Ghent University – Department of Biomedical Molecular Biology VIB – Center for Inflammation Research Research Group: Molecular Signalling and Cell Death

Characterization of MAGED1 as a

component of E3 ubiquitin ligase

complexes

Nora Riems Student number: 01206813

Promoter: Prof. Dr. Mathieu Bertrand

Scientific supervisor: Dario Priem

Master’s dissertation submitted to Ghent University to obtain the degree of Master of Science in

Biochemistry and Biotechnology. Major Biomedical Biotechnology.

Academic year: 2016 - 2017

Acknowledgments

Many people have contributed to the realization of this master dissertation and I would like to give a well-deserved thank you to everybody.

First of all, I would like to thank my promotor Mathieu Bertrand and scientific supervisor Dario Priem for giving me the opportunity to work on this project. I would like to express my sincere appreciation for your constant guidance and the immense amount of feedback. Without it, this project would have remained uncompleted. Thank you.

I would also like to thank Ria Roelandt and Inge Bruggeman for the help and guidance

throughout my project. You have not only helped met with practical work but you were also the persons I could turn to with all my questions.

Next, I would like to warmly thank all the people of the research group for the fun moments in the lab. In particular Wannes, you have supported me in an emotional way and never failed to make me smile.

Finally, I would like to thank my parents. Although the last couple of years have not always been the easiest, you never failed to continuously encourage and support me. You have not only helped me to accomplish my years of study but you also have set the best example I could wish for on the person I want to become.

Nora

Table of contents

List of abbreviations ........................................................................................................................ 1

Resume............................................................................................................................................ 2

Abstract ........................................................................................................................................... 3

Introduction .................................................................................................................................... 4

1. Ubiquitination ................................................................................................................................... 5

1.1. Ubiquitin activating enzyme (E1) .............................................................................................. 7

1.2. Ubiquitin conjugating enzyme (E2) ........................................................................................... 7

1.3. Ubiquitin ligase (E3) .................................................................................................................. 8

1.3.1. HECT E3 ligases.................................................................................................................. 8

1.3.2. RING E3 ligases .................................................................................................................. 8

1.3.3. RING-IBR-RING E3 ligases .................................................................................................. 9

1.3.4. Multi-subunit RING ubiquitin ligase complexes .............................................................. 10

1.3.4.1. The cullin-RING ligase complexes ............................................................................... 10

1.3.4.2. The MAGE-RING ligase complexes .............................................................................. 11

1.4. DUBs ........................................................................................................................................ 13

2. Ubiquitination in the regulation of immune signaling pathways ................................................... 13

2.1. Pattern recognition receptor-mediated activation of the MAPKs and NF-κB pathways ........ 13

2.2. RING E3 ligases in the regulation of immune signaling pathways .......................................... 15

Aim ................................................................................................................................................ 17

Contributions of third parties ....................................................................................................... 18

Results ........................................................................................................................................... 19

1. Cloning of MAGE and RING-containing proteins into a bacterial expressing vector ...................... 19

1.1. Cloning of PELI3 ....................................................................................................................... 20

1.2. Cloning of the other proteins .................................................................................................. 22

2. Protein expression and purification ................................................................................................ 23

2.1. Determining optimal expression conditions ........................................................................... 23

2.1.1. Expression conditions for MAGED1 ................................................................................ 24

2.1.2. Expression conditions for XIAP ....................................................................................... 25

2.1.3. Expression conditions for the other GST-fusion proteins ............................................... 26

2.2. Production and purification of the GST-fusion proteins ......................................................... 26

2.2.1. Production and purification of MAGED1 and MAGEC2 .................................................. 27

2.2.2. Cleavage of MAGED1 and MAGEC2 ................................................................................ 29

2.3. Small scale production of recombinant E3 ligases .................................................................. 33

3. In vitro ubiquitination assays .......................................................................................................... 34

3.1. Effect of MAGEC2 on the enzymatic activity of TRIM28 ......................................................... 34

3.1.1. Set up of the TRIM28 ubiquitination assay ..................................................................... 34

3.1.2. Effect of MAGEC2 on TRIM28 activity............................................................................. 35

3.2. Effect of MAGEC2 on the enzymatic activity of XIAP, cIAP1 and cIAP2 .................................. 36

3.2.1. Set up of the XIAP, cIAP1 and cIAP2 ubiquitination assays ............................................ 36

3.2.2. Effect of MAGEC2 on XIAP, cIAP1 and cIAP2 activities ................................................... 38

Discussion and conclusion ............................................................................................................ 40

1. General discussion .......................................................................................................................... 40

2. Conclusion ....................................................................................................................................... 44

Materials and methods ................................................................................................................. 45

Cloning .................................................................................................................................................... 45

Screen for best expression conditions .................................................................................................... 45

Recombinant protein production + purification ..................................................................................... 46

Quickchange mutagenesis ...................................................................................................................... 46

GST fusion-protein removal .................................................................................................................... 46

In vitro ubiquitination assay .................................................................................................................... 47

References .................................................................................................................................... 48

Addendum 1: Protocols ................................................................................................................ 55

Addendum 2: List of primers ........................................................................................................ 72

Addendum 3: Construction of expression vectors ....................................................................... 73

Addendum 4: Determining the best expression conditions ......................................................... 80

Addendum 5: Determining the concentration of recombinant E3 ligase .................................... 86

List of abbreviations

1

List of abbreviations

AIM2 Absent in melanoma-2 NIK NF-κB inducing kinase

BIR Baculovirus IAP protein repeat NLR NOD-like receptor

BSA Bovine serum albumin NOD Nucleotide-binding and oligomerization domain

CHD Cullin homology domain NS Non-soluble

cIAP Cellular inhibitor of apoptosis ORF Open reading frame

CLR C-type lectin receptor OTU Ovarian tumor

CRL Cullin-RING ligase complex PAMP Pathogen-associated molecular pattern

DUB Deubiquitinating enzyme PBS Phosphate buffered saline

E1 Ubiquitin activating enzyme PELI Pellino

E2 Ubiquitin conjugating enzyme PJA1 Praja1

E3 Ubiquitin ligase PHD Plant homology domain

FT Flow through PP PreScission protease

GST Glutathione S-transferase PRR Pattern recognition receptor

HECT Homologous to the E6-AP carboxyl terminus PTM Post-translational modification

IAP Inhibitor of apoptosis RBR RING between RING

IBR In between RING RIG Retinoid acid-inducible gene I

IκB Inhibitor of κB RING Really interesting new gene

IKK IκB kinase RIPK2 Receptor-interacting protein kinase 2

IL Interleukin RLR Retinoid acid-inducible gene I-like receptor

ILR IL receptor TAB TAK1-binding protein

IPTG Isopropyl β-D-1-thiogalactopyranoside TAK1 Transforming growth factor-β (TGF-β)-activated kinase 1

K Lysine residue TLR Toll-like receptor

LUBAC Linear ubiquitin chain assembly complex TNF Tumor necrosis factor

M1 Linear poly-ubiquitin chain TRIM Tripartite motif

MAGE Melanoma antigen UBC Ubiquitin conjugating domain

MAPK Mitogen-activated protein kinase UBD Ubiquitin binding domain

MHD MAGE homology domain UCH ubiquitin C-terminal hydrolase

MM Multiple myeloma USP Ubiquitin-specific protease

MRL MAGE-RING ligase complex WH Winged helix

NEMO NF-κB essential modulator XIAP X-linked inhibitor of apoptosis

NF-κB Nuclear factor kappa B

Resume

2

Resume

Post-translational modifications (PTMs) of cellular proteins are important regulatory events involved in many cellular processes, including signal transduction. Ubiquitination, the attachment of the 8 kDa protein ubiquitin to a substrate protein, is a common PTM in eukaryotic cells and has emerged as a crucial molecular mechanism regulating signal transduction at various cellular levels, including innate immune signaling. The process of ubiquitination is regulated by the sequential action of three enzymes: the ubiquitin activating enzyme (E1), the ubiquitin conjugating enzyme (E2) and the ubiquitin ligase (E3). Members of the melanoma antigen (MAGE) protein family interact with really interesting new gene (RING) E3 ubiquitin ligase partners, the most abundant type of E3 ligases, to constitute MAGE-RING

ligase (MRL) complexes. In these MRL complexes, MAGE proteins act as molecular scaffolds and influence the activity of the E3 ligase. Up to date, more than 60 MRL complexes have been identified but much remains elusive about the functioning of the identified complexes and the existence of additional non-identified MRL complexes.

Preliminary results from the lab showed MAGED1 to interact with E3 RING ligases involved in the regulation of innate immune signaling pathways. MAGED1 is a MAGE protein that is ubiquitously expressed and shows strong phylogenetic conservation with the ancestral MAGE gene and is therefore thought to perform fundamental and phylogenetically conserved cellular functions. The aim of this master dissertation was to assess the potential role of MAGED1 on the ubiquitin ligase activity of RING-containing proteins, known to be involved in innate

immune signaling.

To do so, we aimed to produce recombinant MAGED1, the E3s identified to interact with MAGED1 (XIAP, PELI1, PELI2, PELI3 and cIAP1) and the related E3 cIAP2. We also opted to produce recombinant MAGEC2, PJA1 and TRIM28 as controls since MAGED1 was previously reported to interact with the E3s PJA1 and TRIM28, and MAGEC2 was also previously reported to regulate the E3 activity of TRIM28. To produce the recombinant proteins, we started with cloning the open reading frame of our proteins of interest into an expression vector suited for

bacterial expression. We then assessed the best conditions to express these proteins. We attempted to purify the MAGED1 protein after production but unfortunately, high amounts of MAGED1-related break down products remained present in the preparation. Protein production and purification was successful for several E3s (XIAP, cIAP1, cIAP2 and TRIM28).

Finally, with the recombinant produced E3 proteins, we performed in vitro ubiquitination assays and we found interesting results regarding MAGEC2. We showed that MAGEC2 enhances cIAP2-mediated ubiquitination. Because of its important regulating role in NF-κB mediated cell survival, cIAP2 would indeed be an excellent candidate for MAGEC2. Although our results indicate an effect of MAGEC2 on the ubiquitin ligase activity of cIAP2, further research will be necessary to identify the physiological relevance of the MAGEC2-cIAP2 complex. Further work will also be needed to successfully produce and test the effect of MAGED1.

3

Abstract

Post-translationele modificaties (PTM's) van cellulaire eiwitten spelen een belangrijke regulerende rol bij veel cellulaire processen, waaronder signaaltransductie. Ubiquitinatie is een veel voorkomende PTM in eukaryote cellen waarbij ubiquitine, een 8 kDa eiwit, aan een substraat eiwit wordt gehecht. Ubiquitinatie is een cruciaal mechanisme bij signaaltransductie, met inbegrip van signaaltransductie tijdens de aangeboren immune respons. Het proces van ubiquitinatie wordt gereguleerd door de sequentiële werking van drie enzymen: het ubiquitine-activerende enzym (E1), het ubiquitine-conjugerende enzym (E2) en het ubiquitine ligase (E3). Eiwitten uit de melanoma antigen (MAGE) familie interageren met really interesting new gene (RING) E3 partners, het meest voorkomende type E3 ligases, om MAGE-RING ligase (MRL)

complexen te vormen. In deze MRL-complexen beïnvloeden MAGE-eiwitten de activiteit van het E3 ligase. Tot nog toe zijn er meer dan 60 MRL complexen geïdentificeerd, maar veel blijft onduidelijk over het functioneren van de geïdentificeerde complexen en het bestaan van aanvullende niet-geïdentificeerde MRL complexen.

Voorlopige resultaten van het laboratorium toonden aan dat MAGED1 interageert met diverse E3s die betrokken zijn bij de regulering van aangeboren immune signaaltransductie. MAGED1 is een MAGE eiwit dat alomtegenwoordig tot expressie komt en dat fylogenetisch sterk gerelateerd is aan het ancestrale MAGE-gen waardoor men vermoedt dat MAGED1 fundamentele en fylogenetisch geconserveerde cellulaire functies uitvoert. Het doel van deze thesis was om de mogelijke rol van MAGED1 op de ubiquitine ligase activiteit van RING

bevattende eiwitten na te gaan, bekend om betrokken te zijn bij aangeboren immune signaaltransductie.

Om dit te doen streefden we ernaar om recombinant MAGED1 te produceren, alsook de E3’s die interageren met MAGED1 (XIAP, PELI1, PELI2, PELI3 en cIAP1) en het gerelateerde E3 cIAP2. We opteerden ook om recombinant MAGEC2, PJA1 en TRIM28 te produceren als controles, aangezien eerder werd vermeld dat MAGED1 interageert met de E3s PJA1 en TRIM28 en dat MAGEC2 de E3-activiteit van TRIM28 reguleert. Om de recombinante eiwitten te produceren,

hebben we de open reading frames van onze eiwitten van interesse gekloneerd in een expressievector die geschikt is voor bacteriële expressie. Daarna hebben we eerst de meest gunstige condities bepaald om deze eiwitten tot expressie te brengen om de eiwitten vervolgens te produceren. Na zuivering van MAGED1 bleven helaas hoge hoeveelheden

MAGED1-gerelateerde afbreekproducten aanwezig in de bereiding. De productie en zuivering was succesvol voor verscheidene E3's (XIAP, cIAP1, cIAP2 and TRIM28). Tenslotte hebben we in vitro ubiquitinatie assays uitgevoerd met de recombinant geproduceerde E3-eiwitten. We toonden aan dat MAGEC2 de ubiquitine ligase activiteit van cIAP2 verhoogt. Door zijn belangrijke regulerende rol in NF-κB gemedieerde celoverleving zou cIAP2 inderdaad een uitstekende kandidaat voor MAGEC2 zijn. Verder onderzoek is nodig om de fysiologische relevantie van het MAGEC2-cIAP2 complex te identificeren, alsook om MAGED1 succesvol te produceren en het effect ervan te testen.

Introduction

4

Introduction

Cells are continuously confronted to a wide variety of stimuli originating from the extracellular environment as well as from inside the cells. In order for a cell to coordinate its behavior accordingly to an incoming signal, signals must be perceived and processed to trigger a cellular response. The ability of a cell to sense a specific signal relies on the expression of a panel of receptors, also termed sensors, capable of detecting their presence and transducing the signal into an intracellular signaling pathway. Upon recognition of a ligand, the receptor commonly undergoes a conformational change that allows the recruitment of adaptor proteins and the formation of a primary signaling complex. Within this complex, first effector proteins are

activated and those subsequently activate secondary effector proteins or secondary messengers and so on, generating a cascade of biochemical events, called a signal transduction

cascade (Figure 1). Along the signal transduction cascade, the signal is typically amplified as one component of the pathway can activate one or multiple downstream proteins. Finally, at the endpoint of the signal transduction cascade, specific biochemical processes are triggered in the cell. In some but not all cases, the pathway leads to the activation of transcription factors and the cellular response to the initial stimulus therefore consists in the expression of a set of responsive genes (Downward, 2001). Signaling networks are generated when multiple signaling pathways interact with each other, allowing the cell to carry out coordinated and complex cellular responses (Jordan et al, 2000). These molecular events constitute the basic mechanisms

controlling most cellular processes such as cell growth, proliferation, cell death, metabolism, immunity, etc.

Figure 1: General scheme of signal transduction. The cell is equipped with a panel of receptors that are able to detect stimuli originating from the extracellular environment as well as from inside the cells. Ligand recognition gives rise to a signaling cascade in which adaptor proteins activate effector proteins and so on. At the end of the signal transduction pathway, a cellular response is activated that is dependent on the input stimuli.

Introduction

5

The generation of a cellular response must be strictly regulated as both insufficient and excessive responses can be detrimental for the cells and the organism, and can lead to the development of pathologies. Cells have developed numerous mechanisms to ensure a well-controlled response including feedback control, short half-life of the messengers, downregulation of the receptor, desensitization, etc. Post-translational modifications (PTMs) play crucial roles in the activation and termination of signal transduction. A PTM consists in the modification (generally enzymatic) of a protein during or after its translation. It can result in the covalent addition of a modifying group or in a proteolytic cleavage event. Just like the use of alternative promotors at transcription initiation, alternative splicing of the transcripts and mRNA editing, PTMs contribute significantly to the diversity of the proteome (Farajollahi & Maas, 2010) (Harper & Bennett, 2016). While the human genome is estimated to encode

around 25 000 genes, the total number of different proteins is estimated at over 1 million. PTMs have been shown to play crucial roles in a multitude of cellular processes such as DNA repair, cell division but also in the modulation of various signaling cascades. Amongst the PTMs, phosphorylation, ubiquitination (also known as ubiquitylation) and acetylation are amongst the most prevalent (Olsen & Mann, 2013) (Hunter, 2007) (Choudhary et al, 2014).

1. Ubiquitination

The ubiquitination process involves the covalent attachment of ubiquitin, a highly-conserved protein of 76 amino acids, to a target protein through the sequential functioning of 3 enzymes

(Figure 2). Initially, the ubiquitin activating enzyme (E1) activates ubiquitin by binding it covalently. In a next step, ubiquitin is transferred via a transthiolation reaction to the active site of the ubiquitin conjugating enzyme (E2) and in a last step, a ubiquitin ligase (E3) mediates the transfer of ubiquitin from the E2 to a lysine residue (K) of a substrate via an isopeptide bond (Swatek & Komander, 2016).

Figure 2: The ubiquitination cascade. The ubiquitin activating enzyme (E1) first activates ubiquitin in an ATP-dependent manner. The activated ubiquitin is then attacked by the conserved cysteine residue (Cys) on the E1 and an E1-Ub thioester intermediate is formed. Ubiquitin is transferred from the E1 to a conserved cysteine residue in the active site of the ubiquitin conjugating enzyme (E2) via a transthiolation reaction. Finally, an ubiquitin ligase (E3) binds both the E2-Ub complex and a substrate and mediates the transfer of ubiquitin from the E2 to the substrate by forming an isopeptide bond between the C-terminal glycine residue of ubiquitin and the ε-aminogroup of a substrates lysine residue (Lys).

Attachment of a single ubiquitin molecule onto a substrate lysine residue is referred to as mono-ubiquitination (Figure 3A). When several lysine residues of a substrate protein are mono-ubiquitinated, the process is referred to as multi-mono-ubiquitination (Figure 3A). Because

Introduction

6

ubiquitin contains seven lysine residues itself (K6, K11, K27, K29, K33, K48 and K63) (Figure 3B), a ubiquitin molecule can also be linked to another ubiquitin molecule already attached to the substrate, thereby generating a chain of ubiquitin molecules on the substrate. This process is referred to as poly-ubiquitination (Figure 3A). Since ubiquitin contains seven lysine residues, seven different ubiquitin-ubiquitin linkages can be generated. An eighth type of ubiquitin linkage, generating the linear chain (M1), is formed when the α-amino group of the N-terminal methionine of one ubiquitin is attached to the C-terminal glycine of another ubiquitin (Figure 3B). At present, the linear ubiquitin chain assembly complex (LUBAC) is the only known E3 complex capable of generating linear poly-ubiquitin chains (Kirisako et al, 2006). Poly-ubiquitin chains can be straight or branched (Figure 3C) and exist of one linkage type (homotypic chains) (Figure 3A) or different linkage types (heterotypic chains) (Figure 3C). The ubiquitin code

becomes even more complex as ubiquitin molecules can not only be ubiquitinated but also be modified by other PTMs such as phosphorylation, acetylation and sumoylation (Choudhary et al, 2009) (Swatek & Komander, 2016).

Figure 3: Complexity in the ubiquitin code. 3A: Mono-ubiquitination refers to the conjugation of a single ubiquitin molecule to a substrate protein. The attachment of multiple mono-ubiquitin molecules to several lysine residues of a substrate protein is referred to as multi-mono-ubiquitination. As ubiquitin itself contains 7 lysine residues (K6, K11, K27, K29, K33, K48 and K63) (3B), ubiquitin molecules can be linked to other ubiquitin molecules, thereby generating poly-ubiquitin chains. Poly-ubiquitin chains can be homotypic (3A) or heterotypic (3C) and straight or branched (3C). The different colors that mark the ubiquitin molecules display different ubiquitin linkage types. Adapted figure from (Komander, 2009).

