www.elsevier.com/locate/cbpa

Comparative Biochemistry and Physiol

Changes in mRNA expression of regulatory factors involved in adipocyte

differentiation during fatty acid induced adipogenesis in chicken

Yusuke Matsubara, Kan Sato*, Hiroshi Ishii, Yukio Akiba

Graduate School of Agricultural Science, Tohoku University, Sendai, 981-8555, Japan

Received 28 January 2005; received in revised form 12 April 2005; accepted 14 April 2005

Available online 26 May 2005

Abstract

The adipocyte differentiation process involves a cascade of transcriptional events that culminates in the expression of peroxisome

proliferator-activated receptor-g (PPARg) and CCAAT/enhancer binding protein-a (C/EBPa). These adipogenic transcription factors regulate

the expression of genes necessary for the development of mature adipocytes in mammals. The current study was undertaken to identify

regulatory factors that affect adipogenesis and to analyze species-specific mRNA expression of factors involved in chicken adipocyte

differentiation. We developed a system for differentiation of chicken (Gallus gallus) adipocytes in culture using medium containing 500 nM

dexamethasone, 0.5 mM 3-isobutyl-1-methylxanthine, 20 Ag/mL bovine insulin, 300 AM oleate, and 10% fetal bovine serum. The rapid

differentiation of cells to mature adipocytes in this culture system was verified by observed increases in adipocyte fatty acid-binding protein

(aP2) expression, glycerol-3-phosphate dehydrogenase (GPDH) activity and intracellular triglyceride accumulation. In contrast, cells cultured

in a differentiation medium without fatty acids did not differentiate into mature adipocytes. The expression profiles of genes involved in the

regulation of adipocyte differentiation, such as PPARg, C/EBPa, h, y, sterol regulatory element binding protein-1 (SREBP-1), fatty acid

synthase (FAS), lipoprotein lipase (LPL), and glucose transporters 1 and 8 (GLUT1 and GLUT8) were studied. Rapid increases in PPARg

and aP2 expression were observed after 9 and 12 h of culture in differentiation medium, respectively. In contrast, the expression patterns of

the other adipogenic genes only differed slightly from those previously determined for mammalian adipocytes. These results suggest that

exogenous fatty acid is essential for adipocyte differentiation in chickens, and that PPARg is possibly a key regulator in the early stages of

chicken preadipocyte differentiation.

D 2005 Elsevier Inc. All rights reserved.

Keywords: Adipocyte; Gene expression; aP2; Glycerol-3-phosphate dehydrogenase; PPAR; C/EBP; Chicken; Adipogenesis

1. Introduction

Obesity, a condition in which there is an excessive

amount of adipose tissue mass in relation to lean body mass,

is a nutritional disorder most prevalent in humans and other

mammals. The increase in adipose tissue mass can result

from the multiplication of new fat cells through adipo-

genesis and/or from increased deposition of cytoplasmic

triglycerides (Soukas et al., 2001). The biological process of

adipocyte differentiation has been extensively studied in

vitro using a number of preadipocyte cell lines, including

1095-6433/$ - see front matter D 2005 Elsevier Inc. All rights reserved.

doi:10.1016/j.cbpb.2005.04.013

* Corresponding author. Tel.: +81 22 717 8689; fax: +81 22 717 8691.

E-mail address: kan@bios.tohoku.ac.jp (K. Sato).

mouse 3T3-L1 cells (Green and Meuth, 1974). These

studies have led to the identification of key regulatory

genes, including CCAAT/enhancer binding proteins (C/

EBPs)a, h and y and peroxisome proliferator-activated

receptor-g (PPARg) (MacDougald and Lane, 1995), that

permit or are necessary for the transition of preadipocytes

into adipocytes in vitro.

In chickens, lipogenic activity is much greater in the liver

than in adipose tissue. Most of the fats accumulated in

adipose tissue are incorporated as triacylglycerols from

plasma lipoproteins, which are either taken up as triacyl-

glycerols from very low density lipoprotein (VLDL)

secreted and transported from the liver, or obtained from

dietary fats (Griffin and Hermier, 1988). We previously

reported that the lipoprotein lipase (LPL)-catalyzed hydrol-

ogy, Part A 141 (2005) 108 – 115

Y. Matsubara et al. / Comparative Biochemistry and Physiology, Part A 141 (2005) 108–115 109

ysis of triacylglycerols in adipose tissue is a rate-limiting

step in fat accumulation in chickens (Sato et al., 1999).

