Ce

CD

ARRAA

KCAREML

1

viaHamCIM(eryi

F

0h

Journal of Virological Methods 195 (2014) 126–133

Contents lists available at ScienceDirect

Journal of Virological Methods

journa l homepage: www.e lsev ier .com/ locate / jv i romet

haracterisation of mouse monoclonal antibodies targeting linearpitopes on Chikungunya virus E2 glycoprotein

hong Long Chua, Yoke Fun Chan, I-Ching Sam ∗

epartment of Medical Microbiology, Faculty of Medicine, University of Malaya, 50603 Kuala Lumpur, Malaysia

rticle history:eceived 23 August 2013eceived in revised form 3 October 2013ccepted 4 October 2013vailable online 14 October 2013

eywords:hikungunya viruslphaviruses

a b s t r a c t

Chikungunya virus (CHIKV) is a mosquito-borne arbovirus which has recently re-emerged globally andposes a major threat to public health. Infection leads to severe arthralgia, and disease managementremains supportive in the absence of vaccines and anti-viral interventions. The high specificities ofmonoclonal antibodies (mAbs) have been exploited in immunodiagnostics and immunotherapy in recentdecades. In this study, eight different clones of mAbs were generated and characterised. These mAbs tar-geted the linear epitopes on the CHIKV E2 envelope glycoprotein, which is the major target antigenduring infection. All the mAbs showed binding activity against the purified CHIKV virion or recombinantE2 when analysed by immunofluorescence, ELISA and Western blot. The epitopes of each mAb were

ecombinant proteins2 glycoproteinonoclonal antibody

inear epitopes

mapped by overlapping synthetic peptide-based ELISA. The epitopes are distributed at different func-tional domains of E2 glycoprotein, namely at domain A, junctions of �-ribbons with domains A and B,and domain C. Alignment of mAb epitope sequences revealed that some are well-conserved within dif-ferent genotypes of CHIKV, while some are identical to and likely to cross-react with the closely-relatedalphavirus O’nyong-nyong virus. These mAbs with their mapped epitopes are useful for the developmentof diagnostic or research tools, including immunofluorescence, ELISA and Western blot.

© 2013 Elsevier B.V. All rights reserved.

. Introduction

Chikungunya virus (CHIKV) is a re-emerging mosquito-borneirus which has caused epidemic outbreaks around the world,ncluding La Reunion, India, and Southeast Asian countries suchs Malaysia, Singapore and Thailand (Arankalle et al., 2007; Ng andapuarachchi, 2010; Schuffenecker et al., 2006). Aedes albopictusnd Aedes aegypti serve as vectors in maintaining a human-osquito–human transmission cycle. There are three genotypes of

HIKV: West African, East Central/South Africa (ECSA) and Asian.n some countries, at least two genotypes circulate; for example, in

alaysia, both Asian and ECSA genotypes have caused outbreaksAbuBakar et al., 2007; Lam et al., 2001; Noridah et al., 2007; Samt al., 2009). The prominent symptoms of CHIKV infection are fever,ash, and excruciating arthritis which may persist for months orears. To date, vaccine development is still in progress (reviewed

n Weaver et al., 2012).

CHIKV is a positive-sense RNA alphavirus within the Semilikiorest complex, together with O’nyong-nyong virus and Ross River

∗ Corresponding author. Tel.: +603 7949 2184; fax: +603 7967 5752.E-mail address: jicsam@ummc.edu.my (I-C. Sam).

166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.jviromet.2013.10.015

virus. The virion is enclosed by envelope glycoproteins (E1 and E2)and capsid protein. These structural proteins of CHIKV play cru-cial roles in virus attachment, fusion, entry and assembly (Straussand Strauss, 1994). E2 glycoprotein is the major immunodomi-nant antigen in infection (Kam et al., 2012b; Kowalzik et al., 2008).Neutralising antibodies have been detected up to 21 months afterinfection (Ayu et al., 2010; Kam et al., 2012a). CHIKV-specific anti-bodies have been showed to be the main mediator in limitinginfection in animal models (Chu et al., 2013; Lum et al., 2013). Therehas been recent interest in the development of CHIKV-specificmurine/humanised monoclonal antibodies for immunodiagnosticsand immunotherapy with broad spectrum of protection (Brehinet al., 2008; Fric et al., 2013; Kumar et al., 2012; Pal et al., 2013;Warter et al., 2011). Most of the identified epitopes were confor-mational epitopes, while linear epitopes have been identified byPEPSCAN method or computational analysis based on hydrophilic-ity, polarity, antigenicity, surface accessibility and flexibility (Kamet al., 2012a; Yathi et al., 2013). To date, CHIKV monoclonal anti-bodies targeting linear epitopes and their relevance in diagnosis

have not been explored extensively.

