characterization of gtf, a glucosyltransferase gene in the ... · gtf exhibits signiﬁcant...

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 2008, p. 4079–4090 Vol. 74, No. 130099-2240/08/$08.00�0 doi:10.1128/AEM.00673-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Characterization of gtf, a Glucosyltransferase Gene in the Genomes ofPediococcus parvulus and Oenococcus oeni, Two Bacterial Species

Commonly Found in Wine�

Marguerite Dols-Lafargue,1* Hyo Young Lee,1 Claire Le Marrec,1 Alain Heyraud,2Gerard Chambat,2 and Aline Lonvaud-Funel1

UMR 1219 Oenologie, Universite Victor Segalen Bordeaux 2, INRA, ISVV, 351 cours de la Liberation, 33405 Talence, France,1 andCentre de Recherche sur les Macromolecules Vegetales-ICMG/CNRS, BP53, 38041 Grenoble Cedex 9, France2

Received 21 March 2008/Accepted 1 May 2008

“Ropiness” is a bacterial alteration in wines, beers, and ciders, caused by �-glucan-synthesizing pediococci.A single glucosyltransferase, Gtf, controls ropy polysaccharide synthesis. In this study, we show that thecorresponding gtf gene is also present on the chromosomes of several strains of Oenococcus oeni isolated fromnonropy wines. gtf is surrounded by mobile elements that may be implicated in its integration into thechromosome of O. oeni. gtf is expressed in all the gtf� strains, and �-glucan is detected in the majority of thesestrains. Part of this �-glucan accumulates around the cells forming a capsule, while the other part is liberatedinto the medium together with heteropolysaccharides. Most of the time, this polymer excretion does not leadto ropiness in a model medium. In addition, we show that wild or recombinant bacterial strains harboring afunctional gtf gene (gtf�) are more resistant to several stresses occurring in wine (alcohol, pH, and SO2) andexhibit increased adhesion capacities compared to their gtf mutant variants.

“Ropiness” or “oiliness” is one of the major bacterial alter-ations in wine. It has no impact on human health. However, theviscosity of the spoiled wines prevents their commercialization(43, 54, 55). Many microbial species have been isolated fromropy wines: Streptococcus mucilaginous and Leuconostoc andLactobacillus species (15, 18, 34, 36, 53, 55). However, thespecies most often incriminated is Pediococcus parvulus (15, 31,48, 53). Different strains have been isolated from red and whiteropy wines from the Bordeaux region in France or fromBasque country ropy ciders and were then shown to causeropiness when grown in model media. These strains were firstcalled Pediococcus cerevisiae (31), later classified as Pediococ-cus damnosus by DNA/DNA hybridizations (15, 32), and thenfinally classified as Pediococcus parvulus based on 16S RNAsequencing (53). The increase in viscosity of wine or modelmedia caused by P. parvulus is due to the production of ahigh-molecular-weight �-glucan. This fibrillar polymer consistsof a trisaccharide repeating unit with a �-1,3-linked glucosylbackbone and branches made up of single �-1,2-linked D-glu-copyranosyl residues (16, 17, 28). The level of production ofsoluble �-glucan by pediococci is low (200 mg/liter at most)and is only slightly modified by external growth parameters (49,50). Polymer production is controlled by a single transmem-brane glucosyltransferase, Gtf, a 567-amino-acid, 65-kDa pro-tein that polymerizes glucosyl residues from UDP glucose (53).Gtf exhibits significant homology with Tts (32% identicalamino acids), an inverting glucosyltransferase produced byStreptococcus pneumoniae type 37, which synthesizes abranched �-1,3 �-1,2 glucan whose structure is very close to

that of the glucan causing ropiness (1, 29). Actually, the anti-bodies targeting the type 37 polysaccharide capsule also agglu-tinate ropy pediococci (51). The gtf gene encoding Gtf is highlyconserved (99.9% identity) in wine- and cider-spoiling bacte-ria, as it is located on the following: (i) a small plasmid of 5.5kb in pediococci found in wine (pF8801 [GenBank accessionno. AF196967] [22, 32]), (ii) a 35-kb plasmid, pPP2 (GenBankaccession no. AY999683) in P. parvulus 2.6 isolated from cider(18, 53), and (iii) on a 5.5-kb pLD1 plasmid (GenBank acces-sion no. AY999684) in ropy Lactobacillus diolivorans G77 iso-lated from cider (18, 53).

Different primer sets were proposed for the detection of thegtf gene by PCR (9, 22, 51, 53). They were used to analyzevarious bacterial strains isolated from wines (spoiled, ropy, ornot spoiled or ropy) and causing an increase or not causing anincrease in model medium viscosity (ropy or nonropy strains).All the ropy strains were isolated from spoiled beverages, andmost of them displayed gtf orthologs. They belong to the spe-cies P. parvulus, P. damnosus, Lactobacillus diolivorans, L. sue-bicus, and L. collinoides. However, some of these ropy strainsdid not give positive gtf internal fragment amplification, sug-gesting the existence of different genetic determinants of ropi-ness (51, 53).

Interestingly, the presence of gtf orthologs was detected inOenococcus oeni strains isolated from wine and cider. A partialgtf gene sequence of 950 bp was amplified from genomic DNAof O. oeni IOEB 0205, even though this bacterial strain wasisolated from nonspoiled champagne (51). The occurrence of agtf gene among O. oeni populations was confirmed by Werninget al. (53) in a survey of 20 O. oeni strains isolated from spoiledropy (4 strains) or nonspoiled ciders (16 strains). The O. oeniI4 strain, isolated from ropy cider, harbored a gtf ortholog(GenBank accession no. AY999685) which displayed 98.8%identity with PF8801 gtf. The authors did not specify if other

* Corresponding author. Mailing address: UMR 1219 Oenologie,LBMA, Universite Victor Segalen Bordeaux 2, INRA, ISVV, 351cours de la Liberation, 33405 Talence, France. Phone: 33 5 40 00 66 54.Fax: 33 5 40 00 64 68. E-mail: [email protected].

� Published ahead of print on 9 May 2008.

4079

on March 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

microorganisms were present in this cider, and the role of O.oeni I4 in the spoilage remained unclear. An additional collec-tion of 80 IOEB O. oeni strains, all isolated from nonropywines (32 white wines, 41 red wines, and 7 roses or others), wasscreened for the presence of gtf by PCR: the genomic DNA of18/80 strains enabled amplification of an internal fragment ofgtf (117 bp) (9, 10).

O. oeni drives malolactic fermentation in most wines and iscommercialized as a malolactic starter. The presence of gtf inthe genome of this useful species is worrying, as it suggests thatit can represent a vector for ropiness in wine. Although thespecies has never been blamed, the role of O. oeni in ciderropiness can be suggested from the results of Ibarburu et al.(26) showing that O. oeni I4 produces �-glucan in a modelmedium and induces an increase in viscosity. Closer character-ization of the gtf gene in the wine O. oeni strains harboring itis now necessary to (i) specify the O. oeni gtf gene sequence andlocation and (ii) assess the gene expression and the proteinfunctionality but also to (iii) analyze the possible role of gtf inbacterial strain persistence in wine.

MATERIALS AND METHODS

Bacterial strains, growth parameters, and plasmids. The bacterial strains usedin this study are presented in Table 1. The nonropy mutant P. parvulus IOEB

0206 was obtained from P. parvulus IOEB 8801 by plasmid curing experiments(51).

P. parvulus and O. oeni were propagated at 25°C, without agitation, in liquidMRS (12) containing the following ingredients (in g � liter�1): glucose, 20; yeastextract, 4; beef extract, 8; Bacto peptone, 10; sodium acetate, 5; trisodium citrate,2; K2HPO4, 2; MgSO4 � 7H2O, 0.2; MnSO4 � H2O, 0.1; Tween 80, 1 ml. The pHof MRS was adjusted to 5.0.

