CHAPTER 10 CHAPTER 10 Molecular Biology of the Gene of the Gene Connection Between Genes & DNA A)Griffith (1928) used pneumonia- causing bacterium used 2 strains: 1)rough strain - mutant & harmless 2)smooth strain - pathogenic (disease-causing) mixed heat-killed S cells w/R cells found that some R cells converted to S cells R cells became pathogenic also = some chemical component of the dead cells could pass on characteristics 10.1 B)Hershey & Chase (1952) used a virus (much simpler than a cell) viruses that infect bacteria used in research are called bacteriophages has DNA or RNA enclosed in a protective coat virus reproduces by infecting cell (some use legs & spring action) and take over metabolism found that DNA of virus is injected into host cell injected DNA directs synthesis of more viral DNA to be made Resulting Discoveries Griffith discovered transformation - process of assimilation of external genetic material inheritable identity of the factor causing this was unknown at that time Hershey & Chase found bacteriophages better in research DNA was genetic rather than protein (radioactive elements in 2 different experiments helped determine this) Nucleic Acids Nucleic Acids Polynucleotides: made up of? nucleotides: sugar, phosphate group, nitrogenous base -covalent bonding of the sugar of one nucleotide to a phosphate of another represents the sugar-phosphate backbone 10.2 DNA/RNA phosphate group sugar? nitrogenous bases? phosphate group sugar? nitrogenous bases? deoxyribose A,T,G,C ribose A,U,G,C Purines - double ring structure (A, G) Pyrimidines - single ring structure (T, C) DNA Structure Chargaff - analyzed DNA composition and concluded that the quantities of adenine = thymine and quantities of guanine = cytosine,this is known as Chargaffs Rule **Where did Mr. Laughlin attend college? AT GC 10.3 Watson & Crick found DNAs structure using information from the research work of both Rosaland Franklin (X-ray crystallography) and Irwin Chargaff (Chargaffs rule) = double helix two sugar-phosphate backbones on the double helix are oriented in opposite directions = antiparallel See page 177 HO OH DNA Replication Happens when? A template mechanism is used to replicate DNA (make a copy) template acts as the pattern for the new DNA (each half of the original DNA serves as the template) nucleotides are added 50 per second in mammals During INTERPHASE S phase 10.4 Origins of Replication Origin of replication - site where replication begins creates replication bubbles along the strand replication will then spread in both directions along the strand (see next slide) 10.5 Strand Separation Necessary enzymes: - helicase unwinds the double helix - single strand binding proteins keep strands separated - topoisonmerase relieves any stress on the strands caused by the unwinding Attaching Nucleotides -DNA polymerase catalyzes the synthesis of the new DNA strands (only starts on the 3 end of original DNA strand) ***DNA is synthesized in a 5 to 3 direction because the -OH group of the third carbon is always the one exposed. (The fifth carbon will have a phosphate attached.) Hydroxyl group on the 3 l end DNA polymerase Replication fork The new 5 to 3 strand is called the leading strand. The new 3 to 5 strand is called the lagging strand (made in segments 5 to 3 called Okazaki fragments) -DNA ligase links Okazaki fragments to the growing strand. Lagging leading Leading lagging Overall direction of replication Parental DNA 5 3 5 3 Leading strand Lagging strand (Okazaki fragments) What is the overall direction of replication? Proofreading There is a high accuracy in DNA replication. Pairing errors between incoming nucleotides occur 1/10,000 before DNA polymerase & other enzymes correct mistakes. Afterwards there is only 1/1,000,000,000. Repair & Maintenance -Includes proofreading but it must also repair accidental changes in DNA due to chemicals, X-rays, UV light, radioactivity -There are more than 50 types of repair enzymes -Excision repair is when an enzyme cuts out a damaged segment of DNA and gap is filled w/proper nucleotides Genotype to Proteins Genes do not build proteins directly but give instructions in the form of RNA (RNA programs protein synthesis) Transcription - genetic info must first Be transferred from DNA into RNA Translation - info in RNA must be transferred into a protein 10.6 Transcription Translation The genetic code, instructions for building a protein, is written in a series of 3 mRNA nitrogen bases called a codon or triplet code possible codons (43) - each codon corresponds to an amino acid or start/stop signals - start is AUG (also codes for met) and stop is UAA, UAG, UGA - genetic code is the same for all organisms w/a few exceptions 10.7 10.8 Transcription 1. Initiation