In this present study, monoclonal antibodies (mAbs) targetinglinear epitopes on the E2 glycoprotein were generated and charac-terised. The mAbs were evaluated in various immunoassays which

logical

hTt

2

2

iM18EsHgR1TcvtTsetq

2

SCTip(i(vhf

tfiwbteTtwccocUbrcmmcl

C.L. Chua et al. / Journal of Viro

ave the potential to be developed into reliable diagnostic tools.he mapped epitopes on E2 glycoprotein also provide insight intohe immunobiology of CHIKV.

. Materials and methods

.1. Cell lines and virus

BHK-21 cells (ATCC CCL10) were maintained in 5% heat-nactivated foetal bovine serum (FBS) Glasgow Minimal Essential

edium (Life Technologies, Grand Island, USA) supplemented with0% tryptose phosphate broth with 2% HEPES. Vero cells (CCL-1) were maintained in 10% heat-inactivated FBS Eagle Minimumssential Medium (Hyclone, Beijing, PR China). All the media wereupplemented with 1% l-glutamine and 1% penicillin/streptomycin.ybridomas were expanded in a CELLine bioreactor CL350 (Inte-ra Biosciences, Zizers, Switzerland) with 20% Ultra-Low IgG FBSPMI medium (Life Technologies) in the cell compartment, and% FBS (Biochrom, Berlin, Germany) in the medium compartment.he RPMI media was supplemented with 1% l-glutamine, 1% peni-illin/streptomycin and 1% non-essential amino acids. The CHIKVirus strain used in this study was MY/08/065, of the ECSA geno-ype, which has been previously characterised (Sam et al., 2012).he virus was propagated in Vero cells and was partially purified byucrose-cushion ultracentrifugation, as previously described (Kamt al., 2012b). The virus was re-suspended in TE buffer and quan-itated by Bradford assay (Bio-Rad, Hercules, USA). Virus titre wasuantitated by standard plaque assay.

.2. Production and purification of mouse monoclonal antibodies

CHIKV-E2 gene was cloned into pET-52b(+) vector (Novagen,an Diego, USA) (forward primer: GCGGATCCTAGCACCAAGGAAACTTCAAT; reverse primer: GCGCGGCCGCCGCTTTAGCTGTCTGATGCA) at BamH1 and Not1 restriction sites, and expressedn BL21(DE3) (Novagen). The recombinant E2 (rE2) protein wasurified under denaturing conditions using Profinity IMAC resinsBio-Rad) according to the manufacturer’s instructions. The proteindentity was verified by Western blotting and mass spectrometryMALDI-ToF/ToF). The protein was resolved on 12% SDS-PAGE andisualised by chilled 0.1 M KCl. The protein band was excised,omogenised finely in phosphate buffered saline (PBS), and boiled

or 2 min.Following approval from the Animal Care and Use Commit-

ee (ACUC) of University Malaya (ref no. MP/14/07/2010/JICS(R)),ve BALB/c mice aged 6–8 weeks were primed subcutaneouslyith 50 �g protein mixed with incomplete Freund’s adjuvant. Eight

oosters were given every 2 weeks and blood was collected prioro administration of booster. The antibody titre was monitored bynzyme-linked immunosorbent assay (ELISA) as described below.he blood from immunised mice was collected and served as posi-ive control. The immunised mouse with the highest antibody titreas sacrificed; the spleen was harvested and fused with myeloma

ells (X63, ATCC CRL1580) to generate hybridomas secreting mono-lonal antibodies. Selection of stable, positive clones and isolationf single clone was performed on the high-throughput automatedlone selection system, ClonePix FL (Molecular Devices, Sunnyvale,SA). Cell fusion, clone screening and selection were performedy InnoBiologics (Nilai, Malaysia). Some parental clones whichetained reactivity were sub-cloned by limiting dilution. Desiredlones were expanded in a bioreactor and purified by affinity chro-

atography on Protein G (GE Healthcare, Uppsala, Sweden). Mouseonoclonal antibodies were dialysed against 1× Dulbecco’s PBS,

oncentrated by Amicon Ultra-15 Centrifugal Filter (Merck Mil-ipore, Carrigtwohill, Ireland), filter-sterilised and aliquoted. The

Methods 195 (2014) 126–133 127

concentration of each antibody was quantitated by Bradford assay.The isotype of monoclonal antibodies were determined with theRapid ELISA Mouse mAb Isotyping Kit (Thermo Scientific, Rockford,USA).

2.3. Epitope-mapping using peptide-based ELISA

Eighty-four biotinylated synthetic peptides (Mimotopes, Clay-ton, Australia) covering the E2 protein region were generated,with 15-mer peptides each with a 10-mer overlap based on theCHIKV MY/08/065 sequence (accession number FN295485). Thepeptides were dissolved in dimethyl sulphoxide, further diluted to aworking concentration of approximately 15 �g/ml in PBS, and incu-bated on streptavidin-coated 96-well microplates. Supernatantfrom different hybridoma clones was harvested and incubated onthe peptide-coated plates for 1 h at room temperature. The platewas rinsed 4 times with 0.05% PBS-Tween 20 (PBST) and boundantigen-antibody complex was detected by HRP-conjugated goatanti-mouse IgG Fc (Merck Millipore, Temecula, USA) at 1:10,000dilution in 1% BSA-PBST. The plate was rinsed before addition ofTMB substrate (KPL, Gaithersburg, USA), and the optical density(OD) was measured with an Epoch plate reader (BioTek, Winooski,USA).

