, and C2 show even distribution of dye before bleaching. A3, B3, and C3, Calcein fluorescence within coupled to AVM was photobleached (red arrows). A4, B4, and C4, The calcein fluorescence signal of the photobleached AVMs recovered during 10 minutes recovery period, whereas the calcein signal of the CBSCs, CDCs, and MSCs declined indicating that CBSCs form functional gap junction with neighboring AVMs (yellow arrows). D–F, Fluorescence recovery at 5, 10, and 15 minutes after photobleaching. Representative images at ×40; 50 μm.



ownloaded from



paracrine factors known to be responsible for improvements in cardiac function after stem cell transplantation (Figure 3). In our previous published findings, we have shown that, after 24 hours and 2 weeks of CBSCs transplantation, levels of paracrine factors including bFGF and VEGF are upregulated1 and could account for enhanced neovascularization previously observed in CBSCs-injected animals after ischemic insult. Similarly, these paracrine factors are also known to have protective effects on heart. This protective effect can be on myocytes and vessels that can limit the expansion of infarct area after cardiac injury, leading to improvement in cardiac function. Simultaneously, CBSCs also have the ability to differentiate into new myocytes and vessels to improve cardiac function after MI in a murine model.1 Improved electric coupling between injected stem cells and cardiac myocytes via gap junctions could enhance the com-mitment of stem cells to the cardiac lineage and enhance their ability to repair the damaged heart. CBSCs, CDCs, and MSCs all couple to AVMs making function gap junctions for direct cellular communication as shown by a fluorescence recovery after photobleaching assay (Figure 4). To initiate the reparative process, stem cells must respond to various stimuli and our re-sults show that CBSCs can respond to inflammatory cytokines as previously reported in other stem cell types, including cardi-ac progenitor cells38 and embryonic stem cells.39Our results re-veal that each cell type responds differently to the inflammatory cytokines ATP and histamine. Both of these cytokines activate plasma membrane receptors, which elicit downstream IP3R

(inositol trisphosphate receptor)-mediated calcium signaling. ATP and histamine play important roles in inflammatory sig-naling and contribute to cardiac repair after MI.40,41 Our results indicate that unlike CDCs and MSCs, CBSCs respond to both ATP and histamine making them prime candidates to initiate cardiac repair processes after MI.

In summary, our study delineated unique characteristics of stem cells isolated from cortical bone. CBSCs express distinc-tive cell surface marker profiles, which clearly distinguish them from MSCs and CDCs. A meticulous comparison of CBSCs with CDCs revealed that despite of CBSCs noncardiac origin, they are equivalent to or better than CDCs in terms of pro-liferative, survival, and cardiac lineage commitment capacity. Preliminary findings also highlighted the prospective role of CBSCs in modifying the immune response; however, detailed in vivo studies are needed to fully understand their immune-modulating properties. Furthermore, CBSCs secrete a host of paracrine factors and possess the ability to migrate to the site of injury and engraft, which should reduce damage and enhance repair after ischemic insult. Our findings suggest that CBSCs may be superior to MSCs or CDCs in terms of their ability to repair the heart that has been injured by ischemic disease.

Sources of FundingS.R. Houser is funded by National Institutes of Health and American Heart Association. S. Mohsin is funded by American Heart Association (Scientific Development Grant).

Figure 5. Differential response to ATP and histamine stimuli measured by cystolic calcium levels. Swine cortical bone stem cells (CBSCs), cardiac-derived stem cells (CDCs), and mesenchymal stem cells (MSCs) were loaded with Fluo-4-AM, perfused with Tyrode Solution and recoded for 3 minutes, after which cells were exposed to 1-μmol/L ATP or 5-μmol/L histamine. A–C, CBSCs, CDCs, and MSCs exposed to histamine. D, Percentage of cells respond to histamine. Increased number of CBSCs responded to histamine versus MSCs **P<0.01, whereas CDCs did not respond to histamine. E–G, CBSCs, CDCs, and MSCs exposed to ATP. H, All CBSCs and CDCs respond to ATP when compared with MSCS where significantly small numbers respond to ATP stimuli, *P<0.05 CBSCs vs MSCs.



ownloaded from



DisclosuresNone.

