Chapter 2

Enzymes for Genetic Engineering

21 Restriction endonucleases22 DNA ligase 23 DNA polymerase24 Other Enzymes25 probe labeling techniques

第二章 基因工程的工具酶 教学目的要求1 了解基因工程各种工具酶的基本概念分类及在基因工程中的作用2 掌握限制性内切酶聚合酶连接酶反转录酶修饰酶的生物学特性和应用教学内容1 工具酶与基因工程2 限制酶3 DNA 聚合酶4 DNA 连接酶5 S1 核酸酶6 BAL31 核酸酶7 碱性磷酸酶8 逆转录酶9 T7 和 SP6RNA 聚合酶

Enzyme function ApplicationRestriction endonucleases

fragment DNA into defined segments

cloning

DNA Ligase joins DNA fragments

DNA polymerase

RNA polymerase

synthesizes DNA based on a template

PCR

fills in gaps in DNA

Reverse transcriptase copies RNA into DNA 1048774 cDNA RT-PCR

Terminal transferase add poly nucleotides for radiolabeling

Polynucleotide kinase transfer P from ATP to the 5 end

For radiolabeling

Alkaline phosphatase remove phosphate Avoid self ligation

S1 nuclease Cut single-stranded DNA and RNA

Ribonucleases (endo and exo RNase) 1048774

degradation of RNA into smaller components

Enzymes for DNA analysis and molecular cloning

21 Restriction endonucleases

211 Restriction modification system (R-M )

212 nomenclature

213 three types of RE

214 Factors Affecting Restriction Enzyme Digestion

21 Restriction endonucleases

Restriction Enzymes are - Proteins - Cleave DNA inside with a sequence-specific

manner - Different restriction enzymes in different organi

sms - Evolved as a defense mechanism against infe

ction by foreign viruses - Isolated from bacteria algae and archaea

( 古生菌 )

( 限制性核酸内切酶）

bull Over 3000 restriction enzymes have been studied in detail

bull More than 600 of these are available commercially bull Routinely used for DNA modification and manipulation in laboratories

Roberts RJ Vincze T Posfai J Macelis D (2007) REBASE--enzymes and genes for DNA restriction and modification Nucleic Acids Res 35 (Database issue) D269ndash70

Facts the first restriction enzyme HindII was isolated in 1970 by

Hamilton Smith and his colleagues [1]

the 1978 Nobel Prize for Physiology or Medicine was awarded to Daniel Nathans Werner Arber and Hamilton Smith

Roberts RJ (April 2005) How restriction enzymes became the workhorses of molecular biology Proc Natl Acad Sci USA 102 (17) 5905ndash8

第二章 基因工程的工具酶 教学目的要求1 了解基因工程各种工具酶的基本概念分类及在基因工程中的作用2 掌握限制性内切酶聚合酶连接酶反转录酶修饰酶的生物学特性和应用教学内容1 工具酶与基因工程2 限制酶3 DNA 聚合酶4 DNA 连接酶5 S1 核酸酶6 BAL31 核酸酶7 碱性磷酸酶8 逆转录酶9 T7 和 SP6RNA 聚合酶

Enzyme function ApplicationRestriction endonucleases

fragment DNA into defined segments

cloning

DNA Ligase joins DNA fragments

DNA polymerase

RNA polymerase

synthesizes DNA based on a template

PCR

fills in gaps in DNA

Reverse transcriptase copies RNA into DNA 1048774 cDNA RT-PCR

Terminal transferase add poly nucleotides for radiolabeling

Polynucleotide kinase transfer P from ATP to the 5 end

For radiolabeling

Alkaline phosphatase remove phosphate Avoid self ligation

S1 nuclease Cut single-stranded DNA and RNA

Ribonucleases (endo and exo RNase) 1048774

degradation of RNA into smaller components

Enzymes for DNA analysis and molecular cloning

21 Restriction endonucleases

211 Restriction modification system (R-M )

212 nomenclature

213 three types of RE

214 Factors Affecting Restriction Enzyme Digestion

21 Restriction endonucleases

Restriction Enzymes are - Proteins - Cleave DNA inside with a sequence-specific

manner - Different restriction enzymes in different organi

sms - Evolved as a defense mechanism against infe

ction by foreign viruses - Isolated from bacteria algae and archaea

( 古生菌 )

( 限制性核酸内切酶）

bull Over 3000 restriction enzymes have been studied in detail

bull More than 600 of these are available commercially bull Routinely used for DNA modification and manipulation in laboratories

Roberts RJ Vincze T Posfai J Macelis D (2007) REBASE--enzymes and genes for DNA restriction and modification Nucleic Acids Res 35 (Database issue) D269ndash70

Facts the first restriction enzyme HindII was isolated in 1970 by

Hamilton Smith and his colleagues [1]

the 1978 Nobel Prize for Physiology or Medicine was awarded to Daniel Nathans Werner Arber and Hamilton Smith

Roberts RJ (April 2005) How restriction enzymes became the workhorses of molecular biology Proc Natl Acad Sci USA 102 (17) 5905ndash8

Enzyme function ApplicationRestriction endonucleases

fragment DNA into defined segments

cloning

DNA Ligase joins DNA fragments

DNA polymerase

RNA polymerase

synthesizes DNA based on a template

PCR

fills in gaps in DNA

Reverse transcriptase copies RNA into DNA 1048774 cDNA RT-PCR

Terminal transferase add poly nucleotides for radiolabeling

Polynucleotide kinase transfer P from ATP to the 5 end

For radiolabeling

Alkaline phosphatase remove phosphate Avoid self ligation

S1 nuclease Cut single-stranded DNA and RNA

Ribonucleases (endo and exo RNase) 1048774

degradation of RNA into smaller components

Enzymes for DNA analysis and molecular cloning

21 Restriction endonucleases

211 Restriction modification system (R-M )

212 nomenclature

213 three types of RE

214 Factors Affecting Restriction Enzyme Digestion

21 Restriction endonucleases

Restriction Enzymes are - Proteins - Cleave DNA inside with a sequence-specific

manner - Different restriction enzymes in different organi

sms - Evolved as a defense mechanism against infe

ction by foreign viruses - Isolated from bacteria algae and archaea

( 古生菌 )

( 限制性核酸内切酶）

bull Over 3000 restriction enzymes have been studied in detail

bull More than 600 of these are available commercially bull Routinely used for DNA modification and manipulation in laboratories

Roberts RJ Vincze T Posfai J Macelis D (2007) REBASE--enzymes and genes for DNA restriction and modification Nucleic Acids Res 35 (Database issue) D269ndash70

Facts the first restriction enzyme HindII was isolated in 1970 by

Hamilton Smith and his colleagues [1]

the 1978 Nobel Prize for Physiology or Medicine was awarded to Daniel Nathans Werner Arber and Hamilton Smith

Roberts RJ (April 2005) How restriction enzymes became the workhorses of molecular biology Proc Natl Acad Sci USA 102 (17) 5905ndash8

21 Restriction endonucleases

211 Restriction modification system (R-M )

212 nomenclature

213 three types of RE

214 Factors Affecting Restriction Enzyme Digestion

21 Restriction endonucleases

Restriction Enzymes are - Proteins - Cleave DNA inside with a sequence-specific

manner - Different restriction enzymes in different organi

sms - Evolved as a defense mechanism against infe

ction by foreign viruses - Isolated from bacteria algae and archaea

( 古生菌 )

( 限制性核酸内切酶）

bull Over 3000 restriction enzymes have been studied in detail

bull More than 600 of these are available commercially bull Routinely used for DNA modification and manipulation in laboratories

Roberts RJ Vincze T Posfai J Macelis D (2007) REBASE--enzymes and genes for DNA restriction and modification Nucleic Acids Res 35 (Database issue) D269ndash70

Facts the first restriction enzyme HindII was isolated in 1970 by

Hamilton Smith and his colleagues [1]

the 1978 Nobel Prize for Physiology or Medicine was awarded to Daniel Nathans Werner Arber and Hamilton Smith

Roberts RJ (April 2005) How restriction enzymes became the workhorses of molecular biology Proc Natl Acad Sci USA 102 (17) 5905ndash8

21 Restriction endonucleases

Restriction Enzymes are - Proteins - Cleave DNA inside with a sequence-specific

manner - Different restriction enzymes in different organi

sms - Evolved as a defense mechanism against infe

ction by foreign viruses - Isolated from bacteria algae and archaea

( 古生菌 )

( 限制性核酸内切酶）

bull Over 3000 restriction enzymes have been studied in detail

bull More than 600 of these are available commercially bull Routinely used for DNA modification and manipulation in laboratories

Roberts RJ Vincze T Posfai J Macelis D (2007) REBASE--enzymes and genes for DNA restriction and modification Nucleic Acids Res 35 (Database issue) D269ndash70

Facts the first restriction enzyme HindII was isolated in 1970 by

Hamilton Smith and his colleagues [1]

the 1978 Nobel Prize for Physiology or Medicine was awarded to Daniel Nathans Werner Arber and Hamilton Smith

Roberts RJ (April 2005) How restriction enzymes became the workhorses of molecular biology Proc Natl Acad Sci USA 102 (17) 5905ndash8

bull Over 3000 restriction enzymes have been studied in detail

bull More than 600 of these are available commercially bull Routinely used for DNA modification and manipulation in laboratories

Roberts RJ Vincze T Posfai J Macelis D (2007) REBASE--enzymes and genes for DNA restriction and modification Nucleic Acids Res 35 (Database issue) D269ndash70

Facts the first restriction enzyme HindII was isolated in 1970 by

Hamilton Smith and his colleagues [1]

the 1978 Nobel Prize for Physiology or Medicine was awarded to Daniel Nathans Werner Arber and Hamilton Smith

Roberts RJ (April 2005) How restriction enzymes became the workhorses of molecular biology Proc Natl Acad Sci USA 102 (17) 5905ndash8

211 Restriction modification system ( 限制与修饰系统）

Restriction Enzymes have evolved to provide a defense mechanism against invading viruses [1]

Inside a bacterial host the restriction enzymes selectively cut up foreign DNA in a process called restriction

Host DNA is methylated by a modification enzyme (a methylase) to protect it from the restriction enzymersquos activity

Collectively these two processes form the restriction modification system (R-M system)

Arber W Linn S (1969) DNA modification and restriction Annu Rev Biochem 38 467ndash500

Kobayashi I (September 2001) Behavior of restriction-modification systems as selfish mobile elements and their impact on genome evolution Nucleic Acids Res 29 (18) 3742ndash56

Lawn

菌膜Plaque 嗜菌斑

Bacteria phagelsquos invation causes host cells dead and lead to form plaques

W Arber and S Linn (1969) E coli C

Plating efficiencies of bacteriophage λ (l phage) grown on E coli strains C K-12 and B

Phageλ EColi C plaque （＋） EColi K-12 plaque （－） EColi B plaque （－）

EcoliK-12 and B can resist phage λ

The DNA of phage which had been grown on strains K-12 and B were found to have chemically modified bases which were methylated

bull Additional studies with other strains indicate that different strains had specific methylated bases

EcoRI

vs

EcoRI Methylase

5rsquomdashGAAmTTCmdash3rsquo will not be cut by EcoRI3rsquomdashCTTAmAGmdash5rsquo

R-M for this strain

In addition to possessing a particular methylase individual bacterial strains also contained accompanying specific endonuclease activities

A characteristic feature of the sites of methylation was that they involved palindromic （回文） DNA sequences EcoR1 methylase specificity （ Rubin and Modrich 1977 ）

The REs cleaved at or near the methylation recognition site However they would not cleave at these specific palindromic sequences if the DNA was methylated

Methylation occurres at very specific sites in the DNA

Typical sites of methylation include the N6 position of adenine the N4 position or the C5 position of cytosine

Assignment1 what are the methylating sites for Guanine and Thymine

212 Nomenclature ( 命名）Since their discovery in the 1970s many different restriction enzymes have been identified in different bacteria Each enzyme is named after the bacterium from which it was isolated using a naming system based on bacterial genus（属） species（种） and strain（菌株）

eg EcoRI restriction enzyme was derived as follow

Abbreviation Meaning Description

E Escherichia genus

co coli species

R RY13 strain

I First identified order of identificationin the bacterium

W Arber and S Linn (1969) E coli C

Plating efficiencies of bacteriophage λ (l phage) grown on E coli strains C K-12 and B

Phageλ EColi C plaque （＋） EColi K-12 plaque （－） EColi B plaque （－）

EcoliK-12 and B can resist phage λ

The DNA of phage which had been grown on strains K-12 and B were found to have chemically modified bases which were methylated

bull Additional studies with other strains indicate that different strains had specific methylated bases

