chapter 3 lecture concepts of genetics tenth edition mendelian genetics

Chapter 3 Lecture

Concepts of GeneticsTenth Edition

Mendelian Genetics

© 2012 Pearson Education, Inc.

Chapter 3 Contents

3.1 Mendel Used a Model Experimental Approach to Study Patterns of Inheritance

3.2 The Monohybrid Cross Reveals How One Trait Is Transmitted from Generation to Generation

3.3 Mendel's Dihybrid Cross Generated a Unique F2 Ratio

3.4 The Trihybrid Cross Demonstrates That Mendel's Principles Apply to Inheritance of Multiple Traits

3.5 Mendel's Work Was Rediscovered in the Early Twentieth Century

Continued


Chapter 3 Contents

3.6 The Correlation of Mendel's Postulates with the Behavior of Chromosomes Provided the Foundation of Modern Transmission Genetics

3.7 Independent Assortment Leads to Extensive Genetic Variation

3.8 Laws of Probability Help to Explain Genetic Events

3.9 Chi-Square Analysis Evaluates the Influence of Chance on Genetic Data

3.10 Pedigrees Reveal Patterns of Inheritance of Human Traits

Who was Gregor Mendel

• The founder of modern genetics was an Austrian monk named Gregor Mendel.

• Mendel was in charge of the monastery garden, where he conducted research on garden peas.

Austria

Not Australia!!!G’day Mate!

Mendel

– Gregor Mendel discovered principles of genetics in experiments with garden garden pea plantspea plants

• Mendel showed that parents pass heritable factors to offspring

– What do we call heritable factors today?

• GenesGenes


3.1 Mendel Used a Model Experimental Approach to Study

Patterns of Inheritance


Section 3.1

• Mendel used a model experimental approach to study patterns of inheritance

• Why did Mendel chose the garden pea as his model system?– it is easy to grow – it has true-breeding strains – it has controlled matings: self-

fertilization or cross-fertilization – it grows to maturity in one season – it has observable characteristics

with two distinct forms


Section 3.1

• Using 7 visible features, each with two contrasting traits and true-breeding strains, – Mendel kept accurate, quantitative

records of his experments


Section 3.1

• Unappreciated during his lifetime• Rediscovered in the turn of the century• Mendel's postulates were eventually

accepted as the basis for Mendelian, or transmission, genetics


3.2 The Monohybrid Cross Reveals How One Trait Is Transmitted from

Generation to Generation

Terms to Know before moving on:

• Genes: Genetic information that codes for specific traits. Genes have specific loci on a chromosome.

• Diploid (2n)/haploid (n)• True-breeding: Inherit identical alleles

generation after generation• Hybrid: Offspring of a cross that has

inherited a pair of nonidentical alleles for a trait.

• Homozygous: Identical pair of Alleles (TT or tt)

• Heterozygous: Pair of different alleles for a gene (one allele to be tall (T) and one to be short (t)

Terms to Know before moving on:

• Dominant alleles are allele that will mask any recessive allele for the same trait. – Dominant alleles are represented with a

capital letter (tall = D)– Recessive alleles are represented with a

lowercase letter (short = d)

• Genotype refers to an individual’s particular genes.

• Phenotype refers to the individual’s observable or physical traits.

Gene loci

Homozygousfor thedominant allele

Dominantallele

Homozygousfor therecessive allele

Heterozygous

Recessive allele

Genotype:

P Ba

P

PP

a

aa

b

Bb

Do Now

• T=tall t=short• A pea plant has the genotype Tt.

– Which trait is dominant? Which is recessive?

– What is the individual’s phenotype? – Explain the individual’s genotype.– Could this plant be a true bred plant?

– Explain what big ‘T’ and little ‘t’ are actually representing. What are they made of? Where would you find them? How are they related to one another? How did the plant get them?

What causes the plant to be tall

• gibberellin 3-beta-hydroxylase, a biosynthetic enzyme crucial to the division and elongation of the cells in the plant's stem

• 3β-hydroxylase which converts GA20 to GA1

• Tallness in pea plants is regulated by a gibberellin (active), GA1, which promotes stem growth. – Gibberellins had been discovered in the 1950s,

but it was not until the early 1980s that the group connected it to stem height.

CU and Australian scientists clone Mendel's historic pea-plant gene By Blaine P. Friedlander Jr.

What is “T”?

