chapter 12 - dna technology and the human genome genetically modify organisms and transgenic...

Chapter 12 - DNA Technology and the Human GenomeGenetically modify organisms and transgenic organisms

Genetically modified organisms (GMO’s):

-Organisms whose genes have been altered using genetic engineering techniques.

- Most GMO’s are transgenic organisms… they have received genes from a different organism.

Transgenic organisms

Ex. A mouse is given a gene from a human. The mouse is a transgenic GMO.

Chapter 12 - DNA Technology and the Human GenomeGenetically modify organisms (GMO’s) and transgenic organisms

GloFish1. Zebra danio was genetically engineered with a gene from sea coral that causes the fish to glow in the presence of environmental toxins.2. Gene was inserted into the embryo of the fish.

Zebra danio

3. First GMO available as a pet.

GMO’s at home:


GFP Mice

GFP (green fluorescent protein)

Aequorea victoria (jellyfish, phylum cnidaria)

1. Gene from a jellyfish (Aequorea victoria) that codes for GFP was inserted into the embryos of mice.

GMO’s in research:


GFP (green fluorescent protein)

1. GFP is used in cellular and molecular biology.2. You can attach this protein to any other protein you want making it a reporter protein.

- It “reports” to you where the protein is going (similar to radioactivity in that sense)



Ex. - GFP has been attached to a protein called MFD, which is found in peroxisomes.

- Those little green dots are peroxisomes…- You can track any protein you want…in a single cell or an entire organism



1. Corn plants containing Cry genes from a bacterium – Bacillus thurengensis.2. The genes code for enzymes that produce a toxin (insecticide), Bt toxin, which will kill European corn borer larvae – most damaging insect to corn in US and canada.

Bt Corn European Corn Borer Larva

GMO food:


Ordinary rice“Golden” rice

- “Golden” rice is genetically engineered with genes that code for enzymes that make beta-carotene, a precursor to Vitamin A for countries deficient in foods with Vit. A…- This rice has never been used because of environmental concerns.

GMO food:


Genetically engineered sheep with the human gene for alpha-1-antitrypsin (AAT). AAT is extracted from their milk and used to treat humans deficient in AAT, which is one cause of emphysema (a breathing disorder) in approximately 100,000 people in the western world.

AAT Sheep

GMO medicine:


- Insulin is made using the bacterium E. coli.

- The human gene coding for insulin is inserted into E. coli, which will then make insulin for us (we will see how this is done shortly)…

E. Coli with the human insulin gene

GMO medicine:


Conclusion- We can basically move any gene(s) between members of a species or between any species. - We can also alter the genes to our liking (GFP tagged proteins) before inserting them into embryos.

Is all of this genetic engineering positive, negative?


Let’s look at some of the ways we genetically engineer organisms starting with how we can take a human insulin gene and put it into E. coli…

Chapter 12 - DNA Technology and the Human GenomeHow can we use bacteria to manipulate DNA and protein?

First we must understand bacteria and how they take up DNA…

(it is more than mutation that give them their genetic diversity)

Fig. 12.1A-C


1. Transformation

Bacteria can take up a free piece of bacterial DNA

There are three methods by which bacteria take up DNA in nature.

Fig. 12.1A-C


2. Transduction

Bacteriophage is mistakenly packaged with bacterial DNA. Injects this DNA into another bacteria.


Fig. 12.1A-C


3. Conjugation

“Male” (F+) bacteria extend sex pili (long tube) to “female” (F-) bacteria. Part of chromosome is replicated and transferred.


Fig. 12.1D


Once the DNA is transferred, integration must occur:

Crossing over occurs (where do you think we got it from?) and the new DNA is integrated in place of the original DNA, which is degraded.


Where have we observed transformation before in this class?

1. Transformation2. Transduction 3. Conjugation

The Griffith experiment when he mixed the R strain with the heat-killed S strain…


We will focus mostly on transformation when we look at genetic engineering…

1. Transformation2. Transduction 3. Conjugation


Transformation in the lab:

Heat Shock Method

1. Transformation

1. Take bacteria in a tube (in solution)

2. Add the DNA you want it to take up into the tube.

3. Let the tube chill on ice for a few minutes4. Then quickly heat the tube to 42°C (107°F) for 90 seconds.- This will open up “holes” in the bacterial

membrane for the DNA to slip in.