Introduction

7

Ubiquitination of target proteins has emerged as a crucial mechanism regulating a multitude of cellular processes including proteolysis, DNA repair, cell communication and receptor signaling. The outcome of protein ubiquitination is highly dependent on the type of ubiquitin linkage generated. The various ubiquitin linkages adopt distinct conformations and these structural differences can be recognized by ubiquitin binding domains (UBDs) in cellular proteins that act as ubiquitin receptors. The diverse UBDs often have specificity for a certain type of linkage and for the length of the ubiquitin chain. In this way, UBDs are able to decode the ubiquitin complexity and to translate it in a specific way in order to generate a specific response (Dikic et al, 2009) (Trempe, 2011). The best characterized poly-ubiquitin chains in the cell are K48-linked chains. K48-linked poly-ubiquitin chains mark proteins for degradation by the 26S proteasome (Bochtler et al, 1999). K63- and M1-linked poly-ubiquitin chains are also relatively well studied

and generally regulate signal transduction. The abundance of the different linkage types is highly dependent of the cellular context and they have been implicated in various cellular processes. However, to date the other ubiquitin linkages have not yet been well studied and their specific role in these processes remains unclear.

1.1. Ubiquitin activating enzyme (E1)

The E1 enzyme mediates the initiation of the ubiquitination cascade. Initially it was thought that the human genome encoded only one E1, Uba1, but more recently another E1, Uba6, was identified (Pelzer et al, 2007) (Xianpeng Liu et al, 2017). In a first step, the E1 activates

ubiquitin, in an ATP-dependent manner, by adenylating its C-terminal carboxylgroup resulting in the formation of a ubiquitin adenylate intermediate. Subsequently, the E1 forms a covalent bond with the activated ubiquitin by linking the C-terminal glycine of ubiquitin to the conserved cysteine residue at its active site via a thiol-ester linkage (Haas et al, 1982). Each E1 enzyme binds two molecules: one Ub-adenylate intermediate and one Ub-thioester intermediate. Double-loaded E1 enzymes undergo a conformational change in the E1 that exposes an E2 binding site in the E1 enzyme necessary for the recruitment of the E2 (Pickart et al, 1994) (Tokgöz et al, 2006).

1.2. Ubiquitin conjugating enzyme (E2)

The human genome encodes for ± 40 E2s which all share a conserved catalytic core domain of ± 150 amino acid residues, referred to as the ubiquitin conjugating domain (UBC) (Pickart, 2001). The UBC domain contains the conserved catalytic cysteine residue (Wu et al, 2003). In the ubiquitination cascade, the E2 catalyzes the transfer of the activated ubiquitin from the E1 to the conserved cysteine residue in its catalytic site via a transthiolation reaction. In a next step, ubiquitin is transferred from the E2 enzyme to the substrate. In this process, E2 enzymes interact with both the E1 and E3 enzymes. Studies have shown that E1 and E3 enzymes bind to overlapping surfaces on the E2 enzyme, suggesting that the E2 first uncouples from the E1 enzyme in order to interact with the E3 enzyme (van Wijk & Timmers, 2010).

Introduction

8

1.3. Ubiquitin ligase (E3)

Ubiquitin ligases catalyze the last step of the ubiquitin cascade by acting as an adaptor molecule, binding both the E2 and the substrate, and mediating the transfer of the E2-loaded ubiquitin to a substrate. The ubiquitin molecule is conjugated to its substrate through an isopeptide bond between its C-terminal glycine residue and the ε-aminogroup of a substrate K residue. The human genome encodes for more than 600 E3s, that are categorized into three major classes (HECT, RING and RING-IBR-RING), according to the mechanism they apply to mediate the transfer of ubiquitin.

1.3.1. HECT E3 ligases

The homologous to the E6-AP carboxyl terminus (HECT) domain E3s are a family of around 30 members in mammals, characterized by a conserved bilobed HECT domain of about 350 amino acid residues. The N-terminal lobe of the domain contains the E2 binding site, while the C-terminal lobe contains a conserved catalytic cysteine residue. HECT E3s are directly involved in the catalysis but do not catalyze the direct transfer of ubiquitin from the E2 to the substrate. Instead, the conserved cysteine in the HECT domain C-lobe performs a nucleophilic attack on the E2-Ub thioester bond resulting in the formation of an E3-Ub thioester intermediate. Ubiquitin is then subsequently transferred to the substrate via a transthiolation reaction (French et al, 2017) (Figure 4A). Upon ubiquitin transfer from the E2 to the E3, the E2 and E3

active sites must be in close proximity but in reality, the active sites are too far apart in the E2-E3 complex. The two lobes of the E3 HECT domain are connected through a linker region of three residues that functions as a flexible hinge. This flexibility is necessary to juxtapose the E2 and E3 active sites during ubiquitin transfer. The HECT C-terminal lobe also contains 60 amino acids that determine the specificity of the chain type upon poly-ubiquitination (Kim & Huibregtse, 2009).

1.3.2. RING E3 ligases

The really interesting new gene (RING) E3s are the most abundant type of E3 ligases. They are characterized by a conserved sequence that is rich in cysteine and histidine residues. RING

domains coordinate two zinc atoms and adapt a cross-brace structure. Unlike the HECT E3s, RING E3s mediate the direct transfer of ubiquitin from the E2 to the substrate (Deshaies & Joazeiro, 2009) (Figure 4B). It is thought that the RING E3s play no direct role in the catalysis but instead serve as a molecular scaffold. RING E3s are bisubstrate enzymes who bind an E2 to a cleft on their surface and the substrate. To facilitate the chemical reaction, the two substrates must be in close proximity which is not the case, as they bind distinct sites of the RING E3 ligase. The gap is likely overcome by a conformational change in the E3 ligase.

Contrary to HECT E3 ligases, RING E3s rely on their E2 partner to generate a specific type of poly-ubiquitin chains. This is presumably because the RING E3 is functioning as a scaffold, while the reaction occurs between the E2 and the substrate protein. Not every RING domain has

Introduction

9

intrinsically E3 ligase activity. Some RING domains should interact with other RING domain proteins and form heterodimers before being capable of exhibiting E3 activity. For example, the RING domain of Bard1 does not exhibit E3 activity by itself but upon interaction with the RING domain of Brca1, E3 activity is reconstituted (Mallery et al, 2002).

1.3.3. RING-IBR-RING E3 ligases

A third type of E3s was discovered that displays characteristics of both RING and HECT E3s and can therefore be considered as a RING-HECT hybrid. The family consist of more than ten members in humans and they are characterized by a 200 amino acid RING between RING-

fingers (RBR) segment, consisting of a central in-between-RINGs (IBR) zinc-binding domain, flanked by two RING finger domains, RING1 and RING2. The RING1 domain is essential to recruit specific E2s. The RING2 domain on the other hand, contributes to the E3 ligase capacity of the RBR domain. Just like the HECT E3 ligases, RBR E3s do not directly transfer ubiquitin to the substrate. A conserved cysteine in the RING2 domain forms a thioester intermediate with ubiquitin (Wenzel et al, 2011) (Figure 4C). Another resemblance to HECT E3s is that the chain linkage specificity is also determined by the E3 RING2 domain and not by the E2 enzyme.

Figure 4: Mechanisms by which the three different E3 classes mediate ubiquitin transfer. A: The HECT E3s contain a conserved cysteine residue that forms a thioester intermediate with ubiquitin before passing it on to the substrate. B: The RING E3s promote the direct transfer of ubiquitin from the ubiquitin-charged E2 to the substrate. C: The RING-IBR-RING E3s are a RING/HECT hybrid. As the HECT E3s, they first form a ubiquitin-intermediate and then, transfer the ubiquitin molecule to the substrate. Figure adapted from (Rieser et al, 2013).

Introduction

10

1.3.4. Multi-subunit RING ubiquitin ligase complexes

Some RING ubiquitin ligases are composed of multiple subunits, such as the cullin-RING ligase complexes (CRLs) and the MAGE-RING ligase complexes (MRLs).

1.3.4.1. The cullin-RING ligase complexes

The cullin RING ligases, the largest E3 ligase family, are one of the best known multi-subunit RING E3 ligases. The human genome encodes for 8 cullin proteins, characterized by a cullin homology domain (CHD) (Sarikas et al, 2011). In the CRL complex, cullin proteins act as scaffolding proteins, by binding a RING domain protein, an adaptor protein and a substrate recognition protein and by bringing them in close proximity (Figure 5). The N-terminal domain

of the cullin protein interacts with specific adaptor proteins that recruit substrate recognition proteins. The C-terminal CHD domain contains two winged-helix motifs that create the binding place for the RING domain protein (Zheng et al, 2002). The RING domain recruits the ubiquitin-charged E2. The rigidity of the cullin backbone juxtaposes the E2 and the substrate. Neddylation, the attachment of the ubiquitin like protein NEDD8, of the cullin backbone protein, switches the CRL from a closed-state to an open-state. In this open-state, neddylation of the cullin protein induces an enhanced flexibility of the cullin protein and conformational changes in the RING domain protein which help overcome the distance between the Ub-E2 and substrate, thereby promoting ubiquitin transfer (Onel et al, 2017). CRLs promote ubiquitin-mediated degradation of various cellular components involved in a broad array of physiological processes, including autophagy (Chen et al, 2015b) (Cui et al, 2016).

Figure 5: The cullin-RING ligase complex (CRL). The CRL complex is a multi-subunit RING E3 ligase composed of a cullin backbone protein that acts as a scaffold and recruits adaptor proteins and a RING E3. Adaptor proteins recruit in their turn the substrate recognition proteins while the RING protein binds the E2.

Introduction

11

1.3.4.2. The MAGE-RING ligase complexes

The melanoma antigen (MAGE) protein family is a large and conserved group of proteins that are characterized by a common MAGE homology domain (MHD) (Barker & Salehi, 2002). The human genome encodes for more than 50 MAGE genes which are categorized into two types, based on their expression pattern and their chromosomal location (Chomez et al, 2001). Type I MAGE proteins comprise the MAGEA, -B and –C subfamily and are clustered on the X chromosome. The expression of type I MAGE proteins is generally restricted to germ-line cells and cancerous tissue (Chomez et al, 2001). Type II MAGEs comprise the MAGED, -E, -F, -G, -H, -L and Necdin subfamilies. In contrast to the type I MAGEs, type II MAGEs are ubiquitously expressed and their localization in the genome is not restricted to the X chromosome (Chomez

et al, 2001). This multigenic family appears to have arisen from retrotranspositions and gene duplication events from a single-copy ancestral gene in protozoa. Members of the MAGED subfamily (3 in the mouse and 4 in the human) are the most related to the ancestral MAGE gene (De Donato et al, 2017). The common MHD is a 170 amino acid residues domain consisting of two in tandem winged helix (WH) motifs: WH-A and WH-B (Barker & Salehi, 2002). On average, the amino acids in this domain are conserved for 46% between all MAGE genes but in subfamilies the conservation percentage is higher, up to 75% for the MAGED genes (Doyle et al, 2010) (Newman et al, 2016). This conservation suggests some similarity in the mechanical functioning of the MAGE family members despite their differences.

Increasing expression of type I MAGEs is correlated with advanced tumor grade and decreased survival (Ayyoub et al, 2014). In addition, emerging data suggests that type I MAGE proteins

display oncogenic properties by actively driving cell proliferation, tumor formation and growth and metastasis (Bhatia et al, 2013) (Yang et al, 2014) (Liu et al, 2008). Due to their restricted expression pattern and antigenic properties, type I MAGE proteins garnered interest as cancer biomarkers and as targets for cancer vaccine development (Sang et al, 2011). Further investigation revealed that MAGEs are not only promotors of tumorigenesis but also implicated in the regulation of a wide variety of diverse cellular and developmental processes such as germ cell development and neuronal development. Accordingly, they are implicated in a broad range of pathologies (Cassidy & Driscoll, 2009).

Recent biochemical and biophysical studies indicate that MAGEs assemble with E3 RING ubiquitin ligases to form MAGE-RING ligase complexes (MRLs) (Lee & Potts, 2017). More than

50 distinct MRLs have been reported to date, including MAGEC2-TRIM28, MAGED1-PJA1, MAGEA3/6-TRIM28, MAGEL2-TRIM27 and MAGEG1-NSE1. MAGE proteins are able to directly bind RING E3s via their MHD. Although the MHD is a conserved structure, MHDs do not recognize a certain motif, but have a certain flexibility as they bind to multiple unique regions on their E3 RING partner. For example, MAGEC2 binds the coiled-coil region of TRIM28 and MAGEG1 binds the WH motifs of NSE1. The RING domain was found not to be required for the binding between the MAGE and its RING partner (Doyle et al, 2010). MRL complexes show some similarity to CRL complexes, a large multi-subunit RING E3 ligase family (Petroski & Deshaies, 2005). Just like the cullin protein component in the complex, the MAGE protein acts as a molecular scaffold, bringing all the components of the complex in close proximity. Another

Introduction

12

similarity is that the conserved domain of both the cullin as the MAGE proteins contain two winged-helix motifs.

In the MRL complex, MAGE proteins have been shown to regulate RING proteins in three different ways (Figure 6).

(1) MAGEs enhance their E3 ligase activities. Different mechanisms have been proposed to explain this function, which seems to depend on the studied MAGE-RING E3 ligase complex. It was proposed that some MAGEs introduce a conformational change in the RING protein, resulting in an increased ubiquitin ligase activity. Another suggested mechanism is that MAGEs help in recruiting the substrate to the E2-E3 complex. A third possibility is that MAGEs stimulate E2 charging. Finally, MAGEs were also proposed to

recruit and/or stabilize the E2 enzyme at the E3-substrate complex. This seems to be the case for the MAGEC2-TRIM28 complex since Doyle and colleagues indeed demonstrated that MAGEC2 specifically binds the E2 enzyme UbcH2 (Doyle et al, 2010).

(2) MAGEs specify novel substrates for ubiquitination. For example, in the absence of MAGEA3/A6, TRIM28 targets p53, but not the tumor suppressor AMPKα1, for proteasomal degradation. In cancerous tissue however, type I MAGEs become aberrantly expressed, among which MAGEA3/A6. In the presence of MAGEA3/A6, TRIM28 will also target AMPKα1 for degradation, thereby promoting tumorigenesis (Pineda et al, 2015).

(3) MAGEs alter the subcellular location of RING proteins. MAGEL2 for example, binds to TRIM27 and this interaction localizes endosomes to the trans-Golgi network or plasma membrane in the retromer pathway (Hao et al, 2013).

Figure 6: Regulation of RING E3 enzymes by MAGE proteins. MAGE proteins have been shown to regulate RING E3 enzymes in the MRL complex by (1) enhancing their E3 activity, (2) specifying novel substrates for ubiquitination and (3) alter the subcellular localization of the RING E3. Figure adapted from (Weon & Potts, 2015).

Introduction

13

1.4. DUBs

A key feature of the ubiquitination system is that ubiquitination is a reversible process as it can be counteracted by the activity of several deubiquitinating enzymes (DUBs). DUBs are ubiquitin specific proteases that cleave ubiquitins from substrate proteins or between poly-ubiquitination chains. The diverse DUBs have a different specificity regarding the substrates, the linkage types and the position of the linkage in the chain (Clague et al, 2015). The human genome encodes for ± 100 DUBs, which are divided into 5 superfamilies. The ubiquitin-specific protease (USP) superfamily, the ovarian tumor (OUT) superfamily, the ubiquitin C-terminal hydrolase (UCH)) superfamily and the Machado-Joseph disease domain (MJDs or Josephins) superfamily belong to the cysteine protease class while the JAMM/MPN+ belong to the

metalloprotease class (Eletr & Wilkinson, 2014).

On top of negatively regulating ubiquitination, DUBs are also required to generate free ubiquitin molecules from poly-ubiquitin precursors. The ubiquitin molecules are subsequently reused in the ubiquitination cascade. In addition, it has become clear that DUBs co-operate with the E1, E2 and E3 enzymes to determine the outcome of ubiquitination (Elliott et al, 2016). DUBs do not only cleave ubiquitin in order to terminate an ubiquitination signal but they also provide a mechanism to edit the poly-ubiquitin chain length and type. Moreover, some DUBS can interact with particular E3 ligases, restricting them into an inactive state (Leznicki & Kulathu, 2017).

2. Ubiquitination in the regulation of immune signaling pathways

2.1. Pattern recognition receptor-mediated activation of the MAPKs and NF-κB pathways

Inflammation is the body’s first response to pathogen exposure or tissue injury. The process of inflammation is initiated by resident immune cells which are able to selectively sense danger signals by utilizing a set of pattern recognition receptors (PRRs). PRRs detect a variety of conserved microbial molecules, called pathogen-associated molecular patterns (PAMPs) as well as cell components that are released upon cell injury or cell death, called damage-associated molecular patterns (DAMPs) (Kawai & Akira, 2006) (Matzinger, 2002). PRRs have been classified into different families according to their subcellular localization, ligand specificity and molecular

structure. The Toll-like receptors (TLRs), interleukin (IL—1 receptors (ILR) and C-type lectin receptors (CLRs) are transmembrane receptors which survey the extracellular environment and the endosomal compartments. Intracellular danger signals on the other hand are sensed by cytoplasmic PRRs including the NOD-like receptors (NLRs), the retinoid acid-inducible gene I (RIG-I)-like receptors (RLRs) and DNA-sensors such as members of the DNA-dependent activator of interferon regulatory factors (DAI) and absent in melanoma 2 (AIM2) families (Takeuchi & Akira, 2010)(Thompson et al, 2011). Upon ligand recognition, PRRs trigger diverse intracellular signaling cascades, that generally converge in the activation of the mitogen-activated protein kinase (MAPK) and nuclear factor-κB (NF-κB) pathways. MAPK- and NF-κB-dependent signaling collectively drives transcriptional upregulation of genes encoding various mediators of

Introduction

14

inflammation, such as pro-inflammatory cytokines, chemokines, adhesion molecules, acute phase proteins and antimicrobial peptides (Akira et al, 2006).

Although crucial for the protection of the human body against various insults, inflammation needs to be tightly regulated because inappropriate inflammatory responses have been linked to various human diseases. Ubiquitination has emerged as a crucial molecular mechanism regulating various levels of the inflammatory response. For example, in many of these PRR signaling pathways, components within the receptor-associated signaling complexes are conjugated with K63-linked and M1-linked ubiquitin chains to activate the MAPK and NF-κB pathways (Figure 7). The K63-linked ubiquitin chains, which are formed by dedicated ubiquitin ligases for each receptor pathway, serve to recruit and activate the TAK1-binding protein 2/3

(TAB2/3)-transforming growth factor-β (TGF-β)-activated kinase 1 (TAK1) kinase complex. TAB2/3 indeed contain UBDs that preferentially binds K63-linked ubiquitin chains (Kanayama et al, 2004). Upon activation, TAK1 then activates the MAPK cascade by phosphorylation of downstream MAPKs, and initiate activation of the canonical NF-κB pathway by phosphorylating IκB kinases (IKKs) (Kanayama et al, 2004). The M1-ubiquitin chains, which are formed by LUBAC (composed of Sharpin, HOIP and HOIL), serves to recruit the IKK complex and are required for TAK1 to activate IKKs, but not MAPKs. The IKK complex comprises the protein kinases, IKKα and IKKβ, and a regulatory unit NF-κB essential modulator (NEMO). Indeed, NEMO contains a UBD that has a high affinity for M1-linked chains (Komander et al, 2009). LUBAC has recently been shown to extend K63-linked poly-ubiquitin chains with linear chains, and the generation of these K63/M1 hybrid chains facilitates the activation of the TAB2/3-TAK1 and IKK complexes by

bringing them in close proximity (Figure 7) (Cohen & Strickson, 2017). IKK then phosphorylates IκB, the inhibitor of NF-κB, resulting in its K48-ubiquitination and proteasomal degradation (Chen et al, 1996). This results in the liberation of the NF-κB dimers, allowing their nuclear translocation and subsequent upregulation of pro-inflammatory genes.