EcoRI

vs

EcoRI Methylase

5rsquomdashGAAmTTCmdash3rsquo will not be cut by EcoRI3rsquomdashCTTAmAGmdash5rsquo

R-M for this strain

In addition to possessing a particular methylase individual bacterial strains also contained accompanying specific endonuclease activities

A characteristic feature of the sites of methylation was that they involved palindromic （回文） DNA sequences EcoR1 methylase specificity （ Rubin and Modrich 1977 ）

The REs cleaved at or near the methylation recognition site However they would not cleave at these specific palindromic sequences if the DNA was methylated

Methylation occurres at very specific sites in the DNA

Typical sites of methylation include the N6 position of adenine the N4 position or the C5 position of cytosine

Assignment1 what are the methylating sites for Guanine and Thymine

212 Nomenclature ( 命名）Since their discovery in the 1970s many different restriction enzymes have been identified in different bacteria Each enzyme is named after the bacterium from which it was isolated using a naming system based on bacterial genus（属） species（种） and strain（菌株）

eg EcoRI restriction enzyme was derived as follow

Abbreviation Meaning Description

E Escherichia genus

co coli species

R RY13 strain

I First identified order of identificationin the bacterium

bull Additional studies with other strains indicate that different strains had specific methylated bases

EcoRI

vs

EcoRI Methylase

5rsquomdashGAAmTTCmdash3rsquo will not be cut by EcoRI3rsquomdashCTTAmAGmdash5rsquo

R-M for this strain

In addition to possessing a particular methylase individual bacterial strains also contained accompanying specific endonuclease activities

A characteristic feature of the sites of methylation was that they involved palindromic （回文） DNA sequences EcoR1 methylase specificity （ Rubin and Modrich 1977 ）

The REs cleaved at or near the methylation recognition site However they would not cleave at these specific palindromic sequences if the DNA was methylated

Methylation occurres at very specific sites in the DNA

Typical sites of methylation include the N6 position of adenine the N4 position or the C5 position of cytosine

Assignment1 what are the methylating sites for Guanine and Thymine

212 Nomenclature ( 命名）Since their discovery in the 1970s many different restriction enzymes have been identified in different bacteria Each enzyme is named after the bacterium from which it was isolated using a naming system based on bacterial genus（属） species（种） and strain（菌株）

eg EcoRI restriction enzyme was derived as follow

Abbreviation Meaning Description

E Escherichia genus

co coli species

R RY13 strain

I First identified order of identificationin the bacterium

In addition to possessing a particular methylase individual bacterial strains also contained accompanying specific endonuclease activities

A characteristic feature of the sites of methylation was that they involved palindromic （回文） DNA sequences EcoR1 methylase specificity （ Rubin and Modrich 1977 ）

The REs cleaved at or near the methylation recognition site However they would not cleave at these specific palindromic sequences if the DNA was methylated

Methylation occurres at very specific sites in the DNA

Typical sites of methylation include the N6 position of adenine the N4 position or the C5 position of cytosine

Assignment1 what are the methylating sites for Guanine and Thymine

212 Nomenclature ( 命名）Since their discovery in the 1970s many different restriction enzymes have been identified in different bacteria Each enzyme is named after the bacterium from which it was isolated using a naming system based on bacterial genus（属） species（种） and strain（菌株）

eg EcoRI restriction enzyme was derived as follow

Abbreviation Meaning Description

E Escherichia genus

co coli species

R RY13 strain

I First identified order of identificationin the bacterium

Methylation occurres at very specific sites in the DNA

Typical sites of methylation include the N6 position of adenine the N4 position or the C5 position of cytosine

Assignment1 what are the methylating sites for Guanine and Thymine

212 Nomenclature ( 命名）Since their discovery in the 1970s many different restriction enzymes have been identified in different bacteria Each enzyme is named after the bacterium from which it was isolated using a naming system based on bacterial genus（属） species（种） and strain（菌株）

eg EcoRI restriction enzyme was derived as follow

Abbreviation Meaning Description

E Escherichia genus

co coli species

R RY13 strain

I First identified order of identificationin the bacterium

212 Nomenclature ( 命名）Since their discovery in the 1970s many different restriction enzymes have been identified in different bacteria Each enzyme is named after the bacterium from which it was isolated using a naming system based on bacterial genus（属） species（种） and strain（菌株）

eg EcoRI restriction enzyme was derived as follow

Abbreviation Meaning Description

E Escherichia genus

co coli species

R RY13 strain

I First identified order of identificationin the bacterium

Each restriction enzyme has specific recognition sequence

Enzymes with 6-bp Recognition sequence

Bgl II ldquobagel-twordquo Bacillus globigi 5rsquo-AGATCT-3rsquo 3rsquo-TCTAGA-5rsquo

Pst I ldquo P-S-T-onerdquo Providencia stuartii 5rsquo-CTGCAG-3rsquo 3rsquo-GACGTC-5rsquo

Enzyme with4-bp Recognition sequence

Hha I ldquoha-ha-onerdquo Haemphilus haemolyticus 5rsquo-GCGC-3rsquo 3rsquo-CGCG-5rsquo

Sau3A ldquosow-three-Ardquo Staphylococcus aureus 3A 5rsquo-GATC-3rsquo 3rsquo-CTAG-5rsquoEnzyme with 8-bp Recognition sequence

Not I ldquonot-onerdquo Nocardia 5rsquo-GCGGCCGC-3rsquo otitidis-caviarum 3rsquo-CGCCGGCG-5rsquo

213 Types of Restriction Enzymes

Restriction endonucleases are categorized into three general groups (Types I II and III) based on bull composition (protein subunits)

bull enzyme cofactor requirements (Mg2+ SAM ATP)

bull the nature of their target sequence

bull the position of their DNA cleavage site relative to thetarget sequence

bull Possess three subunits called HsdR HsdM and HsdS HsdR is required for restriction HsdM is necessary for adding methyl groups to host DNA HsdS is important for specificity of cut site recognition in addition to its methyl transferase activity

multifunctional enzymes multimers

bull Enzyme cofactors required for their activity S- Adenosyl methionine (AdoMet or SAM) hydrolyzed adenosine triphosphate (ATP) magnesium ions (Mg2+ )

Type I restriction enzymes

Me doner

Energy doner

Cleavage activity activator

213 Types of Restriction Enzymes

Restriction endonucleases are categorized into three general groups (Types I II and III) based on bull composition (protein subunits)

bull enzyme cofactor requirements (Mg2+ SAM ATP)

bull the nature of their target sequence

bull the position of their DNA cleavage site relative to thetarget sequence

bull Possess three subunits called HsdR HsdM and HsdS HsdR is required for restriction HsdM is necessary for adding methyl groups to host DNA HsdS is important for specificity of cut site recognition in addition to its methyl transferase activity

multifunctional enzymes multimers

bull Enzyme cofactors required for their activity S- Adenosyl methionine (AdoMet or SAM) hydrolyzed adenosine triphosphate (ATP) magnesium ions (Mg2+ )

Type I restriction enzymes

Me doner

Energy doner

Cleavage activity activator

bull Possess three subunits called HsdR HsdM and HsdS HsdR is required for restriction HsdM is necessary for adding methyl groups to host DNA HsdS is important for specificity of cut site recognition in addition to its methyl transferase activity

multifunctional enzymes multimers

bull Enzyme cofactors required for their activity S- Adenosyl methionine (AdoMet or SAM) hydrolyzed adenosine triphosphate (ATP) magnesium ions (Mg2+ )

Type I restriction enzymes

Me doner

Energy doner

Cleavage activity activator

Target sequence

The recognition site is asymmetrical and is composed of two portionsmdashone containing 3ndash4 nucleotides and another containing 4ndash5 nucleotidesmdashseparated by a spacer of about 6ndash8 nucleotides

eg EcoB

5rsquo-TGANNNNNNNNTGCT-3rsquo

Cleavage sitecut at a site that differs and is some distance (at least 1000 bp) away from their recognition site

Recognition site ne Cutting site

Contain more than one subunit

Double functions (cut and methylase)

Require Mg2+ AdoMet and ATP cofactors for their roles in DNA methylation and restriction respectively

Recognize two separate non-palindromic sequences that are inversely oriented （反向排列）

eg EcoP1 AGACC EcoP15 CAGCAG

Cut DNA about 20-30 base pairs out side the recognition site with unpredictable manner

Type III restriction enzymes

bull Dimers (consists of two identical subunits)

bull Usually require only Mg2+ as a cofactor for their enzyme activity

bull Restriction activity but no modification

bull Recognition sites are usually undivided and palindromic and 4ndash8 nucleotides in length

bull Each cuts in a predictable manner at a site within or adjacent to the recognition sequence

The most commonly available and used restriction enzymes

Type II restriction enzymes

Structure of EcoRI dimer

In the 1990s and early 2000s new enzymes from this family were discovered that did not follow all the classical criteria of this enzyme class and new subfamily nomenclature was developed to divide this large family into subcategories based on deviations from typical characteristics of type II enzymes These subgroups are defined using a letter suffixType IIB restriction enzymes (eg BcgI and BplI) are multimers containing more than one subunit They cleave DNA on both sides of their recognition to cut out the recognition site They require both AdoMet and Mg2+ cofactors Type IIE restriction endonucleases (eg NaeI) cleave DNA following interaction with two copies of their recognition sequence One recognition site acts as the target for cleavage while the other acts as an allosteric effector that speeds up or improves the efficiency of enzyme cleavage Similar to type IIE enzymes type IIF restriction endonucleases (eg NgoMIV) interact with two copies of their recognition sequence but cleave both sequences at the same timeType IIG restriction endonucleases (Eco57I) do have a single subunit like classical Type II restriction enzymes but require the cofactor AdoMet to be active Type IIM restriction endonucleases such as DpnI are able to recognize and cut methylated DNAType IIS restriction endonucleases (eg FokI) cleave DNA at a defined distance from their non-palindromic asymmetric recognition sites These enzymes may function as dimers Similarly Type IIT restriction enzymes (eg Bpu10I and BslI) are composed of two different subunits Some recognize palindromic sequences while others have asymmetric recognition sites

Contain more than one subunit

Double functions (cut and methylase)

Require Mg2+ AdoMet and ATP cofactors for their roles in DNA methylation and restriction respectively

Recognize two separate non-palindromic sequences that are inversely oriented （反向排列）

eg EcoP1 AGACC EcoP15 CAGCAG

Cut DNA about 20-30 base pairs out side the recognition site with unpredictable manner

Type III restriction enzymes

bull Dimers (consists of two identical subunits)

bull Usually require only Mg2+ as a cofactor for their enzyme activity

bull Restriction activity but no modification

bull Recognition sites are usually undivided and palindromic and 4ndash8 nucleotides in length

bull Each cuts in a predictable manner at a site within or adjacent to the recognition sequence

The most commonly available and used restriction enzymes

Type II restriction enzymes

Structure of EcoRI dimer

In the 1990s and early 2000s new enzymes from this family were discovered that did not follow all the classical criteria of this enzyme class and new subfamily nomenclature was developed to divide this large family into subcategories based on deviations from typical characteristics of type II enzymes These subgroups are defined using a letter suffixType IIB restriction enzymes (eg BcgI and BplI) are multimers containing more than one subunit They cleave DNA on both sides of their recognition to cut out the recognition site They require both AdoMet and Mg2+ cofactors Type IIE restriction endonucleases (eg NaeI) cleave DNA following interaction with two copies of their recognition sequence One recognition site acts as the target for cleavage while the other acts as an allosteric effector that speeds up or improves the efficiency of enzyme cleavage Similar to type IIE enzymes type IIF restriction endonucleases (eg NgoMIV) interact with two copies of their recognition sequence but cleave both sequences at the same timeType IIG restriction endonucleases (Eco57I) do have a single subunit like classical Type II restriction enzymes but require the cofactor AdoMet to be active Type IIM restriction endonucleases such as DpnI are able to recognize and cut methylated DNAType IIS restriction endonucleases (eg FokI) cleave DNA at a defined distance from their non-palindromic asymmetric recognition sites These enzymes may function as dimers Similarly Type IIT restriction enzymes (eg Bpu10I and BslI) are composed of two different subunits Some recognize palindromic sequences while others have asymmetric recognition sites

bull Dimers (consists of two identical subunits)

bull Usually require only Mg2+ as a cofactor for their enzyme activity

bull Restriction activity but no modification

bull Recognition sites are usually undivided and palindromic and 4ndash8 nucleotides in length

bull Each cuts in a predictable manner at a site within or adjacent to the recognition sequence