Lactococcus lactis strains were grown at 30°C, without agitation, in M17 broth(47) containing 0.5% glucose. Escherichia coli DH5� cells were grown at 37°C(150 rpm) in Luria-Bertani (LB) medium (37). Plasmid pGK13 was used for thecloning experiments. It replicates in E. coli and L. lactis. Recombinant strains ofE. coli and L. lactis were grown in the presence of 100 �g � ml�1 and 5 �g � ml�1

of erythromycin, respectively.For exopolysaccharide (EPS) synthesis studies, strains were grown in dialyzed

medium in order to avoid the presence of polysaccharides in the initial medium.A 10� concentrated medium was prepared and dialyzed against the desired finalvolume of distilled water for 24 h at �4°C, using 6,000- to 8,000-Da-molecular-size-cutoff membranes. The pH was adjusted to 5.0, and the medium was ster-ilized for 20 min at 121°C. The inoculum represented 2% of the total volume.The fully filled bottles were incubated at 25°C without agitation except justbefore sampling. Beads were added to compensate for the loss of liquid aftersample removal and limit the volume of air in the bottle.

Molecular biology techniques. (i) DNA and RNA extraction. Total genomicDNA from lactic acid bacteria was purified using the Wizard Genomic DNApurification kit (Promega, Madison, WI). For total RNA extraction, cells wereharvested by centrifugation (6,000 � g, 15 min), suspended in the RNA isolationreagent Tri reagent (Sigma), and disrupted with glass beads (0.1 mm) in a Fastprep FP120 instrument at 4°C for 45 s each time for a total of six times at 6,500 �

g. Cell debris was eliminated by centrifugation, and RNA was purified from the

TABLE 1. Bacterial strains used in this study

Species Growth conditionsa Strain Reference or origin Genotypeb

Escherichia coli LB, 37°C, agitation DH5� gtf mutant

Lactococcus lactis M17, 30°C IL-1403 gtf mutantM17 � Ery (5 �g � ml�1), 30°C IL-1403(pGK13) gtf mutantM17 � Ery (5 �g � ml�1), 30°C IL-1403(pESoo8) This study gtf�

Pediococcus parvulus MRS, 25°C IOEB 8801 Bordeaux red wine gtf�

IOEB 0206 Laboratory mutant (51) gtf mutant

Oenococcus oeni MRS, 25°C IOEB 8413 Bordeaux red wine gtf mutantIOEB Sarco 1491 gtf mutantIOEB Sarco 436a gtf mutantIOEB Sarco 450 Commercial starters gtf mutantIOEB Sarco 277 gtf mutantPSU1 gtf mutantIOEB 0205 Champagne gtf�

IOEB Sarco 389 Chablis white wine gtf�

IOEB Sarco 390 gtf�



IOEB Sarco 397b White wine gtf�

IOEB Sarco 410 Bordeaux white wine gtf�


IOEB Sarco 421 Jura white wine gtf�



IOEB Sarco 448 Chablis white wine gtf�


IOEB Sarco 454 Bourgogne white wine gtf�





a Ery, erythromycin.bgtf�, strain displaying gtf gene; gtf mutant, strain whose genomic DNA did not enable the amplification of the expected fragment internal to gtf (primer sets FQ1/FQ2

and PF1/PF8).

4080 DOLS-LAFARGUE ET AL. APPL. ENVIRON. MICROBIOL.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

supernatant by chloroform extraction. RNA was then precipitated using isopro-panol, washed with 80% ethanol, and finally resuspended in diethyl pyrocarbon-ate-treated water. RNA concentration was calculated from the absorbance mea-sured at 260 nm (SmartSpec Plus spectrophotometer; Bio-Rad). Samples weretreated with DNase as indicated by the manufacturer (DNaA-free; Ambion).The absence of chromosomal DNA was controlled by PCR using primers PF1and PF8. The quality of RNA samples was checked on a 1% formaldehyde-agarose gel. The cDNA was then synthesized using the iScript cDNA synthesiskit (Bio-Rad), as recommended by the manufacturer.

(ii) PFGE and Southern blotting. Bacteria grown in MRS broth were har-vested during the exponential growth phase, washed twice with TE buffer (10mM Tris-HCl, 1 mM EDTA [pH 8]), resuspended in T100E buffer (10 mMTris-HCl, 100 mM EDTA [pH 7.5]), and embedded in 1% agarose slices. DNAwas extracted by incubating the gel slices for 8 h at 37°C in T100E buffercontaining 10 mg of lysozyme per ml, followed by 16 h at 37°C in TE buffersupplemented with 1.5% N-lauryl sarcosine and 2 mg of pronase per ml. The gelslices were subsequently transferred into T100E buffer and stored at 4°C untiluse. To obtain NotI digests, the gel slices were washed four times with TE buffer,rinsed with water, and incubated for 16 h at 25°C in 120-�l reaction mixturescontaining 150 U of NotI (New England Biolabs) according to the manufactur-er’s instructions. Pulsed-field gel electrophoresis (PFGE) was performed in a 1%agarose gel using the CHEF-DRIII system (Bio-Rad) with pulse times of 1 to25 s for 20 h at 6 V/cm and 15°C in 0.5� TEB buffer (45 mM Tris-OH [pH 8],45 mM boric acid, 1 mM EDTA). DNA was transferred to a Hybond-N�membrane (Amersham Biosciences) and hybridized by the method of Maniatiset al. (37). The DNA probe corresponded to a 950-bp internal region of the gtfgene amplified by PCR from total DNA from O. oeni IOEB 0205 cells usingprimers PF1 and PF8 (see Table 2). The probe was labeled with digoxigenin-11-dUTP by using the digoxigenin DNA labeling kit (Roche), and detection wasdone by chemiluminescence with an antidigoxigenin antibody and CDP-Star(Roche).

(iii) Sequencing of the gtf locus. The sequence of the gtf locus of O. oeni IOEB0205 was determined by the linker-mediated PCR strategy with the Topo-Walkerkit (Invitrogen). The sequences of the primers used are shown in Table 2.Purified DNA from O. oeni IOEB 0205 was used in order to identify restrictionenzyme cleavage sites located between 1 and 5 kb from the 950-bp internalfragment of the gtf gene amplified with primers PF1 and PF8. Two primerslocated inside this fragment and directed toward the upstream (GspC) or down-stream (GspD) regions were used to elongate DNA fragments containing anEcoRI site and a BamHI site, respectively, at their extremities (Fig. 1). The Topolinker was added to the extremities of the elongated DNA by topoisomerase-mediated ligation, providing two DNA templates that were amplified by PCRwith the primers for upstream GspB and downstream GspE and a primer locatedinside the Topo linker. The two PCR products were gel purified and sequenced(Milligen, France). Subsequent PCR experiments using primers designed fromorf1 orthologs in lactic acid bacteria and primer GspE enabled the completeregion shown in Fig. 1 to be amplified.

(iv) PCR analysis. PCR mixtures (25 �l) contained 0.5 �l of each primer (50pmol), 0.5 �l of genomic DNA, and 2 �l of custom-made PCR master mix 12.5X(Qbiogene, France). The reaction mixture was preheated for 5 min at 95°C, and35 cycles (denaturing step of 30 s at 95°C, annealing step of 30 s at 55°C, andextension step of 1 min at 72°C) were carried out. Using primers GspB and C2enabled the amplification of a 1,277-bp fragment, while primers GspE and C1generated a 997-bp fragment from the DNA from gtf� strains. The primer setsE/D, F/D, and G/H were used to search for the genes surrounding gtf in DNAfrom various O. oeni gtf mutant strains. The relative positions of the primers areindicated in Fig. 1, and their sequences are shown in Table 2.

(v) Reverse transcription-PCR (RT-PCR) analysis. The 50-�l reaction mix-ture contained 25 �l of the 2� Sybr green PCR supermix (Bio-Rad), 5 pmol eachof primers FQ1 and FQ2 for gtf amplification and LDH1 and LDH2 for D-lactatedehydrogenase (ldhD) amplification, and 1 �l of cDNA in the appropriatedilution (to ensure a final concentration of 0.1 ng/�l). The reaction mixture waspreheated for 5 min at 95°C, and 35 cycles (denaturing step of 30 s at 95°C,annealing step of 30 s at 63°C for gtf and 30 s at 60°C for ldhD, and extension stepof 30 s at 72°C) were carried out. After the last cycle, a melting curve analysis wasperformed using the iCycler iQ (Bio-Rad) to check PCR specificity. The resultswere analyzed using the comparative critical threshold method with the O. oenildhD gene as an internal calibrated target, as proposed by Desroches et al. (13)for this microorganism.