2.4. Indirect immunofluorescence assay

BHK cells were seeded at 104 cells per well in the chamber slide(Lab-Tek, Rochester, USA) prior to infection. The cells were infectedwith a MOI of 0.1 per well. After 24 h post-infection, the cells werefixed with 0.4% paraformaldehyde and permeabilised with 0.25%Triton-X 100. The slide was pre-incubated with Image-IT FX SignalEnhancer (Life Technologies, Eugene, USA) for 1 h and subsequentlyprobed with 5 �g/ml monoclonal antibody, followed by Alexa Fluor488 anti-mouse IgG (Life Technologies, Eugene, USA) as the sec-ondary antibody at 1:200 dilution. Cell nuclei were counter-stainedwith DAPI. The slide was mounted and observed under a NikonEclipse TE2000-E Fluorescence Microscope at 200X magnificationand the images were acquired with Nikon Digital Sight DS-Ri1(Japan) and NIS-Elements AR Imaging Software (Nikon, Version4.0).

2.5. Western blotting

Purified rE2 protein (25 �g) and purified CHIKV virion particles(80 �g) were loaded onto 12% SDS-PAGE and electro-transferred toa PVDF membrane. The membrane was blocked with 5% skimmedmilk in 0.05% PBST, assembled onto a Mini-Protean II multi screenapparatus (Bio-Rad) and probed with 5 �g/ml of each monoclonalantibody and 1:100 dilution of CHIKV anti-E2 polyclonal anti-body. Anti-mouse IgG HRP (Merck Millipore) was diluted at 1:2000.Colorimetric change was developed with metal enhanced DAB(Thermo Scientific). Images were acquired with a GS-800 densit-ometer (Bio-Rad).

2.6. Indirect ELISA

MaxiSorp plates (Nunc, Roskilde, Denmark) were coated with4 �g/ml CHIKV antigen or 1 �g/ml purified recombinant CHIKV-E2protein in 0.05 M carbonate–bicarbonate buffer (pH 9.6) and incu-bated overnight at 4 ◦C. The plates were blocked with 3% BSA-0.05%

PBST. Serially diluted mouse serum or purified monoclonal antibod-ies were added to the plates and incubated for 1 h at 37 ◦C. Boundantigen-antibody complex was detected by incubation with TMBsubstrate for 10 min before the reaction was terminated by 1 M

128 C.L. Chua et al. / Journal of Virological

Fig. 1. Sero-reactivity of CHIKV immune sera against recombinant CHIKV E2 gly-coprotein and purified CHIKV virions. Recombinant E2 (lane 1) and purified CHIKVvap

Hr

2

fw

Fmr

irions as control (lane 2) were probed with pooled CHIKV human immune sera (A)nd pooled sera from healthy controls (B) at 1:100 dilution. PageRuler Prestainedrotein ladder (Thermo Scientific) was used as marker (M).

3PO4. The absorbance was acquired at 450 nm with 630 nm as theeference wavelength using an automated ELISA reader (Bio-Tek).

.7. Computational and epitopes analysis

The structural data of CHIKV glycoproteins was obtainedrom the Protein Data Bank (PDB, ID 3N44) and viewedith UCSF CHIMERA software (Pettersen et al., 2004). The

ig. 2. Epitope mapping of mAbs by overlapping synthetic peptide-based ELISA, using 1 �Ab. The assay was performed in triplicate and the error bars indicate the mean and SD

eferred to the web version of the article.)

Methods 195 (2014) 126–133

mapped epitopes were highlighted on the structure at surface-exposed and ribbon views. The identified epitopes distributedon CHIKV E2 glycoprotein were compared and aligned withother alphaviruses of the Semliki Forest complex using ClustalW2 (Thompson et al., 2002). The GenBank accession num-bers for sequences used in this study are: Chikungunya(CHIKV/MY/08/065, FN295485; CHIKV/MY/06/37348, FN295483;CHIKV/S27, AF369024; CHIKV/37997, AY726732), O’nyong-nyong(ONNV, ACC97205), Ross River (RRV, AAA47404), Sagimaya (SAGV,AAO33337), Semliki Forest (SFV, CAA27742), Mayaro (MAYV,AAO33335), Middleburg (MIDDV, AA033343), Barmah Forest (BFV,AA033347), and Eastern equine encephalitis (EEEV, AAT96380).

