Characterization of a Streptococcus suis tet(O/W/32/O)-CarryingElement Transferable to Major Streptococcal Pathogens

Claudio Palmieri,a Gloria Magi,a Marina Mingoia,a Patrizia Bagnarelli,a Sandro Ripa,b Pietro E. Varaldo,a and Bruna Facinellia

Department of Biomedical Sciences and Public Health, Section of Microbiology, Polytechnic University of Marche, Ancona,a and School of Biosciences and Biotechnology,University of Camerino, Camerino,b Italy

Mosaic tetracycline resistance determinants are a recently discovered class of hybrids of ribosomal protection tet genes. Theymay show different patterns of mosaicism, but their final size has remained unaltered. Initially thought to be confined to a smallgroup of anaerobic bacteria, mosaic tet genes were then found to be widespread. In the genus Streptococcus, a mosaic tet gene[tet(O/W/32/O)] was first discovered in Streptococcus suis, an emerging drug-resistant pig and human pathogen. In this study,we report the molecular characterization of a tet(O/W/32/O) gene-carrying mobile element from an S. suis isolate. tet(O/W/32/O) was detected, in tandem with tet(40), in a circular 14,741-bp genetic element (39.1% G�C; 17 open reading frames [ORFs]identified). The novel element, which we designated 15K, also carried the macrolide resistance determinant erm(B) and an amino-glycoside resistance four-gene cluster including aadE (streptomycin) and aphA (kanamycin). 15K appeared to be an unstable geneticelement that, in the absence of recombinases, is capable of undergoing spontaneous excision under standard growth conditions.In the integrated form, 15K was found inside a 54,879-bp integrative and conjugative element (ICE) (50.5% G�C; 55 ORFs),which we designated ICESsu32457. An �1.3-kb segment that apparently served as the att site for excision of the unstable 15Kelement was identified. The novel ICE was transferable at high frequency to recipients from pathogenic Streptococcus species (S.suis, Streptococcus pyogenes, Streptococcus pneumoniae, and Streptococcus agalactiae), suggesting that the multiresistance 15Kelement can successfully spread within streptococcal populations.

Mosaic tetracycline resistance genes are a recently discoveredclass of hybrids of ribosomal protection tet genes (34). The

mosaic tet genes found so far have shown different patterns ofmosaicism, but the final size of the genes has remained unaltered.It is under debate whether they represent a previously undetectedfeature or a recent event in the evolution of tet genes. Mosaicderivatives of tet(O) and tet(W) were first detected in the Gram-negative anaerobe Megasphaera elsdenii from the swine intestine(31). In fact, a tet(O/32/O) mosaic gene, initially reported astet(32), had previously been described in a Clostridium-relatedhuman isolate (22, 32). At first thought to be confined to a smallgroup of anaerobic bacteria (28), mosaic tet genes were then foundto be abundant in human and animal fecal samples (26). Othermosaic tet genes were later detected in organisms of genera Clos-tridium (19, 26), Bifidobacterium, and Lactobacillus (35).

In the genus Streptococcus, a mosaic tet gene [tet(O/W/32/O)]was first reported in Streptococcus suis-–an emerging drug-resis-tant pig and human pathogen (12, 21, 25, 36)—in a survey, whereit was found to be second in frequency only to tet(O) among tetdeterminants (27). High rates of S. suis resistance to tetracyclines(up to �90%) have been reported in pig isolates worldwide (13,27, 37, 41), probably reflecting the broad use of these antibiotics inpiggeries. Tetracycline resistance in S. suis is mainly due to theribosomal protection genes tet(O) and tet(M); tet(W) and the ef-flux genes tet(B), tet(L), and tet(40) have also been reported (25).Recent studies (20, 24) and the analyses of sequenced genomes (6,15–18, 39, 40) have provided significant insights into the S. suisresistome, leading to the identification of several genetic elementscarrying tet genes: primarily integrative and conjugative elements(ICEs), but also transposons, genomic islands, phages, and chime-ric elements (25). A key role of ICEs in the dissemination of tet andother resistance genes has recently been reported, besides in S.

suis, in major streptococcal pathogens such as S. pyogenes (3, 5, 11)and S. pneumoniae (7, 23).