The most commonly available and used restriction enzymes

Type II restriction enzymes

Structure of EcoRI dimer

In the 1990s and early 2000s new enzymes from this family were discovered that did not follow all the classical criteria of this enzyme class and new subfamily nomenclature was developed to divide this large family into subcategories based on deviations from typical characteristics of type II enzymes These subgroups are defined using a letter suffixType IIB restriction enzymes (eg BcgI and BplI) are multimers containing more than one subunit They cleave DNA on both sides of their recognition to cut out the recognition site They require both AdoMet and Mg2+ cofactors Type IIE restriction endonucleases (eg NaeI) cleave DNA following interaction with two copies of their recognition sequence One recognition site acts as the target for cleavage while the other acts as an allosteric effector that speeds up or improves the efficiency of enzyme cleavage Similar to type IIE enzymes type IIF restriction endonucleases (eg NgoMIV) interact with two copies of their recognition sequence but cleave both sequences at the same timeType IIG restriction endonucleases (Eco57I) do have a single subunit like classical Type II restriction enzymes but require the cofactor AdoMet to be active Type IIM restriction endonucleases such as DpnI are able to recognize and cut methylated DNAType IIS restriction endonucleases (eg FokI) cleave DNA at a defined distance from their non-palindromic asymmetric recognition sites These enzymes may function as dimers Similarly Type IIT restriction enzymes (eg Bpu10I and BslI) are composed of two different subunits Some recognize palindromic sequences while others have asymmetric recognition sites

Structure of EcoRI dimer

In the 1990s and early 2000s new enzymes from this family were discovered that did not follow all the classical criteria of this enzyme class and new subfamily nomenclature was developed to divide this large family into subcategories based on deviations from typical characteristics of type II enzymes These subgroups are defined using a letter suffixType IIB restriction enzymes (eg BcgI and BplI) are multimers containing more than one subunit They cleave DNA on both sides of their recognition to cut out the recognition site They require both AdoMet and Mg2+ cofactors Type IIE restriction endonucleases (eg NaeI) cleave DNA following interaction with two copies of their recognition sequence One recognition site acts as the target for cleavage while the other acts as an allosteric effector that speeds up or improves the efficiency of enzyme cleavage Similar to type IIE enzymes type IIF restriction endonucleases (eg NgoMIV) interact with two copies of their recognition sequence but cleave both sequences at the same timeType IIG restriction endonucleases (Eco57I) do have a single subunit like classical Type II restriction enzymes but require the cofactor AdoMet to be active Type IIM restriction endonucleases such as DpnI are able to recognize and cut methylated DNAType IIS restriction endonucleases (eg FokI) cleave DNA at a defined distance from their non-palindromic asymmetric recognition sites These enzymes may function as dimers Similarly Type IIT restriction enzymes (eg Bpu10I and BslI) are composed of two different subunits Some recognize palindromic sequences while others have asymmetric recognition sites

In the 1990s and early 2000s new enzymes from this family were discovered that did not follow all the classical criteria of this enzyme class and new subfamily nomenclature was developed to divide this large family into subcategories based on deviations from typical characteristics of type II enzymes These subgroups are defined using a letter suffixType IIB restriction enzymes (eg BcgI and BplI) are multimers containing more than one subunit They cleave DNA on both sides of their recognition to cut out the recognition site They require both AdoMet and Mg2+ cofactors Type IIE restriction endonucleases (eg NaeI) cleave DNA following interaction with two copies of their recognition sequence One recognition site acts as the target for cleavage while the other acts as an allosteric effector that speeds up or improves the efficiency of enzyme cleavage Similar to type IIE enzymes type IIF restriction endonucleases (eg NgoMIV) interact with two copies of their recognition sequence but cleave both sequences at the same timeType IIG restriction endonucleases (Eco57I) do have a single subunit like classical Type II restriction enzymes but require the cofactor AdoMet to be active Type IIM restriction endonucleases such as DpnI are able to recognize and cut methylated DNAType IIS restriction endonucleases (eg FokI) cleave DNA at a defined distance from their non-palindromic asymmetric recognition sites These enzymes may function as dimers Similarly Type IIT restriction enzymes (eg Bpu10I and BslI) are composed of two different subunits Some recognize palindromic sequences while others have asymmetric recognition sites

Commonly used RE Recognition Sites

Occurring frequencies of recognition sites

Recg sites Sequence Frequency

A AGCT 14

AT A-AGCT G-AGCT

C-AGCT T-AGCT142

ATT 143

AATT 144

AAGTT 145

hellip hellip

nN 14n

EColi genome DNA 42 x 106 bp EcoRI frequency

42 x 106 x 146 = 42 (cut sites in whole genome DNA)

Examples

GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCACCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGTEco RIEco RI

GGCCTGCG AATTCCCGATCGAAGGCCCG AATTCTGGCCACCGGACGCTTAA GGGCTAGCTTCCGGGCTTAA GACCGGT

GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCACCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGTHae IIIHae III

GG CCTGCGAATTCCCGATCGAAGG CCCGAATTCTGG CCACC GGACGCTTAAGGGCTAGCTTCC GGGCTTAAGACC GGT

2 cuts with 3 fragments

3 cuts with 4 fragments

Two major ways for RE cleave

ldquoblunt endsrdquo Symmetrical cutting

ldquoSticky endsrdquo-I

5rsquo- overhanging sticky ends

3rsquoOH of the sticky end is very important for re-joining of DNA fragments

5rsquo-P required for phosphodiester bond formation

Asymmetrical cutting

Pst1Providencia stuartii

3rsquooverhanging sticky end

ldquoSticky endsrdquo-II

214 Factors Affecting Restriction Enzyme Digestion

DNA Purity Cross contamination Metylation dam(+) dcm(+) strains

GATC GAmTC CCWGG CCmWGG

BamHI GGATCC Temperature and time Buffer will give the optimum pH ionic strength Mg2+ Star activities a relaxation or alteration of the specificity o

f restriction enzyme mediated cleavage of DNA that can occur under reaction conditions that differ significantly from those optimum for the enzyme

Reaction volume and RE amount

W=Purine base

22 DNA ligase

DNA ligase is a special type of ligase which is basically an enzyme that in the cell repairs single-stranded discontinuities in double stranded DNA molecules ( strands that have double-strand break a break in both complementary strands of DNA)

Purified DNA ligase is used in gene cloning to join DNA molecules together The alternative a single-strand break is fixed by a different type of DNA ligase using the complementary strand as a template but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA

Okazaki fragment （冈崎片段）

Occurring frequencies of recognition sites

Recg sites Sequence Frequency

A AGCT 14

AT A-AGCT G-AGCT

C-AGCT T-AGCT142

ATT 143

AATT 144

AAGTT 145

hellip hellip

nN 14n

EColi genome DNA 42 x 106 bp EcoRI frequency

42 x 106 x 146 = 42 (cut sites in whole genome DNA)

Examples

GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCACCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGTEco RIEco RI

GGCCTGCG AATTCCCGATCGAAGGCCCG AATTCTGGCCACCGGACGCTTAA GGGCTAGCTTCCGGGCTTAA GACCGGT

GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCACCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGTHae IIIHae III

GG CCTGCGAATTCCCGATCGAAGG CCCGAATTCTGG CCACC GGACGCTTAAGGGCTAGCTTCC GGGCTTAAGACC GGT

2 cuts with 3 fragments

3 cuts with 4 fragments

Two major ways for RE cleave

ldquoblunt endsrdquo Symmetrical cutting

ldquoSticky endsrdquo-I

5rsquo- overhanging sticky ends

3rsquoOH of the sticky end is very important for re-joining of DNA fragments

5rsquo-P required for phosphodiester bond formation

Asymmetrical cutting

Pst1Providencia stuartii

3rsquooverhanging sticky end

ldquoSticky endsrdquo-II

214 Factors Affecting Restriction Enzyme Digestion

DNA Purity Cross contamination Metylation dam(+) dcm(+) strains

GATC GAmTC CCWGG CCmWGG

BamHI GGATCC Temperature and time Buffer will give the optimum pH ionic strength Mg2+ Star activities a relaxation or alteration of the specificity o

f restriction enzyme mediated cleavage of DNA that can occur under reaction conditions that differ significantly from those optimum for the enzyme

Reaction volume and RE amount

W=Purine base

22 DNA ligase

DNA ligase is a special type of ligase which is basically an enzyme that in the cell repairs single-stranded discontinuities in double stranded DNA molecules ( strands that have double-strand break a break in both complementary strands of DNA)

Purified DNA ligase is used in gene cloning to join DNA molecules together The alternative a single-strand break is fixed by a different type of DNA ligase using the complementary strand as a template but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA

Okazaki fragment （冈崎片段）

Examples

GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCACCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGTEco RIEco RI

GGCCTGCG AATTCCCGATCGAAGGCCCG AATTCTGGCCACCGGACGCTTAA GGGCTAGCTTCCGGGCTTAA GACCGGT

GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCACCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGTHae IIIHae III

GG CCTGCGAATTCCCGATCGAAGG CCCGAATTCTGG CCACC GGACGCTTAAGGGCTAGCTTCC GGGCTTAAGACC GGT

2 cuts with 3 fragments

3 cuts with 4 fragments

Two major ways for RE cleave

ldquoblunt endsrdquo Symmetrical cutting

ldquoSticky endsrdquo-I

5rsquo- overhanging sticky ends

3rsquoOH of the sticky end is very important for re-joining of DNA fragments

5rsquo-P required for phosphodiester bond formation

Asymmetrical cutting

Pst1Providencia stuartii

3rsquooverhanging sticky end

ldquoSticky endsrdquo-II

214 Factors Affecting Restriction Enzyme Digestion

DNA Purity Cross contamination Metylation dam(+) dcm(+) strains

GATC GAmTC CCWGG CCmWGG

BamHI GGATCC Temperature and time Buffer will give the optimum pH ionic strength Mg2+ Star activities a relaxation or alteration of the specificity o

f restriction enzyme mediated cleavage of DNA that can occur under reaction conditions that differ significantly from those optimum for the enzyme

Reaction volume and RE amount

W=Purine base

22 DNA ligase

DNA ligase is a special type of ligase which is basically an enzyme that in the cell repairs single-stranded discontinuities in double stranded DNA molecules ( strands that have double-strand break a break in both complementary strands of DNA)

Purified DNA ligase is used in gene cloning to join DNA molecules together The alternative a single-strand break is fixed by a different type of DNA ligase using the complementary strand as a template but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA

Okazaki fragment （冈崎片段）

Two major ways for RE cleave

ldquoblunt endsrdquo Symmetrical cutting

ldquoSticky endsrdquo-I

5rsquo- overhanging sticky ends

3rsquoOH of the sticky end is very important for re-joining of DNA fragments

5rsquo-P required for phosphodiester bond formation

Asymmetrical cutting

Pst1Providencia stuartii

3rsquooverhanging sticky end

ldquoSticky endsrdquo-II

214 Factors Affecting Restriction Enzyme Digestion

DNA Purity Cross contamination Metylation dam(+) dcm(+) strains

GATC GAmTC CCWGG CCmWGG

BamHI GGATCC Temperature and time Buffer will give the optimum pH ionic strength Mg2+ Star activities a relaxation or alteration of the specificity o

f restriction enzyme mediated cleavage of DNA that can occur under reaction conditions that differ significantly from those optimum for the enzyme

Reaction volume and RE amount

W=Purine base

22 DNA ligase

DNA ligase is a special type of ligase which is basically an enzyme that in the cell repairs single-stranded discontinuities in double stranded DNA molecules ( strands that have double-strand break a break in both complementary strands of DNA)

Purified DNA ligase is used in gene cloning to join DNA molecules together The alternative a single-strand break is fixed by a different type of DNA ligase using the complementary strand as a template but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA

Okazaki fragment （冈崎片段）

ldquoSticky endsrdquo-I

5rsquo- overhanging sticky ends

3rsquoOH of the sticky end is very important for re-joining of DNA fragments

5rsquo-P required for phosphodiester bond formation

Asymmetrical cutting

Pst1Providencia stuartii

3rsquooverhanging sticky end

ldquoSticky endsrdquo-II

214 Factors Affecting Restriction Enzyme Digestion

DNA Purity Cross contamination Metylation dam(+) dcm(+) strains

GATC GAmTC CCWGG CCmWGG

BamHI GGATCC Temperature and time Buffer will give the optimum pH ionic strength Mg2+ Star activities a relaxation or alteration of the specificity o

f restriction enzyme mediated cleavage of DNA that can occur under reaction conditions that differ significantly from those optimum for the enzyme

Reaction volume and RE amount

W=Purine base

22 DNA ligase

DNA ligase is a special type of ligase which is basically an enzyme that in the cell repairs single-stranded discontinuities in double stranded DNA molecules ( strands that have double-strand break a break in both complementary strands of DNA)

Purified DNA ligase is used in gene cloning to join DNA molecules together The alternative a single-strand break is fixed by a different type of DNA ligase using the complementary strand as a template but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA

