characterization of pestalotiopsis microspora … · purification kit, (fermentas life sciences,...

436

CHARACTERIZATION OF PESTALOTIOPSIS

MICROSPORA, CAUSAL AGENT OF LEAF BLIGHT ON RUBBER

(HEVEA BRASILIENSIS) IN CAMEROON

Aurelie I. C. Nyaka Ngobisa1,2*

, P. A. Owona Ndongo2,

Oumar Doungous2, Godswill Ntsomboh-Ntsefong

2,3, S. W Njonje

2, and

E. E. Ehabe2

1Research officer & Plant pathologist,Regional Chief of Centre - Research and

Innovation for the Littoral, Douala – Cameroon

*E-mail: [email protected](Corresponding Author) 2Institute of Agricultural Research for Development (IRAD), Cameroon

3Department of Plant Biology, Faculty of Science, University of Yaounde I, Cameroon

Abstract

Rubber tree (Hevea brasiliensis) is the only commercial source of natural rubber

in Cameroon. Its cultivation can be severely limited by diseases A leaf blight disease was

observed on rubber trees affecting 80% of plants in smallholder's fields in South West

Cameroon. Symptomatic leaf samples were collected from infected plants and pathogens

isolated from them on agar media. Single spore isolates from resulting colonies were

identified as Pestalotiopsis microspora based on cultural and morphological

characterisation. Culture media, incubation temperature and pH affected mycelial

growth of P. microspora. Its inoculation on detached leaflets also revealed the

pathogenic capacity of this fungus; re-isolation based on its symptoms confirmed Koch’s

postulates. Morphological identification was confirmed by molecular sequence analysis

of the Internal Transcribed Spacer (ITS) region 1 and 2 including 5.8S rDNA (ITS-5.8S-

ITS2). The effects of some fungicides were tested in vitro on P. microspora mycelial

growth. Banko plus fungicide (Chlorothalonil 550g/l + Carbendazim 100g/l), Penncoz

(Mancozeb 800g/kg) and Metalm 72 WP (Cuprous oxide 600g/kg + Metalaxyl 120g/kg)

tested at different concentrations (100%, 75%, 50% and 25%) revealed inhibitory

activity against P. microspora in vitro. Among these fungicides, a marked efficiency of

chlorothalonil 550g/l was observed, though the inhibition of mycelial growth was more

effective with Cuprous oxide 600g/kg + Metalaxyl 120g/kg at rates: 100%, 75% and

50% only. This study revealed that P. microspora is the causative agent of new leaf

blight on rubber in the South West Region of Cameroon. This is the first report of leaf

blight caused by P. microspora on rubber in Cameroon.

Keywords: Pestalotiopsis microspora, Internal transcribed spacer, pathogenicity,

rubber, leaf blight.

INTRODUCTION

The Pará rubber tree (Hevea brasiliensis), most commonly known

as rubber tree, is a perennial plant, widely grown for its rubber-containing

latex and for wood. It is widely cultivated in South East Asia and West

and Central Africa, including the South West region of Cameroon

mailto:[email protected]

Characterization of pestalotiopsis microspora, causal agent of leaf blight on

437

(Owona Ndongo et al., 2010). Rubber tree contributes significantly to

the in come of thousands of smallholder farmers (Omorusi,

2012). Cameroon is ranked third in Africa and fourteenth in the world

among exporting countries of natural rubber in 2015 with 0.6% of the

total exports (Workman, 2016).

Rubber productivity is compromised by economically important

fungal diseases such as Corynespora leaf fall, Colletotricum leaf disease,

leaf spot diseases and red and white root diseases (Wastie, 1969; Senechal

and Gohet, 1986; Jayasinghe, 2011). Rubber is also the target for specific

parasitic plants belonging to the Loranthaceae family (Pinard, 1994).

Among them, leaf blight is becoming a serious canopy disease on rubber

trees in South West Cameroon. In the course of a disease survey

conducted in 2013, leaf blight was observed on some rubber trees in two

smallholder farms at Muyuka and Malende in the South West region of

Cameroon with disease incidence varying between 10 and 38%.

Rubber is a deciduous tree that loses its leaves in February-March,

in South west Cameroon Refoliation begins with the start of the rainy

season, which coincides with favourable conditions for the development

the pathogens. The young leaves attacked by the pathogen are injured.