The present study reports the molecular characterization of thetet(O/W/32/O) gene-carrying element from an S. suis pig isolate(27). The mosaic tet gene was detected, in tandem with tet(40), ina 14,741-bp unstable genetic element capable of undergoing spon-taneous excision in the absence of recombinases. This elementalso carried macrolide [erm(B)] and aminoglycoside (aadE, aphA)resistance genes. In the integrated form, it was found inside an ICE(54,879 bp) that was transferable at high frequency to pathogenicStreptococcus species.

MATERIALS AND METHODSBacterial strains. S. suis 32457, the tet(O/W/32/O)-carrying strain used inthis study, was isolated from the lung of a diseased pig in a recent survey ofS. suis isolates in Italy (27). It was highly resistant to tetracycline (MIC,�256 �g/ml) and erythromycin [MIC, �256 �g/ml; erm(B) genotype].

Antimicrobials and susceptibility tests. Tetracycline, erythromycin,streptomycin, and kanamycin were purchased from Sigma Chemical Co.,St. Louis, MO. MICs were determined by a standard broth microdilutionmethod.

Amplification experiments. The principal primers used in PCR ex-periments are listed in Table 1. DNA preparation and amplification andelectrophoresis of PCR products were carried out by established proce-dures. The Ex Taq system (TaKaRa Bio, Shiga, Japan) was used when the

Received 22 March 2012 Returned for modification 25 April 2012Accepted 10 June 2012

Published ahead of print 18 June 2012

Address correspondence to Bruna Facinelli, b.facinelli@univpm.it.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AAC.00629-12

September 2012 Volume 56 Number 9 Antimicrobial Agents and Chemotherapy p. 4697–4702 aac.asm.org 4697

on Decem

ber 19, 2018 by guesthttp://aac.asm

.org/D

ownloaded from

expected PCR products exceeded 3 kb in size. The four att sequences wereinvestigated by PCR-restriction fragment length polymorphism (RFLP)analysis using HindIII endonuclease (Roche Applied Science, Basel, Swit-zerland).

DNA sequencing and sequence analysis. PCR products were purifiedusing Montage purification columns (Millipore Corporation, Bedford,MA). Sequencing was carried out using ABI Prism (Perkin-Elmer AppliedBiosystems, Foster City, CA) with dye-labeled terminators. Sequenceswere analyzed using the Sequence Navigator software package (Perkin-Elmer). Open reading frames (ORFs) were predicted using the ORFFinder software (http://ncbi.nlm.nih.gov/gorf/gorf.html). Criteria to de-sign a potential ORF were the existence of a start codon and a minimumcoding size of 50 amino acids. Sequence similarity searches were carriedout using BLAST (http://www.ncbi.nlm.nih.gov).

Conjugal transfer experiments. Four rifampin- and fusidic acid-re-sistant (RF) derivatives of tetracycline- and erythromycin-susceptiblestrains of different species were used as recipients in mating experimentswith S. suis 32457 as the donor: S. suis v36RF (27), Streptococcus pyogenes12RF (9), Streptococcus pneumoniae R6RF, and Streptococcus agalactiae1357RF. Transfer experiments were performed with a membrane filter(9), and selection was performed with suitable antibiotic concentrations.To rule out the contribution of transformation to the genetic exchange

during conjugation, matings were carried out in the presence of 10 mg/mlDNase I (Sigma) (30). The frequency of transfer was expressed as thenumber of transconjugants per recipient. Transfer experiments were donea minimum of three times.

PFGE and hybridization experiments. Macrorestriction with SfiI en-donuclease (Roche) and pulsed-field gel electrophoresis (PFGE) analysiswere performed as described elsewhere (27). SfiI was used instead of SmaIbecause a SmaI restriction site was found in the genetic element investi-gated. Southern blotting and hybridization assays were done as describedpreviously (10) using probes obtained by PCR with the oligonucleotideprimers reported in Table 1.

Nucleotide sequence accession number. The nucleotide sequence ofICESsu32457 has been submitted to the GenBank/EMBL sequence data-base and assigned accession number FR823304.