Okazaki fragment （冈崎片段）

Pst1Providencia stuartii

3rsquooverhanging sticky end

ldquoSticky endsrdquo-II

214 Factors Affecting Restriction Enzyme Digestion

DNA Purity Cross contamination Metylation dam(+) dcm(+) strains

GATC GAmTC CCWGG CCmWGG

BamHI GGATCC Temperature and time Buffer will give the optimum pH ionic strength Mg2+ Star activities a relaxation or alteration of the specificity o

f restriction enzyme mediated cleavage of DNA that can occur under reaction conditions that differ significantly from those optimum for the enzyme

Reaction volume and RE amount

W=Purine base

22 DNA ligase

DNA ligase is a special type of ligase which is basically an enzyme that in the cell repairs single-stranded discontinuities in double stranded DNA molecules ( strands that have double-strand break a break in both complementary strands of DNA)

Purified DNA ligase is used in gene cloning to join DNA molecules together The alternative a single-strand break is fixed by a different type of DNA ligase using the complementary strand as a template but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA

Okazaki fragment （冈崎片段）

214 Factors Affecting Restriction Enzyme Digestion

DNA Purity Cross contamination Metylation dam(+) dcm(+) strains

GATC GAmTC CCWGG CCmWGG

BamHI GGATCC Temperature and time Buffer will give the optimum pH ionic strength Mg2+ Star activities a relaxation or alteration of the specificity o

f restriction enzyme mediated cleavage of DNA that can occur under reaction conditions that differ significantly from those optimum for the enzyme

Reaction volume and RE amount

W=Purine base

22 DNA ligase

DNA ligase is a special type of ligase which is basically an enzyme that in the cell repairs single-stranded discontinuities in double stranded DNA molecules ( strands that have double-strand break a break in both complementary strands of DNA)

Purified DNA ligase is used in gene cloning to join DNA molecules together The alternative a single-strand break is fixed by a different type of DNA ligase using the complementary strand as a template but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA

Okazaki fragment （冈崎片段）

22 DNA ligase

DNA ligase is a special type of ligase which is basically an enzyme that in the cell repairs single-stranded discontinuities in double stranded DNA molecules ( strands that have double-strand break a break in both complementary strands of DNA)

Purified DNA ligase is used in gene cloning to join DNA molecules together The alternative a single-strand break is fixed by a different type of DNA ligase using the complementary strand as a template but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA

Okazaki fragment （冈崎片段）

Ligase mechanism

The mechanism of DNA ligase is to form two covalent phosphodiester bonds between 3 hydroxyl ends of one nucleotide with the 5 phosphate end of another

nick lack P-diester bound gap nucleotide missing

5rsquo

5rsquo3rsquo

3rsquo

5rsquo

5rsquo

缺刻 缺口

Energy-dependent joining of the chains Activated by NAD+ or ATP hydrolysis

E coli DNA lygase NAD NMN+ + AMP

T4 DNA lygase ATP AMP + PPi

AMP -attaches to lysine group on enzyme AMP transferred to 5rsquo phosphate at ligation site 3rsquo OH at ligation site splits out AMP and joins to 5rsquo ph

osphate

Ligation needs

Ligase Mechanism

NH2-Lysine-

N

CONH2

O

OH

CH2OO-P-O-P-

OO

OOO CH2

N

N

N

N

NH2

OHHO HO

+

O-P-

O

OO CH2

N

N

N

N

NH2

OHHO

NH2-Lysine-

Activated Phosphorylatingcomplex

NAD+

NMN+

High EnergyNitrogen PhosphateBond

High EnergyNitrogen PhosphateBond

AMP-Lys-ligase complex

O-P-

O

OO CH2

N

N

N

N

NH2

OHHO

NH2-Lysine-

PO

O

O

OOH

NH2-Lysine-

PO

O

O

OOH

O-P-O

OO

CH2

N

N N

NNH2

OH

HO

OO

OO

P

+ AMP

The formation of phosphodiester bound

ATP is required for the ligase reaction

One vital and often tricky aspect to performing successful recombination experiments involving the ligation of cohesive-ended fragments is controlling the optimal temperature

Most experiments use T4 DNA Ligase (isolated from bacteriophage T4) which is most active at 25degC However in order to perform successful ligations with cohesive-ended fragments the optimal enzyme temperature needs to be balanced with the melting temperature Tm (also the annealing temperature) of the DNA fragments being ligated

In general 14-16 degC over night (on)

Thinking Why the temperature is the critical factor affecting ligation

If the ambient （周围） temperature exceeds Tm homologous pairing of the sticky ends will not occur because the high temperature disrupts hydrogen bonding

Since blunt-ended DNA fragments have no cohesive ends to anneal controlling the optimal temperature becomes much less important The most efficient ligation temperature will be the temperature at which T4 DNA ligase functions optimally Therefore the majority of blunt-ended ligations are carried out at 20-25degC

Joining of stick ends and blunt ends

Use of linkers

an adaptor containing sticky end with 5rsquo-OH modified terminus to avoid self ligation

Use of adaptors when the restriction enzyme can also cut the DNA fragment using an adaptor to join DNA fragments may considered

Produce sticky ends by homopolyer tailling

use of terminal deoxylnucleotidyl transferase

Add a series of poly nucleotides onto the 3rsquo-terminal of a dsDNA

Only need to add one dNTP into the test tube when conduct the polymerase catalyzing reaction

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

Ligase Mechanism

NH2-Lysine-

N

CONH2

O

OH

CH2OO-P-O-P-

OO

OOO CH2

N

N

N

N

NH2

OHHO HO

+

O-P-

O

OO CH2

N

N

N

N

NH2

OHHO

NH2-Lysine-

Activated Phosphorylatingcomplex

NAD+

NMN+

High EnergyNitrogen PhosphateBond

High EnergyNitrogen PhosphateBond

AMP-Lys-ligase complex

O-P-

O

OO CH2

N

N

N

N

NH2

OHHO

NH2-Lysine-

PO

O

O

OOH

NH2-Lysine-

PO

O

O

OOH

O-P-O

OO

CH2

N

N N

NNH2

OH

HO

OO

OO

P

+ AMP

The formation of phosphodiester bound

ATP is required for the ligase reaction

One vital and often tricky aspect to performing successful recombination experiments involving the ligation of cohesive-ended fragments is controlling the optimal temperature

Most experiments use T4 DNA Ligase (isolated from bacteriophage T4) which is most active at 25degC However in order to perform successful ligations with cohesive-ended fragments the optimal enzyme temperature needs to be balanced with the melting temperature Tm (also the annealing temperature) of the DNA fragments being ligated

In general 14-16 degC over night (on)

Thinking Why the temperature is the critical factor affecting ligation

If the ambient （周围） temperature exceeds Tm homologous pairing of the sticky ends will not occur because the high temperature disrupts hydrogen bonding

Since blunt-ended DNA fragments have no cohesive ends to anneal controlling the optimal temperature becomes much less important The most efficient ligation temperature will be the temperature at which T4 DNA ligase functions optimally Therefore the majority of blunt-ended ligations are carried out at 20-25degC

Joining of stick ends and blunt ends

Use of linkers

an adaptor containing sticky end with 5rsquo-OH modified terminus to avoid self ligation

Use of adaptors when the restriction enzyme can also cut the DNA fragment using an adaptor to join DNA fragments may considered

Produce sticky ends by homopolyer tailling

use of terminal deoxylnucleotidyl transferase

Add a series of poly nucleotides onto the 3rsquo-terminal of a dsDNA

Only need to add one dNTP into the test tube when conduct the polymerase catalyzing reaction

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

O-P-

O

OO CH2

N

N

N

N

NH2

OHHO

NH2-Lysine-

PO

O

O

OOH

NH2-Lysine-

PO

O

O

OOH

O-P-O

OO

CH2

N

N N

NNH2

OH

HO

OO

OO

P

+ AMP

The formation of phosphodiester bound

ATP is required for the ligase reaction

One vital and often tricky aspect to performing successful recombination experiments involving the ligation of cohesive-ended fragments is controlling the optimal temperature

Most experiments use T4 DNA Ligase (isolated from bacteriophage T4) which is most active at 25degC However in order to perform successful ligations with cohesive-ended fragments the optimal enzyme temperature needs to be balanced with the melting temperature Tm (also the annealing temperature) of the DNA fragments being ligated

In general 14-16 degC over night (on)

Thinking Why the temperature is the critical factor affecting ligation

If the ambient （周围） temperature exceeds Tm homologous pairing of the sticky ends will not occur because the high temperature disrupts hydrogen bonding

Since blunt-ended DNA fragments have no cohesive ends to anneal controlling the optimal temperature becomes much less important The most efficient ligation temperature will be the temperature at which T4 DNA ligase functions optimally Therefore the majority of blunt-ended ligations are carried out at 20-25degC

Joining of stick ends and blunt ends

Use of linkers

an adaptor containing sticky end with 5rsquo-OH modified terminus to avoid self ligation

Use of adaptors when the restriction enzyme can also cut the DNA fragment using an adaptor to join DNA fragments may considered

Produce sticky ends by homopolyer tailling

use of terminal deoxylnucleotidyl transferase

Add a series of poly nucleotides onto the 3rsquo-terminal of a dsDNA

Only need to add one dNTP into the test tube when conduct the polymerase catalyzing reaction

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

NH2-Lysine-

PO

O

O

OOH

O-P-O

OO

CH2

N

N N

NNH2

OH

HO

OO

OO

P

+ AMP

The formation of phosphodiester bound

ATP is required for the ligase reaction

One vital and often tricky aspect to performing successful recombination experiments involving the ligation of cohesive-ended fragments is controlling the optimal temperature

Most experiments use T4 DNA Ligase (isolated from bacteriophage T4) which is most active at 25degC However in order to perform successful ligations with cohesive-ended fragments the optimal enzyme temperature needs to be balanced with the melting temperature Tm (also the annealing temperature) of the DNA fragments being ligated

In general 14-16 degC over night (on)

Thinking Why the temperature is the critical factor affecting ligation

If the ambient （周围） temperature exceeds Tm homologous pairing of the sticky ends will not occur because the high temperature disrupts hydrogen bonding

Since blunt-ended DNA fragments have no cohesive ends to anneal controlling the optimal temperature becomes much less important The most efficient ligation temperature will be the temperature at which T4 DNA ligase functions optimally Therefore the majority of blunt-ended ligations are carried out at 20-25degC

Joining of stick ends and blunt ends

Use of linkers

an adaptor containing sticky end with 5rsquo-OH modified terminus to avoid self ligation

Use of adaptors when the restriction enzyme can also cut the DNA fragment using an adaptor to join DNA fragments may considered

Produce sticky ends by homopolyer tailling

use of terminal deoxylnucleotidyl transferase

Add a series of poly nucleotides onto the 3rsquo-terminal of a dsDNA

Only need to add one dNTP into the test tube when conduct the polymerase catalyzing reaction

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

The formation of phosphodiester bound

ATP is required for the ligase reaction

One vital and often tricky aspect to performing successful recombination experiments involving the ligation of cohesive-ended fragments is controlling the optimal temperature

Most experiments use T4 DNA Ligase (isolated from bacteriophage T4) which is most active at 25degC However in order to perform successful ligations with cohesive-ended fragments the optimal enzyme temperature needs to be balanced with the melting temperature Tm (also the annealing temperature) of the DNA fragments being ligated

In general 14-16 degC over night (on)

Thinking Why the temperature is the critical factor affecting ligation

If the ambient （周围） temperature exceeds Tm homologous pairing of the sticky ends will not occur because the high temperature disrupts hydrogen bonding

Since blunt-ended DNA fragments have no cohesive ends to anneal controlling the optimal temperature becomes much less important The most efficient ligation temperature will be the temperature at which T4 DNA ligase functions optimally Therefore the majority of blunt-ended ligations are carried out at 20-25degC

Joining of stick ends and blunt ends

Use of linkers

an adaptor containing sticky end with 5rsquo-OH modified terminus to avoid self ligation

Use of adaptors when the restriction enzyme can also cut the DNA fragment using an adaptor to join DNA fragments may considered

Produce sticky ends by homopolyer tailling

use of terminal deoxylnucleotidyl transferase

Add a series of poly nucleotides onto the 3rsquo-terminal of a dsDNA

Only need to add one dNTP into the test tube when conduct the polymerase catalyzing reaction

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

One vital and often tricky aspect to performing successful recombination experiments involving the ligation of cohesive-ended fragments is controlling the optimal temperature

Most experiments use T4 DNA Ligase (isolated from bacteriophage T4) which is most active at 25degC However in order to perform successful ligations with cohesive-ended fragments the optimal enzyme temperature needs to be balanced with the melting temperature Tm (also the annealing temperature) of the DNA fragments being ligated

In general 14-16 degC over night (on)