They fall and are replaced by new leaves which in turn get infected and

fall off all along the epidemic duration. The disease begins with solitary

brown to greyish spots on the leaves, preferably in the leaf margins or

space between veins(>70%). These spots converge into one or several

necrotic patches. Minor symptoms appear showing yellowing of leaf

edges and thick brown spots (Fig.1). The first symptoms were noted in

early May, as small spots on the young leaf margin or leaf tips, usually

grey at the beginning, turning dark-brown at a later stage, with an oval or

irregular shape (0.1 to 0.5 cm) and a yellowish halo surrounding each

lesion. Between June and July, lesions expanded, merged and coalesced

to form leaf blight during the rainy season, causing necrosis of the entire

leaf tissue in severely infected plants. Leaf blight lesions which are

prominent on fully expended leaves resemble anthracnose

(Colletotrichum gloeosporiodes).

Despite its increasing significance, nothing is known about the

etiology of this emerging disease. The objective of the present study was

therefore, to identify the causal agent of leaf blight of rubber in

Cameroon, and thepossible chemical control method. To achieve this

objective, the pathogen was isolated from symptomatic tissues and

characterized morphologically and by DNA barcoding. Pathogenicity was

Proceedings of International Rubber Conference 2017

438

confirmed by satisfyingKoch’s postulates, associating the pathogen to the

observed symptoms. In vitro antifungal activity of some fungicides

against the mycelial growth of the pathogen was tested.

MATERIALS AND METHODS

Pathogen Isolation

Isolates were obtained from diseased leaves of rubber trees showing

typical symptoms of blight in two different fields at Muyuka and Malende

in the South West Region of Cameroon. Leafsamples were collectedfrom

infected treesin the field, placed in bags and transported to IRAD rubber

research laboratory in Ekona where they were processed the following

day for fungal isolation. Pieces of leaf tissue, ~5 mm2, were cut from the

edges of blight lesions, surface-disinfected by immersion in 0.1% sodium

hypochlorite (NAOCl) for 1 min, rinsed three times with sterile distilled

water and inoculated onto potato dextrose agar (PDA) plates. The plates

were incubated at 25 °C, under continuous and constant fluorescent

light according to Sanjay (2004). The putative pathogens were isolated as

single hyphae emerging from the disinfected leaf tissue. Isolates were

further purified by sub culturing from single conidia or hyphal tips and

preserved at 25 °C.

Six-day-old cultures were scraped, sealed in Petri dishes and kept

under continuous light to induce sporulation. After twelve days, 10 ml of

sterile distilled water were added on each of the Petri dishes, and slowly

swirled for three to five minutes. Conidia length and width were assessed

from a sample of fungal conidial suspension in 3mL sterile distilled water

and pipetted onto a microscope slide. The length and width of 30 conidia

and conidiophores per isolate were examined under a light microscope

with a micrometer at 40X magnification (Nikon Model Eclipse E200).

Molecular Studies

DNA Barcoding

Mycelia plugs of a 10-day-old culture of one isolate per farm,

proven to be virulent were used for DNA extraction. They were grown at

26 °C, transferred into Erlenmeyer flasks containing 50 mL Difco PBD

(24g/litre). The flasks were shaken at 80 rpm at room temperature (28 ±

2 °C) for 5 days by using an orbital shaker. The mycelia were filtered

through a layer of cheesecloth and washed twice with distilled water.


439

Dried mycelia (250 mg) were mechanically grounded to a fine powder in

liquid nitrogen by using a pre-chilled mortar and pestle, then transferred

to 1.5 ml micro centrifuge tube. DNA extraction was performed using

CTAB modified method described by Dole and Doyle (1987). A volume

of 5mL pre-heated extraction buffer (2% w/v CTAB, 100mM Tris-HCl

pH 8.0, 20mM EDTA pH 8.0, 1.4 M NaCl)and incubated at 65 °C for 1 h

with occasional swirling, followed by adding an equal volume of phenol:

chloroform: isoamyl alcohol (25:24:1). The tube was inverted gently and

centrifuged at 10,000 rpm for 10 min. The aqueous (upper) phase was

transferred into a fresh, sterile 1.5ml micro centrifuge tube. DNA was

precipitated by adding 0.6 volumes of cold isopropanol, then slowly

swirling the tube and incubated at -20 °C

for 1h. After centrifuging at

10,000 rpm for 10 min at 4 °C, the supernatant was decanted and the

DNA was washed with 70% ethanol and air dried at room temperature.