(vi) Cloning of gtf. The gene encoding Gtf was amplified by PCR from totalDNA from O. oeni IOEB 0205, with the primers Start and Stop designed tointroduce EcoRI and NcoI sites, respectively, at the boundaries (Table 2). Theinsert, recovered from the PCR product after gel purification and digestion withNcoI and EcoRI, was cloned into the corresponding restriction sites of thepGK13 vector; the constructed plasmid, pESoo8 was introduced into E. coliDH5�, and positive clones were selected at 37°C in the presence of erythromycin(100 �g/�l). The plasmid insert was sequenced (Milligen, France) to ensure thatno mutations occurred in the gtf gene. The pESoo8 plasmid was subsequentlyintroduced into L. lactis IL-1403 cells by electrotransformation, and positiveclones were selected at 30°C in the presence of erythromycin (5 �g/�l) (7).

Analytical methods. (i) Substrate and product analysis. Glucose and lactateconcentrations were measured using enzymatic in vitro tests (Boehringer Mann-heim, Germany). For EPS concentration measurements, the whole medium wascentrifuged (10,000 � g, 15 min, 4°C), and 5 volumes of 96% ethanol containing5% HCl (1 N) were added to the supernatant to precipitate the polysaccharides.The tubes were left to stand for 24 h at 4°C. The tubes were then centrifuged(10,000 � g, 15 min, 4°C), and the pellet was washed with 80:20 ethanol-water,centrifuged again, dried for 20 min at 65°C, and dissolved in distilled water. Theamount of neutral polysaccharides was determined using the phenol-sulfuric acidmethod (14), with glucose as the standard. The determination was carried out onthree replicate samples.

(ii) Size exclusion chromatography. The whole medium (100 ml) was centri-fuged (10,000 � g, 20 min, 4°C), and macromolecules from the supernatant wereprecipitated with 5 volumes of 95% ethanol containing 5% HCl (1 N). After 24 hat 4°C, the pellet was recovered by centrifugation (10,000 � g, 20 min, 4°C),washed with 80% ethanol, resuspended in water, and freeze-dried. The freeze-dried powder (30 mg) was resuspended in 3 ml of elution buffer (50 mMK2HPO4, 150 mM NaCl [pH 7.0]) and analyzed using a Sephacryl S400 HRcolumn (1.6 by 83 cm) (Amersham Biosciences), eluted at a 1.2-ml/min flow ratewith a Waters 515 pump. Detection was done with a Waters 2414 refractometer.Column calibration was carried out with commercial dextrans having molecularmasses ranging from 15,000 to 2 � 106 Da.

(iii) Polysaccharide monomer composition analysis. Fractionation of the cul-ture supernatant by ultrafiltration was also performed. A volume of 560 ml of

TABLE 2. Primers used in this study

Primer Sequence (5�33�) Purposea

C1 ACACCCTTAATTCATAGTTCACTGGGCTAC

gtf islandanalysis

C2 CTCGTGACGCTGTCATTCGATATACTAC

D ATGAAGGAACTGGATATCCACTCCGT

E GTTTTAAGAGACATTCAGAACCGCGT

F GCATTAAATCAGGCGGCCATTTGG CGGTCGTGAATTGATGGCACGGspB TTTACCCTAGCAGCTCCAATAA

TTGCGspC GTCCAGCGTTGCACATTCCACTAGGspD TTGGCAGAACTAGCGAAAGTACGCGspE TCCACTAATGTGATTACACTGAAG

AATGCH GAGTCCGTACACCCATCTT gtf qPCR

FQ1 CTGTGTCTGGCGTTTCTGTAGGFQ2 GCCACCGCATAGGGTATTTGTC

LDH1 GCCGCAGTAAAGAACTTGATG ldh qPCRLDH2 TGCCGACAACACCAACTGTTT

PF1 GATTGTAATAAAATAAAAAGACCC Checkingwithingtf

PF8 CATATGATAACACGCAGGGC

Start GGAATTCCGGAATGTAGTATAAATGTTAAATG (EcoRI site underlined)

gtf cloning

Stop TCACGCTATCTGCCATGGAAGCGAAC (NcoI site underlined)

a qPCR, quantitative PCR.

VOL. 74, 2008 GLUCOSYLTRANSFERASE GENE IN P. PARVULUS AND O. OENI 4081


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

dialyzed MRS culture supernatant was filtered on a 100-kDa-cutoff Amiconmembrane. The monomer composition of polysaccharides (the freeze-driedpowder described above or the high-molecular-weight fraction obtained by ul-trafiltration) was determined after acid hydrolysis (2 N H2SO4 for 6 h at 100°C).The neutral monomer composition was determined by gas-liquid chromatogra-phy of alditol acetate derivatives using inositol as the internal standard. Sugaranalysis was performed with an Agilent 6850 series gas chromatograph systemequipped with an ESP2380 macrobore column (25 m by 0.53 mm).

(iv) 1H and 13C NMR analysis. The 13C nuclear magnetic resonance (NMR)spectra of the glucans were recorded with a Bruker AC 300 spectrometer operatingat a frequency of 75,468 MHz. Samples were examined as solutions in D2O (10 to 15mg in 0.35 ml of solvent) at 70°C in 5-mm-diameter spinning tubes (the internalstandard was 13CH3 at 31.5 ppm relative to tetramethyl silicon). Quantitative 13Cspectra were recorded using the INVGATE Bruker sequence, with 90 pulse length(6.5 ms), 15,000-Hz spectral width, 8,000 data points, 0.54-s acquisition time, and arelaxation delay of 1.5 s, and 100,000 scans were accumulated.

(v) Immunological analysis. Agglutination tests were performed using S. pneu-moniae type 37-specific antisera as previously reported (51). Four microliters ofantiserum was spotted on a slide with 20 �l of culture broth and incubated for 30min at 4°C before observation using phase-contrast microscopy.

Stress challenges. The bacteria were grown to the early stationary phase,harvested by centrifugation (6,000 � g, 5 min, 4°C), and resuspended in eitherfresh medium (M17 agar plus 5 �g/ml erythromycin for L. lactis strains and MRSfor the other bacteria) containing the stressor (alcohol or sulfur dioxide ormodified pH) or filtered (0.2-�m-cutoff membrane) red or white wine. The redwine used was of the merlot variety. The white wine was from a blend of differentvarieties of white grapes. The ethanol content was 12%, the pH was 3.81 (red) or

3.25 (white), and the sulfur dioxide content was 20 mg/liter. After 3 h at 25°C (or1 h at 30°C for L. lactis strains), serial 10-fold dilutions in 0.9% NaCl were platedon MRS agar (or M17 agar containing 5 �g/ml erythromycin for L. lactis strains)and incubated at 25°C (or 30°C for L. lactis). Colonies were counted 3 days to 1week later. Survival ratios were calculated from CFU in the stressed medium cellsuspension compared to the supernatant cell suspension.

Adhesion assays. The ability to form a biofilm on an abiotic surface wasquantified by a method adapted from O’Toole et al. (42). Each bacterial strainwas inoculated in the appropriate medium, and 16 200-�l samples of cell sus-pension were deposited in a sterile 96-well polystyrene microtiter plate. After 1or 5 days (L. lactis) or 12 or 30 days (O. oeni and P. parvulus) at 25°C, the wellswere gently washed three times with 200 �l of 0.9% NaCl, dried in an invertedposition, and stained with 1% crystal violet. The wells were rinsed again, and thecrystal violet was solubilized in 100 �l of ethanol-acetone (80:20, vol/vol). Theabsorbance at 595 nm was determined using a microplate reader (MolecularDevices). Three independent assays were performed.

Statistical analysis. The statistical significance of differences between means wascalculated using analysis of variance followed by Tukey post hoc comparisons (P � 0.05).