Thinking Why the temperature is the critical factor affecting ligation

If the ambient （周围） temperature exceeds Tm homologous pairing of the sticky ends will not occur because the high temperature disrupts hydrogen bonding

Since blunt-ended DNA fragments have no cohesive ends to anneal controlling the optimal temperature becomes much less important The most efficient ligation temperature will be the temperature at which T4 DNA ligase functions optimally Therefore the majority of blunt-ended ligations are carried out at 20-25degC

Joining of stick ends and blunt ends

Use of linkers

an adaptor containing sticky end with 5rsquo-OH modified terminus to avoid self ligation

Use of adaptors when the restriction enzyme can also cut the DNA fragment using an adaptor to join DNA fragments may considered

Produce sticky ends by homopolyer tailling

use of terminal deoxylnucleotidyl transferase

Add a series of poly nucleotides onto the 3rsquo-terminal of a dsDNA

Only need to add one dNTP into the test tube when conduct the polymerase catalyzing reaction

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

If the ambient （周围） temperature exceeds Tm homologous pairing of the sticky ends will not occur because the high temperature disrupts hydrogen bonding

Since blunt-ended DNA fragments have no cohesive ends to anneal controlling the optimal temperature becomes much less important The most efficient ligation temperature will be the temperature at which T4 DNA ligase functions optimally Therefore the majority of blunt-ended ligations are carried out at 20-25degC

Joining of stick ends and blunt ends

Use of linkers

an adaptor containing sticky end with 5rsquo-OH modified terminus to avoid self ligation

Use of adaptors when the restriction enzyme can also cut the DNA fragment using an adaptor to join DNA fragments may considered

Produce sticky ends by homopolyer tailling

use of terminal deoxylnucleotidyl transferase

Add a series of poly nucleotides onto the 3rsquo-terminal of a dsDNA

Only need to add one dNTP into the test tube when conduct the polymerase catalyzing reaction

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

Joining of stick ends and blunt ends

Use of linkers

an adaptor containing sticky end with 5rsquo-OH modified terminus to avoid self ligation

Use of adaptors when the restriction enzyme can also cut the DNA fragment using an adaptor to join DNA fragments may considered

Produce sticky ends by homopolyer tailling

use of terminal deoxylnucleotidyl transferase

Add a series of poly nucleotides onto the 3rsquo-terminal of a dsDNA

Only need to add one dNTP into the test tube when conduct the polymerase catalyzing reaction

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

an adaptor containing sticky end with 5rsquo-OH modified terminus to avoid self ligation

Use of adaptors when the restriction enzyme can also cut the DNA fragment using an adaptor to join DNA fragments may considered

Produce sticky ends by homopolyer tailling

use of terminal deoxylnucleotidyl transferase

Add a series of poly nucleotides onto the 3rsquo-terminal of a dsDNA

Only need to add one dNTP into the test tube when conduct the polymerase catalyzing reaction

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

Produce sticky ends by homopolyer tailling

use of terminal deoxylnucleotidyl transferase

Add a series of poly nucleotides onto the 3rsquo-terminal of a dsDNA

Only need to add one dNTP into the test tube when conduct the polymerase catalyzing reaction

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

Topoisomerase mediated TA cloning

bull Topoisomerase I from vaccinia virus binds dsDNA at specific sequence and cleave it after the 5rsquo-CCCTT in one strand

bull The energy from the broken bond is conserved by formation of a covalent bond between the 3rsquo- phosphate of the cleavaged DNA strand and the 274 tyrosine residue of topoisomerase I

bull The phospho-tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5rsquo hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase (Shuman 1991-1994)

Topoisomerase is both a restriction enzyme and ligase naturally involving in DNA replication

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

Taq polymerase has a nontemplate-dependent terminal transferase activity that adds a single A to the 3rsquo-ends of PCR products

Linearized vector DNA with overhanging 3rsquo-T and covalently bound to the topoisomerase I

PCR products inserts to ligate efficiently with the vector

RT 5 minVol 6 ul

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

PCR products inserts to ligate efficiently with the vector

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

topoisomerase originally termed gyrase was first discovered by Taiwanese Harvard Professor James C Wang[

The double-helical configuration that DNA strands naturally reside in makes them difficult to separate and yet they must be separated by helicase proteins if other enzymes are to transcribe the sequences that encode proteins or if chromosomes are to be replicated In so-called circular DNA in which double helical DNA is bent around and joined in a circle the two strands are topologically linked or knotted Otherwise identical loops of DNA having different numbers of twists are topoisomers and cannot be interconverted by any process that does not involve the breaking of DNA strands Topoisomerases catalyze and guide the unknotting of DNA by creating transient breaks in the DNA using a conserved Tyrosine as the catalytic residue

bullType II topoisomerase cuts both strands of one DNA double helix passes another unbroken DNA helix through it and then reanneals the cut strand It is also split into two subclasses type IIA and type IIB topoisomerases which share similar structure and mechanisms Examples of type IIA topoisomerases include eukaryotic topo II E coli gyrase and E coli topo IV Examples of type IIB topoisomerase include topo VI

Type I topoisomerase cuts one strand of a DNA double helix relaxation occurs and then the cut strand is reannealed

23 DNA polymerase

DNA polymerase an enzyme that catalyzes the polymerization of deoxyribonucleotides into a DNA strand alone the template DNA strand

DNA polymerases are best-known for their role in DNA replication in which the polymerase reads an intact DNA strand as a template and uses it to synthesize the new strand The newly-polymerized molecule is complementary to the template strand and identical to the templates original partner strand

DNA polymerases use a magnesium ion for catalytic activity

231 DNA polymerase I and Klenow fragment

Structure single peptide with different domains

Functions

5rsquo3 Polymerase activity 3rsquo5 exonuclease (proofreading) 5rsquo3 exonuclease activity (RNA Primer remove)

Reaction condition for noncell system

4 dNTPs (substrates) Mg2+

Peimers with 3rsquo-OH (no known DNA polimerase is able to begin a new chain)

DNA template template reading 3rsquo 5rsquo new chain extension 5rsquo3rsquo

The Klenow fragment is a large protein fragment produced when DNA pol I from E coli is enzymatically cleaved by the protease subtilisin

Because the 5 rarr 3 exonuclease activity of DNA pol I makes it unsuitable for many applications the Klenow fragment which lacks this activity can be very useful in research

The Klenow fragment is extremely useful for research-based tasks such as

bull Synthesis of double-stranded DNA from ssDNA templates bull Filling in (meaning removal of overhangs to create blunt ends) recessed 3 ends of DNA fragments bull Digesting away protruding （凸出的） 3 overhangs bull Preparation of radioactive DNA probes

Reaction condition for noncell system

4 dNTPs (substrates) Mg2+

Peimers with 3rsquo-OH (no known DNA polimerase is able to begin a new chain)

DNA template template reading 3rsquo 5rsquo new chain extension 5rsquo3rsquo

The Klenow fragment is a large protein fragment produced when DNA pol I from E coli is enzymatically cleaved by the protease subtilisin

Because the 5 rarr 3 exonuclease activity of DNA pol I makes it unsuitable for many applications the Klenow fragment which lacks this activity can be very useful in research

The Klenow fragment is extremely useful for research-based tasks such as

bull Synthesis of double-stranded DNA from ssDNA templates bull Filling in (meaning removal of overhangs to create blunt ends) recessed 3 ends of DNA fragments bull Digesting away protruding （凸出的） 3 overhangs bull Preparation of radioactive DNA probes

The Klenow fragment is a large protein fragment produced when DNA pol I from E coli is enzymatically cleaved by the protease subtilisin

Because the 5 rarr 3 exonuclease activity of DNA pol I makes it unsuitable for many applications the Klenow fragment which lacks this activity can be very useful in research

The Klenow fragment is extremely useful for research-based tasks such as

bull Synthesis of double-stranded DNA from ssDNA templates bull Filling in (meaning removal of overhangs to create blunt ends) recessed 3 ends of DNA fragments bull Digesting away protruding （凸出的） 3 overhangs bull Preparation of radioactive DNA probes

Because the 5 rarr 3 exonuclease activity of DNA pol I makes it unsuitable for many applications the Klenow fragment which lacks this activity can be very useful in research

The Klenow fragment is extremely useful for research-based tasks such as

bull Synthesis of double-stranded DNA from ssDNA templates bull Filling in (meaning removal of overhangs to create blunt ends) recessed 3 ends of DNA fragments bull Digesting away protruding （凸出的） 3 overhangs bull Preparation of radioactive DNA probes

232 T4 and T7 DNA polymerase

Function Similar to Klenow fagment 　

Template dependent Ｄ NA 　polymerase3rsquo-5rsquo cleavage (exonuclease)

Characteristics In general T4 DNA polymerase is used for the same types of reactions as Klenow fragment particularly in blunting the ends of DNA with 5 or 3 overhangs

Source Bacterophageies of Ecoli

T4 DNA polymerase

two differences between the two enzymes that have practical signficance

The 3 -gt 5 exonuclease activity of T4 DNA polymerase is roughly 200 times that of Klenow fragment making it preferred by many investigators for blunting DNAs with 3 overhangs

While Klenow fragment will displace （ shift ） downstream oligonucleotides as it polymerizes T4 DNA polymerase will not This attribute makes T4 DNA polymerase the more efficient choice for certain types of oligonucleotide mutagenesis reactions

two differences between the two enzymes that have practical signficance

The 3 -gt 5 exonuclease activity of T4 DNA polymerase is roughly 200 times that of Klenow fragment making it preferred by many investigators for blunting DNAs with 3 overhangs

While Klenow fragment will displace （ shift ） downstream oligonucleotides as it polymerizes T4 DNA polymerase will not This attribute makes T4 DNA polymerase the more efficient choice for certain types of oligonucleotide mutagenesis reactions

T7 DNA polymerase

a DNA-dependent DNA polymerase responsible for the fast rate of T7 phage DNA replication in vivo

the 3 -gt 5 are approximately 1000-fold greater than that of Klenow fragment

The polymerase consists of a 11 complex of the viral T7 gene 5 protein (80kDA) and the E coli thioredoxin (12kDA)

high fidelity and strand displacement synthesis prevention

This polymerase is unique due to its considerable processivity or ability to stay on DNA for a greater than average number of base pairs This makes it particularly useful for recombinant protein expression systems

Using the T7 promoter and T7 polymerase strongly drive the inserted gene of interest without inducing host protein overexpression

It is also suitable for site-directed mutagenesis

233 Taq DNA polymerasea thermostable DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D Brock in 1965

Taqs optimum temperature for activity is 75-80 with a half life of 9 minutes at 975 and can replicate a 1000 base pair strand of DNA in less than 10 seconds at 72

One of Taqlsquos drawbacks （弊端） is its relatively low replication fidelity It lacks a 3- 5lsquo exonuclease proofreading activity and has an error rate measured at about 1 in 9000 nucleotides

This polymerase is unique due to its considerable processivity or ability to stay on DNA for a greater than average number of base pairs This makes it particularly useful for recombinant protein expression systems

Using the T7 promoter and T7 polymerase strongly drive the inserted gene of interest without inducing host protein overexpression

It is also suitable for site-directed mutagenesis

233 Taq DNA polymerasea thermostable DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D Brock in 1965

Taqs optimum temperature for activity is 75-80 with a half life of 9 minutes at 975 and can replicate a 1000 base pair strand of DNA in less than 10 seconds at 72

One of Taqlsquos drawbacks （弊端） is its relatively low replication fidelity It lacks a 3- 5lsquo exonuclease proofreading activity and has an error rate measured at about 1 in 9000 nucleotides

233 Taq DNA polymerasea thermostable DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D Brock in 1965

Taqs optimum temperature for activity is 75-80 with a half life of 9 minutes at 975 and can replicate a 1000 base pair strand of DNA in less than 10 seconds at 72

One of Taqlsquos drawbacks （弊端） is its relatively low replication fidelity It lacks a 3- 5lsquo exonuclease proofreading activity and has an error rate measured at about 1 in 9000 nucleotides

Some thermostable DNA polymerases have been isolated from other thermophilic bacteria and archaea such as Pfu DNA polymerase possessing a proofreading activity and are being used instead of (or in combination with) Taq for high-fidelity （高保真） amplification

Taq makes DNA products that have A (adenine) overhangs at their 3 ends This may be useful in TA cloning

Pfu makes blunt PCR fragments

Put these two enzymes together

A reverse transcriptase also known as RNA-dependent DNA polymerase is a DNA polymerase enzyme that transcribes single-stranded RNA into complimentary DNA (cDNA) It also helps in the formation of a double helix DNA once the RNA has been reverse transcribed into a single strand cDNA