To maintain immune homeostasis and prevent excessive inflammation, the ubiquitination process must be strictly controlled. Deubiquitinating enzymes have a crucial regulating role in the innate immune signaling as they counter-balance ubiquitination (Lee et al, 2000) (Figure 7). The DUB enzymes A20, CYLD and OTULIN have been shown to negatively regulate the NF-κB pathway and thus downregulate the pro-inflammatory response. A20 was identified as a negative regulator of the NF-κB pathway as it removes K63-linked polyubiquitin chains from a

range of NF-κB signaling components (Hitotsumatsu et al, 2008). In addition, A20 ubiquitinates several signaling intermediates with K48-linked chains, resulting in their proteasomal-mediated degradation (De et al, 2014). A20 is also able to negatively regulates NF-κB signaling in a non-catalytic manner. Indeed, A20 interrupts the binding between E2 and E3 enzymes, downstream of ILR-1 and TLR-4 (Shembade et al, 2010). Additionally, binding of A20 to K63- and M1- linked chains competes with other UBD-containing proteins such as NEMO, preventing IKK activation and downstream NF-κB signaling (Bosanac et al, 2010) (Verhelst et al, 2012). CYLD also negatively regulates the NF-κB pathway by hydrolyzing K63- and M1-linked polyubiquitin chains from essential NF-κB mediatiors (Takiuchi et al, 2014). OTULIN is another important DUB controlling innate immune signaling, by removing M1-linked polyubiquitin chains, preventing the recruitment of NEMO and the downstream NF-κB signaling (Hrdinka et al, 2016).

Introduction

15

2.2. RING E3 ligases in the regulation of immune signaling pathways

Members of the Inhibitor of Apoptosis Protein (IAP) family, of the Pellino protein family and of the Tripartite Motif (TRIM) protein family were identified as RING domain-containing E3s playing major roles in the regulation of the inflammatory responses downstream of various PRRs and in the signaling cascade activated by pro-inflammatory cytokines, such as tumor necrosis factor (TNF) (Estornes & Bertrand, 2015) (Moynagh, 2014) (Hatakeyama, 2017).

Members of the IAP family are characterized by a baculovirus IAP repeat (BIR) motif and were initially thought to exclusively inhibit apoptosis by direct interference with the proteolytic activities of caspases (Deveraux et al, 1997). Later, studies revealed that they mainly function in other cellular processes and that X-linked IAP (XIAP) is the only member that is able to directly inhibit caspases (Deveraux et al, 1997) (Srinivasula & Ashwell, 2008). Some members of the IAP family contain a C-terminal RING domain which provides them with E3 ubiquitin ligase activity. XIAP and cellular IAP 1 and 2 (cIAP1/2), three members of the IAP family, have been shown to regulate several signaling pathways among which the NOD1/2, the TNFR and TLR signaling pathways. They positively regulate MAPK and NF-κB signaling downstream of the NOD1/2 receptors and TNFR1 by conjugating RIPK2 and RIPK1 with ubiquitin chains necessary for the

Figure 7: Ubiquitination in the regulation of immune signalling pathways. Components within the receptor-associated signalling complex are conjugated with K63-linked ubiquitin chains by dedicated E3s. K63-linked ubiquitin chains serve as a scaffold for LUBAC, which extends the K63-linked chains with linear chains to form K63/M1 hybrid chains. K63/M1 hybrid chains facilitate the activation of the TAB2/3-TAK1 and IKK complexes. Indeed, TAB2/3 preferentially binds K63-chains, while NEMO, a component of the IKK complex, displays a high affinity for M1 chains. Binding of the TAB2/3-TAK1 and IKK complexes to the K63/M1 hybrid chains brings them in close proximity and facilitates the activation of both complexes. Activated TAK1 further activates the MAPK cascade, while active IKK phosphorylates IκB, the inhibitor of NF-κB. Phosphorylated IκB proteins are modified with k48-linked ubiquitin chains, resulting in its proteasomal degradation. This results in the liberation of the NF-κB dimers, which activate the NF-κB pathway.

Introduction

16

recruitment of the TAB2/3-TAk1 and IKK complexes (Bertrand et al, 2009) (Bertrand et al, 2008) (Mahoney et al, 2008). Additionally, cIAP1/2 mediated ubiquitination of RIPK1 in response to TNFα inhibits RIPK1-dependent cell death induction (Bertrand et al, 2008). Furthermore, they promote K48-ubiquitination dependent proteasomal degradation of TRAF3 downstream of TLR2 and TLR4, resulting in the activation of the MAPK pathway (Tseng et al, 2010) (Chen et al, 2015a).

The mammalian Pellino family contains three members: PELI1, PELI2 and PELI3 which all contain a RING domain with intrinsic E3 ubiquitin ligase activity. They have only been implicated in regulating innate immunity this far. PELI1 has been linked to IL-R1 signaling whereas PELI3 has been found to be an important mediator of NOD signaling, as it promotes the Lys63-linked

ubiquitination of RIPK2 (Moynagh, 2014). Recent studies have highlighted some functional roles of all three members of the Pellino family in TLR signaling. These studies indicate that PELI1 and PELI2 stimulate NF-κB signaling downstream of TLR activation while PELI3 has a negative effect (Smith et al, 2017).

The TRIM protein family is a large family in which all members share a tripartite motif that consists of a RING domain, one or more B-boxes and a coiled coil region. They are known to contribute in diverse biological processes. Various TRIM proteins were reported to positively and negatively regulate RIG-I and TLR signaling by inducing the K63-linked ubiquitination of RIG-I, by inducing the degradation of the TAB2/TAB3 complex and by modulating the activity of IKKs, (Gack et al, 2007) (Shi et al, 2008) (Uchil et al, 2012) (MM & HB, 2017).

Aim

17

Aim

MAGED1 is a type II MAGE gene that, contrary to most genes of the family, shows strong phylogenetic conservation with the unique MAGE gene found in lower species, suggesting that MAGED1 performs fundamental and phylogenetically conserved cellular functions (Doyle et al, 2010) (De Donato et al, 2017). Previous studies have reported roles for MAGED1 in a variety of cellular processes, such as bone remodeling, apoptotic signaling, cell differentiation and transcriptional regulation (Barker & Salehi, 2002) (Sasaki et al, 2002) (Kendall et al, 2005) (Wu et al, 2015).

Several findings led us believe that MAGED1 may additionally regulates innate immune

responses by modulating the E3 ubiquitin ligase activity of specific RING-domain containing proteins. Indeed, MAGE proteins were reported to be constituent of E3 ubiquitin ligase complexes, referred to as MAGE-RING ligases (MRLs) (Doyle et al, 2010), and results from the lab and from the literature indicate that MAGED1 interacts with different RING E3 ligases reported to regulate PRR signaling (Jordan et al, 2001). By performing a mammalian protein-protein interaction trap (MAPPIT) screen (in collaboration with Prof. Gerlo (UGent)) followed by co-immunoprecipitation analysis, our group obtained results showing interaction between MAGED1 and the RING E3 ligases cIAP1, XIAP and PELI1/2/3. As mentioned in the previous sections, these proteins have been reported to regulate signaling downstream of PRRs.

Our research group is therefore currently investigating the potential role for MAGED1 in the

ubiquitin-dependent regulation of these innate immune signaling pathways. My master dissertation is part of this research theme, and my general aim was to test the potential role of MAGED1, as a component of E3 complexes containing these RING proteins. More specifically, my project consisted in evaluating the effect of MAGED1 on the enzymatic activity of its identified RING domain-interacting partners, namely cIAP1, PELI1, PELI2, PELI3 and XIAP and on the enzymatic activity of a related E3, namely cIAP2. To reach this aim, expression vectors coding for the MAGE and RING E3 proteins of interest were constructed. Afterwards, the proteins were produced by using a bacterial expression system. As bacterial overexpression of proteins is a pressure on the system, the most optimal conditions to overexpress the recombinant proteins were determined before the actual production. We aimed to work with pure MAGE proteins thus following protein production, the recombinant MAGE proteins were

purified from the bacterial cell lysate using glutathione-affinity purification. The E3 enzymes were purified from the bacterial cell lysate using glutathione beads, that were then directly used as input for the in vitro ubiquitination assays. Finally, the purified proteins were used to perform in vitro ubiquitination assays.

This research project should help evaluating the potential role of MAGED1 in innate immune signaling by providing a molecular mechanism by which MAGED1 could regulate the ubiquitination-dependent control of these pathways.

Contributions

18

Contributions of third parties

Glutathione-affinity purification of GST-MAGED1 and GST-MAGEC2 (assisted by Ria Roelandt)

Results

19

Results

The objective of this master dissertation is to test the potential regulatory function of MAGED1 on the E3 activity of RING-containing proteins previously reported to regulate innate immune signaling by ubiquitination. In order to reach this goal, the project will therefore involve the cloning of the genes of interest in an appropriate expression vector, the expression and purification of the encoded proteins, and finally the performance of in vitro ubiquitination assays with the obtained purified proteins. The objective is to evaluate the effect of MAGED1 on the enzymatic activity of these E3s, using the auto-ubiquitination of the E3s as a readout, as previously reported for other MAGE-RING ligase complexes (Doyle et al, 2010).

1. Cloning of MAGE and RING-containing proteins into a bacterial expressing vector

The in vitro ubiquitination reaction requires the input of the three key enzymes: E1, E2 and E3. The E1 and E2 enzymes are commercially available and were purchased. Because of the great variety in E3 enzymes, E3 enzymes are not commercially available in general and therefore, we produced the recombinant E3 proteins of interest ourselves. Previous results from the lab identified cIAP1, PELI1, PELI2 and PELI3 as MAGED1 interacting partners. From the literature, we know that XIAP is a MAGED1 interacting partner (Jordan et al, 2001). We therefore decided

to test the potential regulatory function of MAGED1 on the activity of these E3s. We also opted to test the activity of MAGED1 on a related E3 ligase, namely cIAP2. Since MAGED1 was previously reported to interact with the RING-protein Praja1 (PJA-1) and TRIM28 (Sasaki et al, 2002) (Doyle et al, 2010), we also included them in the study as controls. We decided to use MAGEC2 as a positive control in our experimental setup since MAGEC2 was shown to regulate the enzymatic activity of TRIM28 (Doyle et al, 2010).

The first step of the project therefore consisted in the cloning of the open reading frames (ORFs) of the genes encoding the above-mentioned proteins into a vector allowing expression for purification. We opted for a bacterial expression system and decided to clone the ORFs as GST fusion proteins using the pGEX destination vector. The pGEX destination vector was chosen for a couple of reasons. First of all, the pGEX vector is suitable for inducible and high efficiency

bacterial expression of the recombinant proteins. A second reason why this vector was chosen is because of the cleavable N-terminal glutathione S-transferase (GST) fusion protein it contains. The GST fusion protein not only facilitates the purification of the recombinant proteins but also increases the solubility of the fused recombinant protein. The GST-tag can be removed afterwards if necessary.

Results

20

1.1. Cloning of PELI3

Here, we will illustrate each step of the process with the results obtained for PELI3. The pENTR223-PELI3 plasmid encoding the full-length human PELI3 was obtained from the Human ORFeome (v8.1) (LMBP number: ORF81062-H05, EMBL accession number: LT738451) and the ORF was amplified by PCR using the primers hPELI3 fwd and hPELI3 rev (see Figure 8). The primers used for amplification (hPELI3 fwd and hPELI3 rev) contain additional overhanging sequences homologous to the pGEX-6P-2 vector. The PCR-amplified fragment was subsequently cloned in frame into the pGEX-6P-2 backbone vector by homologous recombination using CloneEZ (Figure 8). The construct was then transformed into DH5α competent cells. DH5α cells are a frequently used E. coli strain in cloning applications. In addition to a high transformation

efficiency, DH5α cells contain a mutation in recA, a gene involved in heterologous recombination, resulting in a higher insert stability. Additionally, DH5α cells lack some endonucleases, improving the quality of plasmid DNA prepared from minipreps.

Figure 8: The pGEX-6P-2-hPELI3 plasmid map. The pENTR223-PELI3 plasmide containing the ORF of hPELI3 was obtained from the human ORFeome v8.1 (LMBP number: ORF81062-H05, EMBL accession number: LT738451). The ORF of hPELI3 was cloned as a GST fusion-protein into the pGEX-6P-2 destination vector. To assess the insert direction of the PELI3 coding sequence in the pGEX-6P-2 vector, a restriction digest was performed using the restriction enzymes EcoRV and NcoI. Insertion of the PELI3 coding sequence in the right direction displays a restriction pattern of bands of lengths 3475 bp, 1800 bp and 1096 bp. pGEX fwd and pGEX rev: the forward and reverse primer used for sequencing.

Results

21

Fifteen colonies were picked up and subjected to a colony PCR to verify the presence of the coding sequence (Figure 9). Colonies 4, 5 and 12 were found to contain a fragment of the correct length so these colonies most likely contain the PELI3 coding sequence.

Afterwards, these colonies (colonies 4, 5 and 12) were subjected to a control restriction digest, using the restriction enzymes EcoRV and NcoI (Figure 8), to assess the insertion direction of the coding sequence into the pGEX-6P-2 destination vector. Insertion of the coding sequence in the right direction should result in a restriction pattern of bands with lengths of 3475 bp, 1800 bp and 1096 bp (Figure 8). Colonies 4, 5 and 12 were found to display the right restriction pattern and were then further sequence verified (Figure 10). The primers used for the sequencing reaction (pGEX fwd and pGEX rev) are located in the destination vector, flanking the PELI3

coding sequence (Figure 8). All coding sequences of PELI3 were found to contain multiple missense mutations, which we later discovered were already present in the original coding sequence. Due to time limitation, we decided not to continue working with PELI3.

Figure 9: Colony PCR PELI3 (1454 bp). Fifteen colonies were subjected to a colony PCR using the primers hPELI3 fwd and hPELI3 rev (Figure 8) to determine the presence of the coding sequence of PELI3 in the pGEX-6P-2 vector. Colonies that were found to contain the PELI3 coding sequence are colonies 4, 5 and 12.

Figure 10: Control digest PELI3. Colonies 4, 5 and 12 were found to contain the coding sequence of PELI3. To assess whether the coding sequence was also inserted in the right direction into the pGEX-6P-2 expression vector, the colonies were subjected to a control digest using the restriction enzymes EcoRV and NcoI. Rightly inserted coding sequences should display a restriction pattern of three bands of 3475 bp, 1800 bp and 1096 bp (Figure 8). Colonies 4, 5 and 12 displayed the right restriction pattern.

Results

22

1.2. Cloning of the other proteins

Bacterial expression vectors coding for hcIAP1, hcIAP2 and hXIAP were already available in the lab. The bacterial expression vector pGEX-5X-hTRIM28 was purchased from Addgene (catalog number: #45570). The cloning strategy for MAGED1, MAGEC2, PELI1, PELI2 and PJA1 is similar as the one shown for PELI3 and the results can be found in the addendum (Addendum 3). All coding sequences, except that for PELI2 were found to be correct. PELI2 contained a single missense mutation so we opted for the Quickchange mutagenesis to perform a site-directed mutagenesis of the point mutation. The Quickchange mutagenesis reaction was successful and we obtained an expression vector containing the correct coding sequence for PELI2 (Addendum 3). In conclusion, we obtained bacterial expression vectors encoding hcIAP1, hcIAP2, hMAGED1,

hMAGEC2, hPJA1, hPELI1, hPELI2, hPELI3, hTRIM28 and hXIAP (Table 1).

Table 1: Available expression vectors. This table mentions which vectors were previously available in the lab or were purchased and which vectors were generated. The ORF of the vectors which we generated ourselves were sequence verified.

Available vectors

Previously available or purchased Generated Sequence verified and correct

pGEX-4T-2-hcIAP1 -

pGEX-4T-2-hcIAP2 -

pGEX-6P-2-hMAGED1 Yes

pGEX-6P-2-hMAGEC2 Yes

pGEX-6P-2-hPELI1 Yes

pGEX-6P-2-hPELI2 Yes

pGEX-6P-2-hPELI3 No

pGEX-6P-2-hPJA1 Yes

pGEX-5X-hTRIM28 -

pGEX-4T-2-XIAP -

Results

23

2. Protein expression and purification

Once the bacterial expression vectors were generated, BL21(DE3) competent E.coli cells were transformed with the plasmids encoding the proteins of interest and protein expression was induced with isopropyl β-D-1-thiogalactopyranoside (IPTG). BL21 E. coli cells are frequently used for the production of recombinant proteins as they allow high-efficiency and IPTG-inducible protein expression. Because expression of these proteins is a pressure on the bacterial system, it could lead to a large percentage of misfolded and/or insoluble recombinant proteins. Therefore, we aimed to first determine the expression conditions displaying the highest soluble expression of the recombinant protein while limiting degradation, before the actual production. The majority of the expression proteins should be located preferentially in

the soluble fraction and should not form non-soluble aggregates. After determining the optimal expression conditions, for each GST-fusion protein, the MAGE proteins were purified using a glutathione column, followed by removal of the GST-tag. The E3 ligases were isolated from the bacterial cell lysate using glutathione agarose beads and these gluthatione agarose beads linked to the GST-fusion protein were used in further applications.

2.1. Determining optimal expression conditions

Protein expression is dependent on the growth temperature, the time of induction and the concentration of inducer used. BL21(DE3) E. coli cultures were induced with IPTG and

subsequently cultured at different conditions in order to optimize the expression conditions. The various parameters that were considered are the culture temperature (20°C, 28°C or 37°C) and time of induction (4 hours or 16 h (overnight)). Afterwards, protein expression in the soluble and non-soluble fraction was analyzed. In the results section, the determination of the optimal expression conditions will be discussed in detail for MAGED1 and XIAP. The obtained optimal expression conditions for the other fusion proteins are summarized in Table 2.

Results

24

2.1.1. Expression conditions for MAGED1

Based on a coomassie-stained gel, MAGED1 expression was clearly induced after IPTG treatment (Figure 11). This was confirmed by immunoblotting against GST (Figure 11). Optimal expression of MAGED1 was achieved by culturing the bacteria at 20°C (Figure 11). Indeed, culturing at higher temperatures reduced solubility drastically, as the majority of the expressed protein was present in the non-soluble fraction and a lot of degradation products were observed. There is no significant difference in protein degradation when inducing protein expression for 4 hours or overnight (16h) at 20°C (Figure 11). Furthermore, bacterial density was higher after culturing overnight compared to culturing for 4 hours, ultimately resulting in a greater yield of the produced protein. Therefore, for the production of MAGED1, we opted to

induce expression overnight (16h) at 20°C.

Figure 11: Determining the best expression conditions for MAGED1. BL21(DE3) E. coli cells expressing the pGEX-6P-2-GST-MAGED1 bacterial expression vector were grown at 20°C, 28°C or 37°C after IPTG induction for 4h or overnight (ON) (16h). 4 OD600 of each culture was harvested and the cells were lysed, sonicated and run on SDS-PAGE. The protein amount was assessed in the soluble (S) and non-soluble (NS) fraction of each condition by coomassie staining and immunoblotting (IB) for GST.

Results

25

2.1.2. Expression conditions for XIAP

Again, protein expression was visualized relying on coomassie-stained gels and results were confirmed by immunoblotting against GST (Figure 12). XIAP expression was already present before induction with IPTG, meaning that there is leaky expression. The expression increased after induction with IPTG, although mainly in the non-soluble (NS) fraction. Culturing the bacteria at a higher temperature and/or for a longer incubation period resulted in increased protein expression but a substantial part of the expressed protein was present in the non-soluble fraction. At 28°C for 4 hours, the level of protein degradation was somewhat increased in comparison to inducing protein expression for 4 hours at 20°C (Figure 12) but a higher bacterial density is obtained after culturing at 28°C compared to culturing at 20°C, leading to a

better yield of the produced protein. Therefore, the optimal culturing conditions for the large-scale production of MAGEC2 were set as 4 hours at 28°C.

Figure 12: Determining the best expression conditions for XIAP. BL21(DE3) E. coli cells expressing the pGEX-4T-2-GST-XIAP bacterial expression vector were grown at 20°C, 28°C or 37°C after IPTG induction for 4h or overnight (ON) (16h). The protein amount was assessed in the soluble (S) and non-soluble (NS) fraction of each condition by coomassie staining and immunoblotting (IB) for GST.

