TECHNOLOGY REPORT

Characterization of Bacterial Artificial ChromosomeTransgenic Mice Expressing mCherry Fluorescent ProteinSubstituted for the Murine Smooth Muscle a-Actin GeneJohn J. Armstrong,1,2,3 Irina V. Larina,4 Mary E. Dickinson,4 Warren E. Zimmer,5

and Karen K. Hirschi1,2,3,4,6,7*1Interdepartmental Graduate Program in Cellular and Molecular Biology, Baylor College of Medicine,One Baylor Plaza, Houston, Texas2Center for Cell and Gene Therapy, Baylor College of Medicine, One Baylor Plaza, Houston, Texas3Children’s Nutrition Research Center, Baylor College of Medicine, One Baylor Plaza, Houston, Texas4Department of Molecular Physiology and Biophysics, Baylor College of Medicine, One Baylor Plaza, Houston, Texas5Department of Systems Biology and Translational Medicine, Texas A&M University Health Science Center,College Station, Texas6Department of Pediatrics, Baylor College of Medicine, One Baylor Plaza, Houston, Texas7Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas

Received 19 January 2010; Accepted 13 April 2010

Summary: Smooth muscle a actin (SMA) is a cyto-skeletal protein expressed by mesenchymal and smoothmuscle cell types, including mural cells (vascularsmooth muscle cells and pericytes). Using Bacterial Ar-tificial Chromosome (BAC) recombineering technology,we generated transgenic reporter mice that express amembrane localized cherry red fluorescent protein(mCherry), driven by the full-length SMA promoter andintronic sequences. We determined that the foundersand F1 progeny of five independent lines contain 1–3copies of the mCherry-substituted BAC vector. Further-more, we characterized the expression of SMA-mCherryin relation to endogenous SMA in the embryo and inadult tissues, and found that the transgenic reporter ineach line recapitulated endogenous SMA expression atall time points. We were also able to isolate SMAexpressing cells from embryonic tissues using fluores-cence-activated cell sorting (FACS). We demonstratedthat this marker can be combined with other vital fluo-rescent reporters and it can be used for live imaging ofembryonic cardiodynamics. Therefore, these transgenicmice will be useful for isolating live SMA-expressingcells via FACS and for studying the emergence, behav-ior, and regulation of SMA-expressing cells, includingvascular smooth muscle cells and pericytes throughoutembryonic and postnatal development. genesis 48:457–463, 2010. VVC 2010 Wiley-Liss, Inc.

Key words: BAC transgenesis; in vivo imaging; cardiacfunction; vascular development; mesenchymal cell

Smooth muscle a actin (SMA) is a cytoskeletal proteinfirst expressed during embryonic cardiovascular devel-opment, and subsequently expressed in developingsomites and gut. Postnatally, SMA is replaced with otheractin isoforms in the heart, but remains expressed in

smooth muscle cells of the cardiovascular and digestivesystems (Black et al., 1991). Studies of SMA function inthe cardiovascular system reveal a role in maintainingblood pressure homeostasis (Schlidmeyer et al., 2000).During embryonic development and postnatally, SMAexpression is widely used to identify mural cells (vascu-lar smooth muscle cells and pericytes) and their mesen-chymal cell precursors. SMA is also commonly used as amarker of mesenteric smooth muscle and embryonicmyocardium (Mack and Owens, 1999).

Previous characterization of murine SMA expressionand regulatory elements in vivo utilized a LacZ reporter,driven by the endogenous SMA promoter (Mack andOwens, 1999). Although SMA-expressing cells can bevisualized in situ with these mice, the use of the LacZ re-porter system does not allow monitoring of cell behaviorin real time in vivo or efficient isolation of live cells forin vitro studies. In these studies, we generated trans-genic mice that faithfully express a fluorescent reporterin a pattern reflective of endogenous SMA expressionduring embryonic development and postnatally (Shaneret al., 2004).