3. Results

3.1. Sero-reactivity of CHIKV rE2 protein

Pooled CHIKV human immune sera, from ten patients with con-

firmed CHIKV infection, had specific CHIKV-reactive antibodieswhich recognised the main structural proteins (E1/E2 glycopro-tein and capsid) of purified CHIKV virions at 56 kDa and 35 kDa,respectively (Fig. 1A). The rE2 glycoprotein reacted with the pooled

g/ml of each mAb. The coloured sequences indicate the respective epitope for each. (For interpretation of the references to colour in this figure legend, the reader is

C.L. Chua et al. / Journal of Virological Methods 195 (2014) 126–133 129

Fig. 3. (A) Indirect immunofluorescence assay to investigate the binding of the mAbs in CHIKV-infected BHK-21 cells. Mock-infected BHK-21 cells served as a negative control.The presence of CHIKV antigen was detected as bright green fluorescence. MAb C-B2(C9) stained weakly as indicated by the white arrows. (B) Western blot showing bindingo ng coC restaint due tp

iciEo

3p

Cm

f the mAbs to purified CHIKV antigen and recombinant E2 protein under denaturi-B2(C9); 7, E-G6(A6), 8, N-B10(B11) and 9, polyclonal anti-CHIKV E2. PageRuler Pested at 5 �g/ml (except N-B10(B11), which was tested at 1 �g/ml for indirect IFositive control in both experiments.

mmune sera, at 55 kDa (Fig. 1A). Pooled sera from ten healthyontrols exhibited sero-negativity as no bands were detected inmmunoblot (Fig. 1B). Similar findings were seen with indirectLISA (data not shown), which confirms the antigenic propertiesf the rE2.

.2. Generation and production of mAbs specific to CHIKV rE2rotein

Positive hybrid clones were screened using indirect ELISA withHIKV antigen and rE2 protein. Clones were selected by auto-ated ClonePixFL and limiting dilution. From a total of 235 parental

nditions. Lane 1, A-A9(A1); 2, B-D2(C4); 3, O-G12(B1); 4, F-G6(F6); 5, D-E3(D8); 6,ed protein ladder (Thermo Scientific) was used as the marker (M). All mAbs were

o high background), while polyclonal anti-CHIKV E2 at 1:100 dilution served as a

clones, 37 clones demonstrated reactivity against CHIKV anti-gen. Eight stable clones were successfully isolated, expanded,and purified with protein G column. Clones A-A9(A1) and B-D2(C4) displayed strong affinity against purified CHIKV virionsin ELISA, while the rest of the clones demonstrated moderateto weak affinity. The characteristics of the different clones ofE2-reactive mAbs are summarised in Table 1. Plaque reductionneutralisation test was performed in Vero cells to assess the

neutralising activity of purified CHIKV-E2-reactive mAbs at con-centrations ranging from 0.001 �g/ml to 100 �g/ml. None of theclones were able to reduce plaque infectivity at concentrations upto 100 �g/ml.

130 C.L. Chua et al. / Journal of Virological Methods 195 (2014) 126–133

Table 1Characteristics of different clones of E2-reactive monoclonal antibodies.

Clone IgG subclass, light chain Matched epitope Epitope locationa Domain binding site CHIKV reactivityb OD of bindingactivityc

Indirect IF ELISA WB

C-B2(C9) IgG1, � LAHCPDCGEGHSCHS 16–30 A + + + 0.42 ± 0.15F-G6(F6) IgG2a, � ADAERAGLFV 76–85 A ++ + ++ 0.54 ± 0.01O-G12(B1) IgG1, � THPFHHDPPV 126–135 Junction of A and �-ribbon ++ ++ +++ 1.07 ± 0.09B-D2(C4) IgG1, � EIEVHMPPDT 166–175 Junction of �-ribbon and B +++ +++ +++ 1.81 ± 0.04N-B10(B11) IgG3, � EIEVHMPPDT 166–175 Junction of �-ribbon and B +++ + +++ 0.70 ± 0.07A-A9(A1) IgG1, � GEEPNYQEEW 301–310 C ++ +++ +++ 1.69 ± 0.15E-G6(A6) IgG3, � VPTEGLEVTW 321–330 C +++ + ++ 0.46 ± 0.05D-E3(D8) IgG1, � GNNEPYKYWP 331–340 C ++ ++ ++ 1.11 ± 0.11

a The first amino acid from E2 is annotated as 1.linked immunosorbent assay (ELISA) and western blotting (WB), and rated accordingly:

(tially purified CHIKV virion particles at 10 �g/ml.

3

wp2aIcw5mpBmAT

3

viptitTamc

p(fNwco

rotnd1ro

b CHIKV reactivity was evaluated by indirect immunofluorescence (IF), enzyme-+++) strong, (++) moderate and (+) weak.

c Mean optical density (OD) ± standard deviation of mAbs binding activity to par

.3. Epitope-mapping of CHIKV-E2 reactive mAbs

Epitope-mapping of these rE2 reactive mAbs was performedith the PEPSCAN method on 84 biotinylated overlapping syntheticeptides. Each mAb showed similar reactivity/OD reading to at leastoverlapping peptides, and the epitope for each mAb was identifieds the overlapping 10 amino acid sequence of the 2 peptides (Fig. 2).n contrast, clone C-B2(C9) had different reactivity against 2 adja-ent peptides; reactivity against peptide 4 (LAHCPDCGEGHSCHS)as higher compared to peptide 5 (DCGEGHSCHSPVALE). The firstamino acid residues (LAHCP) in peptide 4 could contribute to theaximum binding capacity of this mAb. Therefore, the sequence of

eptide 4 was assigned as the epitope sequence for C-B2(C9). Clones-D2(C4) and N-B10(B11) shared the same epitope, although bothAbs were of different IgG subclass (IgG1 and IgG3, respectively).ll the matched epitopes of mAbs and their locations are listed inable 1.