Results

26

2.1.3. Expression conditions for the other GST-fusion proteins

Similarly, the best expression conditions were determined for cIAP1, cIAP2, MAGEC2, PELI1, PELI2, PJA1 and TRIM28. All the results can be found in Table 2 and Addendum 4. As for PJA1, the results from the coomassie stained gel and the immunoblot against GST indicated that the full-length protein GST-PJA1 was not present. Only lower molecular weight products were observed after IPTG induction (Addendum 4). It may be that protein expression from the BL21(DE3) bacteria carrying the full-length GST-PJA1 fusion protein was suboptimal and shorter proteins were produced. Another possibility is that the full-length protein was produced but was degraded.

Table 2: Best conditions for the overexpression of the recombinant proteins.

Recombinant protein

Expression conditions

Temperature Time

GST-cIAP1 20 °C ON

GST-cIAP2 20 °C ON

GST-MAGEC2 20 °C ON

GST-MAGED1 20 °C ON

GST-PELI1 20°C 4 h

GST-PELI2 20 °C ON

GST-PJA1 - -

GST-TRIM28 20 °C ON

GST-XIAP 28 °C 4 h

2.2. Production and purification of the GST-fusion proteins

Having established the optimal conditions for the expression of the GST-fusion proteins, we next scaled up the experimental set up to proceed to their production and purification. Because GST-tags tend to form aggregates which could lead to forced interaction between the GST-tagged MAGE proteins and GST-tagged E3s in the in vitro ubiquitination reactions, we opted to remove the GST tag from the MAGE proteins after purification.

Results

27

2.2.1. Production and purification of MAGED1 and MAGEC2

Following the induction of GST-MAGED1 and GST-MAGEC2 expression, the proteins were purified from the bacterial cell lysate using glutathione-affinity purification. To do so, the soluble fraction of the cell lysate was loaded on the glutathione column and GST-MAGE proteins were eluted with reduced glutathione (EL1). The unbound fraction (flow through) FT1 was reloaded onto the column using a lower flow rate to achieve maximum binding capacity. Indeed, as the binding kinetics between glutathione and GST are relatively slow, it is important to keep the flow rate low during sample application.

MAGED1

Coomassie staining of the gel and immunoblotting against GST, revealed that an important fraction of GST-MAGED1 fusion protein was still present in the insoluble fraction of the cell lysate despite our optimization set up (Figure 13). Nevertheless, full length GST-MAGED1 was also detected in both elution fractions, which was confirmed by immunoblotting against GST (Figure 13). A range of contaminants and/or degradation products were also detected in the elution fractions, of which some were more dominant present than the full length GST-MAGED1 (Figure 13).

Figure 13: Purification of GST-MAGED1 on a Glutathion Sepharose 4FF column. Isolation of the GST-MAGED1 fusion protein from BL21(DE3) E. coli cells. The soluble fraction of the cell lysate was put on the column and the flow through (FT1) was collected. GST-MAGED1 was eluted with reduced glutathione (EL1). FT1 was subsequently loaded again onto the column and FT2 and EL2 were collected. NS: non-soluble fraction, S: soluble fraction, FT: flow through, EL: elution fraction.

Results

28

MAGEC2

The GST-MAGEC2 protein was not only detected in the elution fractions but also in the flow through fractions (FT1 and FT2), due to overloading of the glutathione column (Figure 14). Based on the coomassie stained gel, MAGEC2 was the most dominant protein in the elution fractions EL1 and EL2 after glutathione 4FF purification (Figure 14).

Figure 14: Purification of GST-MAGEC2 on a Glutathion Sepharose 4FF column. Isolation of the GST-MAGEC2 fusion protein from BL21(DE3) E. coli cells. The soluble fraction of the cell lysate was put on the column and the flow through (FT1) was collected. GST-MAGEC2 was eluted with reduced glutathione (EL1). FT1 was subsequently loaded again onto the column and FT2 and EL2 were collected. NS: non-soluble fraction, S: soluble fraction, FT: flow through, EL: elution fraction.

Results

29

2.2.2. Cleavage of MAGED1 and MAGEC2

After purification of the GST-MAGE proteins on glutathione column, the GST-tag was cleaved using the PreScission protease (PP). Initially, the optimal conditions (protease concentration: amount of PP units that has to be add per 100 µg of the preparation, and incubation time) necessary for complete cleavage were determined on analytical scale. Once the cleavage conditions were determined, the glutathione elution samples were digested with PreScission protease to cleave GST. Afterwards, the digested samples were purified on Glutathione Sepharose 4B column for removal of the GST-tag and GST-fused PreScission protease.

MAGED1

The optimal conditions to cleave the GST-tag from GST-MAGED1 (Figure 14) were determined by incubating GST-MAGED1 with increasing concentrations of the PreScission protease during a period of time ranging from 0 to 4h. As shown in Figure 15, the GST-tag was efficiently cleaved from GST-MAGED1 in all the conditions, as monitored by the 26 kDa shift in molecular weight observed on the coomassie stained gel (Figure 15) This was confirmed by immunoblotting the samples against MAGED1 (Figure 15). Of note, the anti-MAGED1 antibody was generated by immunizing rabbit with a GST-tagged MAGED1 peptide, which explains why it also recognizes the GST cleaved fragments (Salehi et al, 2000).

Figure 15: Cleavage test MAGED1 on analytical scale. The glutathione sepharose 4 FF elution fraction EL1 and EL2 were pooled and incubated with different concentrations of PreScission protease (0U, 1U, 2U or 4U/ 100 µg of the GST-MAGED1 preparation) for 4 hours or overnight. The samples were analyzed by SDS-PAGE followed by coomassie staining and immunoblotting. U: unit.

Results

30

Based on the results obtained at the analytical scale, we opted to incubate GST-MAGED1 overnight (to be sure of complete cleavage) with 1U PreScission protease/100 µg of the GST-MAGED1 preparation. MAGED1 was collected in the flow through while the GST-tag and the GST-fused PreScission protease were collected in the elution fraction (Figure 16). The concentration of the preparation before and after purification on glutathione 4B column was determined by Bradford assay and based on these results, we calculated that only 26% of the total protein amount in the preparation was recovered. This is probably due to aspecific interactions of MAGED1 with the Glutathione Sepharose 4B column. The remaining protein mixture consists of a range of contaminants and/or degradation products. A major contaminating band (marked by *) was also detected by immunoblotting the samples for MAGED1, but not for GST (Figure 16). This indicates that this contaminating band may

represent a MAGED1 degradation product. Unfortunately, due to the insufficient ratio of full length MAGED1 compared to contaminating proteins in this preparation, it could not be used in the in vitro ubiquitination reactions. Due to time limitation, we were not able to adapt the conditions of recombinant MAGED1 purification and therefore had to continue the project in absence of recombinant MAGED1.

Figure 16: GST-tag removal of GST-MAGED1. The glutathione sepharose 4FF elution fractions, obtained after purification, were pooled (input) and incubated overnight with 1U PreScission protease/100 µg of the GST-MAGED1 preparation. After incubation, the digested samples (+PP) were purified on Glutathione Sepharose 4B column for removal of the GST-tag and PreScission protease. FT: flow through, EL: elution fraction. *: major MAGED1-related contaminant.

Results

31

MAGEC2

The optimal conditions to cleave the GST-tag from GST-MAGEC2 were determined as for GST-MAGED1 (Figure 17).

According to these results, we opted to incubate the pooled incubation fractions of GST-MAGEC2, obtained after glutathione purification, with 2U PreScission protease/100 µg of the GST-MAGEC2 preparation for 4 hours. The GST-tag was successfully cleaved from MAGEC2, as monitored by the 26 kDa shift in molecular weight observed on the coomassie stained gel (Figure 18). This was confirmed by immunoblotting the samples for GST. The band representing GST-MAGEC2 indeed disappeared upon incubation with the PreScission protease (Figure 18). The percentage of total protein recovery after purification on Glutathione Sepharose 4B column, based on Bradford assay concentration measurements, was about 49%, probably due to aspecific binding of MAGEC2 to the column. A band of around 70 kDa (marked by a *), a higher molecular weight than full length MAGEC2, was observed on the coomassie stained gel

but not by immunoblotting the samples against GST. These results indicate that this major contaminant is not a GST-MAGEC2 degradation product (Figure 18). Although some contaminants and/or degradation products are present in the preparation, MAGEC2 is the most dominant protein and the preparation was found to be adequate to use in the in vitro ubiquitination assays.

Figure 17: Cleavage test MAGEC2 on analytical scale. The glutathione sepharose 4 FF elution fraction EL1 and EL2 were pooled and incubated with different concentrations of PreScission protease (0U, 1U, 2U or 4U/100 µg of the GST-MAGEC2 preparation) for 4 hours or overnight. The samples were characterized by SDS-PAGE followed by Coomassie staining and immunoblotting. U: unit.

Results

32

We estimated the concentration of full length MAGEC2 in the preparation by comparing the

intensity of the MAGEC2 signal to the one obtained with known amount of BSA (Figure 19). The

concentration of MAGEC2 in the preparation was estimated to be around 38 µM. Bovine serum

albumin (BSA) is used for comparison as this is a stable, cheap and easily available protein that

has an intermediate molecular mass.

Figure 19: Determining the concentration and purity of the final hMAGEC2 protein product. A dilution series of our final hMAGEC2 product in glycerol was loaded on SDS-PAGE together with known amounts of bovine serum albumin (BSA). The intensity of the bands was compared using the quantity one software.

Figure 18: GST-tag removal of GST-MAGEC2. The glutathione sepharose 4FF elution fractions, obtained after purification, were pooled (input) and incubated for 4 hours with 2U PreScission protease/100 µg of the GST-MAGEC2 preparation. After incubation, the digested samples (+PP) were purified on Glutathione Sepharose 4B column for removal of the GST-tag and PreScission protease. FT: flow through, EL: elution fraction.

Results

33

2.3. Small scale production of recombinant E3 ligases

The RING E3 ligases were produced on a smaller scale and were isolated from the bacterial cell lysate using glutathione agarose beads. The GST-tag was not removed after purification since our plan was to use the bead-bound E3s directly in the in vitro ubiquitination assays. We estimated the concentration of full length GST-RING E3 ligase fusion proteins in the preparations by comparing the intensity of the signals to the one obtained with known amounts of BSA on a Coomassie stained gel. As an example, the Coomassie stained gel for GST-TRIM28 is shown (Figure 20). The results for the other E3 ligases can be found in Addendum 5. Table 3 shows the determined concentrations of all GST-RING E3 ligases. Due to time limitation, we focused on the production of cIAP1/2, TRIM28 and XIAP.

Table 3: Estimated concentration of the GST-RING E3 ligases based on coomassie stained gel.

Concentration (µM)

GST-XIAP 3

GST-cIAP1 8

GST-cIAP2 2

GST-TRIM28 4.5

Figure 20: Determination of the GST-TRIM28 concentration. Different amounts of glutathione beads coupled to GST-TRIM28 were loaded on gel, together with known amount of bovine serum albumin (BSA) on a coomassie stained gel. The concentration of the GST-TRIM28 on the beads was determined by comparing the intensity of the GST-TRIM28 related bands with the BSA series.

Results

34

3. In vitro ubiquitination assays

The potential effect of the purified recombinant MAGE protein on the ligase activity of the selected E3s was then evaluated using in vitro ubiquitination experiments. In order to do so, we first optimized the conditions of the ubiquitination assay for each E3 ligase alone and then included the purified MAGE protein in the reaction. We followed E3 activity using the auto-ubiquitination of the E3 ligase as readout by immunoblotting against GST and ubiquitin. Our initial objective was to test the effect of MAGED1 on the activity of these E3s, using MAGEC2 as a positive control. As mentioned before, we unfortunately encountered major degradation and contamination problems during the purification of MAGED1, which prevented us from using the MAGED1 preparation in these reactions. We therefore instead decided to try to confirm the

reported effect of MAGEC2 on TRIM28 activity and to test its potential effect on cIAP1, cIAP2 and XIAP.

3.1. Effect of MAGEC2 on the enzymatic activity of TRIM28

3.1.1. Set up of the TRIM28 ubiquitination assay

To determine the optimal conditions to monitor TRIM28 acitivity, we incubated different amounts of the bacterially produced GST-TRIM28 with UbcH2 as E2 component and let the reaction run at 37°C for various timepoints. Two negative controls were used in this experiment. The first negative control was a condition without ATP. ATP is required for the

activation of the E1 enzyme and subsequent continuation of the ubiquitin cascade. In the second negative control, the E3 ligase was absent from the reaction and instead we added recombinant GST. This control assures us that any formation of ubiquitin chains is depending on the ubiquitin ligase activity of the E3.

Surprisingly, no E3 activity of TRIM28 was detected in the assay. Altough we observed a light smear by immunoblotting the samles against GST (Figure 21), this smear was also present in the negative control (-ATP) (Figure 21).

Results

35

3.1.2. Effect of MAGEC2 on TRIM28 activity

As MAGEC2 is reported to influence the E3 activity of TRIM28 (Doyle et al, 2010), it is possible that MAGEC2 is required to detect TRIM28 enzymatic activity. We therefore repeated the

experiment in the presence of MAGEC2 (Figure 22). Again, we did not observe TRIM28-dependent ubiquitination in presence of MAGEC2.

The outcome of the reaction was not as expected. The reaction could have failed due to several reasons. It is possible that we did not use the right reaction conditions or that one or more of the components did not function properly. Our purified TRIM28 protein may indeed be active.

Figure 21: Determining the TRIM28 ubiquitin ligase activity. An in vitro ubiquitination assay was performed using 2.5 µM UbcH2 and indicated amounts of the E3 component (GST or GST-TRIM28). The reactions were incubated at 37°C for the indicated amounts of time. E3 activity of TRIM28 was detected by (i) immunoblotting the samples against GST and (ii) reblotting the samples against ubiquitin on the same membrane after sodium azide treatment to strip the GST signal.

Figure 22: Determining the effect of MAGEC2 on the E3 activity of full length TRIM28. An in vitro ubiquitination assay was performed using 2.5 µM UbcH2, indicated amounts of the E3 ligase component (GST or GST-TRIM28) and indicated amounts of MAGEC2. The reactions were incubated at 37°C for the indicated amounts of time.

Results

36

3.2. Effect of MAGEC2 on the enzymatic activity of XIAP, cIAP1 and cIAP2

Despite the fact that we were not able to reproduce the previously published effect of MAGEC2 on the E3 activity of TRIM28, we still decided to evaluate the potential effect of MAGEC2 on the enzymatic activity of XIAP, cIAP1 and cIAP2.

3.2.1. Set up of the XIAP, cIAP1 and cIAP2 ubiquitination assays

As for TRIM28, we first performed XIAP, cIAP1 and cIAP2 in vitro ubiquitination assays in the absence of MAGEC2 to evaluate their intrinsic acitivities.

XIAP

Autoubiquitination of XIAP is observed in all tested conditions as we clearly observed mono-, di- and tri-ubiquitinated XIAP when immunoblotting the samples against GST (Figure 23). This was confirmed by immunoblotting the samples against ubiquitin (Figure 23).

Figure 23: In vitro ubiquitination assay XIAP. An in vitro ubiquitination assay was performed using 2.5 µM UbcH5b and indicated amounts of the E3 component (GST or GST-XIAP). The reactions were incubated at 37°C for the indicated amounts of time.

Results

37

cIAP1/cIAP2

Ubiquitination in the absence of ATP was observed for the reaction containing cIAP1 as E3 component by immunoblotting the samples against GST (Figure 24). Immunoblotting the samples against ubiquitin indeed confirmed this but the intensity of the smear in the absence of ATP is lighter when compared to reactions in which ATP was added (Figure 24). This background ubiquitination signal suggest that somehow, the ubiquitination reaction starts without ATP, a necessary component in the first step of the cascade. This may be the result of the forced in vitro ubiquitination reaction and the high concentration of the enzymes responsible for catalyzing the ubiquitination cascade. E3 activity of cIAP2 was detected on the immunoblot against GST and was confirmed by immunoblotting the samples against ubiquitin (Figure 24).

Increasing the incubation period allowed more autoubiquitination of cIAP2 to occur (Figure 24).

The in vitro ubiquitination assays using GST-XIAP, GST-cIAP1 and GST-cIAP2 as E3 ligase components were succesful, meaning that the right reaction conditions are used for the in vitro ubiquitination assays.

Figure 24: In vitro ubiquitination assay cIAP1/cIAP2. An in vitro ubiquitination assay was performed using 2.5 µM UbcH5a and indicated amounts of the E3 component (GST, GST-cIAP1 or GST-cIAP2). The reactions were incubated at 37°C for the indicated amounts of time.

Results

38

3.2.2. Effect of MAGEC2 on XIAP, cIAP1 and cIAP2 activities

Now that we have established the set-up conditions, the next step is to test the effect of MAGEC2 on the ubiquitin ligase activity of XIAP, cIAP1 and cIAP2.

XIAP

No increased auto-ubiquitination of XIAP was detected upon addition of MAGEC2 to the in vitro ubiquitination reaction containing XIAP as E3 component (Figure 25).

Figure 25: In vitro ubiquitination assay XIAP + MAGEC2. An in vitro ubiquitination assay was performed using 2.5 µM UbcH5b, 1 µM of the E3 component (GST or GST-XIAP) and the indicated amounts of MAGEC2. The reactions were incubated at 37°C for 5 minutes.

Results

39

cIAP1/cIAP2

No effect on the E3 activity of cIAP1 by MAGEC2 was detected (Figure 26). Equimolar amounts

of MAGEC2 however enhanced the ligase activity of cIAP2 as more auto-ubiquitinated cIAP2 is

detected by immunoblotting the samples against GST and a more intense smear is observed by

immunoblotting against ubiquitin (Figure 26).

Figure 26: In vitro ubiquitination assay cIAP1/cIAP2 + MAGEC2. An in vitro ubiquitination assay was performed using 2.5 µM UbcH5b, the indicated amounts of the E3 component (GST, GST-cIAP1 or GST-cIAP2) and the indicated amounts of MAGEC2. The reactions were incubated at 37°C for 5 minutes.

Discussion

40

Discussion and conclusion

1. General discussion

The research team of Prof. Dr. Mathieu Bertrand focuses on signal transduction of inflammatory pathways, with a particular interest on the role of ubiquitination. Members of the MAGE family are known to interact with RING E3 ligases to constitute MRL complexes. MAGED1 is a type II MAGE gene that is ubiquitously expressed and shows strong phylogenetic conservation with the ancestral MAGE gene, contrary to most genes of the family, suggesting that MAGED1 performs fundamental and phylogenetically conserved cellular functions (Doyle et al, 2010) (De Donato et al, 2017). Previous studies have reported roles for MAGED1 in a

variety of cellular processes, such as bone remodeling, apoptotic signaling, cell differentiation and transcriptional regulation (Barker & Salehi, 2002) (Sasaki et al, 2002) (Kendall et al, 2005) (Wu et al, 2015) but the function of MAGED1 in innate immune signaling and in more detail, its function in the E3 ligase complex remains unknown. Several findings from the literature and results from the lab suggest that MAGED1 may additionally regulates innate immune responses by modulating the E3 ubiquitin ligase activity of specific RING-domain containing proteins involved in innate immune signaling. Indeed, MAGED1 was found to interact with cIAP1, PELI1, PELI2, PELI3 and XIAP (Jordan et al, 2001). The aim of this research project therefore was to investigate the potential role of MAGED1 on the E3 ubiquitin ligase activity of these RING domain containing E3s.

To test the effect of MAGED1 on E3 ligase complexes, we aimed to produce recombinant MAGED1, the E3 ligases that were found to interact with MAGED1 (cIAP1, PELI1, PELI2, PELI3 and XIAP) and the related E3 ligase cIAP2. We also opted to produce recombinant PJA1 and TRIM28 as controls since MAGED1 was previously reported to interact with these proteins (Sasaki et al, 2002) (Doyle et al, 2010). We decided to produce recombinant MAGEC2 and use it as a positive control in our experimental setup since MAGEC2 was shown to regulate the enzymatic activity of TRIM28 (Doyle et al, 2010). To produce recombinant proteins, we started with constructing expression vectors by cloning the ORF of our proteins of interest into an expression vector suited for bacterial expression. We opted for a bacterial expression system because such proteins were successfully produced in other studies using this expression system (Bertrand et al, 2011) (Doyle et al, 2010). After this step, we had generated expression vectors

for the MAGE proteins MAGED1 and MAGEC2 and the E3 ligases PELI1, PELI2 and PJA1. Expression vectors coding for XIAP, cIAP1 and cIAP2 were already available in the lab and the expression vector coding for TRIM28 was purchased. Because expression of proteins is a pressure on the system and can lead to large amounts of insoluble, misfolded, and/or partially translated proteins, the most optimal conditions to overexpress the recombinant proteins were determined before the actual production. After determining the best expression conditions, the proteins were produced and purified. The MAGE proteins were purified by using glutathione-affinity purification and afterwards, GST-tags were cleaved to avoid false-positive results. The RING E3 ligases were produced on a smaller scale and were isolated from the cell lysate by using glutathione agarose beads and the bead-coupled E3s were used in further applications.