References 1. Duran JM, Makarewich CA, Sharp TE, Starosta T, Zhu F, Hoffman NE,

Chiba Y, Madesh M, Berretta RM, Kubo H, Houser SR. Bone-derived stem cells repair the heart after myocardial infarction through transdifferentia-tion and paracrine signaling mechanisms. Circ Res. 2013;113:539–552. doi: 10.1161/CIRCRESAHA.113.301202.

2. Mohsin S, Khan M, Toko H, et al. Human cardiac progenitor cells engi-neered with pim-i kinase enhance myocardial repair. J Am Coll Cardiol. 2012;60:1278–1287. doi: 10.1016/j.jacc.2012.04.047.

3. Urbanek K, Torella D, Sheikh F, De Angelis A, Nurzynska D, Silvestri F, Beltrami CA, Bussani R, Beltrami AP, Quaini F, Bolli R, Leri A, Kajstura J, Anversa P. Myocardial regeneration by activation of multipo-tent cardiac stem cells in ischemic heart failure. Proc Natl Acad Sci U S A. 2005;102:8692–8697. doi: 10.1073/pnas.0500169102.

4. Oskouei BN, Lamirault G, Joseph C, Treuer AV, Landa S, Da Silva J, Hatzistergos K, Dauer M, Balkan W, McNiece I, Hare JM. Increased po-tency of cardiac stem cells compared with bone marrow mesenchymal stem cells in cardiac repair. Stem Cells Transl Med. 2012;1:116–124. doi: 10.5966/sctm.2011-0015.

5. Karantalis V, DiFede DL, et al. Autologous mesenchymal stem cells pro-duce concordant improvements in regional function, tissue perfusion, and fibrotic burden when administered to patients undergoing coronary artery bypass grafting: The prospective randomized study of mesenchymal stem cell therapy in patients undergoing cardiac surgery (prometheus) trial. Circ Res. 2014;114:1302–1310. doi: 10.1161/CIRCRESAHA.114.303180.

6. Bolli R, Chugh AR, D’Amario D, et al. Cardiac stem cells in patients with ischaemic cardiomyopathy (SCIPIO): initial results of a ran-domised phase 1 trial. Lancet. 2011;378:1847–1857. doi: 10.1016/S0140-6736(11)61590-0.

7. Pätilä T, Lehtinen M, Vento A, et al. Autologous bone marrow mononucle-ar cell transplantation in ischemic heart failure: a prospective, controlled, randomized, double-blind study of cell transplantation combined with cor-onary bypass. J Heart Lung Transplant. 2014;33:567–574. doi: 10.1016/j.healun.2014.02.009.

8. Delewi R, van der Laan AM, Robbers LF, Hirsch A, Nijveldt R, van der Vleuten PA, Tijssen JG, Tio RA, Waltenberger J, Ten Berg JM, Doevendans PA, Gehlmann HR, van Rossum AC, Piek JJ, Zijlstra F; HEBE investigators. Long term outcome after mononuclear bone mar-row or peripheral blood cells infusion after myocardial infarction. Heart. 2015;101:363–368. doi: 10.1136/heartjnl-2014-305892.

9. Makkar RR, Smith RR, Cheng K, Malliaras K, Thomson LE, Berman D, Czer LS, Marbán L, Mendizabal A, Johnston PV, Russell SD, Schuleri KH, Lardo AC, Gerstenblith G, Marbán E. Intracoronary cardiosphere-derived cells for heart regeneration after myocardial infarction (CADUCEUS): a prospective, randomised phase 1 trial. Lancet. 2012;379:895–904. doi: 10.1016/S0140-6736(12)60195-0.

10. Mohsin S, Siddiqi S, Collins B, Sussman MA. Empowering adult stem cells for myocardial regeneration. Circ Res. 2011;109:1415–1428. doi: 10.1161/CIRCRESAHA.111.243071.

11. Hong KU, Guo Y, Li QH, Cao P, Al-Maqtari T, Vajravelu BN, Du J, Book MJ, Zhu X, Nong Y, Bhatnagar A, Bolli R. c-kit+ Cardiac stem cells al-leviate post-myocardial infarction left ventricular dysfunction despite poor engraftment and negligible retention in the recipient heart. PLoS One. 2014;9:e96725. doi: 10.1371/journal.pone.0096725.

12. Xie Y, Ibrahim A, Cheng K, Wu Z, Liang W, Malliaras K, Sun B, Liu W, Shen D, Cheol Cho H, Li T, Lu L, Lu G, Marbán E. Importance of cell-cell contact in the therapeutic benefits of cardiosphere-derived cells. Stem Cells. 2014;32:2397–2406. doi: 10.1002/stem.1736.