5. Cool on ice for 10 minutes…done

The bacterium now has the DNA…simple.


Bacteria can have more than just a single circular chromosome…

(They may have little circular extra-chromosomal DNA called Plasmids)

extra-chromosomal = outside of the chromosome like extra-terrestrial means coming from outside Earth (E. T.)

Fig. 12.2C


The majority of the DNA above is chromosomal, but you can see the small circular pieces not part of the chromosome…plasmids.


Plasmid - Small, circular piece of DNA distinct from bacterial chromosome - has own origin of replication (ori)

- carries genes/insert genes at the polylinker region

- called vectors when used in genetic engineering…

The bacterium has enzymes called restriction enzymes that attempt to cut up the bacteriophage DNA before it can take over the cell. Different species have different restriction enzymes…

Chapter 12 - DNA Technology and the Human GenomeHow can we use bacteria to manipulate DNA and protein?Recall how a bacterium defends itself when a bacteriophage injects its DNA into a bacterium…

Aside: Why do these enzymes not cut the bacterial chromosome?The bacterial chromosome is methylated (modified by

adding –CH3 groups so the enzymes can’t bind to it)

Restriction enzymes

1. molecular DNA scissors (enzymes that cut DNA)


2. Different restriction enzymes cut different sequences.3. Scientists have isolated hundreds of different restriction enzymes from many different bacteria – EcoRI, BamHI, NcoI, etc…

Fig. 12.4

Restriction enzymes


Ex. EcoRI

Notice anything interesting about this sequence?

- It is palindromic, read the same way forward and backward.

- Majority of restriction sites are palindromic…

Notice that is doesn’t cut straight through like paper scissors. The enzyme cuts each strand after the G nucleotide generating single-strand regions called sticky ends.

Restriction enzymes


Ex. EcoRI

EcoRI

Why do you think we call them sticky ends?

Restriction enzymes


Ex. EcoRI

EcoRI

Because they can base pair to a complementary strand…they are “sticky”. If it cut straight through then it could no base pair.

More examples of restriction enzymes


Restriction enzymes


Now that we understand transformation, plasmids and restriction enzymes, we are ready to take the next step and learn how to take a gene from an organism of choice (ex. Human insulin) and put it into a bacterium so that the bacterium can make the polypeptide (insulin) for us. This process is called subcloning.

Subcloning

Now imagine this restriction site was in a plasmid (vector).


Ex. EcoRI

plasmid (vector)

Subcloning

What happens if you treat it with the restriction enzyme BamHI?


Ex. EcoRI

BamHI

Nothing, BamHI does not cut that sequence.

Subcloning


Ex. EcoRI

EcoRI

What happens if you treat it with the restriction enzyme EcoRI?

Subcloning

EcoRI cuts the vector leaving two sticky ends…


Ex. EcoRI

EcoRI

Now what?

Subcloning

We need to insert our gene of choice into the plasmid.

Fig. 12.3


1. You can isolate the DNA from the organism of interest, which has the gene you want to put into the vector.

Subcloning


…CGATTAGAATCCCGCC CGGATTGAATCCCGAA… …GCTAATCTTAGGGCGG GCCTAACTTAGGGCTT…

Insulin gene

Zoom in

Subcloning

What do we need to do?

Fig. 12.3


2. Cut the gene out with the same restriction enzyme that you cut the plasmid/vector with.

…CGATTAGAATTCCGCC CGGATTGAATTCCGAA… …GCTAATCTTAAGGCGG GCCTAACTTAAGGCTT…

Insulin gene

Zoom in

Subcloning


…CGATTAG AATTCCGCC CGGATTG AATTCCGAA… …GCTAATCTTAA GGCGG GCCTAACTTAA GGCTT…

Insulin gene

Zoom in

What now?

Subcloning

3. Mix the cut vector with the cut gene…what should happen?


+ AATTCCGCC CGGATTG GGCGG GCCTAACTTAA

Insulin gene

Subcloning

The sticky ends should base pair (the two pieces anneal).


However, you still have gaps between the nucleotides in each strand…what should we do?

Subcloning

Use DNA ligase to ligate the strands together


Every enzyme/protein we discover is a new tool for scientists to use in the lab to manipulate DNA. DNA ligase was discovered when investigating DNA replication, but now we use it as a “glue” when subcloning genes into vectors.

DNA ligase

Subcloning

Now what should we do with this vector containing our gene or interest?