To most effectively recapitulate endogenous expression ofSMA in our reporter mice, we employed a Bacterial ArtificialChromosome (BAC) transgenic approach using recombin-

* Correspondence to: Karen K. Hirschi, Molecular Physiology and Biophy-

sics, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA.

E-mail: khirschi@bcm.tmc.edu

Contract grant sponsor: NIH, Contract grant numbers: R01 EB005173,

P20 EB007076 R01, HL76260 to KKHPublished online 22 April 2010 in

Wiley InterScience (www.interscience.wiley.com).

DOI: 10.1002/dvg.20638

' 2010 Wiley-Liss, Inc. genesis 48:457–463 (2010)

eering technology, which allows seamless modification ofDNA independent of the presence of restriction enzymesites (Lee et al., 2001). BAC recombineering is a versitiletechnology allowing investigators to physically link multiplereporters or tag proteins of interest for functional studies(Maye et al., 2009, Poser et al., 2008). BAC transgenic clonescontain a large component of genomic DNA and increasethe probability of including important transcriptional controlelements for genes of interest. For our studies, we obtainedBAC clone RP23-132C11 from CHORI that contained themurine SMA gene locus. To express the myristoylatedmCherry under the control of SMA regulatory elements, wemodified the BAC by inserting the myristoylation ATG inplace of SMA ATG (Fig. 1a). We modified the SMA locus byreplacing exon 2, the first coding exon, along with 50 bp 30of exon 2 with the mCherry reporter-SV40pA construct.The resultant vector would express the membrane localizedmCherry under the control of the complete SMA regulatoryapparatus, including intragenic sequences of the first intron(Mack and Owens, 1999), while interrupting splicing fromthe accompanying SMA gene sequences. This was achievedby generating a linear target vector by PCR from a templatethat contained the reporter upstream of an FRT-PGKneo-FRT cassette. The resultant linear DNA targeting constructwas used in a standard recombineering strategy (Lee et al.,2001). Although published recombineering protocols pro-duced potential substituted BAC clones, we found anincreased number of recombined clones were obtained byallowing the reaction to continue overnight at 308C insteadof the recommended 1-h incubation. Following identifica-tion of correctly targeted clones by Southern Blot, FRTrecombinase was induced to remove the PGKneo cassette.The BAC was linearized with PI-SceI and used to microinjectfertilized mouse eggs that yielded five founder lines.

We determined the SMA gene copy number for eachmouse line using a qRT-PCR based method (Chandleret al., 2007). We were able to generate a standard curveusing modified BAC DNA spiked into genomic DNA(Fig. 1b). We found that all five transgenic lines con-tained between 1 and 3 copies of the SMA gene(Fig. 1c). An analysis of F1 progeny copy numbermatched that of the founders, indicating we have gener-ated mice with a single insertion site and did not yieldlines with multiple insertions, a phenomenon that hasbeen previously reported (Chandler et al., 2007).

We examined embryonic SMA-mCherry expressionfrom E7.5-18.5. No SMA-mCherry or endogenous SMAexpression was observed at E7.5 by fluorescent stereo-microscopy or confocal microscopy (Fig. 2a). At E8.5and E9.5, we observed SMA-mCherry expression in thedeveloping heart (Fig. 2b,c). Additional analysis at E9.5(not shown) and E10.5 (Fig. 2d) revealed mCherryexpression in the heart and aorta (Fig. 2e–g), yolksac vascular smooth muscle (Fig. 2h–j), and somites(Fig. 2k–m); this expression pattern also recapitulatedendogenous SMA expression (Mack and Owens, 1999).At E13.5, reporter expression was detected in the heart(Fig. 2n–p), aorta, and esophagus (Fig. 2q–s), and intesti-nal and gastric smooth muscle (Fig. 2t–v), as expected

based on previous studies (McHugh, 1995). SMA-mCherry reporter expression was also coincidentwith endogenous SMA expression in the E18.5heart (Fig. 2w–y), lung (Fig. 2z–bb), and esophagus(Fig. 2cc–ee). All reporter expression in the transgeniclines colocalized with endogenous SMA expression.