DNA pellet was dissolved in 50 µl sterile distilled water and stored at -20

°C. The concentration of the resulting DNA was determined using an ND-

1000 spectrophotometer (NanoDrop 2000; Thermo Scientific, USA).

Integrity of the extracted DNA was checked by gel electrophoresis with 2

% agarose gel under 1x TAE buffer (40mM Tris, 20mM acetic acid and

1mM EDTA) at 70 V for 45 min at room temperature (Sambrook et al.,

1989). The molecular weight of the extracted genomic DNA was

estimated by comparison with a 1kb DNA Ladder (0.25-10 kb) marker

(Fermentas). The original DNA was then diluted in sterile distilled water

to a concentration of 1 µg/µL and used for further observations.

Polymerase Chain Reaction Amplification

The oligonucleotide primers

ITS1(5′TCCGTAGGTGAACCTGCGG3′) and ITS4

(5′TCCTCCGCTTATTGATATGC3′) (White et al., 1990) were used to

amplify and sequence the internal transcribed spacer regions (ITS1 and

ITS2) as well as the complete 5.8S gene. To amplify each gene region,

polymerase chain reaction (PCR) mixtures consisting of the following

components were used: 1 µL of each primer (10 mM); 0.5 µL dNTPs (10

mM); 2 µL of MgCl2 (25 mM); 2.5 µL of 10 mM reaction buffer

containing MgCl2 (25 mM, Fermentas, USA); 0.5 U of Taq polymerase

(Vivantis, Shah Alam, USA); 5 µL of DNA; and 12.5 µL of sterile

distilled water. The following amplification conditions were used: for ITS

region, initial denaturation at 94 °C for 3 min; 35 cycles of denaturation at

94 °C for 1 min, annealing at 60 °C for 1 min, and extension at 72 °C for

2 min; and a final extension at 72 °C for 10 min.


440

DNA Sequencing and Analyses

PCR products were purified using Gene JETTM

Commercial PCR

Purification Kit, (Fermentas Life Sciences, Malaysia)and used for

sequencinq at First Base Laboratories Sdn. Bh, Selangor Malaysia. PCR

products (5 µL) form one representative isolate from each farm were run

on 2% agarose gels in a 1× TAE buffer solution (40 mM Tris, 20 mM

acetic acid, and 1 mM EDTA) at 80 V for 45 min at room temperature.

The gel was stained with ethidium bromide, and the bands were

visualized under UV light and photographed using a gel documentation

system (GeneSnap, ver 6.03, Syngene Laboratories). The size of the

amplified DNA fragment was determined using molecular weight

markers (GeneRuler 100 bp DNA Ladder and 1 kb DNA ladder marker

[Fermentas, USA]).

Sequences of isolates from this study and other species

of Pestalotiopsis retrieved from the GenBank were aligned using Clustal

W (Thompson et al., 1994) and manually adjusted as required.

Phylogenetic analysis was done using the maximum likelihood method, in

Jukes-Cantor model (Mega, version 5), with bootsrap of 1000 replicates

(Tamara et al., 2011). Pseudopestalotiopsis cocos was used as an

outgroup taxon. A sample was prepared and sent to the International

Collection of Microorganisms from Plants (ICMP) in New Zealand for

identification and conservation.

Pathogenicity Test

Following modified method by Ismail and Indran (1999), detached

leaflets of rubber (Hevea brasiliensis) clone GT1 at limp green stage were

floated on water in 15-cm-diameter Petri dishes. For inoculation, spore

suspensions of a morphologically identified representative isolate were

prepared from a 12-day-old culturegrown on PDA plate, and the

concentration was adjusted at 3 x 105

spores /ml using haemocytometer.