Discussion

41

Unfortunately, we saw that after affinity purification of MAGED1 there was a dominant contaminating protein of 60 kDa in the preparation. This 60 kDa contaminating protein was found to be a degradation product of the full-length MAGED1. Co-purification of this degradation product occurred as the degradation product was bound to the full-length MAGED1 protein. Indeed, MAGE proteins are known to bind each other (Bai & Wilson, 2008). Unfortunately, this MAGED1-related degradation product was more abundantly present than our full length MAGED1 protein in the preparation. Because the MAGED1 degradation product could possibly hinder the function of the full length MAGED1 protein, we will never be certain that negative results, observed in the ubiquitination assays, are truly negative. Therefore, the MAGED1 protein mixture was not used in further experimental work.

Degradation is commonly caused by the presence of proteases in the sample, proteolysis in the host bacteria or cell disruption during mechanical lysis. To limit degradation, we used a protease deficient bacteria strain (BL21DE3 E. coli strain) and added protease inhibitors to the sample. However, the bacterial cells were lysed by sonication, which is a vigorous cell disruption method. Degradation, as well as the co-purification of host proteins, might be limited by decreasing the lysis time. Additionally, adding lysozyme prior to lysis may improve the results (Healthcare, 2009). Although many simple proteins can be efficiently produced in large quantities and in a quick way using the bacterial expression system, which is also a very affordable production system, the production of more complex proteins is often problematic as bacteria are not able to post-translationally modify proteins nor form intracellular disulphide bridges (Sahdev et al, 2008). Both processes might be crucial for the protein to obtain a stable

conformation and/or become functional active. Instability of the protein is another possible cause of the substantial degree of degradation that is observed. Because of these disadvantages to the bacterial expression system, it might be better to express the recombinant proteins using another expression system. To continue the research, the MAGED1 protein should be produced using a more suitable expression system. Other well used expression systems include yeast cells, insect cell lines and mammalian cell lines, which are eukaryotic expression systems equipped to post-translationally modify proteins. This eukaryotic environment improves the production of well-folded and functional recombinant proteins. Each system comes with its own advantages and disadvantages. Yeast cells combine the advantages of a bacterial expression system (high growth speed and low costs) with eukaryotic features (secretory pathway and PTMs to a certain degree). However, yeast glycosylation is very

heterogeneous and of the high-mannose type, conferring a short half-life to the proteins, and differs from mammalian glycosylation (Mattanovich et al, 2012). Insect cells are higher eukaryotic system and can carry out more complex post-translationally modifications which are additionally relatively homogeneous. The downfall to this system are the higher costs and the process to obtain stable expressing cells is time consuming (Contreras-Gómez et al, 2014). Mammalian cell lines may give us proteins that are closest in form to the endogenous human MAGE proteins and E3 ligases but the costs are high (Khan, 2013).

MAGEC2 was successfully produced and purified. Full-length MAGEC2 was the most abundant protein in the preparation after purification so the MAGEC2 preparation was adequate to use in the in vitro ubiquitination assays.

Discussion

42

Up to this point, we had produced and purified recombinant MAGEC2 and the E3 ligases cIAP1, cIAP2, TRIM28 and XIAP. Our original aim; to assess the effect of MAGED1 on the ubiquitin ligase activity of the E3s by performing in vitro ubiquitination assays was no longer possible but instead we decided to perform in vitro ubiquitination assays with the recombinant proteins we did have. To do so, we first optimized the ubiquitination reaction with the E3 ligases alone to see if our produced E3 ligases are enzymatically active. In a second step, we examined the effect of MAGEC2 on their respective E3 activities. The first E3 ligase we tested was TRIM28 as it was previously reported that MAGEC2 can regulate its enzymatic activity (Doyle et al, 2010). The recombinant produced full length TRIM28 protein did however not display inherent ubiquitin ligase activity. The reason for this absence of activity probably originates from TRIM28 itself since we validated the activity of the E2 and of the experimental conditions in our in vitro

ubiquitination assays using cIAP1/2 and XIAP. The discrepancy between our results and the one previously published might originate from the fact that we used full length TRIM28 while Doyle and colleagues only used a truncated version of TRIM28 (Doyle et al, 2010). In line with this idea, another study showed that only the RBCC fragment (AA 22-419) of TRIM28 and not full length TRIM28 was able to conjugate ubiquitin chains to p53 (Wang et al, 2005). In addition to the RBCC fragment, full-length TRIM28 protein contains a plant homology domain (PHD) and a bromo-domain. It is therefore possible that the PHD or the bromo-domain has auto-inhibitory function towards the ubiquitin ligase activity of TRIM28, although this has not been reported. It would therefore be important to repeat our study with the truncated version of TRIM28 in order to see if we can reproduce the results of Doyle and colleagues. It is important to keep in

mind that this RBCC fragment is an artificial protein and that this protein does not naturally occur in a cellular context and might also not possess the same functionality as the full-length TRIM28. Therefore, the physiological relevance of the reported regulatory function of MAGEC2 on TRIM28 remains questionable.

Since we had succesfully produced recombinant MAGEC2, XIAP, cIAP1 and cIAP2, we still tested the potential effect of MAGEC2 on the enzymatic activity of these E3s. Interestingly, the presence of MAGEC2 had no impact on the catalytic activity of XIAP and cIAP1 but enhanced cIAP2-mediated ubiquitination, as monitored by GST and ubiquitin immunoblotting. Surprisingly, enhanced cIAP2-mediated ubiquitination was only observed in the presence of equimolar amounts of MAGEC2. To the contrary, adding an excess of MAGEC2 (4 times more) to the ubiquitination reaction did not result in an enhancement of the E3 activity of cIAP2. A

possible explanation why the addition of an equimolar amount of MAGEC2 resulted in enhanced E3 activity of cIAP2 and an excessive amount of MAGEC2 did not, may be found in the purity of the MAGEC2 protein mixture. The MAGEC2 protein mixture is contaminated with unknown proteins and these contaminants might bind to cIAP2 and thereby hinder the effect of MAGEC2 on the E3 activity of cIAP2. Addition of larger amounts of MAGEC2 equals the addition of more contaminants. If all the available cIAP2 proteins are bound by contaminants, no effect on the E3 activity will be noticed upon addition of MAGEC2. It is important to repeat this experiment to confirm that the observed results were true and no artefacts. Although these results are interesting, many more experiments should be performed to evaluate their potential relevance. It would for instance be important to demonstrate that both proteins interact in a

Discussion

43

physiological context and that MAGEC2 regulates cIAP2-mediated functions. MAGEC2 is a type I MAGE gene whose expression is restricted to cancer cells where it is propose to functions as an oncogenic driver. Interestingly, cIAP2 expression is often upregualted in tumors and cIAP2 has been shown to positively regulate activation of the canonical NF-κB pathway in cancer cells by ubiquitinating RIPK1 (Bertrand et al, 2008). Aberrant regulation of NF-κB signaling is believed to promote tumorigenesis since NF-κB regulates expression of a wide panel of genes associated with cell survival and proliferation. cIAP2 positively regulates the canonical NF-κB pathway by mediating the K63-linked poly-ubiquitination of RIPK1. The K63-ubiquitin chains serve as a molecular scaffold which recruit LUBAC, in its turn synthesizing M1 chains. K63/M1 hybrid chains recruit the TAB2/3-TAK1 and the IKK complexes, resulting in the degradation of IκB and the induction of gene expression. Depletion of cIAP2 strongly impairs NF-κB-mediated cell

proliferation and survival. Additionally, blocking the K63-linked poly-ubiquitination of RIPK1 by cIAP2 leads to a switch in the function of RIPK1 from being pro-survival to being pro-death in TNF-α stimulated cells. Under these circumstances, RIPK1 can drive both apoptosis and necroptosis (Pasparakis & Vandenabeele, 2015).

By modulating the ubiquitin ligase activity of cIAP2, MAGEC2 could exploit the cellular function of cIAP2 and turn it to advantage for tumor initiation and growth. Alterations in the expression levels of IAPs have been previously reported to be correlated with tumorigenesis. Our results suggest that MAGEC2 regulates cIAP2 activity. MAGEC2 seems to increase cIAP2-mediated ubiquitin chain formation. However, we have not yet studied the ubiquitin linkage type that is promoted by MAGEC2 nor which substrate is possibly ubiquitinated by MAGEC2-cIAP2. The

outcome of this MAGEC2-cIAP2 interaction remains therefore unknown. A possibility is that MAGEC2 collaborates with cIAP2 to conjugate RIPK1 with K63-linked poly-ubiquitin chains, resulting in canonical NF-κB signaling and cell survival and proliferation, thereby promoting tumorigenesis. Since RIPK1 is reported to be constitutively ubiquitinated by cIAP2 in a panel of tumor cell lines (Bertrand et al, 2008), it would be interesting to test the effect of MAGEC2 repression of RIPK1 ubiquitination status in these cells. Until now, it is not yet clear how MAGEC2 promotes a malignant phenotype but it is thought that MAGEC2 might play a role in resistance to TNF‐α‐induced apoptosis (Wang et al, 2016). Regulation of the E3 activity of cIAP2 by MAGEC2 thus might be a possible underlying mechanism.

Our results show that MAGEC2 can also enhance auto-ubiquitination of cIAP2. In case auto-

ubiquitination would involve K48-ubiquitin chains, this could induce proteasomal-dependent degradation of cIAP2 and inhibition of the canonical NF-κB pathway (Listovsky et al, 2004), a situation that could appear non favorable for tumor development, but only if considering the role of cIAP2 in canonical NF-κB activation. Indeed, cIAP2 not only positively regulates canonical NF-κB activation but also negatively regulates the non-canonical NF-κB pathway. MAGEC2-mediated degradation of cIAP2 via enhanced auto-ubiquitination would therefore results in non-canonical NF-κB activation, which can also promote tumorigenesis. Although in most cancer types the expression of IAPs is upregulated, also loss of IAPs is associated with the development of certain types of cancer. The non-canonical or alternative NF-κB signaling pathway is regulated by the NF‐κB‐inducing kinase (NIK), which triggers the downstream activation of the alternative NF-κB pathway by activating IKKα (Zarnegar et al, 2008). In non-

Discussion

44

stimulated cells, the non-canonical NF-κB pathway is shut down by the cIAP2-mediated constitutive degradation of NIK. Upon stimulation of the alternative NF-κB signaling pathway however, cIAP2 promotes the K48-ubiquitination dependent proteasomal degradation of TRAF3, which results in the stabilization of the NF-κB inducing kinase (NIK) and the subsequent activation of the alternative NF-κB pathway (Zarnegar et al, 2008). Depletion of cIAP2 results in elevated levels of stabilized NIK, resulting in NF-κB-dependent pro-survival signalling. In this context, an enhancement in the auto-ubiquitination activity of cIAP2 by MAGEC2 would indeed promote cell survival. For example, in many multiple myeloma’s (MM) cell lines, the non-canonical NF-kB pathway is constitutively activated and is one of the key promotors of tumorigenesis (Keats et al, 2007). Amongst other mutations in key regulators of the NF-κB pathway, loss of function mutations in cIAP1/2 were identified in MM cell lines (Annunziata et

al, 2007) (Keats et al, 2007). Most interestingly, several studies have reported that MAGEC2 is constitutively expressed in MM, suggesting a potential role of MAGEC2 in the malignant phenotype of MM (Lajmi et al, 2015).

To continue the research, the MAGEC2-cIAP2 experiment should be repeated as mentioned and moreover, it might be interesting to study the effect of MAGEC2 on the remaining E3 ligases. To gain better insight in how MAGEC2 might affect the cellular functioning of a particular E3, we may also study substrate ubiquitination, in addition to auto-ubiquitination, and perform deubiquitination assays to determine respectively the specific substrate targeted by the MRL complex and the chain linkage type formed by the MRL complex.

2. Conclusion

This master dissertation aimed to study the potential role of MAGED1 as a component in the RING E3 ligase complex. Unfortunately, due to too high amounts of MAGED1-related contaminants, the recombinant MAGED1 preparation could not be used. It would therefore be important to repeat the planned experiments with another source of recombinant MAGED1. We did however find that MAGEC2 enhances the ubiquitin ligase activity of cIAP2. Although the experiment should be repeated, the potential regulatory function of MAGEC2 on cIAP2 is interesting, especially in light of the reported role of cIAP2 in NF-κB regulation in cancer cells. Type I MAGE proteins, including MAGEC2, are expressed in a wide-variety of cancers and can

drive tumorigenesis through various mechanisms. To our best knowledge, no study has yet reported the role of a MAGE2-cIAP2 complex as an underlying cause of tumorigenesis. The results of this master thesis open the door to further investigate the MAGEC2-cIAP2 interaction. Because it seems that, depending on the cellular context, cIAP2 may be able to act as a pro-survival or pro-apoptotic regulator, MAGEC2 could have both a positive as well as a negative effect on cell survival by modulating the ubiquitin ligase activity of cIAP2. Further studies are necessary to determine the physiological role of the MAGEC2-cIAP2 complex in the context of cancer.

Materials and methods

45

Materials and methods

Cloning

The appropriate destination vectors were linearized using specific restriction enzymes and the vectors backbones were purified after separation on an agarose gel using the QIAQuick gel Extraction Kit (Qiagen). Coding sequences of all different genes were amplified using appropriate primers (Addendum 2) containing additional overhanging sequences homologous to the destination vector. After purifying the PCR fragments using the PureLink®PCR purification

kit (Invitrogen), the coding sequences were cloned into the linearized vector using the CloneEZ® PCR Cloning Kit (Genscript). The resulting products were transformed into E. coli DH5α cells via heatshock and transformants were grown on Luria Bertani (LB) agarose plates containing ampicillin (LB + amp) overnight at 28°C. Fifteen colonies were subjected to a colony PCR to determine the presence of the coding sequences and positive plasmids were isolated and verified by performing appropriate control digests (see table) and further sequence verified.

Screen for best expression conditions

To test the best conditions for protein overexpression, BL21(DE3) E. coli cells were transformed

via heat-shock with bacterial expression vectors encoding the specific genes. Initial cultures were grown overnight at 28°C or 37°C until saturated. To induce protein expression during the exponential growth phase, the bacterial culture was first diluted 50x and cell division was monitored by measuring the bacterial density (OD600). Protein expression was induced using 0,5 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG) once the bacterial density reached 0.6 – 1.0. In addition, all cultures expressing the E3 ligases were supplemented with 100 µM ZnSO4 to allow optimal folding of the protein. The cultures were grown at 20°C, 28°C or 37°C following induction for 4h or 16h. To assess the expression in every condition, an equal amount of bacterial culture was harvested (4 OD600). The bacterial pellet was lysed in lysisbuffer (PBS + protease inhibitor), sonicated (time: 2 x 30”, pulse on: 2”, pulse off: 3”, amplitude: 36%) and the lysate was cleared by centrifugation. Both soluble and insoluble fractions were collected,

resuspended in 2x Laemmli buffer and analysed for protein expression using SDS-PAGE followed by Coomassie staining and immunoblotting. The optimal expression conditions were determined for every protein and these conditions were further used for the large-scale production for each of these proteins.

Materials and methods

46

Recombinant protein production + purification

For the large-scale production of the recombinant proteins, BL21(DE3) E. coli cells harboring the expression construct of interest were grown in large volumes (400 ml for the E3 ligase, 2 l for the MAGE proteins and protein expression was induced under the conditions that were previously determined. After centrifugation, bacterial pellets obtained from the culture were lysed in cooled lysis buffer (PBS + cOmplete protease inhibitor (Roche) + DNAse), sonicated (time: 2’, pulse on: 2”, pulse off: 3”, amplitude: 36%) and the lysate was cleared by centrifugation. MAGED1 and MAGEC2 were purified on a Glutathione Sepharose 4FF column. The following purification procedures were performed using the ÄKTA explorer 100 chromatography system. The glutathione sepharose 4FF column was equilibrated with 5

column volumes (CV) equilibration buffer (PBS, pH 7,4). The supernatant of the cell lysate was adjusted to pH 7,4 and the sample was filtrated using a 0.22 µm Millex-GV filter before it was applied to the column. The columns was washed with 5 CV equilibration buffer (PBS, pH 7,4) and eluted using 3 CV of elution buffer (50 mM Tris, 100 mM NaCl and 15 mM reduced Glutathione, pH 8.0). The purity of eluted proteins was analyzed by SDS-PAGE. The E3 ligases were purified by adding the supernatant to a 50% glutathione-beads suspension in binding buffer (20 mM Tris pH 7.4, 0.2 M NaCl, 1 mM DTT, 0.1 mM ZnSO4) and incubating overnight at 4°C while rotating. After washing 3 times with reaction buffer (50 mM Tris pH 8.0, 2 mM DTT, 0.5 mM MgCl2), the beads were resuspended in reaction buffer to obtain a 50% slurry. The protein concentration on the beads was estimated by comparing with known amounts of BSA on a coomassie stained gel.

Quickchange mutagenesis

Primers containing the desired mutation were designed (Addendum 2). The PELI2 gene was amplified using these mutations containing primers according to the PCR program. The PCR product was treated with DpnI enzyme (Promega, 10U/µl) and the sample was incubated for 1h at 37°C. Afterwards, DH5α cells were transformed with the sample via heat shock. Positive colonies were subjected to a control restricition digest and further sequence verified.

GST fusion-protein removal

To remove the GST-tag from the recombinant MAGE proteins, the MAGE elution fractions, obtained from the Glutathione Sepharose 4FF column were pooled and submitted to dialysis in cleavage buffer (50 mM Tris, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, pH 7.0). Protein concentration was determined before and after dialysis using a Bradford assay. Initially, the optimal conditions (protease concentration and incubation time) necessary for complete cleavage was determined on an analytical scale. And the samples were incubated at 4°C. 10 µg samples were taken after 4 hours and overnight incubation and were characterized by SDS-PAGE followed by coomassie staining.

Materials and methods

47

To remove the GST fusion protein, x units per 1 mg fusion protein of PreScission Protease was added to the MAGE elution fraction, obtained after purification of the supernatant on the Glutathione Sepharose 4FF column. The solution was incubated under conditions that were determined earlier in the analytical scale test. Afterwards, the digested samples were purified on Glutathione Sepharose 4B column for the removal of GST-tags and PreScission protease. The protein concentration of the flow through and elution fractions was determined via Bradford assay and the elution pools containing sufficient proteins were pooled. The presence of the protein of interest was assayed by immunoblotting.

In vitro ubiquitination assay

In vitro ubiquitination assays were performed using 100 nM Ube1, 2.5 μM E2 (His-UbcH2, His-UbcH5a or UbcH5b), 5 μM E3 (GST-TRIM28, GST-XIAP, GST-cIAP1 or GST-cIAP2), 5 μM ubiquitin, 5 mM MgCl2, 4mM ATP and 2 mM DTT. Reaction buffer was added until a total reaction volume of 20 µl was obtained. Negative control reactions (-ATP and –E3 ligase) were set up as described above except ATP was not added and the beads carrying the GST-E3 were replaced with empty beads and GST respectively. Reactions were stopped by the addition of 5x Laemmli buffer after incubation at 37°C for the indicated amount of time. The reaction products were run on SDS-page gels and subjected to immunoblotting.