Transport and incorporation of exogenous lipids, i.e. plasma

VLDL and chylomicron, are therefore essential for the

development of adipose tissues and are characteristic of

lipid metabolism in avian species.

In studying the development of adipose tissue in

chickens, it has previously shown that increases in

abdominal fat pad mass of broiler chickens mainly depends

on hyperplasia of adipocytes until 4 weeks of age and on

hypertrophic growth beyond 4 weeks (Hood, 1982). It is

therefore likely that the hyperplastic stage, starting from a

few days prior to hatching until around 4 weeks of age, may

be targeted for the modulation of fat deposition in chickens.

In order to explore novel methods to control chicken fat

deposition, it may be beneficial to accumulate knowledge of

the expression of regulatory factors that are involved in

adipocyte differentiation during adipogenesis in chickens.

There is only a small amount of information available on the

expression of regulatory genes during adipogenesis, such as

PPARs and C/EBPs, and to date relatively few studies of the

in vitro culture of preadipocytes have been attempted in

chickens (Butterwith and Griffin, 1989; Wu et al., 2000). In

those studies with chicken preadipocyte cultures, chicken

serum has been commonly included at 10–20% in the

medium to induce differentiation (Cryer et al., 1987;

Butterwith and Griffin, 1989; Wu et al., 2000), since culture

media including fetal bovine serum (FBS) with hormones,

i.e. dexamethasone, 3-isobutyl-1-methylxanthine and insu-

lin, was found to be insufficient to induce differentiation of

chicken preadipocytes.

The present study was designed to identify factors that

could be used instead of chicken serum, to induce adipocyte

differentiation in cultures containing FBS. As provision of

exogenous lipid is essential for the development of chicken

adipose tissues, we hypothesized that fatty acids, only a few

of which are biosynthesized in the adipose tissue itself in

chickens, might play an important role in adipocyte differ-

entiation. Another hypothesis tested in the present study is

that the expression pattern of genes involved in adipo-

genesis in chickens is different from that of mammalian

species, since species-specificities in lipid metabolism, i.e.

incorporation and biosynthesis of fatty acids, have been

demonstrated in chickens. The present study was conducted

to evaluate the above hypotheses.

2. Materials and methods

2.1. Cell culture

Chicken preadipocytes were prepared by the method of

Ramsay and Rosebrough (2003) with some modifications.

Abdominal adipose tissue was collected from 10-day-old

broiler chicks (Gallus gallus, Cobb strain) by sterile

dissection following rapid decapitation. The adipose tissue

was minced into fine sections with scissors and incubated in

10 mL of digestion buffer (PBS (�), 0.1% collagenase, 2.8

mM glucose, 4% BSA) for 45 min at 37 -C in a water bath.

After the incubation, growth medium (M199, 10% FBS, 100

U/mL penicillin and streptomycin) was added to the

digestion flask. Flask contents were mixed and filtered

through nylon screens with 100 and 25 Am mesh openings

to remove undigested tissue and large cell aggregates. The

filtered cells were centrifuged at 300�g for 10 min to

separate floating adipocytes from pellets of stromal-vascular

cells. The stromal-vascular cells were then seeded in f90

mm collagen type I-coated dishes (Sumitomo Bakelite Co.,

Ltd., Tokyo, Japan) at a density of 1�104 cells/cm2 and

cultured in a humidified atmosphere of 95% air and 5% CO2

at 37 -C until confluency (days 3–4), when differentiation

was initiated and experiments began.

2.2. Induction of chicken adipocyte differentiation

An aim of this study was to develop a culture system that

permits differentiation of chicken adipocytes in the absence

of chicken serum. Chicken preadipocyte cells were cultured

in a similar manner to mouse 3T3-L1 cells (Wise et al.,

1984). In particular, the cells were cultured in Dulbecco’s

Modified Eagle’s medium (DMEM) containing 10% FBS,

dexamethasone (DEX, 500 nM, Wako, Osaka, Japan), 3-

isobutyl-1-methylxanthine (IBMX, 0.5 mM, Wako) and

bovine insulin (INS, 20 Ag/mL, #I-5500 Sigma) in the

presence or absence of 300 AM oleate. The differentiation

media were introduced following confluence and the media

changed every 2 days until day 7 of culture.