The leaflets were inoculated using micro-pipettes by placing droplets of

the spore suspension onto the abaxial side, and placed in humid condition

(20 °C), with 70% - 80% relative humidity under continuous fluorescent

light. Three replicates of leaves were used and control leaves were

inoculated with distilled water. Scoring of the intensity of necrotic lesion

size was carried out 20 days after application of treatments. The severity

of the infection was rated based on the size of the lesion. Scoring of the

intensity of necrotic lesions was done according to Manju et al. (1999)

following a five levels grading scale with 0 = leaves without lesion, 1 = 1-


441

25% lesion (light symptom), 2 = 25-50% lesion (moderate symptom), 3 =

50-75% lesion (severe symptom); 4 = 75-100% (very severe symptom).

Lesions were observed upon the appearance of the blight on the leaves

therefore confirming the Koch's postulate.

Fungicide Test

The fungal activity test consisted in measuring the mycelial growth

of P. microspora in the Petri dishes after every 24 hours until the

mycelium filled the dish. The PDA culture medium at pH 6 (Seutio et al.,

2016) was sterilized by autoclaving at 121 °C under a pressure of one bar

for 30 min. After allowing to cool, synthetic fungicides were incorporated

(Chlorothalonil 550 g/l + Carbendazim 100 g/l ,Mancozeb 800 g/kg and

Cuprous oxide 600g/kg+Metalaxyl 120g/kg) in different concentrations

(25, 50, 75 and 100%) and stirred with a magnetic stirrer. This was then

poured into Petri dishes (diameter 7 cm) under the hood in the presence of

a flame from a Bunsen burner.

The different concentrations were obtained by the following dilution

formula:

CiVi = CfVf ; the concentration was expressed as a percentage.

When the culture media were cooled and solidified, a 5 mm

diameter fragment from a 7-day old culture of P. microspora was

deposited in the center of each Petri dish in four replicates for each

concentration of fungicide. The incubation period after seeding was 6

days. The Petri dishes were incubated in an oven at 25 ° C. The control

was maintained under the same conditions without fungicides.

Statistical Analysis

The quantitative data obtained was subjected to an analysis of

variance (ANOVA) and the means were separated by the test of the least

significant difference of Student at 5%.


442

RESULTS AND DISCUSSION

Isolation and Purification

The symptoms of leaf blight are shown in Fig. 1 as initially

observed on rubber plants in the field. In order to identify the causal agent

of this blight, isolates were obtained from leaf samples collected from the

field.

Figure 1. Leaf blight symptoms of Pestalotiopsis microspora initially observed on

rubber in the field in South West Cameroon

The fungus collected from the field and cultured on the Petri dish

formed zonate and branched white cottony colonies with black acervuli

containing dark pigmented spores. Macroscopic observation of the culture

showed a fluffy appearance with a flat, large and circular shape.

The colour was whit for the first 5 days, becoming creamy white

after 8 days (Fig 2a). The microscopic analysis presented conidia as

fusoid, ellipsoid straight to slightly curved (20- 30 x 6.5 – 8.5 µm) with

four septa (Fig. 2b). Two to four hyaline filamentous apical appendages

(mostly three, 15.5- 26.5 µm) were attached to each apical cell hyaline

sub-cylindrical, thin-walled, and one 3 – 7 µm long hyaline appendage

attached to each basal cell. The length varied from 20.15 µm to 30 µm

and the width from 5.8 µm to 9.88 µm. Cells with single apical

appendages ranged from 2.7 to 6.9 µm. These two isolates had been

initially identified as belonging to Pestalotiopsis genus by morphological

observation of conidia (Maharachchikumbura et al, 2014).


443

Figure 2. Culture and conidia morphology of Pestalotiopsis microspora isolated from

rubber leaf: a. one-week-old culture on PDA with white cottony mycelia and

abundant fruit bodies in the centre; b. conidia with septa observed under the

light microscope.

DNA Study of the Isolates

DNA extraction and PCR were successfully performed for the

selected gene regions of each representative isolate from each farm. PCR

amplification for ITS-5.8S rDNA region was determined to be

approximately 542 bp in size (Fig. 3). BLAST search against the NCBI

(www.blast.ncbi.nlm.nih.gov) nucleotide database with ITS sequences of

the culture isolates from rubber confirmed that the isolates collected

represented species in the Amphisphaeriaceae family and showed that

isolates from rubber were closely (100%) related to Pestalotiopsis

microspora. The highest ITS-rDNA-scoring matches were with P.