• gibberellin 3-beta-hydroxylase - 358 AA

ATGCCTGCTATGTTAACAGATGTGTTTAGAGGCCATCCCATTCACCTCCCACACTCTCAC ATACCTGACTTCACATCTCTCCGGGAGCTCCCGGATTCTTACAAGTGGACCCCTAAAGAC GATCTCCTCTTCTCCGCTGCTCCTTCTCCTCCGGCCACCGGTGAAAACATCCCTCTCATC

GACCTCGACCACCCGGACGCGACTAACCAAATCGGTCATGCATGTAGAACTTGGGGTGCC TTCCAAATCTCAAACCACGGCGTGCCTTTGGGACTTCTCCAAGACATTGAGTTTCTCACC

GGTAGTCTCTTCGGGCTACCTGTCCAACGCAAGCTTAAGTCTGCTCGGTCGGAGACAGGT GTGTCCGGCTACGGCGTCGCTCGTATCGCATCTTTCTTCAATAAGCAAATGTGGTCCGAA GGTTTCACCATCACTGGCTCGCCTCTCAACGATTTCCGTAAACTTTGGCCCCAACATCAC CTCAACTACTGCGATATCGTTGAAGAGTACGAGGAACATATGAAAAAGTTGGCATCGAAA TTGATGTGGTTAGCACTAAATTCACTTGGGGTCAGCGAAGAAGACATTGAATGGGCCAGT CTCAGTTCAGATTTAAACTGGGCCCAAGCTGCTCTCCAGCTAAATCACTACCCGGTTTGT

CCTGAACCGGACCGAGCCATGGGTCTAGCAGCTCATACCGACTCCACCCTCCTAACCATT CTGTACCAGAACAATACCGCCGGTCTACAAGTATTTCGCGATGATCTTGGTTGGGTCACC GTGCCACCGTTTCCTGGCTCGCTCGTGGTTAACGTTGGTGACCTCTTCCACATCCTATCC AATGGATTGTTTAAAAGCGTGTTGCACCGCGCTCGGGTTAACCAAACCAGAGCCCGGTTA TCTGTAGCATTCCTTTGGGGTCCGCAATCTGATATCAAGATATCACCTGTACCGAAGCTG GTTAGTCCCGTTGAATCGCCTCTATACCAATCGGTGACATGGAAAGAGTATCTTCGAACA

AAAGCAACTCACTTCAACAAAGCTCTTTCAATGATTAGAAATCACAGAGAAGAATGA

Amino acid sequence• 10 20 30 40 50 60 • MPAMLTDVFR GHPIHLPHSH IPDFTSLREL PDSYKWTPKD DLLFSAAPSP

PATGENIPLI • 70 80 90 100 110 120 • DLDHPDATNQ IGHACRTWGA FQISNHGVPL GLLQDIEFLT GSLFGLPVQR

KLKSARSETG • 130 140 150 160 170 180 • VSGYGVARIA SFFNKQMWSE GFTITGSPLN DFRKLWPQHH LNYCDIVEEY

EEHMKKLASK• 190 200 210 220 230 240 • LMWLALNSLG VSEEDIEWAS LSSDLNWAQA ALQLNHYPVC PEPDRAMGLA

AHTDSTLLTI • 250 260 270 280 290 300 • LYQNNTAGLQ VFRDDLGWVT VPPFPGSLVV NVGDLFHILS NGLFKSVLHR

ARVNQTRARL • 310 320 330 340 350 • SVAFLWGPQS DIKISPVPKL VSPVESPLYQ SVTWKEYLRT KATHFNKALS MIRNHREE

Biosynthesis of GA1

• GA20 (inactive intermediate) - gibberellin 3-beta-hydroxylase GA1 (active growth protein)

T vs. t, what does this really mean?

• Researchers have demonstrated that in the tall pea plants used by Mendel, the tallness gene codes for an enzyme (gibberellin 3-beta-hydroxylase) that adds a hydroxyl (OH) group at a very particular location onto GA20, which is the is the immediate precursor of GA1.

• In the dwarf plants there is a change of one base in the DNA sequence, which leads to a change of one amino acid in the resulting protein. In turn, this results in an enzyme that is still active in converting GA20 into GA1, but at 1/20th the rate. – Therefore, dwarf peas are less efficient

at synthesizing the gibberellin responsible for promoting stem growth. The plant becomes growth deficient.

What is “T”?

• Dwarf peas have a defective 3β-hydroxylase which converts GA20 to GA1. This conversion makes an inactive GA into an active GA. This explains why the dwarf plants are dwarf...they lack appreciable active GA.

• Spraying such dwarf peas with gibberellic acid (GA3 an active GA) can result in pea plants of normal height.

