INTRODUCTION

The integrity of the cardiac functions depends on the optimalheart-nervous system connections. The heart is innervated by theautonomic nervous system, classified into sympathetic andparasympathetic nervous systems. Despite the oppositefunctions of the two systems, to maintain homeostasis,sympathetic and parasympathetic systems play an optimal rolein regulating cardiovascular functions (1). Parasympatheticcardiac innervation provides an inhibitory impact by slowingdown the heart rate , the neural control of the arterial bloodpressure is the outcome of the activities of both systems on thecentral and peripheral levels (2). In contrast, sympatheticinnervation accelerates the ventricular contraction and increasesthe heart rate by influencing neurotransmitter norepinephrine.

Loss of catecholaminergic innervation of the cardiac tissuesresults in sympathetic neurodegeneration of the heart and isconsidered a cardiac dysautonomia mechanism (3). Interestingly,patients with Parkinson’s disease exhibit varying levels of cardiacdenervation. However, in Parkinson’s disease patients withintimately related cardiac dysautonomia and neurodegeneration,various symptoms characterize each component. Cardiacdysautonomia in Parkinson’s disease refers to cardiacneurodegeneration, orthostatic hypotension, fatigue, decreasedtime to peak heart rate variability, shortness of breath at regularexercise, and reduced blood catecholamines, especially plasmanorepinephrine (4, 5).

Several animal models of cardiac sympathetic dysautonomiaand neurodegeneration are available to study and validatetherapeutic targets for preclinical evaluation. MPTP (1-methyl-

JOURNAL OF PHYSIOLOGY AND PHARMACOLOGY 2021, 72, 1, 69-80www.jpp.krakow.pl | DOI: 10.26402/jpp.2021.1.07

S.N. AMIN1,2, A.S. KHASHABA3, N.S.A. LATIF4, W.B. EL GAZZAR1,5, U.K. HUSSEIN6,7,8

CITICOLINE IMPROVED CARDIOVASCULAR FUNCTION IN ANIMAL MODEL OF DYSAUTONOMIA

1Department of Basic Medical Sciences, Faculty of Medicine, Hashemite University, Zarqa, Jordan; 2Department of Medical Physiology, Faculty of Medicine, Cairo University; Cairo, Egypt;

3Department of Basic Sciences, Riyadh Elm University, Riyadh, Saudi Arabia; 4Department of Medical Pharmacology, Faculty of Medicine, Cairo University Cairo, Egypt;

5Department of Medical Biochemistry and Molecular Biology, Benha University, Bencha, Egypt; 6Department of Pathology, Jeonbuk National University Medical School, Jeonju, Republic of Korea;

7Research Institute of Clinical Medicine of Jeonbuk National University-Biomedical Research Institute of Jeonbuk NationalUniversity Hospital, Jeonju, Republic of Korea; 8Faculty of Science, Beni-Suef University, Beni-Suef, Egypt

The autonomic nervous system controls cardiovascular function. Autonomic dysfunction or dysautonomia is commonlyencountered in several diseases like Parkinson’s disease. 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) is achemical that changes into the neurotoxin MPP+, which causes catecholamine depletion. We aimed to study the effectsof citicoline on cardiovascular function in MPTP-treated albino rats. Twenty-four male albino rats were divided into fourgroups (6 rats/group): negative control received intraperitoneal (i.p.) saline injection for five consecutive days, a positivecontrol (Citicoline group) received citicoline (250 mg/kg) by oral gavage for consecutive 20 days, MPTP treated withMPTP-HCL (30 mg/kg, i.p.) for five consecutive days, MPTP + citicoline treated with MPTP-HCL (30 mg/kg, i.p.) forfive consecutive days followed by treatment with oral doses of citicoline (250 mg/kg) for 20 days. Cardiovascularfunctions evaluated through recording electrocardiogram (ECG), echocardiography, measuring arterial blood pressureand assessment of aortic rings vascular reactivity. Biochemical measurements on cardiac tissue for tyrosine hydroxylase,norepinephrine, glucose transporter 1 (GLUT1), insulin receptor substrate 1 (IRS1), peroxisome proliferator-activatedreceptor g co-activator-1 (PPAR-g co-activator-1) (PGC-1), phosphatase and tensin homolog-induced kinase 1 (PINK1),carnitine palmitoyltransferase I (CPT1), uncoupling protein 2 (UCP2) and adenosine monophosphate-activated proteinkinase alpha 2 (AMPKa2). Citicoline increased cardiac norepinephrine and tyrosine hydroxylase and improved markersrelated to ROS scavenger, mitochondrial permeability, calcium homeostasis on the cellular level, metabolic homeostasis,and mitochondrial biogenesis. We conclude that citicoline improved cardiovascular dysautonomia and that was reflectedon cardiac contractility, electrical activity, blood pressure, and vascular reactivity.