Put it into bacteria like E. coli by transformation using the heat-shock method.


Since the vector has an origin of replication, it will be replicated by DNA polymerase inside the bacterium when the chromosome is replicated during binary fission.

Now our gene is inside the bacteria. How does this help us?

Subcloning

Subcloning


1. We can take the bacteria after many round of binary fission and isolate the plasmid/vector, and take back the gene. In essence, the bacteria replicated it for us…2. Or we can have the bacterium make the protein for us and then we can take the protein and use it.

Fig. 12.3


Review Slide

Fig. 12.5

What is the problem with this if we were subcloning a eukaryotic gene?


Review Slide

INTRONS!! If you take a eukaryotic gene and insert it straight into a vector, the introns are still there and bacteria cannot splice out introns.How do we fix this?

Fig. 12.7

Let the eukaryotic cell take out the introns for you…

Instead of taking the gene from the eukaryotic cell, take the processed mRNA.

But this leads to another problem, we can’t put RNA into a DNA plasmid…


Fig. 12.7

Make cDNA (complementary DNA) from the mRNA:

Advantages to cDNA 1. No introns2. No junk DNA

1. Isolate mRNA from gene of interest2. use reverse transcriptase to make a dsDNA copy

3. cut with restriction enzyme and ligate into a vector


Summary1. Isolate plasmid


2. Isolate gene of interest (straight from genome if bacterial or via mRNA if eukaryotic)3. Cut both with same restriction enzyme

4. Mix together to allow sticky ends to ANNEAL forming recombinant DNA

5. Ligate using DNA ligase

6. Transform bacteria with vector (plasmid)7. Bacteria will express (make) the protein and divide making more copies of the gene (gene cloning)

Conclusion

We can make any protein we want or more of any gene (gene cloning) by putting it into a plasmid and transforming a bacterium.


There is another, more efficient way of making more of any gene or DNA segment we want…using a method called:

Chapter 12 - DNA Technology and the Human GenomeAIM: What are some other tools of DNA technology?

PCR (Polymerase Chain Reaction)Technique used to amplify (make more of) a specific

piece of DNA. Can be a gene or any other segment. It is essentially DNA replication in a test tube…

http://www.maxanim.com/genetics/PCR/PCR.htm


http://www.youtube.com/watch?v=x5yPkxCLads

A crime has been committed and you have a suspect as well as a tiny bit of DNA sample from the scene of the crime. What do you do?


The first thing you do is PCR the DNA to make more copies of it…

Fig. 12.11A

**Everyone’s DNA (genes) have a slightly different sequence, so we all have different restriction sites.


Amplified section of the DNA from the crime scene

The allele of this person has two restriction sites.

How many restriction fragments (DNA pieces) would there be after cutting with the restriction enzyme?

three

You have a suspect. What should you do?


Use PCR to amplify the same segment of the subjects DNA and cut it with the same restriction enzyme.

Fig. 12.11A

twoHow many restriction fragments will the suspects DNA yield?



Amplified section of the same DNA segment from the suspect.

The suspect has a different allele with a mutation in the first restriction site. The restriction enzyme will not cut this sequence.

The suspect did not commit the crime.

Conclusion:

Fig. 12.11A




This is great, but you can’t see DNA like this…

How can we OBSERVE the DNA and count the number of fragments?

Fig. 12.10

Gel Electrophoresis

This technique allows one to not only indirectly view the DNA, but also to separate and view the DNA fragments.


Fig. 12.10

Gel Electrophoresis


Gel (like jell-o)

The gel is made of either agarose or polyacrylamide. It has tiny, microscopic pores that DNA can fit through.

Fig. 12.10

Gel Electrophoresis


The DNA sample is loaded in the wells at the top of the gel. One sample per well.

Gel (like jell-o)

Fig. 12.10

Gel Electrophoresis


Electricity is then run through the gel. Why do you think the negative end is on the sample side and the positive end is on the other end of the gel?

Electricity (electrons flow from top of gel by the samples to the bottom of the gel)

DNA is negative because the phosphates are negative. The negative electrons moving down push the DNA down with them.

Gel Electrophoresis


Which will move faster through the micro-porous gel, the longer DNA fragments or the shorter DNA fragments?The small fragments (fewer nucleotides) will move more easily through the gel and hence go faster than the large ones.