microspora (AY924279.1) from bark of Terminalia arjuna (Tejesvi et

al., 2005) and to P. Microspora (DQ001010) of leaf lesion of Psidium

guayava (Keith et al., 2006) for ITS-rDNA sequences and their query

coverage were very close (99%). One isolate among the similar isolates

(PEC1) of Amphisphaeriaceae received the accession number KP455649,

and International Collection of Microorganisms from Plants (ICMP) in

New Zealand as ICMP 20841. In the phylogenetic analysis, PEC1 was

clustered in a distinct clade with those of P. microspora isolates retrieved

from the GenBank with 100% bootstrap value (Fig. 4). The results

confirmed the identity of fungus as P. microspora. Although ITS region

sequencing for species identification was informative on P.

microspora (Wu et al., 2009; Jean and Cheon, 2014; Marilia et al.,

2014), sequencing only one region is often insufficient for species level

(Hu et al., 2007), hence, in perspective, it is necessary to use at least two

genes for phylogeny for the GenBank Accession No KP45564 of isolate

PEC1 for better appreciation.


444

Figure 3. Gel electrophoresis showing amplification of ITs-5.8s rDNA fragments from

each representative isolate of Pestalotiopsis microspora from each farm, 1;

Muyuka and 2; Malende. Size of DNA ladder (M) used is 1kb (GeneRulerTM

,

Fermantas, Lithuania Malaysia). The amplification fragments were

approximately 542 bp

Figure 4. Phylogenetic tree constructed with the ITS-5.8S rDNA sequence of PEC1

isolate from this study (KP45549.1), and other species of Pestalotiopsis

microspora retrieved from GenBank. Pseudopestalotiopsis cocos was used as

the out group taxon. The bar indicates nucleotide substitutions per site.

Numbers of bootstrap support values ≥50% based on 1000 replicates

BPC88 Pestalotiopsis mangiferae (KM510410.1)

LK5 Pestalotiopsis virgatula (EU047945.1)

CLB5 Pestalotiopsis palmarum (GQ888738.1)

CGJ-4 Pestalotiopsis microspora (KT459350.1)

B-3 Pestalotiopsis microspora (KJ787111.1)

PEC 1 Pestalotiopsis microspora (KP455649.1)

UOM1 Pestalotiopsis clavispora isolate (JX091744.1)

xsd08078 Pestalotiopsis microspora strain (FJ478120.1)

CBS 272.29 Pseudopestalotiopsis cocos (KM199378.1)


445

Pathogenicity Test

Leaf blight symptoms were observed in all the inocolated leaves

(Fig. 5.), but not in control. The symptom of P. microspora was

manifested on the leaflets as brown circular spots becoming greyish, at

the areas where the inoculum was deposited before spreading gradually.

These spots converged into a necrotic range and causedyellowing of the

leaf.The pathogen was re-isolated and was found to be identical to the

original isolate. The result revealed that P.miscrospora was associated

with the disease.

Figure 5. Lesion development on rubber leaves inoculated with PECI isolate of P.

microspora. a: light symptom after 5 days of inoculation; b: Severe

symptom 10 days after inoculation; c:Very severe lesion 20 days after

inoculation

Fungicide Test

The fungicides Banko Plus (Chlorothalonil 550g/l + Carbendazim

100 g/l) and Penncoz (Mancozeb 800 g/kg) tested in vitro at different

concentrations (100%, 75%, 50% and 25%) effectively inhibited growth

of P. microspore. Inhibition of mycelial growth was effective with

OKMil (Cuprous oxide 600 g/kg + Metalaxyl 120 g/kg) at 100%, 75%

and 50% only.

ACKNOWLEDGEMENT

The authors would like to thank Dr Woin Noe, General Manager of

Institute of Agricultural Research of Cameroon, and Dr. Echu Kingsley,

Chief of S. W. Regional Research Centre, Ekona of IRAD Cameroon for

their support in this research.


446

REFERENCES

Doyle, J. J.& Doyle, J.L. 1987. A rapid DNA isolation procedure from

small quantities of fresh leaf tissues, Phytochem Bull., 19 : 11-15.

Elmsly, T.A.& Dixon, J. 2008. Growth rate of Ripe Rot Fungi at

Different temperatures. New Zealand Avocado growe's

Association.Annual Research report, 8 : 77-84.

Hu, H.L., Jeewon, R., Zhou, D.Q., Zhou, T.X. & Hyde, K.D. 2007.