RESULTS AND DISCUSSION

The tet(O/W/32/O)-carrying element from strain 32457 was in-vestigated by combining conjugation experiments, PFGE, hybrid-ization assays, PCR, restriction analysis, and sequence analysis.

Evidence of a 50- to 60-kb mobile element carrying tet(O/W/32/O) and erm(B). In mating experiments, tetracycline resistancewas successfully transferred at high frequency from S. suis 32457to the recipients of all four species (S. suis, S. pyogenes, S. pneu-moniae, and S. agalactiae) (Table 2). All transconjugants carriednot only tet(O/W/32/O) but also erm(B), suggesting a linkage be-tween the two resistance genes in a mobile element. The transcon-jugants exhibited the same tetracycline and erythromycin MICs asthe donor.

Five randomly chosen transconjugants from each mating assaywere used in experiments aimed at confirming and characterizingthe transferred element. Results of SfiI PFGE analysis and hybrid-ization assays, performed with the recipients and the transconju-gants, were consistent with the existence of a 50- to 60-kb mobileelement carrying tet(O/W/32/O) and erm(B) in the genome of thetransconjugants.

PCR detection of a circular 14,741-bp tet(O/W/32/O)- anderm(B)-carrying element. The putative genetic linkage betweentet(O/W/32/O) and erm(B) was explored in PCR experiments bytesting all four combinations of forward/reverse primers internalto the two genes. Interestingly, two combinations yielded a differ-ent PCR product each (11,543 bp and 4,305 bp) (Fig. 1A). Se-quencing of the two amplicons, together with further PCR exper-iments with primers external to tet(O/W/32/O) and erm(B),clearly demonstrated a circular element (14,741 bp; 39.1% G�C;containing an SmaI restriction site). Seventeen ORFs, of which14 were transcribed in the same direction as the resistance genesand 3 in the opposite direction, were identified in this element, whichwe designated 15K. Additional antibiotic resistance genes—namely,

TABLE 1 Principal oligonucleotide primers used in this study

Gene

PrimerSource orreferenceDesignation Sequence (5=–3=)

tet(O/W/32/O) tetWFa GGAGGAAAATACCGACATA 26tet(O/W/32/O) tet32Ra CTCTTTCATAGCCACGCC 26erm(B) ermBFb TCATCTATTCAACTTATCGTC This studyerm(B) ermBRb CTGTGGTATGGCGGGTAAG This studyorf805-SC84c PAI1 CACGCATCTCGTAGAGTTTGAC 6orf807-SC84c intF GATCTTGGAATCGATCCAGT This studyorf807-SC84c intR TTCACCTGCTGGAGTTTTTG This studyorf846-SC84c primF GTGGCAGGTGTTACTTTC This studyorf846-SC84c primR GTCGTCTCTTGTATTGCCTG This studyorf870-SC84c SNF2F TACTTCACTTTGAGACAGATG This studyorf870-SC84c SNF2R TAGTTGAGTTACCGAGGC This studyorf877-SC84c virBF GGTCGAATGGGTCTTTGTCT This studyorf877-SC84c virBR GCTTGGTGTGTTGTGGGATC This studyorf889-SC84c repAF GTGTCATCTCGTGGCTATTT This studyorf889-SC84c repAR GCCCCATCCTCATCAATCC This studyorf891-SC84c rplLF AAAGTTGGCGTTATCAAAG This studyDNA primased A CGTGTCATCTTGTCTCCCTA This study15K-leftd B AAAAAGCCCTACAATGCCGT This study15K-rightd C ATAATGATTTTGCCATTGTC This studySNF2 helicased D GTCAAGAAATCACAAAAGGAG This studya Also used to obtain a probe specific for the tet(O/W/32/O) gene.b Also used to obtain a probe specific for the erm(B) gene.c Numbered according to the reported sequence of the genome of Streptococcus suisSC84 (accession no. FM252031).d Used in PCR-RFLP experiments to investigate att sequences.