Nucleotide sequence accession number. The nucleotide sequence data re-ported in this study have been deposited in the DDJB/EMBL/GenBank databaseunder the accession number EU556433.

RESULTS

Pediococcus parvulus is the most described vector of oilinessin wines and ciders. The metabolic pathways involved and the

FIG. 1. Genetic organization of various DNA regions containing the gtf gene in pediococci and O. oeni. (A) Plasmid pF8801 (5.5 kb) from P.parvulus IOEB 8801 (GenBank accession no. AF196967) and plasmid pPP2 (35 kb) from P. parvulus 2.6 (GenBank accession no. AY999683).(B) O. oeni IOEB 0205 chromosome (this study). (C) Orthologous genes in other lactic acid bacteria. (Map 1) Transposases in Lactobacillus caseiATCC 334 (three copies of CP_000423), in L. casei ATCC 393 (AF445084), and in bacteriophage phiAT3 (YP_025041). (Map 2) Transposase IS30in Pediococcus pentosaceus ATCC 25745 (CAA83666), Lactobacillus plantarum (ISLpL2 [GenBank accession no. AF459445]), O. oeni PSU1 (threecopies of the complete IS [GenBank accession no. CP_000411]), L. casei ATCC 334 (four copies of the complete IS [GenBank accession no.CP_000423]), and Lactobacillus brevis ATCC 367 (five copies of the complete IS [GenBank accession no. CP_000416]). (Map 3) Transposase inL. casei ATCC 334 (four copies of the complete IS [GenBank accession no. CP_000423]). The large arrows indicate genes, while the smallhorizontal arrows (3) indicate the positions of the primers for PCR experiments and the small vertical arrows (2) indicate the restriction sites.The boxes and the gray-shaded sections link the DNA regions exhibiting significant sequence identity.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

dedicated genetic determinants (glucosyltransferase gene gtf)leading to ropiness have been studied in several strains. Mo-lecular detection tools based on PCR have been designed, andthey were used to analyze a collection of 80 O. oeni IOEBstrains all isolated from nonropy wines. The expected ampliconwas amplified in a total of 18/80 strains (9, 10, 51). These 18 O.oeni gtf� strains were geographically unrelated, since they orig-inated from wines produced in different geographic areas (Ta-ble 1). However, it is worth noting that they all originated fromwhite wine. Their NotI-digested total DNA was compared byPFGE (data not shown) to assess their genetic relatedness. Allthe strains displayed distinct PFGE profiles, except for theIOEB Sarco 422 and IOEB Sarco 421 isolates, which could notbe distinguished on the basis of their PFGE profiles. Bothisolates came from Jura white wine.

Genetic localization of gtf in O. oeni gtf� strains. Native andNotI-digested total DNAs from O. oeni IOEB 0205 were an-alyzed by PFGE, and after Southern blotting, the membranewas hybridized with a probe targeting an internal fragment ofgtf. Prior to digestion, hybridization was observed with chro-

mosomal DNA (Fig. 2B, lane 1). After digestion by NotI, theprobe hybridized to a 242-kb fragment (Fig. 2B, lane 2). Anal-ysis of the other O. oeni gtf� strains also demonstrated a chro-mosomal location on a NotI-digested fragment whose size var-ied from 220 to 250 kb, depending on the strain (not shown).

A 3,528-bp nucleotide sequence containing gtf was deter-mined by a linker-mediated strategy, starting from the internal950-pb region obtained by PCR (primers PF1 and PF8) on O.oeni IOEB 0205 genomic DNA. The G�C content of thisregion was 39%, which is quite similar to the 37% G�C con-tent reported for the two available O. oeni genomes (GenBankaccession no. CP_000411 and NZ_AAUV00000000). The ge-netic organization of the sequence is depicted in Fig. 1B. TheO. oeni IOEB 0205 gtf gene displayed 1,701 nucleotides, as withthe orthologous genes described in the literature (22, 53). Theidentity with reported gtf genes was very high: 97.8% with thepF8801 gtf gene, 97.9% with the pLD1 gtf gene (L. diolivorans),98% with the pPP2 gtf gene (P. parvulus 2.6), and 99.1% withthe O. oeni I4 gtf gene (53). The 26 nucleotides upstream of gtfcontaining the ribosome binding sequence were 100% con-served between plasmids pPP2, pF8801, and the chromosomeof O. oeni IOEB 0205. The upstream sequence of gtf genes inO. oeni I4 and L. diolivorans G77 were not available for com-parison. Downstream of gtf, 10 nucleotides were conservedbetween the P. parvulus pPP2 and pF8801 plasmids, but thesenucleotides were not present at the end of the O. oeni IOEB0205 gtf gene (Fig. 1).

Comparison of the 3,528-bp DNA sequence with the Na-tional Center for Biotechnology (NCBI) database revealedinteresting homologies indicating a mosaic structure (Fig. 1).In O. oeni IOEB 0205, gtf is surrounded by two putative trans-posases. The first one (ORF1), 621 nucleotides (nt) (251amino acids) long, had a protein sequence 99% identical(89.6% to 100% coverage) to that of transposases (COG 2801)from Lactobacillus casei ATCC 334, L. casei ATCC 393, andbacteriophage phiAT3. The region downstream of ORF1 (nt621 to 747) was 98% identical to the downstream region ofthis transposase in L. casei or bacteriophage phiAT3. Fur-thermore, the region IS from nt 747 to 1020 was 91%identical to the nucleotide sequence (25% coverage) of atransposase IS30 encountered in several lactic acid bacteria,including O. oeni PSU1. The second open reading frame(ORF) (ORF2), 646 nt long and divergently transcribedfrom gtf, had a protein sequence 99 to 100% identical (64%coverage) to that of several putative IS30 transposases(COG2826) from L. casei ATCC 334.

Next we examined the genetic environment in other gtf�

strains. The primer sets GspB/C2 and GspE/C1 were used andgenerated the same amplification profile in all the strainstested (Fig. 3). The amplicons from four additional strainswere sequenced, revealing 99.8% identity between IOEBstrains Sarco 393, Sarco 410, Sarco 421, and 0205 and 99.9%identity between IOEB strains Sarco 397 and 0205.

In addition, PCR experiments were carried out in order toamplify these regions from genomic DNA from several O. oenigtf mutant strains (IOEB Sarco strains 450, 277, 1491, and 436aand IOEB 8413). The primer sets D/E, D/F, and G/H (posi-tions shown in Fig. 1B) did not enable any amplicons to beobtained (not shown). Last, the DNA sequences upstream anddownstream of gtf were not present in the O. oeni PSU1 and

FIG. 2. (A) PFGE analysis of O. oeni IOEB 0205. Undigestedgenomic DNA (lane 1) or DNA digested by NotI (lane 2). chDNA,chromosome DNA. (B) Southern hybridization analysis of total DNAprepared for panel A, using an internal fragment of the gtf gene as aprobe.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

ATCC BAA_1163 genomes (GenBank accession no. CP_000411and NZ_AAUV00000000). Only the IS sequence was found.However, multiple IS30-related elements exist in O. oeni PSU1.

Functional analysis of gtf and Gtf with O. oeni IOEB 0205.O. oeni IOEB 0205 was propagated in dialyzed MRS medium.Glucose metabolism by O. oeni IOEB 0205 led to biomassmultiplication (maximum optical density at 600 nm of 2.8) andexopolysaccharide accumulation (227 mg/liter) (Fig. 4A).Throughout the whole culture period, EPS synthesis repre-sented a loss of 1.25% of the glucose consumed by the bacteria.EPS synthesis occurred during growth and glucose consump-tion. No polymer degradation occurred over 60 days (Fig. 4A).The gtf gene was expressed all along the culture period with athreefold increase during the exponential growth phase (Fig.4B). The culture medium was clearly ropy from the 8th day(Fig. 4C). Moreover, upon agitation, the resuspended cell de-

posit formed a long string, which is a common trait of glucan-producing pediococci. However, to the naked eye, the celldeposit was less cohesive than that observed with ropy pedio-cocci. Most O. oeni gtf mutant cells formed chains 3 to 7 unitslong, while O. oeni IOEB 0205 formed chains 10 to 20 unitslong, indicating a specific phenotype for this strain (Fig. 5A).Immunoagglutination assays were performed at different cul-ture times (5th, 15th, and 28th day; Fig. 4A and 5B). Theseclearly indicated the presence of �-glucan at the cell surfacethroughout the culture. In the same conditions, O. oeni gtfmutant strains never agglutinated in the presence of anti-type37 antibodies (not shown).