Genes & Alleles

• In genetic crosses:• Each original pair of plants is the P

(parental) generation.

• The offspring are called the F1, or “first filial,” generation.

Genes & Alleles

• The FF11 hybrid plants all had the character of only only one of the parents.• In each cross the other parent’s trait

seemed to have disappeared

Genes & Alleles

Mendel’s F1 Crosses on Pea Plants

Genes & Alleles

• Mendel's first conclusion was that biological inheritance is determined by factors that are passed from one generation to the next.• Today, scientists call the factors that

determine traits genesgenes.

Genes and Alleles

• Genes are sections of a chromosome that code for a trait.• Most organisms have two copies of

every gene and chromosome, one from each parent.

Genes and Alleles

• Each of the traits Mendel studied was controlled by one gene that occurred in two contrasting forms that produced different characters for each trait.

• The different forms of a gene are

called alleles. • Certain alleles can hide or dominate

over other alleles.


Section 3.2

• Mendel's monohybrid crosses were not sex dependent

• Because it did not matter if the trait came from males or females, it is called a reciprocal cross


Section 3.2

• Mendel proposed three postulates of inheritance: – Unit factors (genes) exist in pairs– In the pair of unit factors for a single

characteristic in an individual, one unit factor is dominant and the other is recessive

– The paired unit factors segregate (separate) independently during gamete formation


Section 3.2• The parental plants are

the P generation

• Their hybrid offspring are the F1 generation

• A cross of the F1 plants forms the F2 generation


Section 3.2

• For each characteristic, an organism inherits two alleles, one from each parent; the alleles can be the same or different

– A ______________ genotype has identical alleles

– A ______________ genotype has two different alleles

homozygous

heterozygous


Section 3.2

• Review of Mendel's first three postulates

• Unit factors in pairs– Genetic characters are controlled by unit

factors existing in pairs in individual organisms

• Dominance/Recessiveness– In the pair of unit factors for a single

characteristic in an individual, one unit factor is dominant and the other is recessive


Section 3.2

• Segregation– The paired unit factors segregate

(separate) independently during gamete formation


Modern Genetic Terminology

• Genes are found in alternative versions called _____________; a genotype is the listing of alleles an individual carries for a specific gene

• The ___________ is the genetic makeup of an individual

• The ____________ is the physical expression of the genetic makeup

alleles

genotype

phenotype


Section 3.2

• A Punnett square allows the genotypes and phenotypes resulting from a cross to be visualized easily (Figure 3.3)

Geneticists use the testcross to determine unknown genotypes

– Testcross• Mating between an unknown

genotype and a homozygous recessive individual– Will show whether the unknown

genotype includes a recessive allele– Used by Mendel to confirm true-breeding

genotypes

B_

or

Two possibilities for the black dog:

Testcross:

Genotypes

Gametes

Offspring 1 black : 1 chocolateAll black

Bb

bb

BB

Bb bb

B

b

Bb

b

bB

1. If purple is dominant to white, show a cross between a homozygous Dominant purple flower with a white flower.

2. Show a cross of the F1 generation.3. What is the genotypic ratio of the F2?4. What is the phenotypic ratio of the F2?5. What percentage of the total offspring

would one expect to be purple?6. What percentage of the purple flowers

would one expect to be heterozygous.

P plants

1–2

1–2

Genotypic ratio1 PP : 2 Pp : 1 pp

Phenotypic ratio3 purple : 1 white

F1 plants(hybrids)

Gametes

Genetic makeup (alleles)

All

All Pp

Sperm

Eggs

PP

p

ppPp

Pp

P

pP

pP

P

p

PP pp

All

Gametes

F2 plants

– Gametes are also known as

• genes.• sex cells. • alleles.• hybrids.

Review

–The offspring of crosses between parents with different traits are called •alleles.•hybrids.•gametes.•dominant.

Review

– In Mendel’s pea experiments, the male gametes are the•eggs.•seeds.•pollen.•sperm.

Review

– In a cross of a true-breeding tall pea plant with a true-breeding short pea plant, the F1 generation consists of•all short plants.•all tall plants.•half tall plants and half short plants.

•all plants of intermediate height.

Review

– If a particular form of a trait is always present when the allele controlling it is present, then the allele must be

•dominant.