Reverse transcriptase was discovered by Howard Temin at the University of WisconsinndashMadison and independently by David Baltimore in 1970 at MIT The two shared the 1975 Nobel Prize in Physiology or Medicine with Renato Dulbecco for their discovery

234 Reverse Transcriptase

Functions

RNA-dependent DNA ploymerase

RNase H activity removing RNA from the RNA-DNA hybrids

DNA polymerase activity

RNA retroviruseseg HIV breast cancer

The process of reverse transcription is extremely error-prone ( 易于出错 ) and it is during this step that mutations may occur

Host cell can use its DNA polymerase to synthesis the second strand DNA and displace the RNA from the cDNA

HIV-1 reverse transcriptase from human immunodeficiency virus type 1 (PDB 1HMV)

M-MLV reverse transcriptase from the Moloney murine leukemia virus ( 鼠白血病病毒 )

AMV reverse transcriptase from the avian myeloblastosis virus ( 禽成髓细胞瘤病毒 )

Telomerase reverse transcriptase that maintains the telomeres of eukaryotic chromosomes

Well studied transcriptases

The highlighted two are well commercialized and routinely used in molecular cloning

Applications

As HIV uses reverse transcriptase to copy its genetic material and generate new viruses (part of a retrovirus proliferation circle) specific drugs have been designed to disrupt the process and thereby suppress its growth Collectively these drugs are known as reverse transcriptase inhibitors and include the nucleoside and nucleotide analogues( 类似物 ) zidovudine (trade name Retrovir) lamivudine (Epivir) and tenofovir (Viread) as well as non-nucleoside inhibitors such as nevirapine (Viramune)

Target of antivirus drugs

RNA retroviruseseg HIV breast cancer

The process of reverse transcription is extremely error-prone ( 易于出错 ) and it is during this step that mutations may occur

Host cell can use its DNA polymerase to synthesis the second strand DNA and displace the RNA from the cDNA

HIV-1 reverse transcriptase from human immunodeficiency virus type 1 (PDB 1HMV)

M-MLV reverse transcriptase from the Moloney murine leukemia virus ( 鼠白血病病毒 )

AMV reverse transcriptase from the avian myeloblastosis virus ( 禽成髓细胞瘤病毒 )

Telomerase reverse transcriptase that maintains the telomeres of eukaryotic chromosomes

Well studied transcriptases

The highlighted two are well commercialized and routinely used in molecular cloning

Applications

As HIV uses reverse transcriptase to copy its genetic material and generate new viruses (part of a retrovirus proliferation circle) specific drugs have been designed to disrupt the process and thereby suppress its growth Collectively these drugs are known as reverse transcriptase inhibitors and include the nucleoside and nucleotide analogues( 类似物 ) zidovudine (trade name Retrovir) lamivudine (Epivir) and tenofovir (Viread) as well as non-nucleoside inhibitors such as nevirapine (Viramune)

Target of antivirus drugs

HIV-1 reverse transcriptase from human immunodeficiency virus type 1 (PDB 1HMV)

M-MLV reverse transcriptase from the Moloney murine leukemia virus ( 鼠白血病病毒 )

AMV reverse transcriptase from the avian myeloblastosis virus ( 禽成髓细胞瘤病毒 )

Telomerase reverse transcriptase that maintains the telomeres of eukaryotic chromosomes

Well studied transcriptases

The highlighted two are well commercialized and routinely used in molecular cloning

Applications

As HIV uses reverse transcriptase to copy its genetic material and generate new viruses (part of a retrovirus proliferation circle) specific drugs have been designed to disrupt the process and thereby suppress its growth Collectively these drugs are known as reverse transcriptase inhibitors and include the nucleoside and nucleotide analogues( 类似物 ) zidovudine (trade name Retrovir) lamivudine (Epivir) and tenofovir (Viread) as well as non-nucleoside inhibitors such as nevirapine (Viramune)

Target of antivirus drugs

Applications

As HIV uses reverse transcriptase to copy its genetic material and generate new viruses (part of a retrovirus proliferation circle) specific drugs have been designed to disrupt the process and thereby suppress its growth Collectively these drugs are known as reverse transcriptase inhibitors and include the nucleoside and nucleotide analogues( 类似物 ) zidovudine (trade name Retrovir) lamivudine (Epivir) and tenofovir (Viread) as well as non-nucleoside inhibitors such as nevirapine (Viramune)

Target of antivirus drugs

Reverse transcriptase is commonly used in research to apply the polymerase chain reaction technique to RNA in a technique called reverse transcription polymerase chain reaction (RT-PCR) as well as real-time PCR

Reverse transcriptase is used also to create cDNA libraries from mRNA The commercial availability of reverse transcriptase greatly improved knowledge in the area of molecular biology as along with other enzymes it allowed scientists to clone sequence and characterize DNA

24 Other Enzymes241 Alkaline phosphatase (ALP ALKP)

Ribbon diagram (N-terminus = blue C-terminus = red) of the dimeric structure of bacterial alkaline phosphatase

A hydrolase enzyme responsible for removing phosphate groups from many types of molecules including nucleotides (DNA RNA) proteins and alkaloids The process of removing the phosphate group is called dephosphorylation

Alkaline phosphatases are most effective in an alkaline environment It is sometimes used synonymously as basic phosphatase

BAP isolated from bacteria In bacteria alkaline phosphatase is located in the periplasmic space external to the cell membrane BAP is comparatively resistant to inactivation denaturation and degradation and also has a higher rate of activity The optimal pH for the activity of the E coli enzyme is 80

CIP derived from Calf Intestinal Alkaline Phosphatase the bovine enzyme optimum pH is slightly higher at 85

PO

O

O

OOH

O-P-O

OO

CH2

N

N N

NNH2

OH

HO

OO

OO

P

+ AMP

OH

GAATTCCTTAAG

5rsquo-p

AA

TT

C

OH

HO

PP

EcoRI

EcoRI

5rsquo-pAATTC

5rsquoP P 5rsquo

OH

OH

HO

OH

P

OH

P

OH

bull A useful tool to remove 5rsquo- phosphates and prevent the DNA from ligating thereby keeping DNA molecules linear until the next step of the process for which they are being prepared

bull Radiolabeling (replacement by radioactive phosphate groups) in order to measure the presence of the labeled DNA through further steps in the process or experiment For these purposes the alkaline phosphatase from shrimp is the most useful as it is the easiest to inactivate once it has done its job

bullDiagnostic uses

Use in research

PO

O

O

OOH

O-P-O

OO

CH2

N

N N

NNH2

OH

HO

OO

OO

P

+ AMP

OH

GAATTCCTTAAG

5rsquo-p

AA

TT

C

OH

HO

PP

EcoRI

EcoRI

5rsquo-pAATTC

5rsquoP P 5rsquo

OH

OH

HO

OH

P

OH

P

OH

bull A useful tool to remove 5rsquo- phosphates and prevent the DNA from ligating thereby keeping DNA molecules linear until the next step of the process for which they are being prepared

bull Radiolabeling (replacement by radioactive phosphate groups) in order to measure the presence of the labeled DNA through further steps in the process or experiment For these purposes the alkaline phosphatase from shrimp is the most useful as it is the easiest to inactivate once it has done its job

bullDiagnostic uses

Use in research

GAATTCCTTAAG

5rsquo-p

AA

TT

C

OH

HO

PP

EcoRI

EcoRI

5rsquo-pAATTC

5rsquoP P 5rsquo

OH

OH

HO

OH

P

OH

P

OH

bull A useful tool to remove 5rsquo- phosphates and prevent the DNA from ligating thereby keeping DNA molecules linear until the next step of the process for which they are being prepared

bull Radiolabeling (replacement by radioactive phosphate groups) in order to measure the presence of the labeled DNA through further steps in the process or experiment For these purposes the alkaline phosphatase from shrimp is the most useful as it is the easiest to inactivate once it has done its job

bullDiagnostic uses

Use in research

bull A useful tool to remove 5rsquo- phosphates and prevent the DNA from ligating thereby keeping DNA molecules linear until the next step of the process for which they are being prepared

bull Radiolabeling (replacement by radioactive phosphate groups) in order to measure the presence of the labeled DNA through further steps in the process or experiment For these purposes the alkaline phosphatase from shrimp is the most useful as it is the easiest to inactivate once it has done its job

bullDiagnostic uses

Use in research

242 S1 NucleaseAn endonuclease that is active against single-stranded DNA and RNA molecules It is five times more active on DNA than RNA

The reaction products are oligonucleotides or single nucleotides with 5 phosphoryl groups

It can also occasionally introduce single-stranded breaks in double-stranded DNA or RNA or DNA-RNA hybrids

It is used as a reagent in nuclease protection assays removing single stranded tails from DNA molecules to create blunt ends and opening hairpin loops

243 DNase and RNase

DNase An endonuclease that is active against dsDNA and ssDNA molecules

Heat inactive EDTA inhibition

The reaction products oligonucleotides or single nucleotides with 5 phosphoryl groups

Use DNase free stuffs to perform the DNA cloning

DNase I is commonly used in DNA foot-printing and in RNA extraction

DNase I in DNA foot-printing

An end labeled DNA probe is incubated with a purified DNA-binding factor or with a protein extract

The unprotected DNA is then digested with DNase I such that on average every DNA molecule is cut once

Digestion products are then resolved by electrophoresis

Comparison of the DNase I digestion pattern in the presence or absence of protein will allow the identification of a footprint (protected region)

DNase I in DNA foot-printing

RNase (Ribonuclease) A type of nuclease that catalyzes the degradation of RNA into smaller components

endoribonucleases

exoribonucleases

RNA degradation is a very ancient and important process As well as cleaning of cellular RNA that is no longer required RNases play key roles in the maturation of all RNA molecules both messenger RNAs and non-coding RNAs that function in varied cellular processes

comprise several sub-classes of the phosphorolytic enzymes and of the hydrolytic enzymes

one of the hardiest enzymes in common laboratory usage heat resistant extremely common

RNases

243 DNase and RNase

DNase An endonuclease that is active against dsDNA and ssDNA molecules

Heat inactive EDTA inhibition

The reaction products oligonucleotides or single nucleotides with 5 phosphoryl groups

Use DNase free stuffs to perform the DNA cloning

DNase I is commonly used in DNA foot-printing and in RNA extraction

DNase I in DNA foot-printing

An end labeled DNA probe is incubated with a purified DNA-binding factor or with a protein extract

The unprotected DNA is then digested with DNase I such that on average every DNA molecule is cut once

Digestion products are then resolved by electrophoresis

Comparison of the DNase I digestion pattern in the presence or absence of protein will allow the identification of a footprint (protected region)

DNase I in DNA foot-printing

RNase (Ribonuclease) A type of nuclease that catalyzes the degradation of RNA into smaller components

endoribonucleases

exoribonucleases

RNA degradation is a very ancient and important process As well as cleaning of cellular RNA that is no longer required RNases play key roles in the maturation of all RNA molecules both messenger RNAs and non-coding RNAs that function in varied cellular processes

comprise several sub-classes of the phosphorolytic enzymes and of the hydrolytic enzymes

one of the hardiest enzymes in common laboratory usage heat resistant extremely common

RNases

DNase I in DNA foot-printing

An end labeled DNA probe is incubated with a purified DNA-binding factor or with a protein extract

The unprotected DNA is then digested with DNase I such that on average every DNA molecule is cut once

Digestion products are then resolved by electrophoresis

Comparison of the DNase I digestion pattern in the presence or absence of protein will allow the identification of a footprint (protected region)

DNase I in DNA foot-printing

RNase (Ribonuclease) A type of nuclease that catalyzes the degradation of RNA into smaller components

endoribonucleases

exoribonucleases

RNA degradation is a very ancient and important process As well as cleaning of cellular RNA that is no longer required RNases play key roles in the maturation of all RNA molecules both messenger RNAs and non-coding RNAs that function in varied cellular processes

comprise several sub-classes of the phosphorolytic enzymes and of the hydrolytic enzymes

one of the hardiest enzymes in common laboratory usage heat resistant extremely common

RNases

An end labeled DNA probe is incubated with a purified DNA-binding factor or with a protein extract

The unprotected DNA is then digested with DNase I such that on average every DNA molecule is cut once

Digestion products are then resolved by electrophoresis

Comparison of the DNase I digestion pattern in the presence or absence of protein will allow the identification of a footprint (protected region)

DNase I in DNA foot-printing

RNase (Ribonuclease) A type of nuclease that catalyzes the degradation of RNA into smaller components

endoribonucleases

exoribonucleases

RNA degradation is a very ancient and important process As well as cleaning of cellular RNA that is no longer required RNases play key roles in the maturation of all RNA molecules both messenger RNAs and non-coding RNAs that function in varied cellular processes

comprise several sub-classes of the phosphorolytic enzymes and of the hydrolytic enzymes

one of the hardiest enzymes in common laboratory usage heat resistant extremely common