Phylogenetic diversity of endopytic Pestalotiopsis species in

Pinusarmandii and Ribes spp: evidence from rDNA an ß-tubulin

gene phylogenies.Fungal Diversity, 24 : 1-22.

Ismail, H.& Indran,J. 1999. Occurrence and identification of

physiological Race of Corynespora cassicola of Hevea.

Proceedings of IRRDB symposium, 1999, Hainan, China pp.263-

272.

Jayasinghe, C.K. 2011. White Root Disease. The most devastating root

disease of the rubber tree. First Edition 2011, IRRDB, p. 24,

Kuala Lumpur.

Jean, Y.H.& Cheon, W. 2014. First Report of Leaf Blight of Japanese

yew caused by Pestalotiopsismicrospora in Korea. PlantDisease,

98 (5) : 691.1

Keith, L.M., Valasquez, M.E., Zee, F.T. 2006. Identification and

characterisation of Pestalotiopsis spp causing scab disease on

guava Psidium in Hawai. PlantDisease, 90 : 16-23.

Manju, M, Vinod J., Idicula, S.P., Kuruvilla, J.C., Nazeer,M.A.& Benagi,

V.I. 2010. Susceptibility of Hevea brasiliensis clones to

Crynespora Leaf Fall disease.Mycology Plant Pathology, 40(40):

603-609.

Marilia, L., Marcieli, P.B., Marlove, F.B.M., Ricardo, H., Lia, R.S.R.,&

Alvaro F dos santos . 2014. Identification and characterisation of

pathogenic Pestalotiopsis species to pecan tree in Brazil. Presq.

Agropec.bras., brasilia, 49 (6) :440-448.

Pinard, F. 1994. Rapport de mission au Cameroun. CIRAD-CP,

programme Hévéa.

Sambrook, J., Fritsch, E.F. & Maniatis, T. 1989. Molecular cloning: a

laboratory manual, 2nd ed.Cold Sprind Harbor Laboratory Press.


447

Sanjay, R. 2004. Studies on Pestalotiopsis spp affecting tea

(Camelliasiensis (L) O Kuntze in southern India. PhD thesis,

Bharathiar University, Coimbatore.

Sarvottam, D.J., Rsanjay, U.I.B.&MandalA. K. A. 2009.Molecular

characterisation of Pestalotiopsis spp. associated with tea

(Camelliasinensis) in southern India using RAPD and ISSR

markers. Indina journal of biotechnology, 8 :3777-3783.

Senechal. Y.& Gohet, E. 1986. Rapport technique, HEVECAM 1986, p.

147, Cameroun.

Tamura, K., Dudley, J., Nei, M. & Kumar, S. 2007. MEGA4: Molecular

Evolutionary Genetics Analysis (MEGA) software version 4.0.

Molecular Biology and Evolution, 24:1596-1599.

Tamura, K.,Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S.

2011. MEGAS: Molecular evolutionnary genetics analysis using

maximum likelihood evolutionary distance and maximum

parsimony methods. Mol bil Evol., 28:2731-2739.

Doi:10.1093/molbev/msr121

Tejesvi, M.V., Tamhankar, S.A., Kini, K.R., Prakash, H.S. Molecular

diversity of Pestalotiopsis spp: an endophyte of medicinal plants.

Thompson, J.D, Higgins, D. G. & Gibson, T.J. 1994. CLUSTAL W:

Improving the sensitivity of progressive multiple sequences

alignment through sequence weighting, position-specific gap

penalities and weight matrix choice. Nucl. Acids Res., 22:4673-

4680. doi:10.1093/nar/22.22.4673

Wastie, R. L. 1969. Planters Bulletin, 104,1969, p.199-205.

White, T.J., Bruns, T., Lee, S.& Taylor, J.1990. Amplification and direct

sequencing of fungal ribosomal RNA genes for phylogenetics. In:

PCR protocols: A Guide to methods and Applications, eds, by

M.A. Innis, D.H Gelfand, J.J. Sninsky & T.J. White, pp.315-322,

Academic Press Inc , New York , USA

Workman, D. 2016. Natural Rubber imports by Country. World's

top Exports.

http://www.worldstopexports.com/author/daniel/

characterization of pestalotiopsis microspora … · purification kit, (fermentas life sciences,...

Documents