Fig. 12.10

Gel Electrophoresis


The gel is soaked with a a compound called ethidium bromide, which sticks to DNA and lights up when you hit the gel with UV light…

Gel Electrophoresis


http://www.youtube.com/watch?v=Wwgs-FjvWlw&feature=related

You are not observing the DNA move. You are seeing a blue dye added to the sample move through the gel. You cannot see the DNA until you put the gel under a UV lamp.

Gel Electrophoresis


AIM: What are some of the other tools of DNA technology?

Virtual Lab

(http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html)

http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html


Draw what the gel would look like for the restriction digest of the criminal and the suspect.



Fig. 12.11Acriminal suspect

Suspect’s DNA fingerprint

Criminal’sDNA fingerprint


Can also be used to detect disease or determine paternity.


Review:


1. Use PCR to get more of the desired DNA2. Digest DNA with restriction enzymes3. Run restriction fragments on a gel (gel electrophoresis)

4. Compare fragments

Question: You have been given two DNA samples that have gone through PCR. Both samples are of the same DNA segment with a size of 1kb (1 kilobase = 1000bp). Sample 1 has four restriction sites at 100bp, 300bp, 350bp, and 700bp. The second piece has the same sites in addition to a fifth site at 725bp. Draw how the gel should look for these two pieces.



Sample 1

Sample 2

100bp 300bp350bp 700bp

Segments of DNA:

50bp, 100bp, 200bp, 300bp, 350bp

100bp 300bp350bp 700bp

725bp

Five segments in total -

25bp, 50bp, 100bp, 200bp, 275bp, 350bp Six segments in total -


-

+

Do not forget to label the charges on the gel and show the flow of electrons (the current).

50bp

100bp

200bp

300bp

350bp

50bp

100bp

200bp

350bp

25bp

275bp

Sample1

Sample2

e-

Gel electrophoresis can be done using proteins as well. In this case the gel is made of polyacrylamide and the proteins are coated with negatively charged molecules since they are not always negative like DNA. It is a little more complicated, but not much…


Humans - 3 billion nucleotides in a haploid set of chromosomes (775 of your textbooks)

1000X more DNA than E. coli

E. coli ~2000 genes

H. sapiens ~35000 genes

Protein coding genestRNA coding genesrRNA coding genes

97% of our genome is non-coding (typical of eukaryotes)

-gene control seqeunces (promoters, enhancers, etc…) -mostly “junk DNA” (unknown function)

-includes introns (which can be 10X the length of the neighboring exon and DNA between genes

Chapter 12 - DNA Technology and the Human GenomeNEW AIM: Understanding the human genome.

DNA between genes

-much is repetitive DNA (2 types) 1. Short repeats (few nucleotides repeated over and over)

- Ex) …CATGCATGCATGCATGCATGCATG…

- Found at centromeres and telomeres (ends of chromosomes)


2. Long repeats

- Repeats are hundreds of nucleotide pairs long

- Blocks of repeats are scattered around the genome

- Function unknown

- Associated with “jumping genes” known as Transposons


Chapter 12 - DNA Technology and the Human GenomeAIM: Understanding the human genome.

Fig. 12.13B


Fig. 12.14


“Pharm” animalsFig. 12.16

Chapter 12 - DNA Technology and the Human GenomeNEW AIM: Making transgenic organisms.

Fig. 12.18AB

Chapter 12 - DNA Technology and the Human GenomeAIM: Making transgenic organisms.

Chapter 12 - DNA Technology and the Human GenomeAIM: Making transgenic organisms.

Fig. 12.19

Chapter 12 - DNA Technology and the Human Genome

AIM: Making transgenic organisms.

Gene Therapy

- Replacing a defective gene with a normal gene.

Fig. 12.20AB

Fig. 12.21ABC

Fig. 12.2AB

AIM: How can bacteria be used as tools to manipulate DNA?

Fig. 12.12


1. We need more of the DNA

Fig. 12.12

PCR - Polymerase Chain Reaction-DNA polymerase-nucleotides (A,T,C,G)-Primers-PCR machine (Heat Cycler)


Fig. 12.12

AIM: What are some of the other tools of DNA technology?

chapter 12 - dna technology and the human genome genetically modify organisms and transgenic...

Documents

organisms gmos

human genomegenetically

transgenic organisms

dna technology

human insulin

transgenic gmo

human gene coding

transgenic organismsglofish1