RNases

RNase (Ribonuclease) A type of nuclease that catalyzes the degradation of RNA into smaller components

endoribonucleases

exoribonucleases

RNA degradation is a very ancient and important process As well as cleaning of cellular RNA that is no longer required RNases play key roles in the maturation of all RNA molecules both messenger RNAs and non-coding RNAs that function in varied cellular processes

comprise several sub-classes of the phosphorolytic enzymes and of the hydrolytic enzymes

one of the hardiest enzymes in common laboratory usage heat resistant extremely common

RNases

RNases are extremely common resulting in very short lifespans for any RNA that is not in a protected environment

It is worth noting that all intracellular RNAs are protected from RNase activity by a number of strategies including 5 end capping 3 end polyadenylation and folding within an RNA protein complex (ribonucleoprotein particle or RNP)

RNase A an RNase that is commonly used in research

It is sequence specific for single-stranded RNAs It cleaves 3end of unpaired C and U residues leaving a 3-phosphorylated product

RNase H a ribonuclease that cleaves the RNA in a DNARNA duplex to produce ssDNA RNase H is a non-specific endonuclease and catalyzes the cleavage of RNA via a hydrolytic mechanism aided by an enzyme-bound divalent metal ion RNase H leaves a 5-phosphorylated product

RNase I cleaves 3-end of ssRNA at all dinucleotide bonds leaving a 5 hydroxyl and 3 phosphate

Nucleic probe In molecular biology a hybridization probe is a fragment of DNA or RNA of variable length (usually 100-1000 bases long) which is used to detect the presence of the DNA target nucleotide sequences that are complementary to the sequence in the probe

The probe hybridizes to ssDNA or RNA) whose base sequence allows probe-target base pairing due to complementarity between the probe and target

The labeled probe is first denatured (by heating or under alkaline conditions) into single DNA strands and then hybridized to the target DNA (Southern blotting) or RNA (northern blotting) immobilized on a membrane or in situ

25 Nucleic probes

To detect hybridization of the probe to its target sequence the probe is tagged (or labelled) with a molecular marker of either radioactive or (more recently) fluorescent molecules

commonly used markers are 32P or Digoxigenin which is non-radioactive antibody-based marker

DNA sequences or RNA transcripts that have moderate to high sequence similarity to the probe are then detected by visualizing the hybridized probe via autoradiography or other imaging techniques

硝酸纤维膜

Depending on the method the probe may be synthesized using phosphoramidite method or generated and labeled by PCR amplification Molecular DNA- or RNA-based probes are now routinely used in screening gene libraries detecting nucleotide sequences with blotting methods and in other gene technologies like microarrays

Probes labeling techniques

Nick Translation carefully using DNase I digest DNA to produce nicks then using the DNA polymerase and dNTP (one of which was radio-labeled) The nick may shift as the enzyme catalyzing deoxylnucleotidyl on the 3rsquo-end

End Filling a gentaler method than nick translation and rarely causes breakage of the DNA but unfortunately can only be use to label DNA molecules that have sticky ends

Randome priming using random synthesized hexameric oligonucleotides (6 聚寡核苷酸） as primers to anneal with an DNA fragments run PCR by klenow fragment to produce radiolabeling probes (to get a probe pool)

• Slide 1
• Slide 2
• Slide 3
• Slide 4
• Slide 5
• Slide 6
• Slide 7
• Slide 8
• Slide 9
• Slide 10
• Slide 11
• Slide 12
• Slide 13
• Slide 14
• Slide 15
• Slide 16
• Slide 17
• Slide 18
• Slide 19
• Slide 20
• Slide 21
• Slide 22
• Slide 23
• Slide 24
• Slide 25
• Slide 26
• Slide 27
• Slide 28
• Slide 29
• Slide 30
• Slide 31
• Slide 32
• Slide 33
• Slide 34
• Slide 35
• Slide 36
• Slide 37
• Slide 38
• Slide 39
• Slide 40
• Slide 41
• Slide 42
• Slide 43
• Slide 44
• Slide 45
• Slide 46
• Slide 47
• Slide 48
• Slide 49
• Slide 50
• Slide 51
• Slide 52
• Slide 53
• Slide 54
• Slide 55
• Slide 56
• Slide 57
• Slide 58
• Slide 59
• Slide 60
• Slide 61
• Slide 62
• Slide 63
• Slide 64
• Slide 65
• Slide 66
• Slide 67
• Slide 68
• Slide 69
• Slide 70
• Slide 71
• Slide 72
• Slide 73
• Slide 74
• Slide 75
• Slide 76
• Slide 77
• Slide 78
• Slide 79
• Slide 80
• Slide 81
• Slide 82

RNase A an RNase that is commonly used in research

It is sequence specific for single-stranded RNAs It cleaves 3end of unpaired C and U residues leaving a 3-phosphorylated product

RNase H a ribonuclease that cleaves the RNA in a DNARNA duplex to produce ssDNA RNase H is a non-specific endonuclease and catalyzes the cleavage of RNA via a hydrolytic mechanism aided by an enzyme-bound divalent metal ion RNase H leaves a 5-phosphorylated product

RNase I cleaves 3-end of ssRNA at all dinucleotide bonds leaving a 5 hydroxyl and 3 phosphate

Nucleic probe In molecular biology a hybridization probe is a fragment of DNA or RNA of variable length (usually 100-1000 bases long) which is used to detect the presence of the DNA target nucleotide sequences that are complementary to the sequence in the probe

The probe hybridizes to ssDNA or RNA) whose base sequence allows probe-target base pairing due to complementarity between the probe and target

The labeled probe is first denatured (by heating or under alkaline conditions) into single DNA strands and then hybridized to the target DNA (Southern blotting) or RNA (northern blotting) immobilized on a membrane or in situ

25 Nucleic probes

To detect hybridization of the probe to its target sequence the probe is tagged (or labelled) with a molecular marker of either radioactive or (more recently) fluorescent molecules

commonly used markers are 32P or Digoxigenin which is non-radioactive antibody-based marker

DNA sequences or RNA transcripts that have moderate to high sequence similarity to the probe are then detected by visualizing the hybridized probe via autoradiography or other imaging techniques

硝酸纤维膜

Depending on the method the probe may be synthesized using phosphoramidite method or generated and labeled by PCR amplification Molecular DNA- or RNA-based probes are now routinely used in screening gene libraries detecting nucleotide sequences with blotting methods and in other gene technologies like microarrays

Probes labeling techniques

Nick Translation carefully using DNase I digest DNA to produce nicks then using the DNA polymerase and dNTP (one of which was radio-labeled) The nick may shift as the enzyme catalyzing deoxylnucleotidyl on the 3rsquo-end

End Filling a gentaler method than nick translation and rarely causes breakage of the DNA but unfortunately can only be use to label DNA molecules that have sticky ends

Randome priming using random synthesized hexameric oligonucleotides (6 聚寡核苷酸） as primers to anneal with an DNA fragments run PCR by klenow fragment to produce radiolabeling probes (to get a probe pool)

• Slide 1
• Slide 2
• Slide 3
• Slide 4
• Slide 5
• Slide 6
• Slide 7
• Slide 8
• Slide 9
• Slide 10
• Slide 11
• Slide 12
• Slide 13
• Slide 14
• Slide 15
• Slide 16
• Slide 17
• Slide 18
• Slide 19
• Slide 20
• Slide 21
• Slide 22
• Slide 23
• Slide 24
• Slide 25
• Slide 26
• Slide 27
• Slide 28
• Slide 29
• Slide 30
• Slide 31
• Slide 32
• Slide 33
• Slide 34
• Slide 35
• Slide 36
• Slide 37
• Slide 38
• Slide 39
• Slide 40
• Slide 41
• Slide 42
• Slide 43
• Slide 44
• Slide 45
• Slide 46
• Slide 47
• Slide 48
• Slide 49
• Slide 50
• Slide 51
• Slide 52
• Slide 53
• Slide 54
• Slide 55
• Slide 56
• Slide 57
• Slide 58
• Slide 59
• Slide 60
• Slide 61
• Slide 62
• Slide 63
• Slide 64
• Slide 65
• Slide 66
• Slide 67
• Slide 68
• Slide 69
• Slide 70
• Slide 71
• Slide 72
• Slide 73
• Slide 74
• Slide 75
• Slide 76
• Slide 77
• Slide 78
• Slide 79
• Slide 80
• Slide 81
• Slide 82

Nucleic probe In molecular biology a hybridization probe is a fragment of DNA or RNA of variable length (usually 100-1000 bases long) which is used to detect the presence of the DNA target nucleotide sequences that are complementary to the sequence in the probe

The probe hybridizes to ssDNA or RNA) whose base sequence allows probe-target base pairing due to complementarity between the probe and target

The labeled probe is first denatured (by heating or under alkaline conditions) into single DNA strands and then hybridized to the target DNA (Southern blotting) or RNA (northern blotting) immobilized on a membrane or in situ

25 Nucleic probes

To detect hybridization of the probe to its target sequence the probe is tagged (or labelled) with a molecular marker of either radioactive or (more recently) fluorescent molecules

commonly used markers are 32P or Digoxigenin which is non-radioactive antibody-based marker

DNA sequences or RNA transcripts that have moderate to high sequence similarity to the probe are then detected by visualizing the hybridized probe via autoradiography or other imaging techniques

硝酸纤维膜

Depending on the method the probe may be synthesized using phosphoramidite method or generated and labeled by PCR amplification Molecular DNA- or RNA-based probes are now routinely used in screening gene libraries detecting nucleotide sequences with blotting methods and in other gene technologies like microarrays

Probes labeling techniques

Nick Translation carefully using DNase I digest DNA to produce nicks then using the DNA polymerase and dNTP (one of which was radio-labeled) The nick may shift as the enzyme catalyzing deoxylnucleotidyl on the 3rsquo-end

End Filling a gentaler method than nick translation and rarely causes breakage of the DNA but unfortunately can only be use to label DNA molecules that have sticky ends

Randome priming using random synthesized hexameric oligonucleotides (6 聚寡核苷酸） as primers to anneal with an DNA fragments run PCR by klenow fragment to produce radiolabeling probes (to get a probe pool)

• Slide 1
• Slide 2
• Slide 3
• Slide 4
• Slide 5
• Slide 6
• Slide 7
• Slide 8
• Slide 9
• Slide 10
• Slide 11
• Slide 12
• Slide 13
• Slide 14
• Slide 15
• Slide 16
• Slide 17
• Slide 18
• Slide 19
• Slide 20
• Slide 21
• Slide 22
• Slide 23
• Slide 24
• Slide 25
• Slide 26
• Slide 27
• Slide 28
• Slide 29
• Slide 30
• Slide 31
• Slide 32
• Slide 33
• Slide 34
• Slide 35
• Slide 36
• Slide 37
• Slide 38
• Slide 39
• Slide 40
• Slide 41
• Slide 42
• Slide 43
• Slide 44
• Slide 45
• Slide 46
• Slide 47
• Slide 48
• Slide 49
• Slide 50
• Slide 51
• Slide 52
• Slide 53
• Slide 54
• Slide 55
• Slide 56
• Slide 57
• Slide 58
• Slide 59
• Slide 60
• Slide 61
• Slide 62
• Slide 63
• Slide 64
• Slide 65
• Slide 66
• Slide 67
• Slide 68
• Slide 69
• Slide 70
• Slide 71
• Slide 72
• Slide 73
• Slide 74
• Slide 75
• Slide 76
• Slide 77
• Slide 78
• Slide 79
• Slide 80
• Slide 81
• Slide 82

To detect hybridization of the probe to its target sequence the probe is tagged (or labelled) with a molecular marker of either radioactive or (more recently) fluorescent molecules

commonly used markers are 32P or Digoxigenin which is non-radioactive antibody-based marker

DNA sequences or RNA transcripts that have moderate to high sequence similarity to the probe are then detected by visualizing the hybridized probe via autoradiography or other imaging techniques

硝酸纤维膜

Depending on the method the probe may be synthesized using phosphoramidite method or generated and labeled by PCR amplification Molecular DNA- or RNA-based probes are now routinely used in screening gene libraries detecting nucleotide sequences with blotting methods and in other gene technologies like microarrays

Probes labeling techniques

Nick Translation carefully using DNase I digest DNA to produce nicks then using the DNA polymerase and dNTP (one of which was radio-labeled) The nick may shift as the enzyme catalyzing deoxylnucleotidyl on the 3rsquo-end

End Filling a gentaler method than nick translation and rarely causes breakage of the DNA but unfortunately can only be use to label DNA molecules that have sticky ends

Randome priming using random synthesized hexameric oligonucleotides (6 聚寡核苷酸） as primers to anneal with an DNA fragments run PCR by klenow fragment to produce radiolabeling probes (to get a probe pool)