TABLE 2 Conjugal transfer of resistance genes tet(O/W/32/O) and erm(B) from the S. suis 32457 donor to four susceptible Streptococcus recipients

Recipients

Transfer frequencyb

Transconjugants

Strain

MIC (�g/ml)a PFGE and hybridization MIC (�g/ml)a

TET ERY Insertion size (kb) tet(O/W/32/O) erm(B) TET ERY

S. suis v36RF 0.06 0.06 3.1 � 10�4 50–60 � � �256 �256S. pyogenes 12RF �0.015 �0.015 7.5 � 10�5 50–60 � � �256 �256S. pneumoniae R6RF 0.5 0.03 4.3 � 10�5 50–60 � � �256 �256S. agalactiae 1357RF 0.25 0.5 2.0 � 10�5 50–60 � � �256 �256a TET, tetracycline; ERY, erythromycin.b Data are from assays using tetracycline (10 �g/ml) for resistance selection, but closely comparable results were obtained using erythromycin (10 �g/ml).

Palmieri et al.

4698 aac.asm.org Antimicrobial Agents and Chemotherapy

on Decem

ber 19, 2018 by guesthttp://aac.asm

.org/D

ownloaded from

tet(40) and an aminoglycoside resistance gene cluster—were found inthe larger portion lying between tet(O/W/32/O) and erm(B). tet(40),here located immediately downstream of tet(O/W/32/O), is a novelefflux gene so far consistently detected in tandem with ribosomalprotection tet genes, such as tet(O/32/O) in Clostridium saccharolyti-cum (19) and tet(O) in S. suis (16, 25). The tandem presence of aribosomal protection tet gene and an efflux tet gene is consistent withthe high-level tetracycline resistance displayed by S. suis 32457 andthe transconjugants. The aminoglycoside resistance gene cluster wasformed by four ORFs, three—including the streptomycin resistancedeterminant aadE-–�99% identical to a trio found in Enterococcusfaecalis plasmid pEF418 (accession no. AF408195), plus the kanamy-cin resistance determinant aphA. In agreement with the presence ofthese genes, the transconjugants exhibited 8- to 16-fold-higher strep-tomycin and kanamycin MICs than the recipients. All the other ORFsof 15K coded for hypothetical proteins with unknown function.

Insights into an �1.3-kb segment playing a key role in 15Kexcision. Analysis of the smaller portion of 15K lying between

tet(O/W/32/O) and erm(B) disclosed an �1.3-kb segment of spe-cial interest. The segment showed �90% identity with corre-sponding regions of several streptococcal ICEs, including a fewrecently detected in S. suis (6, 15, 40). In some of these S. suis ICEs,the segment is flanked on one or the other side by cargo DNA,whereas in others it is split by the insertion of cargo DNA into twofragments (�700 bp and �550 bp); in all cases, the region formedby the �1.3-kb segment plus the cargo DNA is surrounded by twohighly conserved backbone ORFs, a putative DNA primase on theleft side and a putative SNF2 helicase on the right side. Remark-ably, both conserved ORFs, which were not detected by PCR in thefour recipients, were detected in the genome of S. suis 32457 and ofall transconjugants. These findings suggested to us that 15K couldbe integrated as a cargo in an ICE (i.e., the 50- to 60-kb mobileelement detected by PFGE and hybridization assays). By combin-ing primers internal to 15K with primers internal to the DNAprimase and the SNF2 helicase coding sequences, 15K was foundto be integrated as a linear element between the two ORFs (Fig.

FIG 1 15K from S. suis 32457: an unstable multiresistance genetic element exploiting a conserved �1.3-kb ICE segment as the att site for its excision. (A) Geneticorganization of the 15K element in the circular form. (B) Genetic organization of the 15K element in the integrated form. (C) DNA repair after 15K excision.Major primer pairs used and relevant amplicons are shown. ORFs are indicated as arrows pointing in the direction of transcription. No ORFs are associated withattP or attB due to the genetic heterogeneity of the relevant sequences. Color coding is defined in the inset.

tet(O/W/32/O)-Carrying Genetic Element in S. suis

September 2012 Volume 56 Number 9 aac.asm.org 4699

on Decem

ber 19, 2018 by guesthttp://aac.asm

.org/D

ownloaded from

1B). Sequencing revealed that when 15K was in the integratedform, there were two copies (displaying 95% identity) of the�1.3-kb segment, one on the left side and one on the right side.Two ORFs were associated with the former and three with thelatter, all coding for hypothetical proteins with unknown func-tion. Interestingly, PCR experiments demonstrated that in addi-tion to being integrated as a linear element, 15K could also bemissing altogether (both in S. suis 32457 and in the transconju-gants), consistent with its excision in circular form: after DNArepair, only one copy of the �1.3-kb segment was found betweenthe two backbone ORFs (Fig. 1C).