References

48

References

Akira S, Akira S, Uematsu S, Uematsu S, Takeuchi O & Takeuchi O (2006) Pathogen recognition and innate immunity. Cell 124: 783–801 Available at: file://localhost/Users/massimo/Documents/Papers/2006/Akira/Cell 2006 Akira.pdf%5Cnhttp://www.sciencedirect.com/science/article/B6WSN-4JB9231-K/2/549166450ba2573bab834136fd799f09%5Cnhttp://www.ncbi.nlm.nih.gov/pubmed/16497588

Annunziata CM, Davis RE, Demchenko Y, Bellamy W, Gabrea A, Zhan F, Lenz G, Hanamura I, Wright G, Xiao W, Dave S, Hurt EM, Tan B, Zhao H, Stephens O, Santra M, Williams DR, Dang L, Barlogie B, Shaughnessy JD, et al (2007) Frequent Engagement of the Classical and Alternative NF-κB Pathways by Diverse Genetic Abnormalities in Multiple Myeloma. Cancer Cell 12: 115–130

Ayyoub M, Scarlata CM & Hamaï A (2014) Expression of MAGE-A3/6 in Primary Breast Cancer is Associated With Hormone Receptor Negative Status, High Histologic Grade, and Poor Survival. J. … Available at: http://pdfs.journals.lww.com/immunotherapy-journal/9000/00000/Expression_of_MAGE_A3_6_in_Primary_Breast_Cancer.99600.pdf%5Cnpapers3://publication/uuid/88720858-06DD-47ED-975A-797AC7CCDD29

Bai S & Wilson EM (2008) Epidermal Growth Factor-Dependent Phosphorylation and Ubiquitinylation of MAGE-11 Regulates Its Interaction with the Androgen Receptor. Mol. Cell. Biol. 28: 1947–1963 Available at: http://mcb.asm.org/cgi/doi/10.1128/MCB.01672-07

Barker PA & Salehi A (2002) The MAGE proteins: Emerging roles in cell cycle progression, apoptosis, and neurogenetic disease. J. Neurosci. Res. 67: 705–712

Bertrand MJM, Doiron K, Labbé K, Korneluk RG, Barker PA & Saleh M (2009) Cellular Inhibitors of Apoptosis cIAP1 and cIAP2 Are Required for Innate Immunity Signaling by the Pattern Recognition Receptors NOD1 and NOD2. Immunity 30: 789–801

Bertrand MJM, Lippens S, Staes A, Gilbert B, Roelandt R, de Medts J, Gevaert K, Declercq W & Vandenabeele P (2011) CIAP1/2 are direct E3 ligases conjugating diverse types of ubiquitin chains to receptor interacting proteins kinases 1 to 4 (RIP1-4). PLoS One 6:

Bertrand MJM, Milutinovic S, Dickson KM, Ho WC, Boudreault A, Durkin J, Gillard JW, Jaquith JB, Morris SJ & Barker PA (2008) cIAP1 and cIAP2 Facilitate Cancer Cell Survival by Functioning as E3 Ligases that Promote RIP1 Ubiquitination. Mol. Cell 30: 689–700

Bhatia N, Xiao TZ, Rosenthal KA, Siddiqui IA, Thiyagarajan S, Smart B, Meng Q, Zuleger CL, Mukhtar H, Kenney SC, Albertini MR & Jack Longley B (2013) MAGE-C2 Promotes Growth and Tumorigenicity of Melanoma Cells, Phosphorylation of KAP1, and DNA Damage Repair. J. Invest. Dermatol. 133: 759–767 Available at: http://linkinghub.elsevier.com/retrieve/pii/S0022202X15361455

Bochtler M, Ditzel L, Groll M, Hartmann C, Huber R, Stark H, Bourenkov G, Chari A, Bochtler M, Ditzel L, Groll M, Hartmann C, Huber R, Kish-Trier E, Hill CP, Ciechanover A, Finley D, Groll M, Ditzel L, Löwe J, et al (1999) The proteasome. Annu. Rev. Biophys. Biomol. Struct. 28: 295–317 Available at: http://www.ncbi.nlm.nih.gov/pubmed/10410804

Bosanac I, Wertz IE, Pan B, Yu C, Kusam S, Lam C, Phu L, Phung Q, Maurer B, Arnott D, Kirkpatrick DS, Dixit VM & Hymowitz SG (2010) Ubiquitin Binding to A20 ZnF4 Is Required for Modulation of NF-??B Signaling. Mol. Cell 40: 548–557

Cassidy SB & Driscoll DJ (2009) Prader-Willi syndrome. Eur. J. Hum. Genet. 17: 3–13 Available at:

References

49

http://dx.doi.org/10.1038/ejhg.2008.165

Chen I-T, Hsu P-H, Hsu W-C, Chen N-J & Tseng P-H (2015a) Polyubiquitination of Transforming Growth Factor β-activated Kinase 1 (TAK1) at Lysine 562 Residue Regulates TLR4-mediated JNK and p38 MAPK Activation. Sci. Rep. 5: 12300 Available at: http://www.nature.com/articles/srep12300

Chen Z, Sui J, Zhang F & Zhang C (2015b) Cullin family proteins and tumorigenesis: Genetic association and molecular mechanisms. J. Cancer 6: 233–242

Chen ZJ, Parent L & Maniatis T (1996) Site-Specific Phosphorylation of IκBα by a Novel Ubiquitination-Dependent Protein Kinase Activity. Cell 84: 853–862 Available at: http://linkinghub.elsevier.com/retrieve/pii/S0092867400810648

Chomez P, De Backer O, Bertrand M, De Plaen E, Boon T & Lucas S (2001) An overview of the MAGE gene family with the identification of all human members of the family. Cancer Res. 61: 5544–5551

Choudhary C, Kumar C, Gnad F, Nielsen ML, Rehman M, Walther TC, Olsen J V & Mann M (2009) Lysine acetylation targets protein complexes and co-regulates major cellular functions. Science 325: 834–40 Available at: http://www.ncbi.nlm.nih.gov/pubmed/19608861

Choudhary C, Weinert BT, Nishida Y, Verdin E & Mann M (2014) The growing landscape of lysine acetylation links metabolism and cell signalling. Nat. Rev. Mol. Cell Biol. 15: 536–550 Available at: http://dx.doi.org/10.1038/nrm3841%5Cnhttp://www.nature.com/doifinder/10.1038/nrm3841

Clague MJ, Heride C & Urb?? S (2015) The demographics of the ubiquitin system. Trends Cell Biol. 25: 417–426

Cohen P & Strickson S (2017) The role of hybrid ubiquitin chains in the MyD88 and other innate immune signalling pathways OPEN. Cell Death Differ.

Contreras-Gómez A, Sánchez-Mirón A, García-Camacho F, Molina-Grima E & Chisti Y (2014) Protein production using the baculovirus-insect cell expression system. Biotechnol. Prog. 30: 1–18

Cui D, Xiong X & Zhao Y (2016) Cullin-RING ligases in regulation of autophagy. Cell Div. 11: 8 Available at: http://celldiv.biomedcentral.com/articles/10.1186/s13008-016-0022-5

De A, Dainichi T, Rathinam CV & Ghosh S (2014) The deubiquitinase activity of A20 is dispensable for NF-κB signaling. EMBO Rep. 15: 775–83 Available at: http://www.ncbi.nlm.nih.gov/pubmed/24878851

Deshaies RJ & Joazeiro CAP (2009) RING Domain E3 Ubiquitin Ligases. Annu. Rev. Biochem. 78: 399–434 Available at: http://www.annualreviews.org/doi/10.1146/annurev.biochem.78.101807.093809

Deveraux QL, Takahashi R, Salvesen GS & Reed JC (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature 388: 300–304

Dikic I, Wakatsuki S & Walters KJ (2009) Ubiquitin-binding domains - from structures to functions. Nat. Rev. Mol. Cell Biol. 10: 659–671 Available at: http://dx.doi.org/10.1038/nrm2767

De Donato M, O. Peters S, Tanveer, Hussain, Rodulfo H, N. TB, E. BM & G. I khide (2017) Molecular evolution of type II MAGE genes from ancestral MAGED2 gene and their phylogenetic resolution of basal mammalian clades. Mamm. genome

Downward J (2001) The ins and outs of signalling. Nature 411: 759–62 Available at: http://dx.doi.org/10.1038/35081138

Doyle JM, Gao J, Wang J, Yang M & Potts PR (2010) MAGE-RING protein complexes comprise a family of E3

References

50

ubiquitin ligases. Mol. Cell 39: 963–974

Eletr ZM & Wilkinson KD (2014) Regulation of proteolysis by human deubiquitinating enzymes. Biochim. Biophys. Acta - Mol. Cell Res. 1843: 114–128

Elliott PR, Leske D, Hrdinka M, Bagola K, Fiil BK, McLaughlin SH, Wagstaff J, Volkmar N, Christianson JC, Kessler BM, Freund SM V, Komander D & Gyrd-Hansen M (2016) SPATA2 Links CYLD to LUBAC, Activates CYLD, and Controls LUBAC Signaling. Mol. Cell 63: 990–1005

Estornes Y & Bertrand MJM (2015) IAPs, regulators of innate immunity and inflammation. Semin. Cell Dev. Biol. 39: 106–114

Farajollahi S & Maas S (2010) Molecular diversity through RNA editing: a balancing act. Trends Genet. 26: 221–230

French M, Klosowiak J, Aslanian A, Reed S, Yates J & Hunter T (2017) Mechanism of Ubiquitin Chain Synthesis Employed by a HECT Ubiquitin Ligase. J. Biol. Chem.

Gack MU, Shin YC, Joo C-H, Urano T, Liang C, Sun L, Takeuchi O, Akira S, Chen Z, Inoue S & Jung JU (2007) TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG-I-mediated antiviral activity. Nature 446: 916–920 Available at: http://www.nature.com/doifinder/10.1038/nature05732

Haas AL, Warms J V., Hershko A & Rose IA (1982) Ubiquitin-activating enzyme. Mechanism and role in protein-ubiquitin conjugation. J. Biol. Chem. 257: 2543–2548

Hao YH, Doyle JM, Ramanathan S, Gomez TS, Jia D, Xu M, Chen ZJ, Billadeau DD, Rosen MK & Potts PR (2013) Regulation of WASH-dependent actin polymerization and protein trafficking by ubiquitination. Cell 152: 1051–1064

Harper JW & Bennett EJ (2016) Proteome complexity and the forces that drive proteome imbalance. Nature 537: 328–38 Available at: http://www.nature.com/doifinder/10.1038/nature19947%5Cnhttp://www.ncbi.nlm.nih.gov/pubmed/27629639

Hatakeyama S (2017) TRIM Family Proteins: Roles in Autophagy, Immunity, and Carcinogenesis. Trends Biochem. Sci. 42: 297–311

Healthcare GE (2009) Recombinant Protein Purification Handbook. Methods 41: 1–306 Available at: www.gehealthcare.com/protein-purification

Hitotsumatsu O, Ahmad RC, Tavares R, Wang M, Philpott D, Turer EE, Lee BL, Shiffin N, Advincula R, Malynn BA, Werts C & Ma A (2008) The Ubiquitin-Editing Enzyme A20 Restricts Nucleotide-Binding Oligomerization Domain Containing 2-Triggered Signals. Immunity 28: 381–390

Hrdinka M, Fiil BK, Zucca M, Leske D, Bagola K, Yabal M, Elliott PR, Damgaard RB, Komander D, Jost PJ & Gyrd-Hansen M (2016) CYLD Limits Lys63- and Met1-Linked Ubiquitin at Receptor Complexes to Regulate Innate Immune Signaling. Cell Rep. 14: 2846–2858

Hunter T (2007) The Age of Crosstalk: Phosphorylation, Ubiquitination, and Beyond. Mol. Cell 28: 730–738

Jordan BWM, Dinev D, LeMellay V, Troppmair J, Götz R, Wixler L, Sendtner M, Ludwig S & Rapp UR (2001) Neurotrophin Receptor-interacting Mage Homologue Is an Inducible Inhibitor of Apoptosis Protein-interacting Protein that Augments Cell Death. J. Biol. Chem. 276: 39985–39989

Jordan JD, Landau EM & Iyengar R (2000) Signaling networks: the origins of cellular multitasking. Cell 103: 193–200

References

51

Kanayama A, Seth RB, Sun L, Ea CK, Hong M, Shaito A, Chiu YH, Deng L & Chen ZJ (2004) TAB2 and TAB3 activate the NF-??B pathway through binding to polyubiquitin chains. Mol. Cell 15: 535–548

Kawai T & Akira S (2006) Innate immune recognition of viral infection. Nat. Immunol. 7: 131–137

Keats JJ, Fonseca R, Chesi M, Schop R, Baker A, Chng WJ, Van Wier S, Tiedemann R, Shi CX, Sebag M, Braggio E, Henry T, Zhu YX, Fogle H, Price-Troska T, Ahmann G, Mancini C, Brents LA, Kumar S, Greipp P, et al (2007) Promiscuous Mutations Activate the Noncanonical NF-??B Pathway in Multiple Myeloma. Cancer Cell 12: 131–144

Kendall SE, Battelli C, Irwin S, Mitchell JG, Glackin CA & Verdi JM (2005) NRAGE mediates p38 activation and neural progenitor apoptosis via the bone morphogenetic protein signaling cascade. Mol. Cell. Biol. 25: 7711–24 Available at: http://mcb.asm.org/content/25/17/7711

Khan KH (2013) Gene expression in mammalian cells and its applications. Adv. Pharm. Bull. 3: 257–263

Kim HC & Huibregtse JM (2009) Polyubiquitination by HECT E3s and the determinants of chain type specificity. Mol. Cell. Biol. 29: 3307–18 Available at: http://mcb.asm.org/content/29/12/3307.full

Kirisako T, Kamei K, Murata S, Kato M, Fukumoto H, Kanie M, Sano S, Tokunaga F, Tanaka K & Iwai K (2006) A ubiquitin ligase complex assembles linear polyubiquitin chains. EMBO J. 25: 4877–87 Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1618115&tool=pmcentrez&rendertype=abstract

Komander D (2009) The emerging complexity of protein ubiquitination. Biochem. Soc. Trans. 37: 937–53 Available at: http://www.ncbi.nlm.nih.gov/pubmed/19754430

Komander D, Reyes-Turcu F, Licchesi JDF, Odenwaelder P, Wilkinson KD & Barford D (2009) Molecular discrimination of structurally equivalent Lys 63-linked and linear polyubiquitin chains. EMBO Rep. 10: 466–473 Available at: http://embor.embopress.org/cgi/doi/10.1038/embor.2009.55

Lajmi N, Luetkens T, Yousef S, Templin J, Cao Y, Hildebrandt Y, Bartels K, Kröger N & Atanackovic D (2015) Cancer-testis antigen MAGEC2 promotes proliferation and resistance to apoptosis in Multiple Myeloma. Br. J. Haematol. 171: 752–762

Lee AK & Potts PR (2017) A Comprehensive Guide to the MAGE Family of Ubiquitin Ligases. J. Mol. Biol. 429: 1114–1142

Lee EG, Boone DL, Chai S, Libby SL, Chien M, Lodolce JP & Ma a (2000) Failure to regulate TNF-induced NF-kappaB and cell death responses in A20-deficient mice. Science 289: 2350–4 Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3582399&tool=pmcentrez&rendertype=abstract

Leznicki P & Kulathu Y (2017) Mechanisms of regulation and diversification of deubiquitylating enzyme function. J. Cell Sci.: 1–10

Listovsky T, Oren YS, Yudkovsky Y, Mahbubani HM, Weiss AM, Lebendiker M & Brandeis M (2004) Mammalian Cdh1/Fzr mediates its own degradation. EMBO J. 23: 1619–26 Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=391060&tool=pmcentrez&rendertype=abstract

Liu W, Cheng S, Asa SL & Ezzat S (2008) The melanoma-associated antigen A3 mediates fibronectin-controlled cancer progression and metastasis. Cancer Res. 68: 8104–8112

Mahoney DJ, Cheung HH, Mrad RL, Plenchette S, Simard C, Enwere E, Arora V, Mak TW, Lacasse EC, Waring J & Korneluk RG (2008) Both cIAP1 and cIAP2 regulate TNFalpha-mediated NF-kappaB activation. Proc. Natl.

References

52

Acad. Sci. U. S. A. 105: 11778–83 Available at: http://www.ncbi.nlm.nih.gov/pubmed/18697935%0Ahttp://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=PMC2575330

Mallery DL, Vandenberg CJ & Hiom K (2002) Activation of the E3 ligase function of the BRCA1/BARD1 complex by polyubiquitin chains. EMBO J. 21: 6755–6762

Mattanovich D, Branduardi P, Dato L, Gasser B, Sauer M & Porro D (2012) Recombinant protein production in yeasts. Methods Mol. Biol. 824: 329–358

Matzinger P (2002) The Danger Model: A Renewed Sense of Self. Science (80-. ). 296: 301–305 Available at: http://www.sciencemag.org/cgi/doi/10.1126/science.1071059

MM H & HB S (2017) Multifaceted roles of TRIM38 in innate immune and inflammatory responses. Cell. Mol. Immunol. 14: 331–338

Moynagh PN (2014) The roles of Pellino E3 ubiquitin ligases in immunity. Nat Rev Immunol 14: 122–131 Available at: http://dx.doi.org/10.1038/nri3599%5Cn10.1038/nri3599

Newman JA, Cooper CDO, Roos AK, Aitkenhead H, Oppermann UCT, Cho HJ, Osman R & Gileadi O (2016) Structures of two melanoma-associated antigens suggest allosteric regulation of effector binding. PLoS One 11:

Olsen J V & Mann M (2013) Status of large-scale analysis of post-translational modifications by mass spectrometry. Mol. Cell. Proteomics 12: 3444–52 Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3861698&tool=pmcentrez&rendertype=abstract

Onel M, Sumbul F, Liu J, Nussinov R. & Haliloglu T (2017) Cullin neddylation may allosterically tune polyubiquitin chain length and topology. Biochem. J. 474: 781–795

Pasparakis M & Vandenabeele P (2015) Necroptosis and its role in inflammation. Nature 517: 311–320 Available at: http://www.ncbi.nlm.nih.gov/pubmed/25592536

Pelzer C, Kassner I, Matentzoglu K, Singh RK, Wollscheid HP, Scheffner M, Schmidtke G & Groettrup M (2007) UBE1L2, a novel E1 enzyme specific for ubiquitin. J. Biol. Chem. 282: 23010–23014

Petroski MD & Deshaies RJ (2005) Function and regulation of cullin–RING ubiquitin ligases. Nat. Rev. Mol. Cell Biol. 6: 9–20 Available at: http://www.nature.com/doifinder/10.1038/nrm1547

Pickart CM (2001) Mechanisms Underlying Ubiquitination. Annu. Rev. Biochem. 70: 503–533 Available at: http://www.annualreviews.org/doi/10.1146/annurev.biochem.70.1.503

Pickart CM, Kasperek EM, Beal R & Kim A (1994) Substrate properties of site-specific mutant ubiquitin protein (G76a) reveal unexpected mechanistic features of ubiquitin-activating enzyme (E1). J. Biol. Chem. 269: 7115–7123

Pineda CT, Ramanathan S, Fon Tacer K, Weon JL, Potts MB, Ou YH, White MA & Potts PR (2015) Degradation of AMPK by a cancer-specific ubiquitin ligase. Cell 160: 715–728

Rieser E, Cordier SM & Walczak H (2013) Linear ubiquitination: A newly discovered regulator of cell signalling. Trends Biochem. Sci. 38: 94–102

Sahdev S, Khattar SK & Saini KS (2008) Production of active eukaryotic proteins through bacterial expression systems: A review of the existing biotechnology strategies. Mol. Cell. Biochem. 307: 249–264

References

53

Salehi a H, Roux PP, Kubu CJ, Zeindler C, Bhakar a, Tannis LL, Verdi JM & Barker P a (2000) NRAGE, a novel MAGE protein, interacts with the p75 neurotrophin receptor and facilitates nerve growth factor-dependent apoptosis. Neuron 27: 279–288

Sang M, Wang L, Ding C, Zhou X, Wang B, Wang L, Lian Y & Shan B (2011) Melanoma-associated antigen genes - An update. Cancer Lett. 302: 85–90

Sarikas A, Hartmann T & Pan Z-Q (2011) The cullin protein family. Genome Biol. 12: 220 Available at: http://genomebiology.biomedcentral.com/articles/10.1186/gb-2011-12-4-220

Sasaki A, Masuda Y, Iwai K, Ikeda K & Watanabe K (2002) A RING finger protein prajal regulates Dlx5-dependent transcription through its ubiquitin ligase activity for the Dlx/Msx-interacting MAGE/necdin family protein, Dlxin-1. J. Biol. Chem. 277: 22541–22546