2.3. Enzyme activity

Cell cultures in f60 plates were washed with PBS (�)

and then harvested. Glycerol-3-phosphate dehydrogenase

(GPDH; EC 1.1.1.8) was assayed by the method of Wise

and Green (1978). Protein concentrations of cell culture

homogenates were determined by the method of Lowry et

al. (1951) using bovine serum albumin as the standard.

2.4. Determination of triglyceride and DNA concentrations

in cells

Total triglyceride content in cells was determined using

the Triglyceride Assay Kit (Wako). Total DNA content in

the cells was determined using the method of Kissane and

Robins (1958).

2.5. Quantitation of mRNA expression using real-time PCR

Total RNAwas extracted from cultured cells using Trizol

reagent (Invitrogen, San Diego, CA, USA). To study the

progressive alterations in expression of chicken adipo-

genesis genes, real-time reverse transcription-polymerase

chain reaction (RT-PCR) analysis was performed using the

Y. Matsubara et al. / Comparative Biochemistry and Physiology, Part A 141 (2005) 108–115110

iCycler Real Time Detection System (Bio-Rad Laboratories,

Hercules, CA, USA). Five micrograms of total RNA was

reverse transcribed using random primer and M-MLV

reverse transcriptase (Invitrogen). Each RT-reaction served

as a template in a 50 AL PCR reaction containing 2 mM

MgCl2, 0.5 mM of each primer and 0.5 X SYBR green

master mix (Bio Whittaker Molecular Applications). Tem-

perature cycles were as follows: 94 -C for 3 min followed

by 35 cycles at 94 -C for 30 s, 63 -C for 1 min, and 72 -Cfor 1 min. SYBR green fluorescence was detected at the end

of each cycle to monitor the amount of PCR product formed

during that cycle. At the end of each run, melting curve

profiles were recorded. Oligonucleotide sequences of sense

and antisense primers are shown in Table 1.

Specificity of the amplification product was verified by

electrophoresis on a 0.8% agarose-gel and by DNA

sequencing. Results for each RNA type are presented as a

ratio to 18S ribosomal RNA to correct for differences in the

amounts of template DNA.

2.6. Western blot analysis

Cultured cells were washed with PBS. Aliquots of

detergent-solubilized cells were separated by 10% SDS-

PAGE electrophoresis and transferred to Hybond C extra

membranes (HP9028, Amersham). The membrane was

probed with a polyclonal human aP2 antibody (HyCult

biotechnology, 101700). Blots were incubated in blocking

buffer A (PBS-T containing 7% nonfat dry milk) for 1 h at

room temperature. Then, the blots were washed with PBS-T

and incubated with the antibody (1:1000) for 3 h at room

Table 1

Oligonucleotides used (5¶ to 3¶)

GenBank accession number Gene

name

AF432507 aP2

AF163811 PPARg

X66844 C/EBPa

AY212285 C/EBPh

BG711211 C/EBPy

AY029224 SREBP-1

J03860 Fatty acid synthase

AB016987 Lipoprotein lipase

L07300 GLUT1

AB083371 GLUT8

AF173612 18S ribosomal RNA

temperature. After incubating and washing with PBS-T, the

blots were incubated with anti-rabbit IgG (Sigma) diluted

1:10,000 in PBS-T for 1 h at room temperature. After

washing with PBS-T, antibody-protein complexes on blots

were visualized with the ECL system (Pierce) and exposed

to X-Ray-film (Amersham) for 10–15 min. Immunoreactive

protein levels were determined semi-quantitatively by

densitometry using a Molecular imager FX (Bio-Rad).

2.7. Statistical analysis

Results are given as meansTS.D. Statistical significancewas determined using the Student’s t test with two-tailed p

values. The level of significance used in all studies was

P <0.05.