13. Yang D, Wang W, Li L, Peng Y, Chen P, Huang H, Guo Y, Xia X, Wang Y, Wang H, Wang WE, Zeng C. The relative contribution of paracine effect ver-sus direct differentiation on adipose-derived stem cell transplantation mediated cardiac repair. PLoS One. 2013;8:e59020. doi: 10.1371/journal.pone.0059020.

14. Hahn JY, Cho HJ, Kang HJ, Kim TS, Kim MH, Chung JH, Bae JW, Oh BH, Park YB, Kim HS. Pre-treatment of mesenchymal stem cells with a combination of growth factors enhances gap junction formation, cyto-protective effect on cardiomyocytes, and therapeutic efficacy for myo-cardial infarction. J Am Coll Cardiol. 2008;51:933–943. doi: 10.1016/j.jacc.2007.11.040.

15. Mirotsou M, Jayawardena TM, Schmeckpeper J, Gnecchi M, Dzau VJ. Paracrine mechanisms of stem cell reparative and regenerative actions

in the heart. J Mol Cell Cardiol. 2011;50:280–289. doi: 10.1016/j.yjmcc.2010.08.005.

16. Tang JM, Wang JN, Zhang L, Zheng F, Yang JY, Kong X, Guo LY, Chen L, Huang YZ, Wan Y, Chen SY. VEGF/SDF-1 promotes cardiac stem cell mobilization and myocardial repair in the infarcted heart. Cardiovasc Res. 2011;91:402–411. doi: 10.1093/cvr/cvr053.

17. Williams AR, Hatzistergos KE, Addicott B, McCall F, Carvalho D, Suncion V, Morales AR, Da Silva J, Sussman MA, Heldman AW, Hare JM. Enhanced effect of combining human cardiac stem cells and bone marrow mesenchymal stem cells to reduce infarct size and to restore car-diac function after myocardial infarction. Circulation. 2013;127:213–223. doi: 10.1161/CIRCULATIONAHA.112.131110.

18. Makarewich CA, Zhang H, Davis J, Correll RN, Trappanese DM, Hoffman NE, Troupes CD, Berretta RM, Kubo H, Madesh M, Chen X, Gao E, Molkentin JD, Houser SR. Transient receptor potential chan-nels contribute to pathological structural and functional remodeling af-ter myocardial infarction. Circ Res. 2014;115:567–580. doi: 10.1161/CIRCRESAHA.115.303831.

19. Kubo H, Berretta RM, Jaleel N, Angert D, Houser SR. c-Kit+ bone mar-row stem cells differentiate into functional cardiac myocytes. Clin Transl Sci. 2009;2:26–32. doi: 10.1111/j.1752-8062.2008.00089.x.

20. Liu SQ, Tefft BJ, Zhang D, Roberts D, Schuster DJ, Wu A. Cardioprotective mechanisms activated in response to myocardial ischemia. Mol Cell Biomech. 2011;8:319–338.

21. Mushtaq M, DiFede DL, Golpanian S, Khan A, Gomes SA, Mendizabal A, Heldman AW, Hare JM. Rationale and design of the Percutaneous Stem Cell Injection Delivery Effects on Neomyogenesis in Dilated Cardiomyopathy (the POSEIDON-DCM study): a phase I/II, randomized pilot study of the comparative safety and efficacy of transendocardial injection of au-tologous mesenchymal stem cell vs. allogeneic mesenchymal stem cells in patients with non-ischemic dilated cardiomyopathy. J Cardiovasc Transl Res. 2014;7:769–780. doi: 10.1007/s12265-014-9594-0.

22. Messina E, De Angelis L, Frati G, Morrone S, Chimenti S, Fiordaliso F, Salio M, Battaglia M, Latronico MV, Coletta M, Vivarelli E, Frati L, Cossu G, Giacomello A. Isolation and expansion of adult cardiac stem cells from human and murine heart. Circ Res. 2004;95:911–921. doi: 10.1161/01.RES.0000147315.71699.51.

23. Quijada P, Toko H, Fischer KM, Bailey B, Reilly P, Hunt KD, Gude NA, Avitabile D, Sussman MA. Preservation of myocardial struc-ture is enhanced by pim-1 engineering of bone marrow cells. Circ Res. 2012;111:77–86. doi: 10.1161/CIRCRESAHA.112.265207.