a. genetic information in DNA is transcribed (message has just been rewritten) in RNA b. RNA molecules are made from DNA templates (similar to DNA replication but only 1 original strand serves as a template) 10.9 DNA c. new strand grows in what direction? d. ribonucleotides make up the RNA strand (similar to DNA nucleotides w/same base pairing rules) RNA: UACGGU DNA: ATGCCA Why is there U? 5 l 3 l Uracil replaces Thymine What linked DNA nucleotides together? So what links RNA? e. RNA polymerase links the ribonucleotides together f. RNA polymerase must be instructed where to start (promoter sequence of nucleotides initiates the process) and where to stop the transcription process DNA polymerase RNA polymerase What are the possible terminator sequences?UAA, UAG, UGA 2. Elongation a. RNA peels away from DNA & DNA comes back together b. growth of the new strand continues until RNA polymerase reaches the terminator sequence Template Strand RNA - Occurs in the nucleus then moves into the cytoplasm (this is where ribosomes make protein) 3. Termination a. terminator sequence (codon) signals stop b. new mRNA must now move So where does transcription take place? Transcription in Eukaryotes Before mRNA leaves the nucleus it receives a cap (a single G nucleotide) and tail (50 to 250 As) to protect it from attack by enzymes in the cytoplasm. The cap and tail do not code for amino acids Eukaryotic DNA Introns-internal noncoding regions Exons-parts of a gene expressed as amino acids -Both are transcribed into RNA, but introns are removed prior to the mRNA leaving the nucleus. Exons then join to form one continuous coding sequence. 3 Kinds of RNA 2)Transfer RNA (tRNA) - serves as an interpreter between nucleic acids and proteins - Brings in appropriate amino acids to make polypeptides 1) Messenger RNA (mRNA) - encodes amino acid sequence that is transcribed DNA - The genetic message it carries is translated into polypeptides -tRNA is single stranded and folded into a shape similar to a cloverleaf Amino Acid attachment site **tRNA has 2 special attachment sites: -site where aa is picked up -site where mRNA is recognized by the anticodon (set of 3 bases which recognize complementary bases on the mRNA codon) 3)Ribosomal RNA (rRNA) - found on the ribosomes (structural component) -helps read mRNA code and delivers the proper tRNA 10.12 The Actual Ribosome Made of 2 subunits. Each one is made up of proteins (40%) and rRNA (60%). These coordinate the binding of mRNA plus 2 binding sites for tRNA. - P site holds tRNA strand carrying the growing polypeptide - A site holds tRNA carrying the next amino acid to be added on Ribosome Simplified Version Translation - Making Proteins Protein Synthesis - 3 stages 1. Initiation - brings together mRNA codon w/tRNA anticodon (view)(view) 2. Elongation - when more amino acids are added on, one by one -peptide bonds form between aas 3. Termination - when termination codon reaches A site of ribosome -protein is typically 100 aa long -protein release factor helps to free new polypeptide SUMMARY: DNA Non-template ATGTATACCCCGTACGTGTTC Template TACATATGGGGCATGCAGAAG mRNA AUGUAUACCCCGUACGUCUUC AUG anticodon codon tRNA amino acid Mutations changing the meaning of genes any change in the nucleotide sequence (either large chromosome regions or single DNA base pairs) Point Mutations - changes in single DNA base pairs - 2 types 1. Base Substitutions - replacement of one nucleotide w/another (can result no change or change crucial to life) 2. Base Insertions or Deletions - can change reading frame of codons (nucleotide triplets) Mutagenesis process of creating mutations 2 causes 1. Spontaneous Mutations - errors made during DNA replication or recombination 2. Mutagen - physical or chemical agent that causes mutation (X- rays, UV, tobacco) And who benefits from all of our knowledge of DNA? CBS How to use DNA Firstcollect DNA samples to be tested 12.2 & Some restriction enzymes will separate a strand of DNA at very specific locations based on nitrogen base-pairing sequences. Nextuse enzymes to cut DNA segments Those enzymes will produce segments known as restriction fragments. ThenGel Electrophoresis sorts DNA molecules by size The fragments can be placed into wells in a gel and an electrical current is run through the gel pulling the strands through the gel. DNA strands have a slightly negative charge and will move from the negative electrode end towards the positive electrode end of the gel. The larger the fragment the shorter the distance it will travel because it gets caught in the gel. (Which fragment was the largest?) Wells (Which ends would the positive and negative electrodes be located?) Finallythe gel is read to determine if the samples being tested are matches