Despite their unusual length, the four copies of the �1.3-kbsegment actually represent att sequences involved in 15K excisionand, possibly, integration: attL and attR, the two copies flankingthe integrated 15K; attP, the copy found in the circular 15K; andattB, the copy found between the two conserved backbone ORFsafter 15K excision.

In recent studies of unstable genetic elements resembling 15K(i.e., capable of spontaneous excision in the absence of their ownrecombinase genes by exploiting long att sequences) (1, 29), theexcision mechanism appeared to be associated with recombina-tion events between attL and attR, yielding multiple attP and attBhybrid sequences in the bacterial population. The possibility that15K could share this feature was suggested by the occurrence ofseveral dual peaks in the electropherograms of the attB- and attP-containing amplicons just where mismatches between attL andattR were detected. PCR-RFLP analysis using HindIII endonu-clease (which has two restriction sites in attL and none in attR)confirmed that, while attL and attR were fixed sequences, attB andattP were heterogeneous hybrids of the attL and attR sequences,some containing both HindIII restriction sites detected in attL,some just one, and some none (Fig. 2).

Characterization of a 54,879-bp ICE carrying 15K. PCR map-ping using primers internal to conserved regions of streptococcalICEs demonstrated a 15K-carrying composite ICE in S. suis 32457and the transconjugants (Fig. 3A). The ICE, which we namedICESsu32457, was completely sequenced (54,879 bp; 50.5%G�C), and its chromosomal junctions were determined. Se-quence analysis revealed 55 ORFs, of which 50 were transcribed inthe same direction and 5 in the opposite direction (Fig. 3B). Thefragment formed by 15K plus the attL and attR sequences (22ORFs) was integrated between orf13 (DNA primase) and orf36(SNF2 helicase) of ICESsu32457. The highest BLASTN score forthe ICE backbone was S. agalactiae ICESa2603 (33) (�94% iden-tity). BLASTP analysis of the integrase (orf1) disclosed �99%amino acid identity with the tyrosine family recombinase of S.agalactiae ICESa2603. The latter, which has extensively been com-pared with ICEs from other streptococcal species (7, 8), is re-garded as the prototype of an ICE family recognized in a recentICE classification (ICEberg database http://db-mml.sjtu.edu.cn/ICEberg) based on the amino acid identity of integrases (4). In S.suis 32457 and all tested transconjugants, the integrase mediatedICE integration immediately downstream of the 50S ribosomalprotein L7/L12 gene (rplL). In both S. suis 32457 and the transcon-jugants, ICESsu32457 was also detected by PCR in the circularform, as is required for ICE transfer (38).

Concluding remarks. tet(O/W/32/O), detected by our groupin S. suis pig isolates, was the first mosaic tet gene reported in thegenus Streptococcus (27). It has subsequently been detected in ahuman endocarditis isolate of Streptococcus gallolyticus subsp. gal-lolyticus, a taxon resulting from the recent reclassification of Strep-tococcus bovis (2), where it was carried by an �21-kb non-self-transmissible plasmid (14). This is the first study to characterize amosaic tet gene-carrying conjugative element. ICESsu32457,

FIG 2 Schematic illustration of PCR-RFLP assays using HindIII endonuclease, indicating that attB and attP sequences are heterogeneous hybrids of the fixed attLand attR sequences. The att sequences are shown as white bars, flanked by DNA of ICE backbone ORFs (plain black, DNA primase; checkered black, SNF2helicase) or of 15K (plain gray, left end; checkered gray, right end). Primers (A, B, C, and D) are depicted as arrowheads. HindIII restriction sites are depicted asvertical strokes with overhanging black triangles.

Palmieri et al.