Shembade N, Ma A & Harhaj EW (2010) Inhibition of NF- B Signaling by A20 Through Disruption of Ubiquitin Enzyme Complexes. Science (80-. ). 327: 1135–1139 Available at: http://www.sciencemag.org/cgi/doi/10.1126/science.1182364

Shi M, Deng W, Bi E, Mao K, Ji Y, Lin G, Wu X, Tao Z, Li Z, Cai X, Sun S, Xiang C & Sun B (2008) TRIM30α negatively regulates TLR-mediated NF-κB activation by targeting TAB2 and TAB3 for degradation. Nat. Immunol. 9: 369–377 Available at: http://www.nature.com/doifinder/10.1038/ni1577

Smith SM, Freeley M, Moynagh PN & Kelleher DP (2017) Differential modulation of Helicobacter pylori lipopolysaccharide-mediated TLR2 signaling by individual Pellino proteins. Helicobacter 22:

Srinivasula SM & Ashwell JD (2008) IAPs: What’s in a Name? Mol. Cell 30: 123–135

Swatek KN & Komander D (2016) Ubiquitin modifications. Cell Res. 26: 399–422 Available at: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=4822133&tool=pmcentrez&rendertype=abstract

Takeuchi O & Akira S (2010) Pattern Recognition Receptors and Inflammation. Cell 140: 805–820

Takiuchi T, Nakagawa T, Tamiya H, Fujita H, Sasaki Y, Saeki Y, Takeda H, Sawasaki T, Buchberger A, Kimura T & Iwai K (2014) Suppression of LUBAC-mediated linear ubiquitination by a specific interaction between LUBAC and the deubiquitinases CYLD and OTULIN. Genes to Cells 19: 254–272

Thompson MR, Kaminski JJ, Kurt-Jones EA & Fitzgerald KA (2011) Pattern Recognition Receptors and the Innate Immune Responde to Viral Infection. Viruses 3: 920–940

Tokgöz Z, Bohnsack RN & Haas AL (2006) Pleiotropic effects of ATP·Mg2+

binding in the catalytic cycle of ubiquitin-activating enzyme. J. Biol. Chem. 281: 14729–14737

Trempe JF (2011) Reading the ubiquitin postal code. Curr. Opin. Struct. Biol. 21: 792–801

Tseng P-H, Matsuzawa A, Zhang W, Mino T, Vignali DAA & Karin M (2010) Different modes of ubiquitination of the adaptor TRAF3 selectively activate the expression of type I interferons and proinflammatory cytokines. Nat. Immunol. 11: 70–75 Available at: http://www.nature.com/doifinder/10.1038/ni.1819

Uchil PD, Hinz a., Siegel S, Coenen-Stass a., Pertel T, Luban J & Mothes W (2012) TRIM protein mediated regulation of inflammatory and innate immune signaling and its association with antiretroviral activity. J. Virol. 87: 257–272

Verhelst K, Carpentier I, Kreike M, Meloni L, Verstrepen L, Kensche T, Dikic I & Beyaert R (2012) A20 inhibits LUBAC-mediated NF-κB activation by binding linear polyubiquitin chains via its zinc finger 7. EMBO J. 31:

References

54

3845–3855 Available at: http://emboj.embopress.org/cgi/doi/10.1038/emboj.2012.240

Wang C, Ivanov A, Chen L, Fredericks WJ, Seto E, Rauscher FJ & Chen J (2005) MDM2 interaction with nuclear corepressor KAP1 contributes to p53 inactivation. EMBO J. 24: 3279–3290 Available at: http://emboj.embopress.org/cgi/doi/10.1038/sj.emboj.7600791

Wang J, Song X, Guo C, Wang Y & Yin Y (2016) Establishment of MAGEC2-knockout cells and functional investigation of MAGEC2 in tumor cells. Cancer Sci. 107: 1888–1897

Wenzel DM, Lissounov A, Brzovic PS & Klevit RE (2011) UBCH7 reactivity profile reveals parkin and HHARI to be RING/HECT hybrids. Nature 474: 105–108 Available at: http://www.nature.com/doifinder/10.1038/nature09966

Weon JL & Potts PR (2015) The MAGE protein family and cancer. Curr. Opin. Cell Biol. 37: 1–8

van Wijk SJL & Timmers HTM (2010) The family of ubiquitin-conjugating enzymes (E2s): deciding between life and death of proteins. FASEB J. 24: 981–993 Available at: http://www.fasebj.org/cgi/doi/10.1096/fj.09-136259

Wu PY, Hanlon M, Eddins M, Tsui C, Rogers RS, Jensen JP, Matunis MJ, Weissman AM, Wolberger CP & Pickart CM (2003) A conserved catalytic residue in the ubiquitin-conjugating enzyme family. EMBO J. 22: 5241–5250

Wu Q, Qi S, Ma J, Chen F, Chen J, Li J, Zhang X, Xu Y, Pan Q & Wang R (2015) The Effect of NRAGE on cell cycle and apoptosis of human dental pulp cells and MDPC-23. Int. J. Clin. Exp. Med. 8: 10657–10667

Xianpeng Liu, Zhao B, Sun L, Bhuripanyo K, Wang Y, Bi Y, Davuluri R V., Duong DM, Nanavati D & Kiyokawab YH (2017) Orthogonal ubiquitin transfer identifies ubiquitination substrates under differential control by the two ubiquitin activating enzymes. Nat. Community 8:

Yang F, Zhou X, Miao X, Zhang T, Hang X, Tie R, Liu N, Tian F, Wang F & Yuan J (2014) MAGEC2, an epithelial-mesenchymal transition inducer, is associated with breast cancer metastasis. Breast Cancer Res. Treat. 145: 23–32

Zarnegar BJ, Wang Y, Mahoney DJ, Dempsey PW, Cheung HH, He J, Shiba T, Yang X, Yeh W-C, Mak TW, Korneluk RG & Cheng G (2008) Noncanonical NF-kappaB activation requires coordinated assembly of a regulatory complex of the adaptors cIAP1, cIAP2, TRAF2 and TRAF3 and the kinase NIK. Nat. Immunol. 9: 1371–8 Available at: http://www.nature.com.proxy.bib.uottawa.ca/ni/journal/v9/n12/full/ni.1676.html

Zheng N, Schulman BA, Song L, Miller JJ, Jeffrey PD, Wang P, Chu C, Koepp DM, Elledge SJ, Pagano M, Conaway RC, Conaway JW, Harper JW & Pavletich NP (2002) Structure of the Cul1–Rbx1–Skp1–F boxSkp2 SCF ubiquitin ligase complex. Nature 416: 703–709 Available at: http://www.nature.com/doifinder/10.1038/416703a

Addendum 1 - Protocols

55

Addendum 1: Protocols

1: Linearization of the pGEX-6P-2-GST- TANK vector

1. First, cleave with NotI as there are two BamHI restriction sites.

2. Then cleave with BamHI. BamHI normally functions in buffer E but buffer D also works so no

clean up step is necessary

50 µl reaction (2,5x 20 µl reactions)

NotI 5 - 10 µg Template DNA (3959 ng/µl)

2,52 µl

10 U/µl NotI enzyme (Promega)

2,5 µl

Buffer D (10x) (Promega)

10 µl

Acetylated BSA, 10μg/μl

0,5 µl

Ultrapure water

34,5 µl

Put 2h @ 37°C (Thermomixer)

BamHI 10 U/µl BamHI enzyme (Promega)

2,5 µl

2h @ 37°C (Thermomixer)

Vector DNA

50 µl

Phosphatase (1 U / µl)

10 µl

1h @ 37°C (Thermomixer)

Add 12 µl 6x loading buffer

Load everything on 1,2 % agarose gel

Stain with SYBR safe (1/10.000)

ISOLATE LINEARIZED VECTOR

Cut out the 4958 bp band

Put the gel fragment in a pre-weighted eppendorf

Use QIAquick Gel Extraction Kit

Elute DNA in 30 µl H20

Addendum 1 - Protocols

56

2: Amplification of the coding sequences for the different genes of interest

1. Mix the following components (50 µl reaction)

Composition PCR mix:

Component Amount (µl)

10 ng/µl template DNA 1

5x Phusion HF buffer 10

10 nM dNTP mix (Promega) 1.5

10 µM forward primer* 2.5

10 µM reverse primer* 2.5

2U/µl Phusion DNA polymerase 0.5

Ultra-pure water 32

* primers containing additional overhanging sequences homologous to the destination vector (see

Addendum 2)

PCR program:

98°C - 4 min

98°C - 45 sec

XX°C - 30 sec

72°C - 3 min

72°C - 4 min

12°C - ∞

2. Take 5 µl of the amplified PCR product and add 1 µl 6x loading buffer

3. Load on a 1.2% agarose gel

4. Stain the gel with ethidium bromide

29x

Addendum 1 - Protocols

57

3: Purification of the PCR products using the PureLink®PCR purification kit (Invitrogen)

Addendum 1 - Protocols

58

Addendum 1 - Protocols

59

4: CloneEZ recombination reaction

1. Mix the following components (20 µl reaction)

Component Amount (µl)

PCR product (100 ng) X

200 ng linearized vector X

10x CloneEZ buffer 2

CloneEZ enzyme 2

Ultra-pure water Up to 20

2. Incubate the reaction at room temperature for 30 min

3. Afterwards, incubate the reaction on ice for 5 min

Addendum 1 - Protocols

60

5: DNA transformation in E. coli

1. Take the competent cells (100 µl) out of -80°C and thaw on ice.

2. Add 50-100 ng plasmid to the bacteria. GENTLY mix by flicking the bottom of the tube with your

finger a few times.

3. Incubate the competent cells/DNA mixture on ice for 10 minutes.

4. Heat shock each transformation tube by placing the tube into a 37°C water bath for 5 minutes.

5. Put the tubes back on ice for 10 minutes.

6. From now on: work in a sterile way!

7. Add 900 µl LB medium (without antibiotic) to the bacteria and grow in a shaking incubator for 2

hours (time is dependent on the strain and plasmid).

8. Remove agar plates(containing the appropriate antibiotic) from storage at 4°C and let warm up

to room temperature.

9. Plate the bacteria at a high and low concentration onto agar plates containing the appropriate

antibiotic. This is the best chance to get single colonies.

10. Incubate plates at the appropriate temperature.

Addendum 1 - Protocols

61

6: Colony PCR

1. Pick 15 colonies.

2. Prepare a PCR mastermix (17x 20 µl PCR reaction/colony) and divide into PCR tubes.

Component 1x 20 µl reaction 17x 20 µl reaction

10x PCR buffer 2 µl 34 µl

50 mM MgCl2 0.6 µl 10.2 µl

10 mM dNTP mix (Promega) 0.4 µl 6.8 µl

10 µM forward primer 1 µl 17 µl

10 µM reverse primer 1 µl 17 µl

5U/µl Taq DNA Polymerase 0.5 µl 8.5 µl

Ultra-pure water 14.5 µl 238 µl

3. Pick colony, mix in PCR tube and ent on new (number labelled) agar plate containing the

appropriate antibiotic.

4. Incubate plates at the appropriate temperature.

PCR program:

98°C - 4 min

98°C - 45 sec

XX°C - 30 sec

72°C - 3 min

72°C - 4 min

12°C - ∞

5. Add 4 µl 6x loading buffer to the PCR reaction and load on a 1.2% agarose gel

29x

Addendum 1 - Protocols

62

7: Nucleospin® Plasmid Easypure (Miniprep)

1. Pellet cells into a micro centrifuge tube (5’-5000g) or (10’-3900 rpm)

2. Add 150 µl buffer A1 and vortex to resuspend cells completely

3. Add 250 µl buffer A2 and invert 5 times.

4. Incubate up to 2 minutes at room temperature to lyse cells

5. Add 350 µl buffer A3 and invert until lysate has turned colorless

6. Centrifuge for 3 minutes at full speed to pellet precipitate

7. Put a Nucleospin® Plasmid Easypure column into a collection tube

8. Load clear supernatant onto the spin column

9. Centrifuge for 30 seconds at 1000-2000g. Discard the flow-through and place the column back

into the collection tube.

10. Add 450 µl buffer AQ. Centrifuge for 1 min at full speed. Discard the flow-through.

11. Place the column in a 1.5 ml micro centrifuge tube and add 2 x 25 µl ultra-pure H2O.

12. Incubate for 1 minute at room temperature.

13. Centrifuge for 1 minute at full speed.

14. Measure the concentration.

Addendum 1 - Protocols

63

8: Quickchange mutagenesis

8.1: Quickchange reaction

Mix the following components for 50 µl reaction/sample:

10 ng/µl template DNA 1 µl

10x Pfu reaction buffer 5 µl

10 mM dNTP mix (Promega) 2 µl

10 µM Fw primer 2.5 µl

10 µM Rv primer 2.5 µl

2.5 U/µl PfuTurbo DNA polymerase 1.5 µl

Ultra-pure water 36 µl

PCR programme

95°C - 30 s

95°C - 30 s

55°C - 60 s

68°C - XX s

4°C - 120 s

XX: 1 min for 1000 bp

Add 6x loading buffer to 10 µl PCR product

Load 10 µl PCR product on 1.2 % agarose gel

Stain with ethidium bromide

Add 1 µl DpnI enzyme (Promega, 10U/µl) to 40 µl PCR product

Incubate the sample for 4h at 37°C

8.2: Bacterial transformation

Add 1 or 2 µl of the sample to competent DH5α E. coli cells and transform them via heat shock

(see DNA transformation in E.coli)

8.3: Control restriction digest on pDNA

8.4: Send in for sequencing

18x

Addendum 1 - Protocols

64

9: Screen to determine best expression conditions

Choose 2 transformed colonies and ent them in 10 ml LB + Amp (50 ml falcons)

Grow ON (see table) + measure OD600 of both precultures + select the best preculture

Diute this preculture 50x + grow until OD 0.6-11.0

Make slants of the best precultures (500 µl glycerol + 500 µl culture -20°C)

Grow like described in the table below +divide the culture between the different setups

Induce with IPTG + add control (no IPTG: check leaky expression) (IPTG 100 mM stock)

Collect samples: 4 OD (e.g. 4 ml of 1 OD) (KEEP ON ICE!)

Centrifuge (max. speed, 2’) and discard the supernatans (with pump)

Freeze pellet (-20°C) or work further with the pellet

Resuspend pellets in 300 µl cooled lysebuffer (=PBS + protease inhibitor)

Lysate the cells via sonication: (sonicate each sample 2x: not directly after each other!)

o Time: 30’’

o Pulser ON: 2’’

o Pulser OFF: 3’’

o Temperature: -

o Amplitude: 36%

Centrifuge (max. speed, 20’, 4°C)

Collect the supernatans in new eppendorfs

Resuspend the pellet in cooled 2x Laemlli (work in fumehood)

Calculate how many µll of the suspension you need for 0. 2 OD/ gel

Collect this volume in new eppendorfs and add 5x Laemmli buffer until 1x diluted (add first the

β-mercapto-ethanol to the 5x Laemmli buffer!)

Freeze the samples or cook the samples (95°C, 10’) and load them on gel

Check expression levels first on gel (coomassie staining) or via WB

Plasmid xxx

Preculture (2

transformants)

28°C / 10 ml 37°C / 10 ml

Culture OD 0.6-1.0 28°C / 150 ml 37°C / 150 ml

Induce with IPTG (+ ZnSO4) 20°C / 10 ml

0.5 mM IPTG

100 µM ZnSO4

28°C / 10 ml

0.5 mM IPTG

100 µM ZnSO4

37°C / 10 ml

0.5 mM IPTG

100 µM ZnSO4

Addendum 1 - Protocols

65

10: Purification of GST-PCS-hMageD1/C2 (E. coli BL21DE3): protocols

1. Cell disruption and clarification (WORK ON ICE!!)

Sample preparation:

- Bacterial cell pellet was resuspended in lysis buffer at 3 mL / g pellet and homogenized:

- E. coli cells were broken by sonication using following settings:

Time: 2 min.

Pulser ON:5 sec.

OFF 9 sec.

Temp. /

Amplitude: 36%

- Lysate was centrifuged for 60 min. at 38724 x g (18000 rpm) in SS-34 rotor at 4°C (Centrifuge: Sorvall RC-6Plus)

→ Supernatant was collected and pellet discarded

→ pH was adjusted to 7.4

- samples were filtrated using a 0.22 µm Millex-GV filter (Millipore; Cat. No SLGV033RS)

Buffers:

Lysis buffer: PBS

1 mg DNase I* (solid)/ 100 mL

Complete (EDTA-free)*: 1 tablet/50 mL

pH 7.4

* DNase I and complete were added to the lysis buffer just before use

PBS (Lonza; Cat. No BE15-512D)

DNase I (Roche; Cat. No 10 104 159 001)

Complete (Roche; Cat. No 11 873 580 001)

Remark: All buffers were 0.22 µm filtered.

Addendum 1 - Protocols

66

2. Glutathione Sepharose 4FF

Sample preparation:

- no extra sample preparation necessary

Buffers:

Equilibration buffer: PBS Elution buffer: 50 mM Tris

pH 7.4 100 mM NaCl

15 mM reduced Glutathione*

pH 8.0

Cleaning buffer 1: 6 M GuHCl Cleaning buffer 2: 70% EtOH

Storage buffer: 20% Ethanol

PBS (Lonza; Cat. No BE15-512D)

Tris (BioSolve; Cat. No 20092391)

NaCl (Merck; Cat. No 1.06404.5000)

Reduced Glutathione (Sigma; Cat. No G6013-5G)

GuHCl (Sigma; Cat. No G4505-500g)

EtOH (Merck; Cat. No 1.00983.1006)

Remark: - All buffers were 0.22 µm filtered.

- *Reduced Glutathione was added to the buffer just before use.

Equipment:

Äkta explorer 100 (GE Healthcare)

Path length UV flow cell: 10 mm

Column:

Glutathione Sepharose 4FF (GE Healthcare, Cat. No 17-5132-01, Lot. No 10222416)

Column: Tricorn 10/50

Column height: 5 cm

Column area: 0.785 cm2

Column volume (CV): 4 mL

Pmax resin: 0.3 Mpa

Chromatography conditions:

Equilibration: 4.5 CV Equilibration buffer: 2.0 cm/min

0.5 CV Equilibration buffer: 0.5 cm/min

Sample application: 0.5 cm/min

Wash out unbound sample: 3.5 CV Equilibration buffer: 0.5 cm/min

Addendum 1 - Protocols

67

1.5 CV Equilibration buffer: 1.0 cm/min

Elution: 3.0 CV Elution buffer: 1.0 cm/min → Fractionate

Cleaning: 10 CV Equilibration buffer: 1.0 cm/min

2 CV Cleaning buffer 1: 1.0 cm/min

10 CV Equilibration buffer: 1.0 cm/min

2 CV Cleaning buffer 2: 1.0 cm/min

10 CV Equilibration buffer: 1.0 cm/min

Storage: 5 CV 20% EtOH: 1.0 cm/min

Protein dosage: Bradford assay

Procedure:

- Protein samples were pre-diluted in sample-buffer (if necessary) (linear range of the assay for BSA is 0.2 to 0.9

mg/mL, whereas with IgG the linear range is 0.2 to 1.5 mg/mL)

- 795 µL UPW was put in a cuvette

- 5 µL (diluted) sample was added to the 795 µL UPW

- 200 µL ‘BioRad Protein assay’ (Cat. No 500-0006) was added to the UPW-sample

- Samples were homogenized and incubated at room temperature for at least 5 min. ( Absorbance increase over

time, however incubate the samples at room temperature for no more than 1h.)

- Absorbance at 595 nm was measured

- Protein concentration was calculated as follows: Conc. (mg/mL) = OD 595 nm x 0.01814 x DF

3. Cleavage and removal GST-tag

3.1 Buffer Exchange step to Cleavage buffer

Material

Glutathione Sepharose 4FF eluate

Buffers

Cleavage buffer: 50 mM Tris

150 mM NaCl

1 mM EDTA

1 mM DTT (1 M stock)

pH 7.0

Tris (BioSolve; Cat. No 20092391)

NaCl (Merck; Cat. No 1.06404.5000)

EDTA (Merck; Cat. No 20302.293)

DTT (Sigma; Cat. No Cat. No D-0632)

Remark: - Buffer was 0.22 µm filtered.