3. Results

3.1. Chicken preadipocyte differentiation

Preadipocyte cells cultured in differentiation media

containing 300 AM oleate and hormones showed a marked

increase in lipid deposition in relation to the control

cultured in growth medium (Fig. 1A). In contrast, there

was little lipid deposition in cells cultured in the absence

of oleate (Fig. 1B). The addition of oleate with hormones

resulted in increased aP2 mRNA expression and GPDH

activity after 48 h of culture in the differentiation media

(Fig. 2). The levels of aP2 protein observed in those cells

increased with increases in culture time (Fig. 3). However,

Primer sequence

Sense: GAGTTTGATGAGACCACAGCAGA

Antisense: ATAACAGTCTCTTTGCCATCCCA

Sense: TACATAAAGTCCTTCCCGCTGACC

Antisense: TCCAGTGCGTTGAACTTCACAGC

Sense: GTGCTTCATGGAGCAAGCCAA

Antisense: TGTCGATGGAGTGCTCGTTCT

Sense: CGCTCCATGACCGAACTTACC

Antisense: CCACTTTGGTCTCCACGATCTG

Sense: CAACCAGGAGATGCAGCAGAAG

Antisense: GGGCAGCTGCTTGAAGAAGTG

Sense: CATTGGGTCACCGCTTCTTCGTG

CGTTGAGCAGCTGAAGGTACTCC

Sense: ACGATTGCCCACCAGGATTCGCT

Antisense: GCTGTGCTCTTGCTGTAGGTCTG

Sense: GCATTCACCATTCAGAGAGTCAG

Antisense: AACTGCTAAAGAGGAACTGATGG

Sense: GATGGCTTTGTCCTTTGAGATGC

Antisense: CAAAGATGCTGGTGGAGTAGTAG

Sense: GCAGCAGAGGTTATTCGCGCCG

Antisense: GCCTCCCAGTATTCCTCCAGCAG

Sense: TAGATAACCTCGAGCCGATCGCA

Antisense: GACTTGCCCTCCAATGGATCCTC

Fig. 2. aP2 mRNA levels (A) and glycerol-3-phosphate dehydrogenase

(GPDH) activity in chicken adipocytes cultured in differentiation medium

with or without fatty acid. (A) Quantitation of mRNA expression using real-

time PCR as described in the Materials and methods. (B) GPDH activities

were analyzed from cell lysates at 2 and 7 days post-induction. Bars

indicate SD of the mean values (n =4). *Statistically significant differences

compared to the levels at time 0 ( P <0.05).

Fig. 3. Western blot analysis of aP2 immunoreactive protein in chicken

adipocytes that were cultured in differentiation medium with or without

fatty acid supplementation. Aliquots of cell lysates (50 Ag protein) at 12,

24, or 72 h post-induction were subjected to SDS/PAGE. Immunoblot

analysis was performed with 1.2 Ag/mL of antibody against human aP2.

Bound antibodies were visualized with the ECL system. Blots were

exposed to film for 1 min.

Fig. 1. Morphological changes of chicken adipocytes cultured in differ-

entiation medium with or without fatty acid supplementation. (A) Cells

cultured in differentiation medium in the presence of fatty acids for 5 days.

(B) Cells cultured in differentiation medium in the absence of fatty acids for

5 days.

Y. Matsubara et al. / Comparative Biochemistry and Physiology, Part A 141 (2005) 108–115 111

aP2 mRNA and protein levels, GPDH activity and

intracellular triglyceride content in cells cultured in the

differentiation media without oleate were not significantly

different from those in cells before induction of differ-

entiation (time 0) (Figs. 2–4).

3.2. Gene expression profile during chicken adipogenesis

induced by addition of oleate

To understand the molecular basis underlying differ-

entiation of chicken preadipocytes into mature adipocytes,

mRNA levels of regulatory genes involved in adipocyte

differentiation were monitored for 48 h of culture.

Expression of aP2 mRNA increased up to 9 h of culture

in the differentiation media and maintained high levels for

48 h (Fig. 5A). PPARg mRNA expression levels markedly

increased over the first 9 h, decreased by 12 h and were

unchanged over 18–48 h after induction of differentiation

(Fig. 5B). C/EBPa, a potent enhancer expressed in parallel

to PPARg in 3T3-L1 cells, reached maximum levels in

chicken adipocytes after 24 h of culture in media

containing oleate (Fig. 5C), and the increase was

approximately 2-fold that of values at time 0. The levels

of C/EBPh and C/EBPy mRNA gradually increased by 36

Fig. 4. Intercellular triglyceride accumulation in chicken adipocytes

cultured in differentiation medium with or without fatty acid supplement.

Chicken preadipocytes were cultured in differentiation medium with (&) orwithout (g) fatty acid. Cells were harvested at time points for determination

of DNA and triglyceride levels. Results are given with the S.D. of the mean

values (n =4). *Statistically significant differences compared to the levels at

time 0 ( P <0.05).