4700 aac.asm.org Antimicrobial Agents and Chemotherapy

on Decem

ber 19, 2018 by guesthttp://aac.asm

.org/D

ownloaded from

which is transferable to the major pathogenic Streptococcus spe-cies, may be an important genetic vehicle for the spread of tet(O/W/32/O); however, it is not the sole, and probably not even themost common, genetic support for the gene. In the recent surveyof S. suis isolates in Italy leading to collection of S. suis 32457, sevenadditional clonally unrelated pig isolates were found to harbor thetet(O/W/32/O) gene (27). However, in these seven isolates thegene, still linked to erm(B), was carried by a variety of non-self-transmissible plasmids (�15 to �25 kb in size), a genetic organi-zation that was reminiscent of the one mentioned above for S.gallolyticus subsp. gallolyticus (14). However, the genetic contextsof tet(O/W/32/O) in 15K and the above plasmids showed no sim-ilarities (data not shown).

An especially interesting finding of this study is the novel ge-netic element (15K) integrated as a cargo in ICESsu32457. On theone hand, 15K bears a unique combination of tetracycline, mac-rolide, and aminoglycoside resistance genes. On the other, it ap-pears to be an unstable genetic element that, though lacking anintegrase/excisionase system, undergoes spontaneous excision incircular form under standard growth conditions. 15K may repre-sent a novel class of mobile genetic structures capable of excisionin spite of the lack of their own recombinase genes. As indicated inrecent reports on enterobacteria (1, 29), excision apparently oc-curs through recombination between unusually long, imperfectdirect repeats flanking the element. It has been suggested that suchelements may employ a parasitic strategy for their mobility (1),exploiting host recombination trans-acting functions (1, 29). Itmay be hypothesized that, as demonstrated for an Escherichia colimicrocin-encoding genomic island (1), 15K can also spread toother streptococcal ICEs by integrating into the conserved emptyattB. The fact that 15K is carried by ICESsu32457, a composite ICEcapable of moving at high frequency to a broad spectrum of strep-tococcal hosts, suggests that this unstable multiresistance elementcan successfully spread among streptococcal populations.

ACKNOWLEDGMENT

This work was supported in part by the Italian Ministry of Education,University and Research (PRIN 2008CBSB9Y and 200929YFMK).

REFERENCES1. Azpiroz MF, Bascuas T, Laviña M. 2011. Microcin H47 system: an

Escherichia coli small genomic island with novel features. PLoS One6:e26179. doi:10.1371/journal.pone.0026179.

2. Beck M, Frodl R, Funke G. 2008. Comprehensive study of strains previ-ously designated Streptococcus bovis consecutively isolated from humanblood cultures and emended description of Streptococcus gallolyticus andStreptococcus infantarius subsp. coli. J. Clin. Microbiol. 46:2966 –2972.

3. Beres SB, Musser JM. 2007. Contribution of exogenous genetic elementsto the Group A Streptococcus metagenome. PLoS One 2:e800. doi:10.1371/journal.pone.0000800.

4. Bi D, et al. 2012. ICEberg: a web-based resource for integrative andconjugative elements found in Bacteria. Nucleic Acids Res. 40:D621–D626.

5. Brenciani A, et al. 2011. Two distinct genetic elements are responsible forerm(TR)-mediated erythromycin resistance in tetracycline-susceptibleand tetracycline-resistant strains of Streptococcus pyogenes. Antimicrob.Agents Chemother. 55:2106 –2112.

6. Chen C, et al. 2007. A glimpse of streptococcal toxic shock syndromefrom comparative genomics of S. suis 2 Chinese isolates. PLoS One 2:e315.doi:10.1371/journal.pone.0000315.

7. Croucher NJ, et al. 2009. Role of conjugative elements in the evolution ofthe multidrug-resistant pandemic clone Streptococcus pneumoniaeSpain23F ST81. J. Bacteriol. 191:1480 –1489.

8. Davies MR, Shera J, Van Domselaar GH, Sriprakash KS, McMillan DJ.2009. A novel integrative conjugative element mediates genetic transferfrom group G streptococcus to other �-hemolytic streptococci. J. Bacte-riol. 191:2257–2265.

9. Giovanetti E, et al. 2002. Conjugative transfer of the erm(A) gene fromerythromycin-resistant Streptococcus pyogenes to macrolide-susceptible S.pyogenes, Enterococcus faecalis, and Listeria innocua. J. Antimicrob. Che-mother. 50:249 –252.