.4. Binding activity of CHIKV-E2 reactive mAbs

Indirect immunofluorescence assay (IF), Western blotting andirus-based ELISA were employed to investigate the binding activ-ty of the mAbs. CHIKV anti-E2 polyclonal antibodies served asositive control in all these assays. For the indirect IF, the use of allhe mAbs led to staining of the CHIKV-infected BHK cells with vary-ng intensity. Clones B-D2(C4), N-B10(B11) and E-G6(A6) stainedhe infected cells strongly, while C-B2(C9) stained the cells weakly.he mAbs bound to endogenous E2 viral glycoproteins which werectively synthesised in infected cells, and none of them bound toock-infected cells (Fig. 3A). Therefore, the mAbs are highly spe-

ific to CHIKV but not to other cellular elements.In Western blotting analysis, the mAbs detected both E2 viral

rotein from CHIKV and rE2 with varying levels of binding activityFig. 3B). However, when CHIKV antigen was blotted, an antigenicragment at 40 kDa was detected by clones A-A9(A1), B-D2(C4) and-B10(B11), but not the others. A similar observation was noticedhen polyclonal anti-CHIKV E2 antibody was used as the positive

ontrol, and this antigenic fragment could be a proteolytic productf the E2 glycoprotein.

Indirect virus-based ELISA was also performed to examine theeactivity and sensitivity of these mAbs in binding to native viri-ns. All the mAbs bound to virus in indirect ELISA, suggesting thatheir epitopes on the E2 glycoprotein could present on the exter-al surface of the virion. Binding of the mAbs to virions exhibited a

ose-dependent effect with amounts of mAbs ranging from 10−3 to03 ng (Fig. 4). Clones B-D2(C4) and A-A9(A1) showed the strongesteactivity of all the mAbs, and reached binding saturation at 100 ngf mAbs.

Fig. 4. Binding activity of different mAbs at different amounts against 400 ng ofpurified CHIKV virions per well using ELISA. The assay was performed in triplicateand the error bars indicate the mean and SD.

The reactivity of all the mAbs from the 3 experiments (indirectIF, Western blot and ELISA) are summarised in Table 1.

3.5. Epitopes localisation and alignment

Computational modelling was used to map the epitopes of mAbsbound to the native CHIKV particle (Fig. 5A). Structural visualisationshowed that some epitopes are exposed at the surface of the E2glycoprotein, and some are buried in the E1/E2 heterodimer spikes(Fig. 5B and C). Interestingly, the epitopes of the most reactive mAbssuch as clones A-A9(A1), B-D2(C4) and N-B10(B11) are not readilyexposed on the surface of the E1/E2 heterodimers.

The epitopes of the mAbs were compared with the sequences ofa representative strain from each CHIKV genotype (MY/06/37348,Asian; S27, ECSA prototype; 37997, West African), as well as withother alphaviruses categorised under the Semliki Forest complex.Clones C-B2(C9), B-D2(C4), E-G6(A6) and D-E3(D8) recognised epi-topes which are well-conserved within CHIKV, in the 4 selectedsequences as well as other published CHIKV sequences (134sequences in total, data not shown) (Fig. 6). However, epitopesfrom clones C-B2(C9) and B-D2(C4) are identical with the ONNVsequence. CHIKV epitopes otherwise have differences with theother alphaviruses of this complex.

4. Discussion

In this study, a panel of E2-reactive mAbs were generated andcharacterised. The epitopes recognised by the mAbs were identifiedby peptide-based ELISA, and the epitopes positions were located.The E2 glycoprotein was chosen as it is the major viral protein

C.L. Chua et al. / Journal of Virological Methods 195 (2014) 126–133 131

Fig. 5. Localisation of the CHIKV E2 epitopes of the monoclonal antibodies. (A) Schematic diagram of the E2 protein showing the positions of the domains, with asterisks indifferent colours corresponding to the mapped epitopes. The numbers refer to the amino acid positions within the CHIKV E2 demarcating the domains. C. arch, central arch;T re ofd yellowt on of

ieChesnaSdtttm

M, transmembrane; C. tail, cytoplasmic tail. (B) The coloured regions on the structuC, domain C. (C) Localisation of epitopes on triplets of E1 (in grey) and E2 (in palehe references to colour in this figure legend, the reader is referred to the web versi

nvolved in host-cell receptor interaction by alphaviruses (Smitht al., 1995), and the major target of the immune response againstHIKV (Kam et al., 2012b). The E2-reactive antibodies in CHIKVuman immune sera could recognise rE2 protein strongly in West-rn blotting. The E2 glycoprotein belongs to the immunoglobulinuperfamily, and consists of 3 structural domains: domain A (span-ing residues 16–133), domain B (spanning residues 173–230),nd domain C (spanning residues 271–341) (Voss et al., 2010).everal mAbs that target domain A and domain B have beenescribed, which block fusion and inhibit the interaction with

he cellular receptor (Pal et al., 2013; Sun et al., 2013); howeverhe mAbs in this study that target linear epitopes distributed onhese regions are non-neutralising. Apart from this, some of the