Fig. 5. Gene expression profiles of chicken preadipocytes cultured in the differentiation medium supplemented with fatty acid. The expression level of each

gene was determined by real-time PCR as described in the Materials and methods, and expressed as a ratio to 18S ribosomal RNA levels. Results are given with

the SD of the mean values (n =4). * or . significant up-regulation or down-regulation ( P <0.05) compared to the levels at time 0, respectively. (A) aP2, (B)

PPARg, (C) C/EBPa, (D) C/EBPh, (E) C/EBPy, (F) SREBP-1, (G) Fatty acid synthase, (H) Lipoprotein lipase, (I) GLUT8, (J) GLUT1.

Y. Matsubara et al. / Comparative Biochemistry and Physiology, Part A 141 (2005) 108–115112

h of culture in the presence of oleate (Fig. 5D and E).

SREBP-1 and FAS mRNA levels gradually increased up

to 24 h and remained high for 48 h (Fig. 5F and G). In

sharp contrast to the mRNA expression aforementioned,

LPL mRNA levels gradually decreased by 6 h and

significantly lower expression levels were observed until

48 h of culture in the presence of oleate (Fig. 5H). The

expression of GLUT8 was down-regulated in the cells 12

h after induction of adipogenesis, but then gradually

increased until 48 h (Fig. 5I). High levels of GLUT1

mRNA expression were observed from 9 to 48 h of

culture in the differentiation media supplemented with

oleate (Fig. 5J).

4. Discussion

Factors responsible for regulation of adipocyte differ-

entiation in chickens had not been previously characterized,

even changes in adipogenic gene expression during adipo-

genesis had not been analysed. One of the major reasons for

this lack of knowledge of chicken adipogenesis might be

that until now no culture system was available for the study

of chicken adipogenesis. Recently, Ramsay and Rosebrough

(2003) developed a culture system using the stromal-

vascular fraction of chicken adipose tissue and partly

characterized hormonal regulation of chicken preadipocyte

differentiation. This culture media was able to differentiate

Y. Matsubara et al. / Comparative Biochemistry and Physiology, Part A 141 (2005) 108–115 113

chicken preadipocytes as it included 2.5% of chicken serum.

However, whether adipogenesis of chicken preadipocytes

can be induced in differentiation media with FBS instead of

chicken serum by the addition of functional molecules has

not yet been explored. In chicken adipose tissue lipogenic

activity, which is regulated by the transcription factor

SREBP-1, is quite low compared to mammals. Chicken

adipose tissue consequently incorporates a greater amount

of fatty acids from the bloodstream than mammalian adipose

tissue (Gondret et al., 2001). It is hypothesized that fatty

acids may, to a certain extent, play a role in the induction of

adipocyte differentiation in chickens. In the present study,

culture of chicken preadipocytes in differentiation medium

supplemented with oleate, a fatty acid, resulted in greatly

increased intracellular lipid deposition, aP2 mRNA expres-

sion and GPDH activity. In contrast, differentiation of

chicken preadipocytes was not observed in the absence of

fatty acids. Therefore, our study has firstly shown that

supplementation of the differentiation media, containing

FBS and hormones, with fatty acid was essential to initiate

the differentiation of chicken preadipocytes into mature

adipocytes.

Much of our knowledge concerning the sequence of

transcriptional events mediating adipogenesis has been

derived from studies of cultured mouse 3T3-L1 cell lines

where determined fibroblastic-like cells differentiate into

functionally mature adipocytes (Morrison and Farmer,

2000). On exposure of 3T3-L1 adipocytes to exogenous

mediators, expression of C/EBPh and C/EBPy is immedi-

ately and transiently increased (Cao et al., 1991). The

current study shows that expression of C/EBPh and C/EBPygradually, but only slightly, increased during adipogenesis

in chicken preadipocyte cultures. One might presume that

chicken preadipocytes, prepared from the stromal-vascular

fraction of chicken adipose tissue, intrinsically have more

potential to activate C/EBPh and C/EBPy protein, as has

been shown for DFAT-D1, a novel mouse preadipocyte cell

line. In DFAT-D1 cells, C/EBPh and C/EBPy mRNA are

constantly expressed throughout adipogenesis (Yagi et al.,

2004). It is, therefore, likely that expression of C/EBPh and

C/EBPy in adipocyte differentiation is dependent on cell

type.