24. Karantalis V, Hare JM. Use of mesenchymal stem cells for therapy of cardiac disease. Circ Res. 2015;116:1413–1430. doi: 10.1161/CIRCRESAHA.116.303614.

25. Quijada P, Sussman MA. Making it stick: chasing the optimal stem cells for cardiac regeneration. Expert Rev Cardiovasc Ther. 2014;12:1275–1288. doi: 10.1586/14779072.2014.972941.

26. Dakhlallah D, Zhang J, Yu L, Marsh CB, Angelos MG, Khan M. MicroRNA-133a engineered mesenchymal stem cells augment cardiac function and cell survival in the infarct heart. J Cardiovasc Pharmacol. 2015;65:241–251. doi: 10.1097/FJC.0000000000000183.

27. Dixit P, Katare R. Challenges in identifying the best source of stem cells for cardiac regeneration therapy. Stem Cell Res Ther. 2015;6:26. doi: 10.1186/s13287-015-0010-8.

28. Ho MS, Mei SH, Stewart DJ. The Immunomodulatory and Therapeutic Effects of Mesenchymal Stromal Cells for Acute Lung Injury and Sepsis. J Cell Physiol. 2015;230:2606–2617. doi: 10.1002/jcp.25028.

29. Ben Nasr M, Vergani A, Avruch J, et al. Co-transplantation of autolo-gous MSCs delays islet allograft rejection and generates a local im-munoprivileged site. Acta Diabetol. 2015;52:917–927. doi: 10.1007/s00592-015-0735-y.

30. Santarlasci V, Cosmi L, Maggi L, Liotta F, Annunziato F. IL-1 and T helper immune responses. Front Immunol. 2013;4:182. doi: 10.3389/fimmu.2013.00182.

31. Delisle JS, Giroux M, Boucher G, Landry JR, Hardy MP, Lemieux S, Jones RG, Wilhelm BT, Perreault C. The TGF-β-Smad3 pathway inhib-its CD28-dependent cell growth and proliferation of CD4 T cells. Genes Immun. 2013;14:115–126. doi: 10.1038/gene.2012.63.

32. Zhang N, Bevan MJ. TGF-β signaling to T cells inhibits autoimmunity during lymphopenia-driven proliferation. Nat Immunol. 2012;13:667–673. doi: 10.1038/ni.2319.

33. Wang DG, Zhang FX, Chen ML, Zhu HJ, Yang B, Cao KJ. Cx43 in mes-enchymal stem cells promotes angiogenesis of the infarcted heart inde-pendent of gap junctions. Mol Med Rep. 2014;9:1095–1102. doi: 10.3892/mmr.2014.1923.



ownloaded from



34. Wang WE, Yang D, Li L, et al. Prolyl hydroxylase domain protein 2 silenc-ing enhances the survival and paracrine function of transplanted adipose-derived stem cells in infarcted myocardium. Circ Res. 2013;113:288–300. doi: 10.1161/CIRCRESAHA.113.300929.

35. Hawat G, Hélie P, Baroudi G. Single intravenous low-dose injections of connexin 43 mimetic peptides protect ischemic heart in vivo against myo-cardial infarction. J Mol Cell Cardiol. 2012;53:559–566. doi: 10.1016/j.yjmcc.2012.07.008.

36. Li J, Qi D, Cheng H, Hu X, Miller EJ, Wu X, Russell KS, Mikush N, Zhang J, Xiao L, Sherwin RS, Young LH. Urocortin 2 autocrine/paracrine and pharma-cologic effects to activate AMP-activated protein kinase in the heart. Proc Natl Acad Sci U S A. 2013;110:16133–16138. doi: 10.1073/pnas.1312775110.

37. Khan M, Nickoloff E, Abramova T, et al. Embryonic stem cell-derived exosomes promote endogenous repair mechanisms and enhance cardiac

function following myocardial infarction. Circ Res. 2015;117:52–64. doi: 10.1161/CIRCRESAHA.117.305990.

38. Ferreira-Martins J, Ogórek B, Cappetta D, et al. Cardiomyogenesis in the developing heart is regulated by c-kit-positive cardiac stem cells. Circ Res. 2012;110:701–715. doi: 10.1161/CIRCRESAHA.111.259507.