Abs in this study had linear epitopes which were also found to

the E2 glycoprotein correspond to the listed epitopes. dA, domain A; dB, domain B;) of the E–E2 heterodimer complex (based on PDB ID 3J2W). (For interpretation of

the article.)

be B-cell linear epitopes shared between human and mice (Lumet al., 2013), such as 301GEEPNYQEEW310, 321VPTEGLEVTW330, and331GNNEPYKYWP340 distributed in domain C. It is most likely thatthe major neutralising sites on the CHIKV E2 glycoprotein arepresent in a conformational-dependent manner instead of as lin-ear epitopes. To date, only a single linear peptide “E2EP3”, derivedfrom the N-terminal of E2 glycoprotein, has been shown to induceneutralising antibodies in humans, and antibodies which provideprotective immunity in a mouse model (Kam et al., 2012b).

Binding activities of the mAbs were assessed by various

immunological assays. Indirect ELISA and immunofluorescenceassay demonstrated that clones A-A9(A1) and B-D2(C4) have supe-rior binding to native virus particles compared to the other mAbs.Poor antibody affinity could be an explanation for the weak

132 C.L. Chua et al. / Journal of Virological Methods 195 (2014) 126–133

F s of ds rencew

rbcltvpdoub

wctbtwpa(p(viewta3

(fTsa(c

Fric, J., Bertin-Maghit, S., Wang, C.I., Nardin, A., Warter, L., 2013. Use of human

ig. 6. Alignment of the mAb epitopes sequences with E2 sequences of CHIKV strainequence from CHIKV/08/065 was used as the reference sequence. Amino acid diffeithin CHIKV isolates are highlighted in black.

eactivity of mAbs C-B2(C9) and F-G6(F6) despite their epitopeseing exposed at the surface tips of the spikes, while mAb A-A9(A1)ould possess strong affinity for its epitope, despite its unexposedocation within the E1-E2 heterodimers. A further possibility is thathe number of accessible epitope sites could be different in nativeirus particles compared to endogenous newly synthesised viralrotein, due to alteration of structural proteins under different con-itions. The ELISA results support this possibility (Fig. 3), as nonef the mAbs except A-A9(A1) and B-D2(C4) achieved binding sat-ration point at 103 ng of CHIKV, suggesting that the occupancy ofinding sites by these antibodies had not reached saturation level.

The homologous sequences of each epitope were comparedith other representative alphaviruses in the Semliki Forest

omplex, including different genotypes of CHIKV, in an attempto predict cross-reactivity. There were a number of differencesetween CHIKV and the other alphaviruses, except for the epi-opes 16LAHCPDCGEGHSCHS30 and 166EIEVHMPPDT175, whichere identical in CHIKV and ONNV. CHIKV and ONNV have beenreviously described as sharing a one-way cross-reactivity, withnti-CHIKV antibodies reacting against both CHIKV and ONNVPowers et al., 2000). This likely cross-reactivity would limitotential diagnostic applications of the three mAbs involvedC-B2(C9), B-D2(C4) and N-B10(B11)) in countries where bothiruses circulate. At present, ONNV has only been describedn East, West and Central Africa (Powers et al., 2000; Poseyt al., 2005). The homologous sequences were also comparedithin representatives of different genotypes of CHIKV. Epi-

opes derived from the West African genotype have at least 1mino acid difference from the other genotypes, while epitopes21VPTEGLEVTW330 (mAb E-G6(A6)) and 331GNNEPYKYWP340

mAb D-E3(D8)) are well-conserved within CHIKV, and differrom ONNV (1 amino acid difference) and the other alphaviruses.hese mAbs E-G6(A6) and D-E3(D8) could be useful in diagno-is or surveillance, to differentiate CHIKV from other alphaviruses

nd arboviruses which share similar clinical manifestationsSam et al., 2011), although the mAb specificities should beonfirmed.

ifferent genotypes and other alphaviruses from the Semliki Forest complex. The E2s between CHIKV and other alphaviruses are highlighted in grey, while differences

In conclusion, the CHIKV anti-E2 mAbs described here arepotentially useful for diagnostic applications (such as ELISA andimmunofluorescence), and knowledge of their epitopes are valu-able in studies of CHIKV virology or immunology, including antigenlocalisation during infection.