The polysaccharides in the supernatant were precipitated atthe end of the culture and analyzed by size exclusion chroma-tography. The chromatographic profile was compared with thatobtained for P. parvulus IOEB 8801 (Fig. 6). Two main classes

FIG. 3. Multiplex PCR analysis on genomic DNA using primers GspB/C2 (997-bp amplicon) and C1/GspE (1,277-bp amplicon). Lanes: 1,negative control (no DNA); 2, P. parvulus IOEB 8801; 3, P. parvulus IOEB 0206; 4, positive control (O. oeni IOEB 0205); 5, negative control (O.oeni ATCC BAA-1163). Lanes 6 to 22 contain O. oeni IOEB Sarco strains 389 (lane 6), 390 (lane 7), 392 (lane 8), 393 (lane 9), 397b (lane 10),410 (lane 11), 413 (lane 12), 421 (lane 13), 422 (lane 14), 423 (lane 15), 448 (lane 16), 449 (lane 17), 454 (lane 18), 455 (lane 19), 456 (lane 20),457 (lane 21), and 459 (lane 22).

FIG. 4. (A) Growth and exopolysaccharide production by O. oeni IOEB 0205 in dialyzed MRS. F, optical density at 600 nm [OD(600)]; ▫,glucose; ‚, EPS. The big black arrows indicate the samples used for immunoagglutination assays. (B) gtf expression levels (relative to the lactatedehydrogenase gene ldh). (C) Visualization of ropiness induced by O. oeni IOEB 0205 in dialyzed MRS medium.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

of molecules were obtained. The first group of molecules dis-played a molecular mass lower than 60 kDa. These represented45% and 95% of the polymers precipitated from P. parvulusIOEB 8801 and O. oeni IOEB 0205, respectively. The secondgroup was composed of high-molecular-mass molecules (morethan 106 Da) eluted at around 80 min. These molecules rep-resented less than 5% of the polymer precipitated in the O.oeni IOEB 0205 culture broth and 55% of the polymer pre-cipitated in that of P. parvulus IOEB 8801. According to Llau-beres et al. (28), the ropy �-glucan has a mean molecular massof 800 kDa and should elute at this peak. The chemical analysisof the whole precipitate, as well as the analysis of the high-molecular-weight fraction obtained by size exclusion chroma-

tography, indicated the presence of glucose, galactose, man-nose, ribose, and N-acetylglucosamine. The background signalwas very high on the 1H NMR spectrum, indicating the pres-ence of numerous oxidic bonds. In order to improve isolationof the high-molecular-weight �-glucan, macromolecules fromthe supernatant were concentrated by ultrafiltration withoutprior alcohol precipitation. A methylation analysis was thenconducted and indicated the predominance of glucan in theretentate. The 1H NMR spectrum exhibited a lower back-ground signal and the characteristic signals of the H-1 of �-1,3and �-1,2 linked glucopyranoses. This was confirmed by the13C NMR spectra through the C-3 signal at 87.6 ppm and thethree C-1 signals of equal intensity at 104 to 105 ppm (16, 17,

FIG. 5. Immunoagglutination induced by anti-type 37 antibody. (A and B) O. oeni IOEB 0205 without antibody (A) and after antibody addition(B). (C and D) L. lactis IL-1403(pESoo8) without antibody (C) and after antibody addition (D). (E and F) L. lactis IL-1403(pGK13) withoutantibody (E) and after antibody addition (F).



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28). �-Glucan was thus present in this high-molecular-weightretentate. However, its isolation and analysis were much moredifficult than in the case of pediococci. Similar problems havebeen mentioned by Ibarburu et al. (26) with O. oeni I4.

O. oeni is not amenable to genetic transformation. Hence, todemonstrate the role of gtf in glucan production, the gene wasexpressed in L. lactis IL-1403. Prior to cloning, PCR was usedto check (primer sets PF1/PF8 and FQ1/FQ2) that L. lactisIL-1403 did not display gtf. Expression of gtf in L. lactis IL-1403(pESoo8) was then checked by RT-PCR (not shown).Immunoagglutination assays clearly indicated that L. lactis IL-1403(pESoo8) was positive (Fig. 5C and D). Moreover, uponagitation, the resuspended cell deposit formed a long string.However, the L. lactis strain harboring the pGK13 plasmid (gtfmutant) did not agglutinate (Fig. 5E and F) or form a stringupon agitation. The gtf gene in O. oeni IOEB 0205 enabled thesynthesis of �-glucan on the surfaces of the cells of either O.oeni or L. lactis. After cultivation in the appropriate dialyzedM17 medium (Table 1), L. lactis IL-1403(pESoo8) culturesupernatants contained 28 � 5 mg/liter EPS, whereas L. lactisIL-1403(pGK13) culture supernatants contained only 13 � 6mg/liter EPS, suggesting that �-glucan was excreted by therecombinant strain. This was confirmed by NMR analysis (notshown). However, L. lactis IL-1403(pESoo8) did not induce anincrease in ropiness of the medium.

Functional analysis of gtf and Gtf with the other O. oeni gtf�

strains. RT-PCR analysis of RNA extracted from the cells ofthe 17 other O. oeni gtf� strains sampled during exponentialgrowth indicated the presence of gtf mRNA (relative expres-sion level between 0.5 and 1 using lactate dehydrogenase as areference). Immunoagglutination assays clearly indicated thepresence of a �-glucan capsule around the cells of 13 strains.Strains IOEB Sarco 454, 455, 456, and 457 were negative,although three independent assays were performed on cellstaken at various stages of growth (not shown). However, smallamounts of �-glucan capsule (undetectable) cannot be ruledout for these four strains.

The total level of EPS production by the 17 gtf� strainsvaried from 50 to 250 mg/liter (227 mg/liter with strain IOEB0205), but in contrast to strain IOEB 0205, none of the othergtf� strains induced an increase in viscosity and ropiness of themedium.

Presence of gtf and resistance of bacteria to stressful con-ditions. In order to demonstrate whether glucan formationconfers a selective advantage, we compared the behavior of L.lactis harboring either pGK13 or pESoo8 and that of P. par-vulus IOEB 8801 and its nonropy mutant IOEB 0206. Chal-lenges were performed over 1 to 3 h on planktonic cells iso-lated during the early stationary growth phase. Strains weresubjected to single stresses relevant in wine: acidic pH,ethanol, and sulfur dioxide (Fig. 7). Survival of gtf� strainswas improved by 1 to 2 log units in stressful conditions. Thiswas particularly true at low pH. Compared to its nonropyvariant P. parvulus IOEB 0206 (51), P. parvulus IOEB 8801exhibited an increased survival rate when introduced intowine and protection by Gtf was 12.5 higher in white winecompared to red wine. That is to say, white wine representeda stronger stress than red wine for the gtf mutant strain butnot for the gtf� strain. L. lactis is not a bacterium found inwine, and the challenge in wine led to bacterial death. How-ever, these experiments clearly demonstrate the improvedsurvival rates of the P. parvulus and L. lactis gtf� strains instressful conditions.

The genetic transformation of O. oeni being impossible, thesurvival rate of wild strains of O. oeni in wine was investigated(Fig. 8). Three strains were used: O. oeni IOEB Sarco 450 (gtfmutant), O. oeni IOEB 0205 (gtf�), and IOEB 8413 (gtf mu-tant). As shown in Fig. 8, the gtf� strain exhibited an interme-diate survival rate in red wine and the best survival rate inwhite wine. As for pediococci, white wine represented a stron-ger stress than red wine for the gtf mutant strain but not for thegtf� strain. However, this high level of resistance cannot beassigned to the sole gtf gene in this experiment because O. oeniis a highly variable species (11, 38) and because resistance towine is a complex mechanism.