• Slide 1
• Slide 2
• Slide 3
• Slide 4
• Slide 5
• Slide 6
• Slide 7
• Slide 8
• Slide 9
• Slide 10
• Slide 11
• Slide 12
• Slide 13
• Slide 14
• Slide 15
• Slide 16
• Slide 17
• Slide 18
• Slide 19
• Slide 20
• Slide 21
• Slide 22
• Slide 23
• Slide 24
• Slide 25
• Slide 26
• Slide 27
• Slide 28
• Slide 29
• Slide 30
• Slide 31
• Slide 32
• Slide 33
• Slide 34
• Slide 35
• Slide 36
• Slide 37
• Slide 38
• Slide 39
• Slide 40
• Slide 41
• Slide 42
• Slide 43
• Slide 44
• Slide 45
• Slide 46
• Slide 47
• Slide 48
• Slide 49
• Slide 50
• Slide 51
• Slide 52
• Slide 53
• Slide 54
• Slide 55
• Slide 56
• Slide 57
• Slide 58
• Slide 59
• Slide 60
• Slide 61
• Slide 62
• Slide 63
• Slide 64
• Slide 65
• Slide 66
• Slide 67
• Slide 68
• Slide 69
• Slide 70
• Slide 71
• Slide 72
• Slide 73
• Slide 74
• Slide 75
• Slide 76
• Slide 77
• Slide 78
• Slide 79
• Slide 80
• Slide 81
• Slide 82

硝酸纤维膜

Depending on the method the probe may be synthesized using phosphoramidite method or generated and labeled by PCR amplification Molecular DNA- or RNA-based probes are now routinely used in screening gene libraries detecting nucleotide sequences with blotting methods and in other gene technologies like microarrays

Probes labeling techniques

Nick Translation carefully using DNase I digest DNA to produce nicks then using the DNA polymerase and dNTP (one of which was radio-labeled) The nick may shift as the enzyme catalyzing deoxylnucleotidyl on the 3rsquo-end

End Filling a gentaler method than nick translation and rarely causes breakage of the DNA but unfortunately can only be use to label DNA molecules that have sticky ends

Randome priming using random synthesized hexameric oligonucleotides (6 聚寡核苷酸） as primers to anneal with an DNA fragments run PCR by klenow fragment to produce radiolabeling probes (to get a probe pool)

• Slide 1
• Slide 2
• Slide 3
• Slide 4
• Slide 5
• Slide 6
• Slide 7
• Slide 8
• Slide 9
• Slide 10
• Slide 11
• Slide 12
• Slide 13
• Slide 14
• Slide 15
• Slide 16
• Slide 17
• Slide 18
• Slide 19
• Slide 20
• Slide 21
• Slide 22
• Slide 23
• Slide 24
• Slide 25
• Slide 26
• Slide 27
• Slide 28
• Slide 29
• Slide 30
• Slide 31
• Slide 32
• Slide 33
• Slide 34
• Slide 35
• Slide 36
• Slide 37
• Slide 38
• Slide 39
• Slide 40
• Slide 41
• Slide 42
• Slide 43
• Slide 44
• Slide 45
• Slide 46
• Slide 47
• Slide 48
• Slide 49
• Slide 50
• Slide 51
• Slide 52
• Slide 53
• Slide 54
• Slide 55
• Slide 56
• Slide 57
• Slide 58
• Slide 59
• Slide 60
• Slide 61
• Slide 62
• Slide 63
• Slide 64
• Slide 65
• Slide 66
• Slide 67
• Slide 68
• Slide 69
• Slide 70
• Slide 71
• Slide 72
• Slide 73
• Slide 74
• Slide 75
• Slide 76
• Slide 77
• Slide 78
• Slide 79
• Slide 80
• Slide 81
• Slide 82

Depending on the method the probe may be synthesized using phosphoramidite method or generated and labeled by PCR amplification Molecular DNA- or RNA-based probes are now routinely used in screening gene libraries detecting nucleotide sequences with blotting methods and in other gene technologies like microarrays

Probes labeling techniques

Nick Translation carefully using DNase I digest DNA to produce nicks then using the DNA polymerase and dNTP (one of which was radio-labeled) The nick may shift as the enzyme catalyzing deoxylnucleotidyl on the 3rsquo-end

End Filling a gentaler method than nick translation and rarely causes breakage of the DNA but unfortunately can only be use to label DNA molecules that have sticky ends

Randome priming using random synthesized hexameric oligonucleotides (6 聚寡核苷酸） as primers to anneal with an DNA fragments run PCR by klenow fragment to produce radiolabeling probes (to get a probe pool)

• Slide 1
• Slide 2
• Slide 3
• Slide 4
• Slide 5
• Slide 6
• Slide 7
• Slide 8
• Slide 9
• Slide 10
• Slide 11
• Slide 12
• Slide 13
• Slide 14
• Slide 15
• Slide 16
• Slide 17
• Slide 18
• Slide 19
• Slide 20
• Slide 21
• Slide 22
• Slide 23
• Slide 24
• Slide 25
• Slide 26
• Slide 27
• Slide 28
• Slide 29
• Slide 30
• Slide 31
• Slide 32
• Slide 33
• Slide 34
• Slide 35
• Slide 36
• Slide 37
• Slide 38
• Slide 39
• Slide 40
• Slide 41
• Slide 42
• Slide 43
• Slide 44
• Slide 45
• Slide 46
• Slide 47
• Slide 48
• Slide 49
• Slide 50
• Slide 51
• Slide 52
• Slide 53
• Slide 54
• Slide 55
• Slide 56
• Slide 57
• Slide 58
• Slide 59
• Slide 60
• Slide 61
• Slide 62
• Slide 63
• Slide 64
• Slide 65
• Slide 66
• Slide 67
• Slide 68
• Slide 69
• Slide 70
• Slide 71
• Slide 72
• Slide 73
• Slide 74
• Slide 75
• Slide 76
• Slide 77
• Slide 78
• Slide 79
• Slide 80
• Slide 81
• Slide 82

Nick Translation carefully using DNase I digest DNA to produce nicks then using the DNA polymerase and dNTP (one of which was radio-labeled) The nick may shift as the enzyme catalyzing deoxylnucleotidyl on the 3rsquo-end

End Filling a gentaler method than nick translation and rarely causes breakage of the DNA but unfortunately can only be use to label DNA molecules that have sticky ends

Randome priming using random synthesized hexameric oligonucleotides (6 聚寡核苷酸） as primers to anneal with an DNA fragments run PCR by klenow fragment to produce radiolabeling probes (to get a probe pool)

• Slide 1
• Slide 2
• Slide 3
• Slide 4
• Slide 5
• Slide 6
• Slide 7
• Slide 8
• Slide 9
• Slide 10
• Slide 11
• Slide 12
• Slide 13
• Slide 14
• Slide 15
• Slide 16
• Slide 17
• Slide 18
• Slide 19
• Slide 20
• Slide 21
• Slide 22
• Slide 23
• Slide 24
• Slide 25
• Slide 26
• Slide 27
• Slide 28
• Slide 29
• Slide 30
• Slide 31
• Slide 32
• Slide 33
• Slide 34
• Slide 35
• Slide 36
• Slide 37
• Slide 38
• Slide 39
• Slide 40
• Slide 41
• Slide 42
• Slide 43
• Slide 44
• Slide 45
• Slide 46
• Slide 47
• Slide 48
• Slide 49
• Slide 50
• Slide 51
• Slide 52
• Slide 53
• Slide 54
• Slide 55
• Slide 56
• Slide 57
• Slide 58
• Slide 59
• Slide 60
• Slide 61
• Slide 62
• Slide 63
• Slide 64
• Slide 65
• Slide 66
• Slide 67
• Slide 68
• Slide 69
• Slide 70
• Slide 71
• Slide 72
• Slide 73
• Slide 74
• Slide 75
• Slide 76
• Slide 77
• Slide 78
• Slide 79
• Slide 80
• Slide 81
• Slide 82

End Filling a gentaler method than nick translation and rarely causes breakage of the DNA but unfortunately can only be use to label DNA molecules that have sticky ends

Randome priming using random synthesized hexameric oligonucleotides (6 聚寡核苷酸） as primers to anneal with an DNA fragments run PCR by klenow fragment to produce radiolabeling probes (to get a probe pool)

• Slide 1
• Slide 2
• Slide 3
• Slide 4
• Slide 5
• Slide 6
• Slide 7
• Slide 8
• Slide 9
• Slide 10
• Slide 11
• Slide 12
• Slide 13
• Slide 14
• Slide 15
• Slide 16
• Slide 17
• Slide 18
• Slide 19
• Slide 20
• Slide 21
• Slide 22
• Slide 23
• Slide 24
• Slide 25
• Slide 26
• Slide 27
• Slide 28
• Slide 29
• Slide 30
• Slide 31
• Slide 32
• Slide 33
• Slide 34
• Slide 35
• Slide 36
• Slide 37
• Slide 38
• Slide 39
• Slide 40
• Slide 41
• Slide 42
• Slide 43
• Slide 44
• Slide 45
• Slide 46
• Slide 47
• Slide 48
• Slide 49
• Slide 50
• Slide 51
• Slide 52
• Slide 53
• Slide 54
• Slide 55
• Slide 56
• Slide 57
• Slide 58
• Slide 59
• Slide 60
• Slide 61
• Slide 62
• Slide 63
• Slide 64
• Slide 65
• Slide 66
• Slide 67
• Slide 68
• Slide 69
• Slide 70
• Slide 71
• Slide 72
• Slide 73
• Slide 74
• Slide 75
• Slide 76
• Slide 77
• Slide 78
• Slide 79
• Slide 80
• Slide 81
• Slide 82

Randome priming using random synthesized hexameric oligonucleotides (6 聚寡核苷酸） as primers to anneal with an DNA fragments run PCR by klenow fragment to produce radiolabeling probes (to get a probe pool)

• Slide 1
• Slide 2
• Slide 3
• Slide 4
• Slide 5
• Slide 6
• Slide 7
• Slide 8
• Slide 9
• Slide 10
• Slide 11
• Slide 12
• Slide 13
• Slide 14
• Slide 15
• Slide 16
• Slide 17
• Slide 18
• Slide 19
• Slide 20
• Slide 21
• Slide 22
• Slide 23
• Slide 24
• Slide 25
• Slide 26
• Slide 27
• Slide 28
• Slide 29
• Slide 30
• Slide 31
• Slide 32
• Slide 33
• Slide 34
• Slide 35
• Slide 36
• Slide 37
• Slide 38
• Slide 39
• Slide 40
• Slide 41
• Slide 42
• Slide 43
• Slide 44
• Slide 45
• Slide 46
• Slide 47
• Slide 48
• Slide 49
• Slide 50
• Slide 51
• Slide 52
• Slide 53
• Slide 54
• Slide 55
• Slide 56
• Slide 57
• Slide 58
• Slide 59
• Slide 60
• Slide 61
• Slide 62
• Slide 63
• Slide 64
• Slide 65
• Slide 66
• Slide 67
• Slide 68
• Slide 69
• Slide 70
• Slide 71
• Slide 72
• Slide 73
• Slide 74
• Slide 75
• Slide 76
• Slide 77
• Slide 78
• Slide 79
• Slide 80
• Slide 81
• Slide 82

• Slide 1
• Slide 2
• Slide 3
• Slide 4
• Slide 5
• Slide 6
• Slide 7
• Slide 8
• Slide 9
• Slide 10
• Slide 11
• Slide 12
• Slide 13
• Slide 14
• Slide 15
• Slide 16
• Slide 17
• Slide 18
• Slide 19
• Slide 20
• Slide 21
• Slide 22
• Slide 23
• Slide 24
• Slide 25
• Slide 26
• Slide 27
• Slide 28
• Slide 29
• Slide 30
• Slide 31
• Slide 32
• Slide 33
• Slide 34
• Slide 35
• Slide 36
• Slide 37
• Slide 38
• Slide 39
• Slide 40
• Slide 41
• Slide 42
• Slide 43
• Slide 44
• Slide 45
• Slide 46
• Slide 47
• Slide 48
• Slide 49
• Slide 50
• Slide 51
• Slide 52
• Slide 53
• Slide 54
• Slide 55
• Slide 56
• Slide 57
• Slide 58
• Slide 59
• Slide 60
• Slide 61
• Slide 62
• Slide 63
• Slide 64
• Slide 65
• Slide 66
• Slide 67
• Slide 68
• Slide 69
• Slide 70
• Slide 71
• Slide 72
• Slide 73
• Slide 74
• Slide 75
• Slide 76
• Slide 77
• Slide 78
• Slide 79
• Slide 80
• Slide 81
• Slide 82