Acknowledgements

This study was funded by grants from University of Malaya(Postgraduate Research Fund PG114-2012B and HIR grantE000013-20001), the Ministry of Education, Malaysia (FRGS grantFP036-2013A), and the European Union Seventh Framework Pro-gramme FP7/2007–2013 Integrated Chikungunya Research grant(number 261202). We thank Dr Lisa F.P. Ng (Singapore ImmunologyNetwork, A*STAR) for kindly sharing the virus purification protocolused in this study.

References

AbuBakar, S., Sam, I.C., Wong, P.F., MatRahim, N., Hooi, P.S., Roslan, N., 2007. Reemer-gence of endemic Chikungunya, Malaysia. Emerg. Infect. Dis. 13, 147–149.

Arankalle, V.A., Shrivastava, S., Cherian, S., Gunjikar, R.S., Walimbe, A.M., Jadhav, S.M.,Sudeep, A.B., Mishra, A.C., 2007. Genetic divergence of Chikungunya viruses inIndia (1963–2006) with special reference to the 2005–2006 explosive epidemic.J. Gen. Virol. 88, 1967–1976.

Ayu, S.M., Lai, L.R., Chan, Y.F., Hatim, A., Hairi, N.N., Ayob, A., Sam, I.C., 2010. Sero-prevalence survey of Chikungunya virus in Bagan Panchor, Malaysia. Am. J. Trop.Med. Hyg. 83, 1245–1248.

Brehin, A.C., Rubrecht, L., Navarro-Sanchez, M.E., Marechal, V., Frenkiel, M.P.,Lapalud, P., Laune, D., Sall, A.A., Despres, P., 2008. Production and characteri-zation of mouse monoclonal antibodies reactive to Chikungunya envelope E2glycoprotein. Virology 371, 185–195.

Chu, H., Das, S.C., Fuchs, J.F., Suresh, M., Weaver, S.C., Stinchcomb, D.T., Partidos,C.D., Osorio, J.E., 2013. Deciphering the protective role of adaptive immunity toCHIKV/IRES a novel candidate vaccine against Chikungunya in the A129 mousemodel. Vaccine 31, 3353–3360.

monoclonal antibodies to treat Chikungunya virus infection. J. Infect. Dis. 207,319–322.

Kam, Y.W., Lee, W.W., Simarmata, D., Harjanto, S., Teng, T.S., Tolou, H., Chow, A.,Lin, R.T., Leo, Y.S., Renia, L., Ng, L.F., 2012a. Longitudinal analysis of the human

logical

K

K

K

L

L

N

N

P

P

P

P

C.L. Chua et al. / Journal of Viro

antibody response to Chikungunya virus infection: implications for serodiagno-sis and vaccine development. J. Virol. 86, 13005–13015.

am, Y.W., Lum, F.M., Teo, T.H., Lee, W.W., Simarmata, D., Harjanto, S., Chua, C.L.,Chan, Y.F., Wee, J.K., Chow, A., Lin, R.T., Leo, Y.S., Le Grand, R., Sam, I.C., Tong,J.C., Roques, P., Wiesmuller, K.H., Renia, L., Rotzschke, O., Ng, L.F., 2012b. Earlyneutralizing IgG response to Chikungunya virus in infected patients targets adominant linear epitope on the E2 glycoprotein. EMBO Mol. Med. 4, 330–343.

owalzik, S., Xuan, N.V., Weissbrich, B., Scheiner, B., Schied, T., Drosten, C., Muller,A., Stich, A., Rethwilm, A., Bodem, J., 2008. Characterisation of a chikungunyavirus from a German patient returning from Mauritius and development of aserological test. Med. Microbiol. Immunol. 197, 381–386.

umar, J., Khan, M., Gupta, G., Bhoopati, M., Lakshmana Rao, P.V., Parida, M., 2012.Production, characterization, and application of monoclonal antibodies specificto recombinant (E2) structural protein in antigen-capture ELISA for clinical diag-nosis of Chikungunya virus. Viral. Immunol. 25, 153–160.

am, S.K., Chua, K.B., Hooi, P.S., Rahimah, M.A., Kumari, S., Tharmaratnam, M., Chuah,S.K., Smith, D.W., Sampson, I.A., 2001. Chikungunya infection – an emergingdisease in Malaysia. Southeast Asian J. Trop. Med. Public Health 32, 447–451.

um, F.M., Teo, T.H., Lee, W.W., Kam, Y.W., Renia, L., Ng, L.F., 2013. An essential roleof antibodies in the control of chikungunya virus infection. J. Immunol. 190,6295–6302.

g, L.C., Hapuarachchi, H.C., 2010. Tracing the path of Chikungunya virus – evolutionand adaptation. Infect. Genet. Evol. 10, 876–885.

oridah, O., Paranthaman, V., Nayar, S.K., Masliza, M., Ranjit, K., Norizah, I., Chem,Y.K., Mustafa, B., Kumarasamy, V., Chua, K.B., 2007. Outbreak of chikungunyadue to virus of Central/East African genotype in Malaysia. Med. J. Malaysia 62,323–328.