Presence of gtf and biofilm formation. The adhesion capac-ities of P. parvulus IOEB 8801 and its nonropy mutant IOEB0206 and L. lactis harboring either pGK13 or pESoo8 wereanalyzed (Table 3). The strains of L. lactis and P. parvulusharboring gtf exhibited significantly increased adhesion com-pared to their gtf mutant variant in the early assay (1 or 12days) as well as later (5 or 30 days). O. oeni IOEB 0205 didnot exhibit any significant adherence compared to wild gtfmutant strains in the early assay, but, in the later assay (30

FIG. 6. Size distribution analysis of the alcohol-precipitated polysaccharides from the dialyzed MRS culture supernatant of O. oeni IOEB 0205and P. parvulus IOEB 8801. RI, refractive index.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

days), it showed significantly better adherence than theother O. oeni strains did.

DISCUSSION

Several PCR experiments reported in the literature sug-gested the presence of gtf orthologs in O. oeni (10, 51, 53). Inthis study, we have shown that in O. oeni strains from wine, gtfis integrated in the chromosome, whereas in P. parvulus or L.diolivorans, gtf is located on the plasmid (18, 32, 51, 53). Inaddition, the gtf nucleotide sequence is highly conserved in O.oeni (99% identity between the five gtf orthologs sequenced inthis study and gtf in O. oeni I4) but also among the other lacticacid bacteria (at least 97.5% identity). This high level of se-quence identity may be due to high requirements in amino acidconservation to ensure glycosyltransferase activity, or it mayindicate recent horizontal transfer between species (5, 25, 27,

30, 33, 38). Actually, frequent horizontal transfers are thoughtto be the cause of the high level of diversity within the speciesO. oeni (11, 39, 53) and may promote the evolution of bacterialgene loci through genomic island interexchange (5, 8, 24, 25,30, 38, 53). Genomic islands can display very different struc-tures, modes of acquisition, or mobility mechanisms (8, 24).Indeed, the mosaic structure and the presence of putativetransposase genes (ORF1 and ORF2), as well as truncatedinsertion sequences (ISs) in the nucleotide sequence surround-ing gtf, suggests that transfers and recombinations involving ISsmay have led to the integration of gtf in the O. oeni chromo-some. Furthermore, several facts indicate that gtf and the nu-cleotide sequence surrounding it in O. oeni (ORF1 and ORF2)could form part of a genomic island. (i) These three ORFswere systematically found in the O. oeni gtf� strains analyzed,and their sequences are highly conserved. (ii) These ORFswere not encountered in the O. oeni gtf mutant strains ana-

FIG. 7. Survival rates to single stresses (pH, ethanol, SO2, or wine). (A) L. lactis IL-1403(pESoo8) (gtf�) (black bars) and L. lactis IL-1403(pGK13) (gtf mutant) (white bars). (B) P. parvulus IOEB 8801 (gtf�) (black bars) and P. parvulus IOEB 0206 (gtf mutant variant) (white bars).



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

lyzed. (iii) The gtf� strains displayed distinct PFGE profilesand originate from very distant geographic zones. This de-creases the probability of a common ancestor that received gtfand then evolved into different strains without significantchanges in the gtf sequence, but (iv) the island might be largerthan 3,528 bp. However, its exact size could not be determinedin the present study due to the presence of IS sequences at thecurrent boundaries resulting in multiple priming during PCRextension assays.

The acquisition of an island is not always sufficient to conferthe associated phenotype to the bacteria (23). In the presentcase, we showed that gtf is expressed in all the O. oeni gtf�

strains tested. We also checked the activity of Gtf through�-glucan detection. (i) The molecular cloning of gtf into L.lactis led to the accumulation of �-glucan in the capsular formand in the soluble form. (ii) Immunoagglutination assays indi-cated the presence of a �-glucan capsule around the cells of

most of the O. oeni gtf� strains. (iii) O. oeni IOEB 0205 accu-mulated EPS in the culture supernatant, and �-glucan waspresent in soluble form, although it represented a very minorpart of the polysaccharides in the supernatant.

The integration of gtf in the chromosome presents severaladvantages over retaining it on an episome: there is no furtherneed for replicating elements, and no risk of losing the genewhen selective pressure is lower. This finding, associated withthe unexpected level of occurrence of gtf (18/80 strains) in theO. oeni collection studied by Delaherche (10), prompted us toinvestigate the selective advantage provided by the acquisitionof gtf. The present study shows that, in O. oeni IOEB 0205, theEPSs produced were not degraded and did not serve as exter-nal sources of carbon or energy, as described in the literaturefor pediococci �-glucan and for most lactic acid bacteria EPS(2). In addition, by using the plasmid-cured P. parvulus strainand the recombinant L. lactis, we showed that the presence ofgtf confers two selective advantages to these bacteria. (i) Thefirst selective advantage is a higher rate of survival in acidic pH,high ethanol or sulfur dioxide concentrations in a planktonicstate, and a higher rate of survival in red or white wine in aplanktonic state. Lonvaud-Funel and Joyeux (31) had previ-ously noticed that pediococci isolated from ropy wine exhibiteda strong resistance to conditions in wine (e.g., ethanol, pH, orSO2 content), but the results of this study have clearly dem-onstrated the link between gtf and this stress resistance. Gtfcertainly promotes resistance by synthesizing a glucan capsulearound the cells. Indeed, many capsular EPSs have been shownto play a role in the protection of the microbial cell againstdesiccation, phagocytosis, phage attack, antibiotics, toxic com-pounds, and osmotic stress (2, 21, 35, 44, 46). (ii) The secondselective advantage brought by gtf is an increased adhesion inthe early stages and above all in the later stages of biofilmformation. Biofilm formation is a sequential process initiatedby the attachment of planktonic cells to a surface and subse-quent steps where the entire community is embedded in anamorphous matrix partly composed of polysaccharides (6, 41,42, 52). Linear and nearly fibrillar neutral polymers, such as�-glucan produced by Gtf, are thought to constitute key ele-

FIG. 8. Survival rates in wine of various O. oeni strains displayinggtf: O. oeni IOEB 0205 (gtf�), O. oeni IOEB 450 (malolactic starter; gtfmutant), and IOEB 8413(gtf mutant).

TABLE 3. Microplate attachment assaysa

Strain

Absorbance (595 nm)b of:

Initial biofilm after1 day

Mature biofilm after5 days

Initial biofilm after12 days

Mature biofilm after30 days

L. lactis IL-1403(pESoo8) 0.11 � 0.01** 0.23 � 0.05** ND NDL. lactis IL-1403(pGK13) 0.09 � 0.01 0.11 � 0.03 ND ND

P. parvulus strainsIOEB 8801 ND ND 0.79 � 0.20** 0.99 � 0.25**IOEB 0206 0.28 � 0.11 0.35 � 0.12

O. oeni strainsIOEB 0205 ND ND 0.09 � 0.02 0.35 � 0.12*PSU1 0.10 � 0.03 0.21 � 0.02IOEB 8413 0.09 � 0.02 0.15 � 0.05

a Biofilms were stained with crystal violet after short (initial biofilm) or long (mature biofilm) incubation periods. The incubation period was varied depending onthe species-specific growth rate in the conditions of the assay.

b Values that were significantly different between the gtf� strain and the corresponding gtf mutant strain(s) of the same species, after the same period of incubation,are indicated as follows: �, P � 0.05; ��, P � 0.005. ND, not determined.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

ments that strengthen and organize the biofilm structures (19,45, 52).