We also examined SMA-mCherry expression in adulttissues along side WT controls. We observed reporterexpression in the coronary arteries of the heart but notcardiac myocytes (Fig. 3a–d). We observed reporterexpression around mesenteric vessels (Fig. 3e–h) and insmooth muscle of the stomach (Fig. 3i–l). SMA-mCherryexpression was also detected in the vasculature of thelung (Fig. 3m,n) and kidney (Fig. 3q–t), but not othercell types within these organs. Reporter expression wasdetected in the smooth muscle of the ileum of the intes-tine (Fig. 3u–x), myoepithelial cells of the mammarygland (Fig. 3y–bb), and femoral artery (Fig. 3cc–ff) of thehindlimb. Thus, by the inclusion of DNA sequenceswithin and surrounding the SMA locus, we have faith-fully recapitulated expression of this gene in developingand adult tissues/cells; this includes expression withinthe vasculature of the skeletal muscle and not the skele-tal myotubes (Fig. 3cc–ff), nor in cardiac myocytes (Fig.3a–d). It is likely that by presence of DNA both 50 and 30to the SMA gene locus in our recombineered BAC con-struct, we have included regulatory sequences directingappropriate transcriptional capacity of the SMA pro-moter (Mack and Owens, 1999) focusing expression insmooth muscle cells and their mesenchymal precursors.

We isolated and cultured SMA positive cells fromE15.5 yolk sac by flow cytometry. There was a distinctmCherry positive population (Fig. 4b) when comparedto WT littermate controls (Fig. 4a). The isolated cellsexpressed mCherry in culture (Fig. 4c, red). Culturescells were positive for endogenous cytoskeletal SMA thatwas coexpressed with reporter expression in the mem-brane (Fig. 4c, green).

One benefit of using mCherry fluorescent protein is theability to combine this marker with other fluorescent pro-teins without spectral overlap. The mCherry has an emis-sion peak at 610 nm; therefore, it is easily separated fromblue, green, or yellow fluorescent proteins. We havecrossed SMA-mCherry mice with mice from the Tg(e-glo-bin::GFP) line, expressing Green Fluorescent Proten (GFP)under the control of e-globin promoter, which drives theexpression in the embryonic erythrocytes (Dyer et al.,2001). Crossing these markers produced embryos inwhich the myocardium is labeled with the mCherry andthe blood is labeled with the GFP (Fig. 5a–d).

Because the mCherry is highly expressed in the em-bryonic myocardium, we tested whether this markercan be used for dynamic visualization of the embryonicheartbeat in live embryo culture. Images of an E9.5 beat-ing heart acquired at 16 fps using fast scanning confocalmicroscopy are shown in Figure 5a–c. Successive panelsshow different phases of the cardiac cycle. Even thoughthe imaging plane was positioned at the depth of100 lm, the mCherry clearly outlines the myocardium.

458 ARMSTRONG ET AL.

FIG. 1. SMA-mCherry construct and characterization. (a) Diagram of BAC clone RP23-132C11 demonstrating the location of sequencessubstituted for SMA exon 2 creating the SMA-mCherry vector is shown. Exon 2 of the SMA locus was replaced with a myristoylated mCherrycassette at the AUG translational initiation codon to express membrane localized mCherry. (b) Standard curve to calculate copy number ofSMA-mCherry lines. (c) Copy number of SMA-mCherry lines. Transgenic mice contained between 1 and 3 copies of the transgene.

459CHARACTERIZATION OF SMA-MCHERRY MICE

FIG. 2. Expression of SMA-mCherry in thedeveloping mouse embryo. (a–d) Wholemount reporter expression in E7.5-10.5embryos. (e,h,k,n,q,t,w,z,cc) Reporterexpression (red) (f,i,l,o,r,u,x,aa,dd) SMA anti-body staining (green) (g,j,m,p,s,v,y,bb,ee) andmerged images of SMA-mCherry immuno-chemistry. Reporter expression in the devel-oping heart and aorta at E10.5 (e–g), yolk sac(h–j), and somites (k–m) recapitulates endoge-nous SMA expression. Reporter expression inthe E13.5 heart (n–p), aorta and esophagus(q–s), stomach and intestine smooth muscle(t–v) recapitulate endogenous SMA expres-sion. Reporter expression in the E18.5 (w–y),heart (z–bb), lung (cc–ee) esophagus alsorecapitulates endogenous SMA expression.Scale bar (e–g, k–v) 100 um (h–j, w–ee) scalebar 50 um. A, Aorta; E, Esophagus; S, Stom-ach; I, Intestine.