10. Giovanetti E, Brenciani A, Lupidi R, Roberts MC, Varaldo PE. 2003.Presence of the tet(O) gene in erythromycin- and tetracycline-resistantstrains of Streptococcus pyogenes and linkage with either the mef(A) or theerm(A) gene. Antimicrob. Agents Chemother. 47:1935–1940.

11. Giovanetti E, Brenciani A, Tiberi E, Bacciaglia A, Varaldo PE. 2012.ICESp2905, the erm(TR)-tet(O) element of Streptococcus pyogenes, is

FIG 3 Genetic organization of 15K-carrying ICESsu32457 from S. suis 32457. (A) PCR mapping of ICESsu32457. Major primer pairs used and relevantamplicons are shown. The DNA is represented by a bar (black, ICE; gray, 15K; yellow, att sites; spotted, chromosome). (B) ORF map and genetic organizationof ICESsu32457 and its alignment with the ORF map of ICESa2603. The ORFs, indicated as arrows pointing in the direction of transcription, are numberedconsecutively in the two ICEs. Color coding is defined in the inset.

tet(O/W/32/O)-Carrying Genetic Element in S. suis

September 2012 Volume 56 Number 9 aac.asm.org 4701

on Decem

ber 19, 2018 by guesthttp://aac.asm

.org/D

ownloaded from

formed by two independent integrative and conjugative elements. Anti-microb. Agents Chemother. 56:591–594.

12. Gottschalk M, Xu J, Calzas C, Segura M. 2010. Streptococcus suis: a newemerging or an old neglected zoonotic pathogen? Future Microbiol.5:371–391.

13. Hendriksen RS, et al. 2008. Occurrence of antimicrobial resistanceamong bacterial pathogens and indicator bacteria in pigs in different Eu-ropean countries from year 2002-2004: the ARBAO-II study. Acta Vet.Scand. 50:19. doi:10.1186/1751-0147-50-19.

14. Hinse D, et al. 2011. Complete genome and comparative analysis ofStreptococcus gallolyticus subsp. gallolyticus, an emerging pathogen of in-fective endocarditis. BMC Genomics 12:400. doi:10.1186/1471-2164-12-400.

15. Holden MT, et al. 2009. Rapid evolution of virulence and drug resistancein the emerging zoonotic pathogen Streptococcus suis. PLoS One 4:e6072.doi:10.1371/journal.pone.0006072.

16. Hu P, et al. 2011. Complete genome sequence of Streptococcus suis sero-type 14 strain JS14. J. Bacteriol. 193:2375–2376.

17. Hu P, et al. 2011. Complete genome sequence of Streptococcus suis sero-type 3 strain ST3. J. Bacteriol. 193:3428 –3429.

18. Hu P, et al. 2011. Comparative genomics study of multi-drug-resistancemechanisms in the antibiotic-resistant Streptococcus suis R61 strain. PLoSOne 6:e24988. doi:10.1371/journal.pone.0024988.

19. Kazimierczak KA, et al. 2008. A new tetracycline efflux gene, tet(40), islocated in tandem with tet(O/32/O) in a human gut firmicute bacteriumand in metagenomic library clones. Antimicrob. Agents Chemother. 52:4001– 4009.

20. Li M, et al. 2011. GI-type T4SS-mediated horizontal transfer of the 89Kpathogenicity island in epidemic Streptococcus suis serotype 2. Mol. Mi-crobiol. 79:1670 –1683.

21. Lun ZR, Wang QP, Chen XG, Li AX, Zhu XQ. 2007. Streptococcus suis:an emerging zoonotic pathogen. Lancet Infect. Dis. 7:201–209.

22. Melville CM, Scott KP, Mercer DK, Flint HJ. 2001. Novel tetracyclineresistance gene, tet(32), in the Clostridium-related human colonic anaer-obe K10 and its transmission in vitro to the rumen anaerobe Butyrivibriofibrisolvens. Antimicrob. Agents Chemother. 45:3246 –3249.

23. Mingoia M, Tili E, Manso E, Varaldo PE, Montanari MP. 2011. Het-erogeneity of Tn5253-like composite elements in clinical Streptococcuspneumoniae isolates. Antimicrob. Agents Chemother. 55:1453–1459.