In O. oeni, the selective advantage brought by gtf was notentirely demonstrated, due to the variable genetic backgroundof the gtf� and gtf mutant strains. O. oeni IOEB 0205 (gtf�)exhibited significantly higher adhesion than the other strainsanalyzed. It also exhibited a higher survival rate than strainIOEB8413 did. This, associated with the results obtained withL. lactis and P. parvulus, suggests that Gtf forms part of theselection of O. oeni stress resistance tools, in addition to other,better described metabolic equipment, such as H� ATPases(20, 23), FtsH proteases, chaperones (3, 20) and multidrugresistance proteins (4). However, O. oeni IOEB 0205 (gtf�) wasnot as resistant to red wine as the malolactic starter IOEBSarco 450 was. �-Glucan synthesis may be useful for survival inwine, but it is not sufficient to confer the highest survival rateson the gtf� strains. Nevertheless, the high proportion of O. oenigtf� strains in the collection analyzed may reflect the following:(i) a higher degree of tolerance to wine (especially to whitewine) thanks to the presence of a glucidic capsule around thecells, and (ii) a selective advantage for adhesion to grapes orwinemaking material and a higher level of subsistence on thewinery material through biofilm cohesion.

What about the risk of spoilage? None of the O. oeni gtf�

strains were isolated from ropy wine, and the species has neverbeen blamed for inducing ropiness. However, in the case of O.oeni IOEB 0205, the �-glucan produced, although a minorityamong the EPSs produced, is abundant enough or may interactwith the other polysaccharides present (40) to clearly increasethe viscosity of dialyzed MRS. In contrast, the other O. oenigtf� strains isolated from wine, as well as the recombinantlactococcal strains, produced soluble polysaccharides, but noincrease in viscosity was observed in the model medium. Suchdiscrepancy between genetic equipment and slime productionwas observed by Bourgoin et al. (5) with Streptococcus ther-mophilus. It is possible that these O. oeni gtf� strains produceadditional polysaccharides which prevent �-glucan networkformation and thus prevent an increase in viscosity (40). It isalso possible that these strains never induce ropiness due to alevel of �-glucan formation that is too low, which may be theconsequence of the low availability of the precursor UDP-glucose (2, 27). Indeed, four of these strains did not agglutinatein the presence of antibodies targeting �-glucan, suggesting avery low level or even the absence of excreted �-glucan amongthe excreted EPSs. The composition of the medium can alsoinfluence polysaccharide formation and composition (2, 47).However, the carbohydrates in wine are far less abundant thanin the model media used in this study (43). This suggests that�-glucan formation in wine may be even more difficult than inthe model medium. Nevertheless, it is still possible that theseO. oeni gtf� strains, once in a convenient must or wine, abun-dantly produce �-glucan and lead to wine ropiness. As a result,though induction of ropiness in wine by most O. oeni gtf�

strains seems improbable, it cannot be completely excluded.More worrying is the fact that gtf can form part of a func-

tional mobile element. This, associated with the improved ca-pacity of the gtf� bacteria to form biofilms, may promote gtftransfer from one species to another and between variousstrains within a species. Indeed, biofilms are the place of ac-

celerated conjugation rates (52). Assessment of gtf mobility willbe an interesting focus for further studies.

ACKNOWLEDGMENT

We thank E. Garcia for providing the anti-type 37 antibody.

REFERENCES

1. Adeyeye, A., P. E. Jansson, and B. Lindberg. 1988. Structural studies of thecapsular polysaccharide from Streptococcus pneumoniae type 37. Carbohydr.Res. 180:295–299.

2. Boels, I. C., R. van Kranenburg, J. Hugenholtz, M. Kleerebezen, and V. M.de Vos. 2001. Sugar catabolism and its impact on the biosynthesis andengineering of exopolysaccharide production in lactic acid bacteria. Int.Dairy J. 11:723–732.

3. Bourdineaud, J. P., B. Nehme, S. Tesse, and A. Lonvaud-Funel. 2003. TheftsH gene of the wine bacterium Oenococcus oeni is involved in protectionagainst environmental stress. Appl. Environ. Microbiol. 69:2512–2520.

4. Bourdineaud, J. P., B. Nehme, S. Tesse, and A. Lonvaud-Funel. 2004. Abacterial gene homologous to ABC transporters protects Oenococcus oenifrom ethanol and other stress factors in wine. Int. J. Food Microbiol.92:1–14.

5. Bourgoin, F., A. Pluvinet, B. Gintz, B. Decaris, and G. Guedon. 1999. Arehorizontal transfers involved in the evolution of the Streptococcus thermo-philus exopolysaccharide synthesis loci? Gene 233:151–161.

6. Branda, S. S., A. Vik, L. Friedman, and R. Kolter. 2005. Biofilms: the matrixrevisited. Trends Microbiol. 13:20–26.

7. Broadbent, J. R., and J. K. Kondo. 1991. Genetic construction of nisin-producing Lactococcus lactis subsp. cremoris and analysis of a rapid methodfor conjugation. Appl. Environ. Microbiol. 57:517–524.

8. Burrus, V., G. Pavlovic, B. Decaris, and G. Guedon. 2002. Conjugativetransposons: the tip of the iceberg. Mol. Microbiol. 46:601–610.

9. Delaherche, A., O. Claisse, and A. Lonvaud-Funel. 2004. Detection andquantification of Brettanomyces bruxellensis and “ropy” Pediococcus damno-sus strains in wine by real time polymerase chain reaction. J. Appl. Microbiol.97:910–915.

10. Delaherche, A. 2006. Adaptation d’Oenococcus oeni a l’environnementoenologique: approaches genomique comparative, transcriptomique et pro-teomique. Ph.D. thesis no. 1385. Universite Victor Segalen Bordeaux 2,Talence, France.

11. de las Rivas, B., A. Marcobal, and R. Munoz. 2004. Allelic diversity andpopulation structure in Oenococcus oeni as determined from sequence anal-ysis of housekeeping genes. Appl. Environ. Microbiol. 70:7210–7219.

12. De Man, J. C., M. Rogosa, and M. E. Sharpe. 1960. A medium for thecultivation of lactobacilli. J. Appl. Bacteriol. 23:130–135.

13. Desroches, N., C. Beltramo, and J. Guzzo. 2005. Determination of an inter-nal control to apply reverse transcription quantitative PCR to study stressresponse in the lactic acid bacterium Oenococcus oeni. J. Microbiol. Methods60:325–333.

14. Dubois, M., K. A. Gilles, J. K. Hamilton, P. A. Rebers, and F. Smith. 1956.Colorimetric method for determination of sugars and related substances.Anal. Chem. 28:350–356.

15. Duenas, M., A. Irastorza, K. Fernandez, and A. Bilbao. 1995. Heterofer-mentative Lactobacilli causing ropiness in Basque country ciders. J. FoodProt. 58:76–80.

16. Duenas-Chasco, M. T., M. A. Rodriguez-Carvajal, P. Tejero-Mateo, G.Franco-Rodriguez, J. L. Espartero, A. Irastorza-Iribas, and A. M. Gil-Ser-rano. 1997. Structural analysis of the exopolysaccharides produced by Pedio-coccus damnosus 2.6. Carbohydr. Res. 303:453–458.

17. Duenas-Chasco, M. T., M. A. Rodriguez-Carvajal, P. Tejero-Mateo, J. L.Espartero, A. Irastorza-Iribas, and A. M. Gil-Serrano. 1998. Structural anal-ysis of the exopolysaccharides produced by Lactobacillus spp. G-77. Carbo-hydr. Res. 307:125–133.

18. Fernandez, K., M. Duenas, A. Irastorza, A. Bilbao, and G. del Campo. 1995.Characterization and DNA plasmid analysis of ropy Pediococcus spp. strainsisolated from Basque country ciders. J. Food Prot. 59:35–40.

19. Flemming, H. C., T. R. Neu, and D. J. Wozniak. 2007. The EPS matrix: thehouse of biofilm cells. J. Bacteriol. 189:7945–7947.

20. Fortier, L. C., R. Tourdot Marechal, C. Divies, B. H. Lee, and J. Guzzo. 2003.Induction of Oenococcus oeni H� ATPase activity and mRNA transcriptionunder acidic conditions. FEMS Microbiol. Lett. 28:165–169.

21. Gil-ad, N. L., N. Bar-Nun, and A. M. Mayer. 2001. The possible function ofthe glucan sheath of Botrytis cinerea: effects on the distribution of the enzymeactivities. FEMS Microbiol. Lett. 199:109–113.