Addendum 1 - Protocols

68

Procedure

The membranes were hydrated by immersing the cassettes in dialysis buffer for at least 30 seconds. After hydration

of the membranes, the sample was injected to the cassette and the air was withdrawn. The samples were dialyzed

against 100x-extend cleavage buffer at 4°C (overnight). Buffer was refreshed and dialysis was continued for 4 hours.

After dialysis, the sample was recovered from the cassettes.

Equipment

Slide-A-Lyzer dialysis cassettes 3 - 12 mL MWCO 3.5 kD (Pierce, Cat. No 66110, Lot. No OO000428)

3.2 GST-cleavage and removal

Sample preparation

No extra sample preparation for the desalted sample

GST-cleavage

X U PreScission Protease was added per 100 µg protein:

After addition of PreScission Protease, sample was incubated at 4°C for X hours. Subsequently, the digested sample

was purified on Glutathione Sepharose 4B (gravity flow column purification).

GST removal

Column

Pre-packed column containing 2 mL of Glutathione Sepharose 4B (GE Healthcare; Cat. No 17-0757-01)

Capacity: > 5.0 mg horse liver glutathione S-transferase per mL drained gel

Remark: Chromatography was performed manually, based on gravity (on ice).

Buffers

- PBS pH 7.4 Cleavage buffer: 50 mM Tris

150 mM NaCl

- Elution buffer: 50 mM Tris 1 mM EDTA

100 mM NaCl 1 mM DTT (1 M stock)

10 mM Reduced Glutathione pH 7.0

pH 8.0

PBS (Cat. No BE15-512D)

Tris (Cat. No 20092391)

NaCl (Cat. No 1.06404.5000)

Reduced Glutathione (Sigma; Cat. No G6013-5G)

EDTA (Cat. No 20302.293)

Remark: - Buffer was 0.22 µm filtered.

Removal GST-tag and PreScission protease

Addendum 1 - Protocols

69

Remark: Sample was divided into 2 equal parts and sequentially loaded on Glutathione Sepharose 4B column.

- Matrix was washed with 20 mL PBS to remove the preservative

- Gel was equilibrated with 6 mL PBS (= 3 CV)

- Sample was repeatedly (3x) applied to the column* → Flow through was collected

- Column was washed with 20 mL PBS (= 10 CV) → Wash was collected in 2 mL fractions

- Elution was performed with 10 mL elution buffer (= 5 CV) → Elution was collected in 1 mL fractions

- Gel was equilibrated with 20 mL PBS → PBS was discarded

Addendum 1 - Protocols

70

11: In vitro ubiquitination assay

Produce and purify GST-tagged proteins

1. Grow 10 ml preculture of protein-containing bacteria (ON @28°C)

2. Add 400 ml LB + Amp, grow at XX°C until OD 0.6 (see screen for best expression conditions)

3. Add ZnSO4 (100 µM final concentration) and IPTG (0.5 mM final concentration)

4. Induce (see screen for best expression conditions)

5. Centrifuge 15’, 5000 g (large centrifuge tubes)

6. Work on ice!!

7. Resuspend in 15 ml cooled lysisbuffer + Compete, transfer to small centrifuge tubes

8. Incubate 10’ on ice

9. Sonicate:

- Amp: 36%

- Time set: 2’

- Pulse on: 2”

- Pulse off: 3”

10. Add 1% Triton + rotate 30’ at 4°C

11. Centrifuge 15’, 10000 rpm, 4°C

12. Store the supernatant or put on beads

Prepare the beads

1. Stock glutathione beads: 80% in ethanol

2. Add XX µl 80% beads in an Eppendorf

3. Centrifuge 1’, 3000 rpm, 4°C

4. Remove ethanol with protein tip

5. Wash 3x with 1 ml binding buffer

6. Add XX µl binding buffer to the beads, to obtain a 50% solution

Coat the beads with GST-tagged protein

1. You can coat 625 µl 50% beads with 15 ml lysate

2. Add 625 µ 50% glutathione beads to the 15 ml lysate tube

3. Rotate ON at 4°C

4. Centrifuge 1’, 1000 g, 4°C

5. Add 1 ml reaction buffer, resuspend the beads and transfer them into an eppendorf

6. Centrifuge 1’, 3000 rpm, 4°C

7. Wash another 2 times with reaction buffer

8. Remove the supernatant, estimate the volume of beads and add the same amount of reaction

buffer to make a 50% slurry store at 4°C

Determine protein concentration

1. Take 2 µl and 10 µl of the 50% slurry, add 1x Laemmli buffer up to 20 µl

2. Make a dilution series of BSA (100, 250, 500, 1000 ng in in 20 µl 1x Laemmli buffer)

Addendum 1 - Protocols

71

3. Boil the samples 5’ at 95°C

4. Load the samples on gel

5. Color the gels using coomassie

6. Determine relative concentrations of the GST-tagged purified proteins

Addendum 2 – List of primers

72

Addendum 2: List of primers

Table 4: List of primers used for amplification of target gene using PCR. FP: forward primer, RP: reverse primer.

Gene Sequence of primer Annealing temperature (°C)

hMAGED1

FP: 5’ AGGGGCCCCTGGGATCCATGGCTCAGAAAATGGA 3’ RP: 5’ TCAGTCAGTCACGATGCGGCCGCTCACTCAACCCAGAAGAAACC 3’

64.1 63.5

hMAGEC2 FP: 5’ TTCCAGGGGCCCCTGGGATCCATGCCTCCCGTTCCAG 3’ RP: 5’ TCAGTCAGTCACGATGCGGCCGCCTACTCAGAAAAGGAGACGTTGC 3’

63.0 63.5

hPELI1 FP: 5’ TTCCAGGGGCCCCTGGGATCCATGTTTTCCTGATCAAGAAAAT 3’ RP: 5’ TCAGTCAGTCACGATGCGGCCGCTTAGTCTAGAGGTCCTTGAAAAATAAGT 3’

61.1 61.1

hPELI2 FP: 5’ TTCCAGGGGCCCCTGGGATCCATGTTTTCCCCTGGCCA 3’ RP: 5’TCAGTCAGTCACGATGCGGCCGCTCAGTCAATTGGACCTTGGAA 3’

64.5 64.8

hPELI3 FP: 5’ TTCCAGGGGCCCCTGGGATCCATGGTGCTGGAAGGAAACC 3’ RP: 5’ TCAGTCAGTCACGATGCGGCCGCCTAATCCAGCGGGCCC 3’

64.3 64.8

hPJA1 FP: 5’ TTCCAGGGGCCCCTGGGATCCATGGGTCAGGAATCTAGCAAG 3’ RP: 5’ TCAGTCAGTCACGATGCGGCCGCTTAGAGTGGGGGAGGGAAC 3’

62.4 63.3

Table 5: List of primers used for sequencing.

Sequence of primer

pGEX fwd 5’ CGTATTGAAGCTATCCCACA 3’

pGEX rev 5’ AGTGCCACCTGACGTCTAAG 3’

hMAGED1 int 1 5’ GACATAGAGACCGACCCAGGT 3’

hMAGED1 int 2 5’ CCACTGCCACCTGATTGGCCA 3’

hPJA1 int 1 5’ TCAAAGAGTGCAGAGGAACC 3’

Addendum 3 – Construction of expression vectors

73

Addendum 3: Construction of expression vectors

MAGED1

Plasmid map

Colony PCR

Figure 28: Colony PCR MAGED1 (2381 bp). Fifteen colonies were subjected to a colony PCR using the primers hMAGED1 fwd and hMAGED1 rev (Figure 27) to determine the presence of the MAGED1 coding sequence in the pGEX-6P-2 vector. All colonies were found to contain the MAGED1 coding sequence.

Figure 27: Plasmid map of MAGED1. The ORF of MAGED1 was amplified by PCR from the pENTR3C-hMAGED1V2 + stop plasmid (pIB0491) using the primers hMAGED1 fwd and MAGED1 rev. The PCR-amplified fragment was cloned as a GST fusion-protein into the pGEX-6P-2 destination vector. To assess the insert direction of the MAGED1 coding sequence, a restriction digest was performed using the restriction enzymes EcoRV and BamHI. Insertion of the MAGED1 coding sequence in the right direction displays a restriction pattern of bands of lengths 3397 bp, 1796 bp, 1288 bp and 216 bp. pGEX fwd, pGEX rev, hMAGED1 int 1 and hMAGED1 int 2: the forward and reverse primer used for sequencing.

Addendum 3 – Construction of expression vectors

74

Restriction digest

Figure 29: Control digest MAGED1. Three colonies were subjected to a control digest using the restriction enzymes EcoRV and BamHI Rightly inserted coding sequences should display a restriction pattern of bands of lengths 3397 bp, 1796 bp, 1288 bp and 216 bp (Figure 27). Colony 15 displayed the right restriction pattern.

Addendum 3 – Construction of expression vectors

75

MAGEC2

Plasmid map

Colony PCR

Restriction digest

Figure 31: Colony PCR MAGEC2 (1166 bp). Twelve colonies were subjected to a colony PCR using the primers hMAGEC2 fwd and hMAGEC2 rev (Figure 30) to determine the presence of the coding sequence of MAGEC2 in the pGEX-6P-2 vector. All twelve colonies were found to contain the MAGEC2 coding sequence.

Figure 32: Control digest MAGEC2. Colonies 2, 6 and 10 were found to contain the coding sequence of MAGEC2. To assess whether the coding sequence was also inserted in the right direction into the pGEX-6P-2 expression vector, the colonies were subjected to a control digest using the restriction enzymes EcoRV and NotI. Rightly inserted coding sequences should display a restriction pattern of two bands of 3185 bp and 2925 bp (Figure 30). Colonies 2, 6 and 10 all displayed the right restriction pattern.

Figure 30: Plasmid map of MAGEC2. The pDONR221-MAGEC2 plasmid containing the ORF of MAGEC2 was purchased from DNASU (catalog nr: HsCD00041930) and the ORF was amplified by PCR using the primers hMAGEC2 fwd and MAGEC2 rev. The PCR-amplified fragment was cloned as a GST fusion-protein into the pGEX-6P-2 destination vector. To assess the insert direction of the MAGEC2 coding sequence, a restriction digest was performed using the restriction enzymes EcoRV and NotI. Insertion of the MAGEC2 coding sequence in the right direction displays a restriction pattern of bands of lengths 3185 bp and 2925 bp. pGEX seq fwd, pGEX seq rev: the forward and reverse primer used for sequencing.

Addendum 3 – Construction of expression vectors

76

PELI1

Plasmid map

Colony PCR

Restriction digest

Figure 34: Colony PCR PELI1 (1301 bp). Fifteen colonies were subjected to a colony PCR using the primers hPELI1 fwd and hPELI1 rev (Figure 33) to determine the presence of the coding sequence of PELI1 in the pGEX-6P-2 vector. All colonies, except for colony 8 and 14 were found to contain the PELI1 coding sequence.

Figure 35: Control digest PELI1. Colonies 2, 6 and 10 were found to contain the coding sequence of PELI1. To assess whether the coding sequence was also inserted in the right direction into the pGEX-6P-2 expression vector, the colonies were subjected to a control digest using the restriction enzymes EcoRV and NcoI. Rightly inserted coding sequences should display a restriction pattern of two bands of 3504 bp and 2714 bp (Figure 33). Colonies 6 and 10 displayed the right restriction pattern.

Figure 33: Plasmid map of PELI1. The pENTR223-PELI1 plasmid containing the ORF of hPELI1 was obtained from the Human ORFeome (v8.1) (LMBP number: ORF81092-D06, EMBL accession number: LT741194) and the ORF was amplified by PCR using the primers hPELI1 fwd and hPELI1 rev. The PCR-amplified fragment was cloned as a GST fusion-protein into the pGEX-6P-2 destination vector. To assess the insert direction of the PELI1 coding sequence in the pGEX-6P-2 vector, a restriction digest was performed using the restriction enzymes EcoRV and NcoI. Insertion of the PELI1 coding sequence in the right direction displays a restriction pattern of bands of lengths 3504 bp and 2714 bp. pGEX fwd and pGEX rev: the forward and reverse primer used for sequencing.

Addendum 3 – Construction of expression vectors

77

PELI2

Plasmid map

Colony PCR

Figure 37: Colony PCR PELI2 (1307 bp). Fifteen colonies were subjected to a colony PCR using the primers hPELI2 fwd and hPELI1 rev (Figure 36) to determine the presence of the coding sequence of PELI2 in the pGEX-6P-2 vector. All colonies, except for colony 7 and 9 were found to contain the PELI2 coding sequence.

Figure 36: Plasmid map of PELI2. The pENTR223-PELI2 plasmid containing the ORF of hPELI2 was obtained from the Human ORFeome (v8.1) (LMBp number: ORF81120-B12, EMBL accession number: LT743736) and the ORF was amplified by PCR using the primers hPELI2 fwd and hPELI2 rev. The PCR-amplified fragment was cloned as a GST fusion-protein into the pGEX-6P-2 destination vector. To assess the insert direction of the PELI2 coding sequence, a restriction digest was performed using the restriction enzyme EcoRV. Insertion of the PELI2 coding sequence in the right direction displays a restriction pattern of bands of lengths 4238 bp and 1986 bp. pGEX fwd and pGEX rev: the forward and reverse primer used for sequencing.

Addendum 3 – Construction of expression vectors

78

Restriction digest

Quickchange mutagenenis

Figure 38: Control digest PELI2. Colonies 1, 4 and 6 were found to contain the coding sequence of PELI2. To assess whether the coding sequence was also inserted in the right direction into the expression vector, the colonies were subjected to a control digest using the restriction enzyme EcoRV. Rightly inserted coding sequences should display a restriction pattern of two bands of 4238 bp and 1986 bp (Figure 36). Colonies 4 and 6 displayed the right restriction pattern.

Figure 39: Result Quickchange mutagenesis. Due to a point mutation (T > C), a missense mutation had occurred, resulting in an arginine residue at position 214 instead of a cysteine residue. Quickchange mutagenesis was performed to make a single point mutation (C > T).

Addendum 3 – Construction of expression vectors

79

PJA1

Plasmid map

Colony PCR

Restriction digest

Figure 41: Colony PCR PJA1 (1976 bp). Fifteen colonies were subjected to a colony PCR to determine the presence of the coding sequence of PJA1 in the pGEX-6P-2 vector. Colonies that were found to contain the PJA1 coding sequence are colonies 3, 5, 7 and 15.

Figure 42: Control digest PJA1. Colonies 3, 5 and 7 were found to contain the coding sequence of PELI3. To assess whether the coding sequence was also inserted in the right direction into the pGEX-6p-2 expression vector, the colonies were subjected to a control digest using the restriction enzymes EcoRV and NcoI. Rightly inserted coding sequences should display a restriction pattern of two bands of 4061 bp and 2832 bp (Figure 40). Colonies 3, 5 and 7 displayed the right restriction pattern.

Figure 40: Plasmid map PJA1. The pENTR223-PJA1 plasmid containing the ORF of hPJA1 was obtained from the Human ORFeome (v8.1) (LMBp number: ORF81013-E11, EMBL accession number: LT733872) and the ORF was amplified by PCR using the primers hPJA1 fwd and hPJA1 rev. The PCR-amplified fragment was cloned as a GST fusion-protein into the pGEX-6P-2 destination vector. To assess the insert direction of the PJA1 coding sequence, a restriction digest was performed using the restriction enzymes EcoRV and NcoI. Insertion of the PELI2 coding sequence in the right direction displays a restriction pattern of bands of lengths 4061 bp and 2832 bp. pGEX fwd and pGEX rev: the forward and reverse primer used for sequencing.

Addendum 4 – Determining the best expression conditions

80

Addendum 4: Determining the best expression conditions

cIAP1

Figure 43: Determining the best expression conditions for cIAP1. BL21(DE3) E. coli cells expressing the pGEX-4T-2-GST-cIAP1 bacterial expression vector were grown at 20°C, 28°C or 37°C after IPTG induction for 4h or 16h. 4 OD600 of each culture was harvested and the cells were lysed, sonicated and run on SDS-PAGE. The protein amount was assessed in the soluble (S) and non-soluble (SN) fraction of each condition by coomassie staining and immunoblotting (IB) for GST.

Addendum 4 – Determining the best expression conditions

81

cIAP2

Figure 44: Determining the best expression conditions for cIAP2. BL21(DE3) E. coli cells expressing the pGEX-4T-2-GST-cIAP2 bacterial expression vector were grown at 20°C, 28°C or 37°C after IPTG induction for 4h or 16h. 4 OD600 of each culture was harvested and the cells were lysed, sonicated and run on SDS-PAGE. The protein amount was assessed in the soluble (S) and non-soluble (SN) fraction of each condition by coomassie staining and immunoblotting (IB) for GST.

Addendum 4 – Determining the best expression conditions

82

MAGEC2

Figure 45: Determining the best expression conditions for MAGEC2. BL21(DE3) E. coli cells expressing the pGEX-6P-2-GST-MAGEC2 bacterial expression vector were grown at 20°C, 28°C or 37°C after IPTG induction for 4h or 16h. 4 OD600 of each culture was harvested and the cells were lysed, sonicated and run on SDS-PAGE. The protein amount was assessed in the soluble (S) and non-soluble (SN) fraction of each condition by coomassie staining and immunoblotting (IB) for GST.

Addendum 4 – Determining the best expression conditions

83

PELI1

Figure 46: Determining the best expression conditions for MAGEC2. BL21(DE3) E. coli cells expressing the pGEX-6P-2-GST-MAGEC2 bacterial expression vector were grown at 20°C, 28°C or 37°C after IPTG induction for 4h or 16h. 4 OD600 of each culture was harvested and the cells were lysed, sonicated and run on SDS-PAGE. The protein amount was assessed in the soluble (S) and non-soluble (SN) fraction of each condition by coomassie staining and immunoblotting (IB) for GST.

Addendum 4 – Determining the best expression conditions

84

PELI2

Figure 47: Determining the best expression conditions for PELI2. BL21(DE3) E. coli cells expressing the pGEX-6P-2-GST-PELI2 bacterial expression vector were grown at 20°C, 28°C or 37°C after IPTG induction for 4h or 16h. 4 OD600 of each culture was harvested and the cells were lysed, sonicated and run on SDS-PAGE. The protein amount was assessed in the soluble (S) and non-soluble (SN) fraction of each condition by coomassie staining and immunoblotting (IB) for GST.

Addendum 4 – Determining the best expression conditions

85

PJA1

Figure 48: Determining the best expression conditions for PJA1. BL21(DE3) E. coli cells expressing the pGEX-6P-2-GST-PJA1 bacterial expression vector were grown at 20°C, 28°C or 37°C after IPTG induction for 4h or 16h. 4 OD600 of each culture was harvested and the cells were lysed, sonicated and run on SDS-PAGE. The protein amount was assessed in the soluble (S) and non-soluble (SN) fraction of each condition by coomassie staining and immunoblotting (IB) for GST.

Addendum 5 – Determining the concentration of recombinant E3 ligase

86

Addendum 5: Determining the concentration of recombinant E3 ligase

cIAP1

cIAP2

Figure 49: Determination of the GST-cIAP1 concentration. Different amounts of glutathione beads coupled to GST-cIAP1 were loaded on gel, together with known amount of bovine serum albumin (BSA) on a Coomassie stained gel. The concentration of the GST-cIAP1 on the beads was determined by comparing the intensity of the GST-cIAP1 related bands with the BSA series.

Figure 50: Determination of the GST-cIAP2 concentration. Different amounts of glutathione beads coupled to GST-cIAP2 were loaded on gel, together with known amount of bovine serum albumin (BSA) on a Coomassie stained gel. The concentration of the GST-cIAP2 on the beads was determined by comparing the intensity of the GST-cIAP2 related bands with the BSA series.

Addendum 5 – Determining the concentration of recombinant E3 ligase

87

XIAP

Figure 51: Determination of the GST-XIAP concentration. Different amounts of glutathione beads coupled to GST-XIAP were loaded on gel, together with known amount of bovine serum albumin (BSA) on a Coomassie stained gel. The concentration of the GST-XIAP on the beads was determined by comparing the intensity of the GST-XIAP related bands with the BSA series.