24. Palmieri C, Princivalli MS, Brenciani A, Varaldo PE, Facinelli B. 2011.Different genetic elements carrying the tet(W) gene in two human clinicalisolates of Streptococcus suis. Antimicrob. Agents Chemother. 55:631– 636.

25. Palmieri C, Varaldo PE, Facinelli B. 2011. Streptococcus suis, an emergingdrug-resistant animal and human pathogen. Front. Microbiol. 2:235.

26. Patterson AJ, Rincon MT, Flint HJ, Scott KP. 2007. Mosaic tetracycline

resistance genes are widespread in human and animal fecal samples. An-timicrob. Agents Chemother. 51:1115–1118.

27. Princivalli MS, et al. 2009. Genetic diversity of Streptococcus suis clinicalisolates from pigs and humans in Italy (2003-2007). Euro Surveill. 14:15–21.

28. Roberts MC. 2005. Update on acquired tetracycline resistance genes.FEMS Microbiol. Lett. 245:195–203.

29. Santiviago CA, et al. 2010. Spontaneous excision of the Salmonella en-terica serovar Enteritidis-specific defective prophage-like element SE14.J. Bacteriol. 192:2246 –2254.

30. Santoro F, Oggioni MR, Pozzi G, Iannelli F. 2010. Nucleotide sequenceand functional analysis of the tet(M)-carrying conjugative transposonTn5251 of Streptococcus pneumoniae. FEMS Microbiol. Lett. 308:150 –158.

31. Stanton TB, Humphrey SB. 2003. Isolation of tetracycline-resistant Me-gasphaera elsdenii strains with novel mosaic gene combinations of tet(O)and tet(W) from swine. Appl. Environ. Microbiol. 69:3874 –3882.

32. Stanton TB, Humphrey SB, Scott KP, Flint HJ. 2005. Hybrid tet genesand tet gene nomenclature: request for opinion. Antimicrob. Agents Che-mother. 49:1265–1266.

33. Tettelin H, et al. 2002. Complete genome sequence and comparativegenomic analysis of an emerging human pathogen, serotype V Streptococ-cus agalactiae. Proc. Natl. Acad. Sci. U. S. A. 99:12391–12396.

34. Thaker M, Spanogiannopoulos P, Wright GD. 2010. The tetracyclineresistome. Cell. Mol. Life Sci. 67:419 – 431.

35. van Hoek AH, et al. 2008. Mosaic tetracycline resistance genes and theirflanking regions in Bifidobacterium thermophilum and Lactobacillus john-sonii. Antimicrob. Agents Chemother. 52:248 –252.

36. Wertheim HFL, Nghia HDT, Taylor W, Schultsz C. 2009. Streptococcussuis: an emerging human pathogen. Clin. Infect. Dis. 48:617– 625.

37. Wisselink HJ, Veldman KT, Van den Eede C, Salmon SA, Mevius DJ.2006. Quantitative susceptibility of Streptococcus suis strains isolated fromdiseased pigs in seven European countries to antimicrobial agents licensedin veterinary medicine. Vet. Microbiol. 113:73– 82.

38. Wozniak RA, Waldor MK. 2010. Integrative and conjugative elements:mosaic mobile genetic elements enabling dynamic lateral gene flow. Nat.Rev. Microbiol. 8:552–563.

39. Ye C, et al. 2009. Clinical, experimental, and genomic differences betweenintermediately pathogenic, highly pathogenic, and epidemic Streptococcussuis. J. Infect. Dis. 199:97–107.

40. Zhang A, et al. 2011. Comparative genomic analysis of Streptococcus suisreveals significant genomic diversity among different serotypes. BMCGenomics 12:523. doi:10.1186/1471-2164-12-523.

41. Zhang C, et al. 2008. In vitro antimicrobial susceptibility of Streptococcussuis strains isolated from clinically healthy sows in China. Vet. Microbiol.131:386 –392.

Palmieri et al.

4702 aac.asm.org Antimicrobial Agents and Chemotherapy

on Decem

ber 19, 2018 by guesthttp://aac.asm

.org/D

ownloaded from