22. Gindreau, E., E. Walling, and A. Lonvaud-Funel. 2001. Direct polymerasechain reaction detection of ropy Pediococcus damnosus strains in wine.J. Appl. Microbiol. 90:535–542.

23. Grandvalet, C., F. Coucheney, C. Beltramo, and J. Guzzo. 2005. CtsR is themaster regulator of stress response gene expression in Oenococcus oeni. J.Bacteriol. 187:5614–5623.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24. Groismann, E. A., and H. Ochman. 1996. Pathogenicity islands: bacterialevolution in quantum leaps. Cell 87:791–794.

25. Guedon, G., F. Bourgoin, M. Pebay, Y. Roussel, C. Colmin, J. M. Simonet,and B. Decaris. 1995. Characterization and distribution of two insertionsequences, IS1191 and iso-IS981, in Streptococcus thermophilus: does inter-generic transfer of insertion sequences occur in lactic acid bacteria co-cultures? Mol. Microbiol. 16:69–78.

26. Ibarburu, I., M. E. Soria Diaz, M. A. Rodriguez-Carvajal, S. E. Velasco, P.Tejero Mateo, A. M. Gil-Serrano, A. Iraztorza, and M. T. Duenas. 2007.Growth and exopolysaccharide (EPS) production by Oenococcus oeni I4 andstructural characterization of their EPSs. J. Appl. Microbiol. 103:477–486.

27. Knoshaug, E. P., J. A. Ahlgren, and J. E. Trempy. 2007. Exopolysaccharideexpression in Lactococcus lactis subsp. cremoris Ropy352: evidence for novelgene organization. Appl. Environ. Microbiol. 73:897–905.

28. Llauberes, R. M., B. Richard, A. Lonvaud, D. Dubourdieu, and B. Fournet.1990. Structure of an exocellular �-D-glucan from Pediococcus sp., a winelactic bacteria. Carbohydr. Res. 203:103–107.

29. Llull, D., E. Garcia, and R. Lopez. 2001. Tts, a processive beta-glucosyltrans-ferase of Streptococcus pneumoniae, directs the synthesis of the branchedtype 37 capsular polysaccharide in Pneumococcus and other gram-positivespecies. J. Biol. Chem. 276:21053–21061.

30. Llull, D., R. Lopez, and E. Garcia. 2001. Genetic bases and medical rele-vance of capsular polysaccharide biosynthesis in pathogenic streptococci.Curr. Mol. Med. 1:475–491.

31. Lonvaud-Funel, A., and A. Joyeux. 1988. Une alteration bacterienne des vins:la maladie des vins filants. Sci. Aliments 8:33–49.

32. Lonvaud-Funel, A., Y. Guilloux, and A. Joyeux. 1993. Isolation of a DNAprobe for identification of glucan producing Pediococcus damnosus in wines.J. Appl. Bacteriol. 74:41–47.

33. Lucas, P. M., W. A. M. Wolken, O. Claisse, J. S. Lolkema, and A. Lonvaud-Funel. 2005. Histamine-producing pathway encoded on an unstable plasmidin Lactobacillus hilgardii 0006. Appl. Environ. Microbiol. 71:1417–1424.

34. Luthi, H. 1957. Symbiotic problems relating to the bacterial deterioration ofwines. Am. J. Enol. Vitic. 8:176–181.

35. Mah, T. F., B. Pitts, B. Pellock, G. C. Walker, P. S. Stewart, and G. A.O’Toole. 2003. A genetic basis for Pseudomonas aeruginosa biofilm antibioticresistance. Nature 426:306–310.

36. Manca de Nadra, M. C., and A. M. Strasser de Saad. 1995. Polysaccharideproduction by Pediococcus pentosaceus from wine. Int. J. Food Microbiol.27:101–106.

37. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Har-bor, NY.

38. Marcobal, A., B. de las Rivas, V. Moreno-Arribas, and R. Munoz. 2006.Evidence for horizontal transfer as origin of putrescine production in Oeno-coccus oeni RM83. Appl. Environ. Microbiol. 72:7954–7958.

39. Marcobal, A. M., D. A. Sela, Y. I. Wolf, K. S. Makarova, and D. A. Mills.

2008. Role of hypermutability in the evolution of the genus Oenococcus. J.Bacteriol. 190:564–570.

40. Nishinari, K., and R. Takahashi. 2003. Interactions in polysaccharide solu-tions and gels. Curr. Opin. Colloids Interface Sci. 8:396–400.

41. O’Toole, G. A., and R. Kolter. 1998. Initiation of biofilm formation inPseudomonas fluorescens WCS365 proceeds via multiple, convergent signal-ling pathways: a genetic analysis. Mol. Microbiol. 28:449–461.

42. O’Toole, G. A., B. Kaplan, and R. Kolter. 2000. Biofilm formation as micro-bial development. Annu. Rev. Microbiol. 54:49–79.

43. Ribereau-Gayon, P., D. Dubourdieu, B. Doneche, and A. Lonvaud. 2000.Handbook of enology, vol. 1. The microbiology of wine and vinifications.John Wiley & Sons, Ltd., Chichester, United Kingdom.

44. Schar-Zammaretti, P., and J. Ubbink. 2003. The cell wall of lactic acidbacteria: surface constituent and macromolecular conformations. Biophys. J.85:4076–4092.

45. Scott, J. E., A. M. Thomlinson, and P. Prehm. 2003. Supramolecular orga-nization in streptococcal pericellular capsules based on hyaluronan tertiarystructures. Exp. Cell Res. 285:1–8.

46. Sutherland, I. W. 1993. Microbial polysaccharides, p. 69–85. In R. L. Whis-tler and J. N. Miller (ed.), Industrial gums: polysaccharides and their deriv-atives, 3rd ed. Academic Press, San Diego, CA.

47. Terzaghi, B. E., and W. E. Sandine. 1975. Improved medium for lacticstreptococci and their bacteriophages. Appl. Microbiol. 29:807–813.

48. Van Oevelen, D., and H. Verachtert. 1979. Slime production by brewerystrains of Pediococcus cerevisiae. J. Am. Soc. Brew. Chem. 37:34–37.

49. Velasco, S., E. Arskod, M. Paese, H. Grage, A. Iraztorza, P. Radstrom, andE. W. J. van Niel. 2006. Environmental factors influencing growth and exo-polysaccharide formation by Pediococcus parvulus 2.6. Int. J. Food Microbiol.111:252–258.

50. Walling, E., M. Dols-Lafargue, and A. Lonvaud-Funel. 2005. Glucose fer-mentation kinetics and exopolysaccharide production by ropy Pediococcusdamnosus IOEB 8801. Food Microbiol. 22:71–78.

51. Walling, E., E. Gindreau, and A. Lonvaud-Funel. 2005. A putative glucansynthase gene dps detected in exopolysaccharide-producing Pediococcusdamnosus and Oenococcus oeni strains isolated from wine and cider. Int. J.Food Microbiol. 98:53–62.

52. Watnick, P., and R. Kolter. 2000. Biofilm, city of microbes. J. Bacteriol.182:2675–2679.

53. Werning, M. L., I. Ibarburu, M. T. Duenas, A. Irastorza, J. Navas, and P.Lopes. 2006. Pediococcus parvulus gtf gene encoding the Gtf glucosyltrans-ferase and its application for specific PCR detection of �-D-glucan produc-ing bacteria in food and beverages. J. Food Prot. 69:161–169.

54. Whiting, G. C. 1975. Some biochemical and flavour aspects of lactic acidbacteria in ciders and other alcoholic beverages, p. 69–85. In J. G. Carr, C. V.Cutting, and G. C. Whiting (ed.), Lactic acid bacteria in beverages and foods.Academic Press, London, United Kingdom.

55. Williamson, D. H. 1959. Studies on lactobacilli causing ropiness in beer.J. Appl. Microbiol. 22:392–402.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

characterization of gtf, a glucosyltransferase gene in the ... · gtf exhibits signiﬁcant...

Documents