Review

Review

• A form of a gene that is not expressed when paired with a dominant allele is called a ______________________recessive allele

Review

• Sections of chromosomes that code for a trait are called ______________________genes

Review

• Organisms usually get one copy of each gene from each parent. The different forms of the same gene are called ______________________alleles


3.3 Mendel's Dihybrid Cross Generated a Unique F2 Ratio


Section 3.3

• Mendel's dihybrid cross generated a unique F2 ratio

• A dihybrid cross involves two pairs of contrasting traits (Figure 3.5)


• The product law can be used to predict the frequency with which two independent events will occur simultaneously


Section 3.3

• Mendel's fourth postulate: Independent assortment

• Mendel's fourth postulate states that– traits assort independently during

gamete formation– all possible combinations of gametes

will form with equal frequency


3.4 The Trihybrid Cross Demonstrates That Mendel's Principles Apply to

Inheritance of Multiple Traits


Section 3.4

• The trihybrid cross demonstrates that mendel's principles apply to inheritance of multiple traits

• Trihybrid crosses involving three independent traits show that Mendel's rules apply to any number of traits

Section 3.4 The forked-line method, or branch diagram

• The forked-line (branched diagram) method is easier to use than a Punnett square for analysis of inheritance of larger number of traits


Section 3.4

Figure 3.8


Section 3.4

• Some simple mathematical rules shown in Table 3.1 apply in working genetics problems


3.5 Mendel's Work Was Rediscovered in the Early Twentieth Century


Section 3.5 The chromosomal theory of inheritance

• The chromosomal theory of inheritance proposed that the separation of chromosomes during meiosis could be the basis for Mendel's principles of segregation and independent assortment


Explaining Mendelian Genetics

Figure 3.10a



Figure 3.10b



Figure 3.10c


3.7 Laws of Probability Help to Explain Genetic Events


Section 3.7

• Laws of probability help to explain genetic events

• A major consequence of independent assortment is the production of genetically dissimilar gametes

• Genetic variation results from independent assortment and is very important to the process of evolution


Section 3.7

• The probability of two independent events occurring at the same time can be calculated using the product law

• The probability of both events occurring is the product of the probability of each individual event

Flip a coin

• What are the chance of a coin landing on heads? On tails?

• The chance, or probability, of either outcome is equal. Therefore, the probability that a single coin flip will land heads up is 1 chance in 2. This amounts to 1/2, or 50 percent.

Flip a coin

– Each coin flip is an independent event, with a one chance in two probability of landing heads up.

– With that in mind, if you flip a coin three times in a row, what is the probability that it will land heads up every time?

1/2 × 1/2 × 1/2 = 1/8


Section 3.7

• The sum law is used to calculate the probability of a generalized outcome that can be accomplished in more than one way

• The sum law states that the probability of obtaining any single outcome, where that outcome can be achieved in two or more events, is equal to the sum of the individual probabilities of all such events


Section 3.7

• When one event depends on another, the likelihood of the desired outcome is the conditional probability


Section 3.7 The binomial theory

• The binomial theorem can be used to calculate the probability of any specific set of outcomes among a large number of potential events


3.8 Chi-Square Analysis Evaluates the Influence of Chance on Genetic Data


Section 3.8: Chi-Square analysis evaluates the influence of chance on genetic data• Chance deviation from an

expected outcome is diminished by larger sample size

Chi Square Analysis

X2= ∑• O = Observed• E = Expected• ∑ = The sum of• X2 = Chi Square Value

(O-E)2

E


Section 3.8: Chi-Square Calculations and Null Hypothesis

• When we assume that data will fit a given ratio, we establish what is called the null hypothesis—so named because it assumes that there is no real difference between the measured values (or ratio) and the predicted values (or ratio)

• The apparent difference can be attributed purely to chance

Try This

• 50% of the students population at EHTHS is male, and 50% is female. Based on this information, for a class of our size, what would the expected number of male and female students be?

• Create a null hypothesis:


There is no real difference between the male to female ratio in our class compared

to the general population and that any difference is due solely to chance..

Solve for X2


X2= ∑• O = Observed• E = Expected• ∑ = The sum of• X2 = Chi Square Value

• Males O = ___• Males E = ___• Females O = ___• Females E = ___

(O-E)2

E

(Omale-Emale)2

Emale

(Ofemale-Efemale)2

EfemaleX2=


Section 3.8

• Chi-square (2) analysis is used to test how well the data fit the null hypothesis

• Table 3.3 shows the steps in 2 calculations for the F2 generation of a monohybrid cross


Section 3.8

• Chi-square analysis requires that the degree of freedom (df) be taken into account, since more deviation is expected with a higher degree of freedom (Figure 3.11)

• The degree of freedom is equal to n – 1, where n is the number of different categories into which each datum point may fallWhat are we looking at and what are the possible outcomes we could observe? How many categories? What is our degree of freedom?