460 ARMSTRONG ET AL.

FIG. 3. SMA-mCherry expression in adult organs. (a–d) Heart, (e–h) mesenteric vessels, (i–l) stomach, (m–p) lung, (q–t) kidney, (u–x) ileumof the intestine, (y–bb) mammary gland, (cc–ff) femoral artery. Expression was observed in (c-d, g-h, k-l, o-p, s-t, w-x, aa-bb, ee-ff) SMA-mCherry but not (a-b, e-f, i-j, m-n, q-r, u-v, y-z, cc-dd) WTcontrols. WT images for fluorescence were obtained with the same light intensigyand exposure time as SMA-mCherry.

461CHARACTERIZATION OF SMA-MCHERRY MICE

The changes of the relative fluorescence intensity for themCherry (Fig. 5d, red line) and the GFP (Fig. 5d, greenline) are shown for the region marked in (Fig. 5a). Theseperiodical changes are produced by the tissue dynamicsand could be used to estimate the heart rate and charac-terize heart wall movements. These results demonstratethat the SMA-mCherry is suitable for dynamic imaging ofthe heart and could be a useful tool for studying earlymammalian cardiac function during the time frame thatit is possible to maintain mouse embryos on the micro-scope stage (up to E10.5; see Jones et al., 2002). Further-more, such a marker could be used for a large variety ofvital imaging experiments, provided that the cells or tis-sues of interest are accessible to confocal or two-photonmicroscopy.

In summary, we generated transgenic mouse lines thatexpress membrane localized mCherry reporter driven bythe SMA genetic apparatus included in the �150 kb BACconstruct, and determined that reporter expression faith-fully recapitulated endogenous SMA expression duringembryonic development and in postnatal tissues. Thesemice will be useful for noninvasive real-time in vivo imag-ing, as well as fluorescence-activated cell sorting (FACS)-mediated isolation of live SMA-expressing cells for invitro studies of their cellular and molecular regulation.

MATERIALS AND METHODS

BAC Recombineering

BAC clone RP23-132C11 was obtained from Children’sHospital Research Oakland Research Institute (CHORI)and electroporated into SW105. Twenty-five millilitersSW105-132C11 were induced by incubating at 428C for15 min. Induced SW105-132C11 were washed 33 in 50ml 10% Glycerol in ddH2O and used for electroporation ofthe targeting vector. Linear targeting vector was generatedby PCR from a plasmid DNA constructed in our lab con-taining the coding sequence for myristoylated mCherrywith SV40 pA upstream of FRT-PGKneo-FRT cassette. For-ward and reverse primers used in linear target PCR reac-tion contained 75-bp homology with targeted SMA locus 50and 30, respectively, and 25 bp homologous with targetingvector sequence. One microgram linear target was electro-porated into SW105-132C11 with 1.8 kV 5.0 lS pulse andthe cells were resuspended in 1 ml LB and placed at 308C.After 1 h, 100 ul cells were plated on 15 ug/ml Kanamycinplates and placed in 308C incubator overnight. Four millili-ters LB was added to the electroporated SW105-132C11and incubated overnight at 308C, after which 100 ul cellswere streaked onto 15 ug/ml Kanamycin plates. Theclones were confirmed by restriction mapping followed

FIG. 5. Live imaging of the beating embryonic heart at E9.5. The image series is acquired from a cross of the SMA-mCherry line to the Tg(e-globin::GFP) line labeling embryonic erythrocytes at 16 frames per second (fps) at the depth of 100 lm. (a–c) Representative frames fromthe image series showing different phases of the cardiac cycle. (d) Relative fluorescence intensity of the mCherry (red) and the GFP (green)as a function of time in the region marked by a circle in the panel (a).