al, P., Dowd, K.A., Brien, J.D., Edeling, M.A., Gorlatov, S., Johnson, S., Lee, I., Akahata,W., Nabel, G.J., Richter, M.K., Smit, J.M., Fremont, D.H., Pierson, T.C., Heise, M.T.,Diamond, M.S., 2013. Development of a highly protective combination mono-clonal antibody therapy against Chikungunya virus. PLoS Pathog. 9, e1003312.

ettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng, E.C.,Ferrin, T.E., 2004. UCSF Chimera – a visualization system for exploratory researchand analysis. J. Comput. Chem. 25, 1605–1612.

osey, D.L., O’Rourke, T., Roehrig, J.T., Lanciotti, R.S., Weinberg, M., Maloney, S., 2005.O’Nyong-nyong fever in West Africa. Am. J. Trop. Med. Hyg. 73, 32.

owers, A.M., Brault, A.C., Tesh, R.B., Weaver, S.C., 2000. Re-emergence of Chikun-gunya and O’nyong-nyong viruses: evidence for distinct geographical lineagesand distant evolutionary relationships. J. Gen. Virol. 81, 471–479.

Methods 195 (2014) 126–133 133

Sam, I.C., Chan, Y.F., Chan, S.Y., Loong, S.K., Chin, H.K., Hooi, P.S., Ganeswrie, R.,Abubakar, S., 2009. Chikungunya virus of Asian and Central/East African geno-types in Malaysia. J. Clin. Virol. 46, 180–183.

Sam, I.C., Chua, C.L., Chan, Y.F., 2011. Chikungunya virus diagnosis in the developingworld: a pressing need. Expert Rev. Anti Infect. Ther. 9, 1089–1091.

Sam, I.C., Loong, S.K., Michael, J.C., Chua, C.L., Wan Sulaiman, W.Y., Vythilingam, I.,Chan, S.Y., Chiam, C.W., Yeong, Y.S., AbuBakar, S., Chan, Y.F., 2012. Genotypic andphenotypic characterization of Chikungunya virus of different genotypes fromMalaysia. PLoS One 7, e50476.

Schuffenecker, I., Iteman, I., Michault, A., Murri, S., Frangeul, L., Vaney, M.C.,Lavenir, R., Pardigon, N., Reynes, J.M., Pettinelli, F., Biscornet, L., Diancourt, L.,Michel, S., Duquerroy, S., Guigon, G., Frenkiel, M.P., Brehin, A.C., Cubito, N.,Despres, P., Kunst, F., Rey, F.A., Zeller, H., Brisse, S., 2006. Genome microevo-lution of chikungunya viruses causing the Indian Ocean outbreak. PLoS Med. 3,e263.

Smith, T.J., Cheng, R.H., Olson, N.H., Peterson, P., Chase, E., Kuhn, R.J., Baker, T.S., 1995.Putative receptor binding sites on alphaviruses as visualized by cryoelectronmicroscopy. Proc. Natl. Acad. Sci. U. S. A. 92, 10648–10652.

Strauss, J.H., Strauss, E.G., 1994. The alphaviruses: gene expression, replication, andevolution. Microbiol. Rev. 58, 491–562.

Sun, S., Xiang, Y., Akahata, W., Holdaway, H., Pal, P., Zhang, X., Diamond, M.S., Nabel,G.J., Rossmann, M.G., 2013. Structural analyses at pseudo atomic resolution ofChikungunya virus and antibodies show mechanisms of neutralization. eLife 2,e00435.

Thompson, J.D., Gibson, T.J., Higgins, D.G., 2002. Multiple Sequence Alignment UsingClustalW and ClustalX, Curr. Protoc. Bioinformatics (Chapter 2, Unit 2.3).

Voss, J.E., Vaney, M.C., Duquerroy, S., Vonrhein, C., Girard-Blanc, C., Crublet, E.,Thompson, A., Bricogne, G., Rey, F.A., 2010. Glycoprotein organization of Chikun-gunya virus particles revealed by X-ray crystallography. Nature 468, 709–712.

Warter, L., Lee, C.Y., Thiagarajan, R., Grandadam, M., Lebecque, S., Lin, R.T., Bertin-Maghit, S., Ng, L.F., Abastado, J.P., Despres, P., Wang, C.I., Nardin, A., 2011.Chikungunya virus envelope-specific human monoclonal antibodies with broadneutralization potency. J. Immunol. 186, 3258–3264.

Weaver, S.C., Osorio, J.E., Livengood, J.A., Chen, R., Stinchcomb, D.T., 2012.

Chikungunya virus and prospects for a vaccine. Expert Rev. Vaccines 11,1087–1101.

Yathi, K.K., Bhasker, S., Chinnamma, M., 2013. Determination of B cell epitopes andevaluation of antigen capture ELISA for the earlier diagnosis of CHIK virus usinganti-rCHIK E1 rabbit antibodies. J. Immunol. Methods 393, 45–52.