39. Yanagida E, Shoji S, Hirayama Y, Yoshikawa F, Otsu K, Uematsu H, Hiraoka M, Furuichi T, Kawano S. Functional expression of Ca2+ signal-ing pathways in mouse embryonic stem cells. Cell Calcium. 2004;36:135–146. doi: 10.1016/j.ceca.2004.01.022.

40. Eltzschig HK, Sitkovsky MV, Robson SC. Purinergic signaling during in-flammation. N Engl J Med. 2013;368:1260. doi: 10.1056/NEJMc1300259.

41. Levick SP, Meléndez GC, Plante E, McLarty JL, Brower GL, Janicki JS. Cardiac mast cells: the centrepiece in adverse myocardial remodelling. Cardiovasc Res. 2011;89:12–19. doi: 10.1093/cvr/cvq272.

What Is Known?

• Cell therapy after myocardial infarction leads to modest reductions in infarct size and some minor improvements in cardiac pump functions.

• Adoptively transferred stem cells have limited survival, engraftment and differentiation capacity and these problems reduce their ability to induce cardiac repair, justifying the need for identification of a novel stem cell type that has the capacity to overcome these limitations.

• Cortical bone–derived stem cells (CBSCs) have recently been shown to have a great ability to improve cardiac structure and function after myocardial infarction.

What New Information Does This Article Contribute?

• Cortical bone–derived stem cells have enhanced proliferation, survival, and engraftment capacity.

• CBSCs can form functional gap junctions with adult-derived feline myocytes.

CBSCs improve cardiac function after myocardial infarction and these functional gains are attributed to denovo myocyte forma-tion and neovascularization in combination with paracrine factor secretion from the donated CBSCs. In this study, an exhaustive characterization of CBSCs was done in comparison with 2 stem cell types being used in clinical trials, including cardiac-derived stem cells and mesenchymal stem cells. CBSCs possess a unique cell surface marker profile and had enhanced proliferation, sur-vival, and engraftment capacity versus cardiac-derived stem cells and mesenchymal stem cells. In addition, CBSCs formed func-tional gap junctions with adult cardiac myocytes and enhanced myocyte survival. Collectively, our results show proof of concept that CBSCs have properties that explain their greater ability to re-pair the damaged heart than 2 other cell types that are currently being tested clinically.

Novelty and Significance



ownloaded from


and Steven R. HouserShavonn Smith, Jason M. Duran, Neil Zalavadia, Yan Zhou, Hajime Kubo, Remus M. Berretta

Sadia Mohsin, Constantine D. Troupes, Timothy Starosta, Thomas E. Sharp, Elorm J. Agra,Unique Features of Cortical Bone Stem Cells Associated With Repair of the Injured Heart

Print ISSN: 0009-7330. Online ISSN: 1524-4571 Copyright © 2015 American Heart Association, Inc. All rights reserved.is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation Research

doi: 10.1161/CIRCRESAHA.115.3073622015;117:1024-1033; originally published online October 15, 2015;Circ Res.

http://circres.ahajournals.org/content/117/12/1024World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circres.ahajournals.org/content/suppl/2015/10/15/CIRCRESAHA.115.307362.DC1Data Supplement (unedited) at:

http://circres.ahajournals.org//subscriptions/

is online at: Circulation Research Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer about this process is available in the

located, click Request Permissions in the middle column of the Web page under Services. Further informationEditorial Office. Once the online version of the published article for which permission is being requested is

can be obtained via RightsLink, a service of the Copyright Clearance Center, not theCirculation Researchin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:



ownloaded from

http://circres.ahajournals.org/content/117/12/1024

http://circres.ahajournals.org/content/suppl/2015/10/15/CIRCRESAHA.115.307362.DC1

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circres.ahajournals.org//subscriptions/