In 3T3-L1 preadipocytes, C/EBPh and C/EBPy sequen-

tially mediate expression of PPARg (Wu et al., 1995) and C/

EBPa (Christy et al., 1991). Once activated, PPARg and C/

EBPa appear to cross-regulate each other (Schwarz et al.,

1997) and the expression pattern of PPARg parallels that of

C/EBPa in 3T3-L1 cells in which adipogenesis has been

induced (Mandrup and Lane, 1997). However, we found

that in chicken preadipocyte culture PPARg mRNA levels

rapidly and markedly increased in the differentiation

medium supplemented with fatty acid for up to 9 h, while

C/EBPa mRNA levels gradually increased until 24 h of

culture (Fig. 5). Although an explanation for why the

expression patterns of 3T3-L1 and chicken preadipocytes

differ has not been found, it might be relevant to consider

that the early stimulation of PPARg gene expression, rather

than that of C/EBPa expression, is the primary step in the

induction of chicken adipogenesis. This possible role of

PPARg in chicken adipocyte differentiation may be

substantiated by our previous finding that the administration

of troglitazone, a PPARg synthetic ligand, to growing

chickens increased abdominal adipose mass (Sato et al.,

2004). It is therefore likely that PPARg is a potent and key

regulator of the differentiation of chicken adipose cells.

The exposure of preadipocytes to hormonal agents that

induce differentiation also leads to an early upregulation of

ADD1/SREBP-1c gene expression in 3T3-L1 preadipocytes

(Ericsson et al., 1997). ADD1/SREBP-1 c is involved in a

metabolic cascade leading the production of endogenous

PPARg ligands required for transcriptional events, i.e.

expression of fatty acid synthase (FAS) (Fajas et al.,

1999). Prior to this study, we hypothesized that sterol

regulatory element binding protein-1 (SREBP-1) and FAS

are not involved in the differentiation of chicken adipocytes

because SREBP-1 and FAS expression levels are quite low

in chicken adipose tissue. However, the present results show

that both SREBP-1 and FAS mRNA levels gradually

increase with adipogenesis progression (Fig. 5F and G). In

addition, in our study the changes in SREBP-1 and FAS

mRNA levels corresponded well to changes in C/EBPa

mRNA levels. These results suggest that chicken SREBP-1

and FAS are involved in adipogenesis, in particular the

maturation of adipocytes, in concert with C/EBPa.

Any property of the mature adipocyte is likely to

require the expression of numerous genes. aP2 mRNA and

protein levels markedly increased following the increase in

PPARg gene expression, while the increase in aP2

expression occurred earlier than that of the C/EBPa

expression. It is likely that aP2 protein levels are regulated

at the transcriptional level by intra-nuclear PPARg, as has

been shown in mammals. In sharp contrast to aP2, LPL

mRNA expression decreased rapidly with commencement

of culture in the oleate-supplemented differentiation

medium. We previously observed that the LPL mRNA

levels were quite low in adipose tissues of chickens at two

weeks of age, when adipocyte number significantly

increased in the adipose tissue. It is, therefore, assumed

that suppression of LPL gene expression is characteristic

of chicken adipocyte differentiation.

Glucose is essential for maturation, i.e. lipid deposition,

in mammalian adipocytes. Stimulation of gene expression of

GLUT4, an insulin-sensitive glucose transporter, plays an

important role in the adipocyte maturation process (Kaestner

et al., 1990). However, we previously reported that broiler

chickens lack sequences homologous to GLUT4 (Seki et al.,

2003). In the present study we monitored the expression

pattern of GLUT1 and GLUT8 as Scheepers et al. (2001)

previously showed that GLUT8 mRNA levels increase

markedly during the differentiation of 3T3-L1 cells.

Expression of both GLUT1 and GLUT8 gradually increased

during the progression of adipogenesis in chickens. There-

Y. Matsubara et al. / Comparative Biochemistry and Physiology, Part A 141 (2005) 108–115114

fore, GLUT1 and GLUT8 might be, in part, involved in

glucose uptake during the differentiation and maturation of

chicken adipocytes.