FIG. 4. Isolation of SMA positive cells by flow cytometry. FACS profiles of (a) WTand (b) SMA-mCherry E15.5 yolk sac cells. Cultured cellsexpressed mCherry (c, red) and immunostained positive for SMA (c, green).

462 ARMSTRONG ET AL.

by Southern hybridization and positive clones weresequenced across recombination sites to confirm correctrecombination. The Kanamycin selection cassette wasremoved by induction of FRT recombinase with 0.2%d-arabinose. BAC DNA for microinjection was prepared bythe Mouse Embryo Manipulation Services at Baylor Collegeof Medicine protocol. Mice were genotyped from tail DNAusing primers: Forward 50CCTGTCCCCTCAGTTCATGT30Reverse 50CTTCAGCTTCAGCCTCTGCT.

Copy Number

Copy number of integrated SMA-mCherry BAC DNAwasdetermined as previously described (Chandler et al.,2007). Mouse tail DNA was digested with Proteinase Kovernight, extracted 23 by Phenol/chloroform/isoamylalcohol (25:25:1), precipitated with ethanol and washedwith 70% ethanol. Primers used in qRT-PCR are: Jun Mm00495062_s1 (Applied Biosystems, Carlsbad, CA), CherryForward 50 GACCACCTACAAGGCCAAGAAG30 Reverse50AGGTGATGTCCAACTTGATGTTGA30 Probe FAM50CAGCTGCCCGGCGCCTACA30MGB. Reactions were preformedusing AmpTaq Gold with UNG erase (Applied Biosystems).Reactions were run at 508C 2 min, 958C 10 min, followedby 40 cycles of 958C 15 s 608C 30 s.

Immunohistochemistry

Embryos and yolk sac were dissected and fixed in 4%-paraformaldehyde at 48C for 15 min to 1 h for E8.5-10.5,respectively. E13.5-18.5 embryos were fixed overnight at48C. Embryos and yolk sac were then washed with PBS,dehydrated with 10% sucrose followed by 20% sucrose so-lution in PBS, and embedded in OCT (Sakura, Torrance,CA). Ten micrometer sections were obtained on a Shan-don cryotome. Tissue was blocked in DSB10 [10% DonkeySerum (Sigma), 1% BSA (Sigma) in PBST (PBS with 0.1%Tween 20)] for 1 h RT. SMA antibody (Genetex, Irvine,CA) was diluted in DSB10 at 2 ug/ml added to tissue andincubated overnight at 48C. After extensive washing withPBST, secondary antibody, donkey anti rabbit 488 (Molec-ular Probes, Carlsbad, CA), was diluted in DSB10 at 4 ug/ml and incubated with the tissue for 1 h at RT. Slides werethen rinsed and mounted for collecting images. Cellswere fixed with 4% paraformaldehyde at 48C for 10 minand immunostained identically to tissue sections. Imageswere obtained on Zeiss Axiovert 200M with a Zeiss Axio-Cam MRm camera (Carl Zeiss, Thornwood, NY).

Live Imaging of Embryonic Cardiodynamics

SMA-mCherry males were mated to the Tg (e-glo-bin::GFP) females expressing Green Fluorescent Protein(GFP) in the embryonic blood cells. The embryos weredissected with the yolk sac intact at E9.5 and culturedon the microscope stage according to previouslyreported protocols (Jones et al., 2002). Fast confocalimaging was performed using ZEISS LSM 5LIVE line scan-ning microscope (Carl Zeiss) at 203 magnification. ThemCherry was excited using 532-nm laser; GFP wasexcited using 488-nm laser. Time lapse images wereacquired at a rate of 16 frames per second (fps).