Supplemental Material: Cortical Bone Stem Cell (CBSCs) isolation: From mice: Cortical bone stem cells were isolated as previously described 1. Briefly, Femurs and tibias were isolated from transgenic 12-week-old male C57BL/6-Tg (CAG-EGFP)1Osb/J mice (The Jackson Laboratory; Bar Harbor, ME), which constitutively express enhanced green fluorescent protein (EGFP). Bone marrow was flushed out of the bone cavity and washed thoroughly with phosphate-buffered saline (PBS). Cortical bone was crushed using a sterilized mortar and pestle, and bone fragments were further digested using collagenase II for n hour at 37C. Bone chunks were removed using 100 um and 40um filters. Bone derived cells were plated in CBSCs media containing DMEM/F12 Media (Lonza/Biowhittaker; Basel, Switzerland) + 10% fetal bovine serum (Gibco Life Technologies; Grand Island, NY), 1% Penicillin/Streptomycin/L-glutamine (Gibco Life Technologies; Grand Island, NY), 0.2% insulin-transferrin-selenium (Lonza; Basel, Switzerland), 0.02% basic-fibroblast growth factor (Peprotech; Rock Hill, NJ), 0.02% epidermal growth factor (Sigma; St. Louis, MO), and 0.01% leukemia inhibitory factor (Millipore; Billerica, MA). Cells were passaged till homogenous population of stem cells was obtained. From Gottingen mini swine: Cortical bone stem cells were isolated from biopsies obtained from hard bone of miniswine. Bone marrow was flushed out before taking the bone biopsies (3mm). The bone biopsy was digested in collagenase for an hour and passed through 100um and 40um. The remaining cells were plated in CBSCs media until homogenous population of stem cells was obtained. Cardiac Derived Stem Cell (CDCs) isolation: Heart biopsy was obtained from Gottingen miniswine for isolation of cardiac derived stem cells. Heart tissue was digested in collagenase and c-kit sorted as described earlier 1. CDCs were cultured in CBSCs media. Mesenchymal Stem Cells (MSCs) isolation: Mesenchymal stem cells were kindly provided by Dr. Joshua Hare (University of Miami). The cells were cultured in DMEM (Invitrogen, containing 20% Fetal Bovine Serum (FBS, (Gibco Life Technologies; Grand Island, NY), 1% Penicillin/Streptomycin/L-glutamine (Gibco Life Technologies; Grand Island, NY) as described earlier 2. Adult Ventricular myocytes (AVM) Co-culture and FRAP assay: AVM were isolated from feline hearts as described earlier 3. Briefly, Felines were euthanized by IP injection of pentabarbitol (100 mg/kg) and hearts were rapidly excised, cannulated, and mounted on a constant-flow Langendorff apparatus to obtain myocytes. AVM’s were co-culture with CBSCs, CDCs and MSCs stained with vybrant Dil labeling solution (Life technologies, CA) following manufacture’s protocol. Fluorescence recovery after photobleaching (FRAP) assay was developed to quantify diffusion of a fluorescent dyes between two cells forming connections to study cell-cell coupling and as described previously 4. Cells in co-culture were loaded with the fluorescent dye FITC-casein and then the myocyte forming connections to neighboring stem cells were photobleached. The rate of fluorescence recovery into the bleached cell was be used as an indicator of the degree of coupling between the cells and AFVMs. These experiments were performed at day 7 after co-culture.

Cytoplasmic Ca2+ level measurement in stem cells: Cytoplasmic Ca2+ was measured as described earlier 3. Briefly, CBSCs, CDCS and MSCs were loaded with Fluo-4-AM and perfused with Tyrode’s solution and recorded for 3 minutes. The solution was then switched to contain either 1µM ATP (Sigma) or 5µM histamine (Sigma) and the fluorescence signal was acquired. Changes in fluorescence signal were not seen at baseline with prolonged recordings. Data was graphically visualized and analyzed using Nikon AR analysis software. 1. Duran JM, Makarewich CA, Sharp TE, Starosta T, Zhu F, Hoffman NE, Chiba Y,

Madesh M, Berretta RM, Kubo H, Houser SR. Bone-‐derived stem cells repair the heart after myocardial infarction through transdifferentiation and paracrine signaling mechanisms. Circulation research. 2013;113:539-‐552

2. Hatzistergos KE, Quevedo H, Oskouei BN, Hu Q, Feigenbaum GS, Margitich IS, Mazhari R, Boyle AJ, Zambrano JP, Rodriguez JE, Dulce R, Pattany PM, Valdes D, Revilla C, Heldman AW, McNiece I, Hare JM. Bone marrow mesenchymal stem cells stimulate cardiac stem cell proliferation and differentiation. Circulation research. 2010;107:913-‐922

3. Makarewich CA, Zhang H, Davis J, Correll RN, Trappanese DM, Hoffman NE, Troupes CD, Berretta RM, Kubo H, Madesh M, Chen X, Gao E, Molkentin JD, Houser SR. Transient receptor potential channels contribute to pathological structural and functional remodeling after myocardial infarction. Circulation research. 2014;115:567-‐580

4. Kubo H, Berretta RM, Jaleel N, Angert D, Houser SR. C-‐kit+ bone marrow stem cells differentiate into functional cardiac myocytes. Clinical and translational science. 2009;2:26-‐32

Online Figure I: Differen/al cell surface marker expression: CBSCs, CDCs, and MSCs isolated from mini swine express differen8al cell surface markers measured by RNA seq analysis.