In differentiation medium, 3T3-L1 preadipocytes gen-

erally mature to adipocytes in 3 to 10 days of culture. In

contrast, in our system differentiation medium supple-

mented with fatty acid enabled maturation of chicken

preadipocytes within 48 h. Distel et al. (1992) reported that

the addition of fatty acid to 3T3-F422 media rapidly

increases aP2 mRNA levels within 12 h post addition,

while the expression of C/EBPa is not affected by the

addition of fatty acid. These findings suggest that the

induction of aP2 mRNA synthesis by fatty acid is

independent of differentiation-dependent activation of the

aP2 gene. However, the present study shows that culturing

chicken preadipocytes in differentiation medium supple-

mented with fatty acid and hormones induced not only aP2

expression but also other adipogenic genes, i.e. GPDH, C/

EBPa, SREBP-1 and GLUT1 and GLUT8. We have

shown, here that supplementation of differentiation

medium with hormones in the absence of fatty acid is

unable to induce maturation of chicken preadipocytes even

after 7 days of incubation (Fig. 2). Thus our data

demonstrate that fatty acid is required for the differ-

entiation of chicken preadipocytes into adipocytes, and that

this requirement is specific to adipose tissue development

in chickens.

In conclusion, PPARg and aP2 expression are elevated

during the early stages of chicken adipogenesis that is

induced by the addition of fatty acid together with

hormones. Therefore, fatty acid incorporation into preadi-

pocytes by the augmentation of aP2 through the activation

of PPARg plays a crucial role in the regulation of chicken

adipogenesis. These results establish the importance of

exogenous fatty acid in chicken adipogenesis and represent

a species-specific difference between chicken and mamma-

lian lipid metabolism.

Acknowledgement

This work was partly supported by Grants-in-Aid (Nos.

13460121 and 15208026) from the Ministry of Education,

Science and Culture of Japan.

References

Butterwith, S.C., Griffin, H.D., 1989. The effects of macrophage-derived

cytokines on lipid metabolism in chicken (Gallus domesticus) hepato-

cytes and adipocytes. Comp. Biochem. Physiol., A 94, 721–724.

Cao, Z., Umek, R.M., McKnight, S.L., 1991. Regulated expression of three

C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev.

5, 1538–1552.

Christy, R.J., Kaestner, K.H., Geiman, D.E., Lane, M.D., 1991. CCAA-

T/enhancer binding protein gene promoter: binding of nuclear factors

during differentiation of 3T3-L1 preadipocytes. Proc. Natl. Acad. Sci.

U. S. A. 88, 2593–2597.

Cryer, J., Woodhead, B.G., Cryer, A., 1987. The isolation and character-

isation of a putative adipocyte precursor cell type from the white

adipose tissue of the chicken (Gallus domesticus). Comp. Biochem.

Physiol., A 86, 515–521.

Distel, R.J., Robinson, G.S., Spiegelman, B.M., 1992. Fatty acid regulation

of gene expression. Transcriptional and post-transcriptional mecha-

nisms. J. Biol. Chem. 267, 5937–5941.

Ericsson, J., Jackson, S.M., Kim, J.B., Spiegelman, B.M., Edwards, P.A.,

1997. Identification of glycerol-3-phosphate acyltransferase as an

adipocyte determination and differentiation factor 1- and sterol

regulatory element-binding protein-responsive gene. J. Biol. Chem.

272, 7298–7305.

Fajas, L., Schoonjans, K., Gelman, L., Kim, J.B., Najib, J., Martin, G.,

Fruchart, J.C., Briggs, M., Spiegelman, B.M., Auwerx, J., 1999.

Regulation of peroxisome proliferator-activated receptor gamma

expression by adipocyte differentiation and determination factor

1/sterol regulatory element binding protein 1: implications for

adipocyte differentiation and metabolism. Mol. Cell. Biol. 19,

5495–5503.

Gondret, F., Ferre, P., Dugail, I., 2001. ADD-1/SREBP-1 is a major

determinant of tissue differential lipogenic capacity in mammalian and

avian species. J. Lipid Res. 42, 106–113.

Green, H., Meuth, M., 1974. An established pre-adipose cell line and its

differentiation in culture. Cell 3, 127–133.

Griffin, H.D., Hermier, D., 1988. Plasma lipoprotein metabolism and

fattening on poultry. In: Leclercq, B., Whitehead, C.C. (Eds.), Leanness

in Domestic Birds. Butterworths, London, UK, pp. 175–201.