Fluorescence-Activated Cell Sorting

Yolk sac tissues were digested in 0.2% collagenase IIHBSS solution at 378C for 30 min. Digest was filteredthrough 35-um filter and cells were centrifuged at 1000gat 48C for 5 min. Cells were resuspended in HBSS 2%FBS 1 ug/ml DAPI. Cells were sorted on BDAriaII cellsorter. The mCherry reporter was excited at 561 nm andemission collected through a 610/20 bandpass filter intoDMEM 10% FBS penstrep and grown at 378C 5% CO2.Images were obtained on Zeiss Axiovert 200M with aZeiss AxioCam MRm camera (Carl Zeiss).

Cell Culture

Cells were sorted into 0.1% gelatin coated 96-wellplates at 5,000 cells per well containing DMEM (highglucose), 10% Fetal Bovine Serum and penstrep. Cellswere cultured at 378C 5% CO2 for 5 days after whichthey were examined for endogenous SMA expression byimmunohistochemistry, as described above.

LITERATURE CITED

Black FA, Packer SE, Parker TG, Lloyd MH, Roberts R, Schwartz RJ,Schneider MD. 1991. The vascular smooth muscle a-actin gene isreactivated during cardiac hypertrophy provoked by load. J ClinInvest 88:1581–1588.

Chandler KJ, Chandler RL, Broeckelmann EM, Hou Y, Southard-SmithM, Mortlock DP. 2007. Relevance of BAC transgene copy numberin mice: Transgene copy number variation across multiple trans-genic lines and correlations with transgene integrity and expres-sion. Mamm Genome 18:693–708.

Dyer MA, Farrington SM, Mohn D, Munday JR, Baron MH. 2001. Indianhedgehog activates hematopoiesis and vasculogenesis and canrespecify prospective neurectodermal cell fate in the mouseembryo. Development 128:1717–1730.

Jones EAV, Crotty D, Kulesa PM, Waters CW, Baron MH, Fraser SE, DickinsonME. 2002. Dynamic in vivo imaging of postimplantation mammalianembryos using whole embryo culture. Genesis 34:228–235.

Lee C, Daiguan Y, Martinez de Velasco J, Tessarollo L, Swing DA, CourtDL, Jenkins NA, Copeland NG. 2001. A highly efficient Escherichiacoli-based chromosome engineering system adapted for recombino-genic targeting and subcloning of BAC DNA. Genomics 73:56–65.

Mack CP, Owens GK. 1999. Regulation of smooth muscle a-actinexpression in vivo is dependent on CArG elements within the 50and first intron promoter regions. Circ Res 84:852–861.

Maye P, Stover ML, Liu Y, Rowe DW, Gong S, Lichtler AC. 2009. A BAC-bacterial recombination method to generate physically linked mul-tiple gene reporter DNA constructs. BMC Biotechnol 9:20.

McHugh KM. 1995. Molecular analysis of smooth muscle developmentin the mouse. Dev Dyn 204:278–290.

Poser I, Sarov M, Hutchins JRA, Heriche JK, Toyoda Y, Pozniakovsky A,Weigl D, Nitzsche A, Hegemann B, Bird AW, Pelletier A, Kittler R,Hua S, Naumann R, Augsburg M, Sykora MM, Hofemeister H,Zhang Y, Nasmyth K, White KP, Dietzel S, Mechtler K, Durbin R,Stewart AF, Peters JM, Buchholz F, Hyman AA. 2008. BAC Transge-neOmics: A high-throughput method for exploration of proteinfunction in mammals. Nat Methods 5:409–415.

Schlidmeyer LA, Braun R, Taffet G, Debiasi M, Burns AE, Bradley A,Schwartz RJ. 2000. Impaired vascular contractility and blood pres-sure homeostasis in the smooth muscle a-actin null mouse. FASEBJ 14:2213–2220.

Shaner NC, Campbell RE, Steinbach PA, Giepmans BNG, Palmer AE,Tsien RY. 2004. Improved monomeric red, orange and yellow fluo-rescent proteins derived from Disconsoma sp. red fluorescent pro-tein. Nat Biotechnol 12:1567–1572.

463CHARACTERIZATION OF SMA-MCHERRY MICE