Day 1 Day 2 Day 4

Day 5 Day 6 Day 7

Online Figure II: CBSCs are clonal: CBSCs from mini swine are clonally expanded. Single cell was sorted in a 96 well, Day 1 single cell, Day 7 mul8ple colonies of CBSCs generated from single cell demonstra8ng the clonal capacity of CBSCs.

Online Figure III: mCBSCs form gap junc8ons with Adult ventricular myocytes; CBSCs are in green, Connexin-‐43 white, α-‐sarcomeric ac8n red, DAPI Blue.

Patch PipeTe

CBSC

AVM

Online Figure IV: A; AVMs were co-‐cultured with CBSCs and membrane poten8als of CBSCs aTached to AVMs were recorded. Membrane poten8al fluctua8ons B; were recorded in CBSCs that occurred during spontaneous AVM contrac8on C;. (n=3). These likely occurred by conduc8on of local currents from AFVMs into CBSCs via gap junc8ons.

A

C B

Online Table I: Cell surface marker profiling: Cell surface marker profiling: Gene expression of different cell surface markers using Real time PCR showed difference in expression between the three cell types CBSCs , CDCs and MSCs from mini swines. CT values of cell surface receptor expression within 25-35 cycles was labeled as medium and lower CT values than 25 were labeled as high expression. CBSCs CDCs MSCs Functional Relevance

CD105 (High) CD105 (High) CD105 (High) Endoglin, part of TGFβ family, involved in angiogenesis

CD106 (med) CD106 (High) CD106 (High) VCAM-1, cell adhesion molecule

CD73 (med) CD73 (High) CD73 (High) Ecto-5'-nucleotidase, converts AMP to Adenosine

CD271 (High) CD271 (negative)

CD271 (High) LNGFR (low-affinity nerve growth factor receptor), involved in development, survival and differentiation of cells.

CD90 (High) CD90 (High) CD90 (High) Thy-1, expressed on variety of stem cells

CD133(med) CD133(med) CD133(med) Prominin-1, expressed on many stem cells including hematopoietic stem cells, endothelial progenitor cells

CD29 (High) CD29 (High) CD29 (High) Integrin Beta 1, in cell adhesion, recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells.

CD44 (med) CD44 (med) CD44 (med) Cell Adhesion and migration, also expressed on stem cells

CD45 (negative) CD45 (negative)

CD45 (negative)

Protein tyrosine phosphatase, receptor type, C, Present on hematopoietic cells,

CD11-b (negative)

CD11-b (negative)

CD11-b (negative)

Macrophage-1 antigen, expressed on many immune cells

Online Table II: Primer Sequences for Real time Rt-PCR CD105 R GAAACCTGGCTCGTGGTGTA CD105 F CAGCAGGTCTTGCAGAAGGA CD106 R CGTGGATCTGGTCCCGTTAG CD106 F GCGAGTCCTCCCTGTCTTTC CD73 R ACGTGAATTCCATTGTTCCGC CD73 F GACACCCGGATGAGATGTCC CD271R GGCAAAGCTGACTTGGCTTC CD271 F AATGAGGGGCCTCAGGTTTG CD90 R GTTCGAGAGCGGTAGGAGTG CD90 F GAATACCACCAACCTGCCCA CD133 R TCTGTCGCTGGTGCATTTCT CD133F TCCTAATGCCTCTGGTGGGG CD29 R TTCAGAACCTGCCCATAGCG CD29 F TCTCAGCACTGAATGCCAAGT CD44 R GCTTCACCCTTTGGTGTCTC CD44 F TTCCACTGAGGTTGGGGTGTA CD45 R TTCTGGTGTCTGCCTGCTTC CD45 F GTGAGAGTGGACGATAAAGGGA CD11b R TTGCTGGCAACCTAGACAGG CD11b F GCCTGTTGCCTCTGTGAGAA

cellular biology - circulation researchcircres.ahajournals.org/content/117/12/1024.full.pdf · 1024...

Documents