Hood, R.L., 1982. The cellular basis for growth of the abdominal fat pad in

broiler-type chickens. Poult. Sci. 61, 117–121.

Kaestner, K.H., Christy, R.J., Lane, M.D., 1990. Mouse insulin-responsive

glucose transporter gene: characterization of the gene and trans-

activation by the CCAAT/enhancer binding protein. Proc. Natl. Acad.

Sci. U. S. A. 87, 251–255.

Kissane, J.M., Robins, E., 1958. The fluorometric measurement of

deoxyribonucleic acid in animal tissues with special reference to the

central nervous system. J. Biol. Chem. 233, 184–188.

Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein

measurement with the folin phenol reagent. J. Biol. Chem. 193,

265–275.

MacDougald, O.A., Lane, M.D., 1995. Transcriptional regulation of gene

expression during adipocyte differentiation. Annu. Rev. Biochem. 64,

345–373.

Mandrup, S., Lane, M.D., 1997. Regulating adipogenesis. J. Biol. Chem.

272, 5367–5370.

Morrison, R.F., Farmer, S.R., 2000. Hormonal signaling and transcriptional

control of adipocyte differentiation. J. Nutr. 130, 3116S–3121S.

Ramsay, T.G., Rosebrough, R.W., 2003. Hormonal regulation of postnatal

chicken preadipocyte differentiation in vitro. Comp. Biochem. Physiol.,

B 136, 245–253.

Sato, K., Akiba, Y., Chida, Y., Takahashi, K., 1999. Lipoprotein hydrolysis

and fat accumulation in chicken adipose tissues are reduced by chronic

administration of lipoprotein lipase monoclonal antibodies. Poult. Sci.

78, 1286–1291.

Sato, K., Fukao, K., Seki, Y., Akiba, Y., 2004. Expression of the

chicken peroxisome proliferator-activated receptor-gamma gene is

influenced by aging, nutrition, and agonist administration. Poult. Sci.

83, 1342–1347.

Scheepers, A., Doege, H., Joost, H.G., Schurmann, A., 2001. Mouse

GLUT8: genomic organization and regulation of expression in 3T3-

L1 adipocytes by glucose. Biochem. Biophys. Res. Commun. 288,

969–974.

Schwarz, E.J., Reginato, M.J., Shao, D., Krakow, S.L., Lazar, M.A., 1997.

Retinoic acid blocks adipogenesis by inhibiting C/EBPbeta-mediated

transcription. Mol. Cell. Biol. 17, 1552–1561.

Seki, Y., Sato, K., Kono, T., Abe, H., Akiba, Y., 2003. Broiler chickens

(Ross strain) lack insulin-responsive glucose transporter GLUT4 and

have GLUT8 cDNA. Gen. Comp. Endocrinol. 133, 80–87.

Y. Matsubara et al. / Comparative Biochemistry and Physiology, Part A 141 (2005) 108–115 115

Soukas, A., Socci, N.D., Saatkamp, B.D., Novelli, S., Friedman, J.M.,

2001. Distinct transcriptional profiles of adipogenesis in vivo and in

vitro. J. Biol. Chem. 276, 34167–34174.

Wise, L.S., Green, H., 1978. Studies of lipoprotein lipase during the adipose

conversion of 3T3 cells. Cell 13, 233–242.

Wise, L.S., Sul, H.S., Rubin, C.S., 1984. Coordinate regulation of the

biosynthesis of ATP-citrate lyase and malic enzyme during adipocyte

differentiation. Studies on 3T3-L1 cells. J. Biol. Chem. 259, 4827–4832.

Wu, Z., Xie, Y., Bucher, N.L., Farmer, S.R., 1995. Conditional ectopic

expression of C/EBP beta in NIH-3T3 cells induces PPAR gamma and

stimulates adipogenesis. Genes Dev. 9, 2350–2363.

Wu, Y.J., Wright, J.T., Young, C.R., Cartwright, A.L., 2000. Inhibition of

chicken adipocyte differentiation by in vitro exposure to monoclonal

antibodies against embryonic chicken adipocyte plasma membranes.

Poult. Sci. 79, 892–900.

Yagi, K., Kondo, D., Okazaki, Y., Kano, K., 2004. A novel preadipocyte

cell line established from mouse adult mature adipocytes. Biochem.

Biophys. Res. Commun. 321, 967–974.