Male or female, 2 categoriesdf = n-1df = 2-1 = 1


Section 3.8

• Once the number of degrees of

freedom is determined, the 2 value can be interpreted in terms of a corresponding probability value (p)

Conclusion



3.9 Pedigrees Reveal Patterns of Inheritance of Human Traits


Section 3.9

• Pedigrees reveal patterns of inheritance of human traits

• A pedigree shows a family tree with respect to a given trait. Pedigree analysis reveals patterns of inheritance

Section 3.9 Pedigree conventions

• Parents are connected by a single horizontal line, and vertical lines lead to their offspring

• If the parents are related (consanguineous), such as first cousins, they are connected by a double line

• Offspring are called sibs (siblings) and are connected by a horizontal sibship line


Section 3.9

• Twins are indicated by diagonal lines stemming from a vertical line connected to the sibship line

• For identical (monozygotic) twins, the diagonal lines are linked by a horizontal line

• Fraternal (dizygotic) twins lack this connecting line


Tell me something about I-3 or I-4


Section 3.9

• Pedigree analysis• Pedigree analysis of human traits has

been an extremely valuable tool in human genetic studies (see Table 3.4 for some examples of human traits for which pedigree analysis is very useful)


If the green pea pod allele (G) is dominant to the yellow allele (g), a cross between two heterozygous plants would be expected to produce _____.

a) all green

b) 1/4 green and 3/4 yellow

c) 1/2 green and 1/2 yellow

d) 3/4 green and 1/4 yellow

e) all yellow


If the green pea pod allele (G) is dominant to the yellow allele (g), a cross between two heterozygous plants would be expected to produce _____.

d)3/4 green and 1/4 yellow

The cross is expected to produce offspring in the genotypic proportions of 1/4 GG, 2/4 Gg, and 1/4 gg. Since G is dominant to g, 1/4 GG and 2/4 Gg = 3/4 green and 1/4 gg is yellow.


If a mouse has a dominant phenotype (P-), how would you determine if it is homozygous (PP) or heterozygous (Pp)?a) Cross it to a homozygous dominant mouse.b) Cross it to a mouse with the dominant trait but a

similarly unknown genotype.c) Cross it to a mouse with the recessive trait.d) Cross it to a heterozygous dominant mouse.e) It cannot be determined.


If a mouse has a dominant phenotype (P-), how would you determine if it is homozygous (PP) or heterozygous (Pp)?c)Cross it to a mouse with the recessive trait.

In order to identify an unknown genotype, one performs a testcross, which is a cross to a homozygous recessive individual. If there are many offspring, all with the dominant phenotype, the tested mouse is homozygous dominant. If some offspring have the recessive trait (half would be expected), the tested mouse is heterozygous.


In a cross between two individuals BbGG X Bbgg, what ratio of phenotypes would be expected in the offspring if the two genes show independent assortment?a) 1:2:1b) 9:3:3:1c) 1:1d) 3:1 e) 2:1


In a cross between two individuals BbGG X Bbgg, what ratio of phenotypes would be expected in the offspring if the two genes show independent assortment?d) 3:1

While we are looking at two genes, the "G" locus cross is GG x gg. The resultant offspring will all be Gg, and have the dominant phenotype. As a result, only theBb x Bb cross contributes to the variation.P BbGG X BbggGametes 1/2 BG, 1/2 bG 1/2 Bg, 1/2 bg

F1 1/4 BBGg, 1/4 BbGg, 1/4 bBGg, 1/4 bbGg

3 B-Gg1 bbGg


What is the probability that two parents who are heterozygous for the recessive trait of albinism will have two albino offspring?

a) 1/2

b) 1/4

c) 1/8

d) 1/16

e) 1/32


What is the probability that two parents who are heterozygous for the recessive trait of albinism will have two albino offspring?

d)1/16

For each birth, the probability that the couple will have a homozygous recessive child is 1/4. Using the product law, the probability of having two such offspring is1/4 1/4 1/16.


How many different types of gametes can be formed by the genotype AaBbCc?

a) 3b) 4c) 8d) 16e) 32


How many different types of gametes can be formed by the genotype AaBbCc?c) 8

First, you must determine the number of different heterozygous gene pairs (n) involved. Once n is determined, 2n is the number of different gametes that can be formed. Here, there are three heterozygous genes, so the correct formula is 23 = 8.The possible gametes areP genotype AaBbCc

Gametes ABC ABc AbC Abc aBC aBc abC abc

chapter 3 lecture concepts of genetics tenth edition mendelian genetics

Documents