K e y w o r d s : citicoline, dysautonomia, heart, echocardiography, electrocardiogram, vascular reactivity, aortic ring,norepinephrine, mitochondrial permeability

4-phenyl-1,2,3,6-tetrahydropyridine) is a lipophilic neurotoxinwidely used in Parkinson’s disease nigral dopaminergic loss inmice (6) and monkeys (7). It has the ability not only to cross theblood-brain barriers affecting brain stem nuclie the sympatheticautonomic nuclei such as rostroventrolateral medulla (RVLM)and nucleus tractus solitarii (NTS) in the lower hindbrain,causing desensitization of baroreceptor reflex and impaired heartrate variability (8) but also induces loss of cardiac sympatheticinnervation (9). MPTP affects the heart and gut throughcatecholamine neuron degeneration and extends to chromaffincells of the adrenal medulla (10). Loss of cardiac sympatheticnerve induced by MPTP has been previously demonstrated inrats by a daily dose (20 mg/kg/5 days, i.p.) to yield 100% loss ofcardiac norepinephrine (11).

Citicoline or CDP-choline is a drug composed of a cytidine5’-diphosphate moiety and choline, after being absorbed it ishydrolyzed into cytidine 5’-diphosphate and choline, that cancross the blood-brain barrier. In the brain, these hydrolysisderived components recombined to form citicoline in the neuronsincreasing the brain content of phospholipids (12). Citicoline is asafe drug with negligible acute or chronic toxicity (13).

Previous studies introduced the neuroprotective effect ofcytidine-diphosphate-choline (CDP-choline or citicoline)against several neurological disorders like Alzheimer’s disease,ischemic stroke (14), spinal cord injury (15) and a recent studyshowed its protective effect in children after cardiac arrest (16).In the current study, we aimed to study the effects of citicolineon cardiovascular function in MPTP-treated albino rats as ananimal model for cardiovascular dysautonomia.

MATERIALS AND METHODS

Animal maintenance

Twenty-four male albino rats, initially weighing 150 – 200 g,were received from the Ophthalomolgy Research Institute (Giza,Egypt). We kept the rats in conventional animal service-basedhousing. The rats were accommodated to normal standardconditions (temperature 24 ± 1°C, relative humidity 40 – 60%, anda 12:12 h light/dark photoperiods). Moreover, they weremaintained in polycarbonated cages (3 rats/cage) to avoid isolationstress for one week before starting the experiment. The rats werekept under monitoring along the acclimatization period to excludeinfectious rats. The animals were provided with a standard basaldiet (El-Nasr Inc., Giza, Egypt) and water ad libitum.

The approval of animal procedures, Care, and Use ofLaboratory Animals was guided based on the Ethics and ScientificCommittee (Eighth edition 2011), Department of Physiology,Kasr Al Ainy, Faculty of Medicine, Cairo University, Egypt.

Experimental design for in vivo work

Pathogen-free twenty-four male albino rats were divided intofour groups (6 rats each). The first group was designated as anegative control (normal control) and received intraperitoneal(i.p.) saline injection for five consecutive days. The second groupwas a positive control group and received citicoline (Somazinadrops October Pharma, 6th of October city - Egypt Under Licenseof Ferrer International, SA, Spain) (250 mg/kg) by oral gavage forconsecutive 20 days based on a previous study (17). The third andfourth groups treated with MPTP-HCL (Sigma, St Louis, MO,USA) (30 mg/kg, i.p.) for five consecutive days based on previousstudies (18), followed by additional treatment with oral doses ofciticoline (250 mg/kg) for only the fourth group, which continuedfor 20 days. Food, water, and behavioral changes were monitoredperiodically, and the body weights were recorded weekly. At the

end of the study, all the rats were exposed to the cardiovascularsystem’s functional assessment before euthanasia.

In vivo functional assessment of the cardiovascular system

The functional measurements performed over two daysseparated by one day (to allow recovery). D1: Transthoracicechocardiography using ketamine and xylazine, D3: measuringblood pressure in conscious rats followed ECG under urethaneanesthesia.

1) Transthoracic echocardiography

The assessment was performed by using echocardiography toevaluate the cardiac functions in vivo. The rats were anesthetizedby injecting both ketamine-hydrochloride (25 mg/kg, bw, i.p.) andxylazine (5 mg/kg, bw, i.p.). Anesthesia was followed by removingthe hairs from the chest’s anterior part and maintaining the rats ona specialized warming table to maintain normothermia (19).

The echocardiography system was equipped with a 10 MHzphased-array transducer (GE Healthcare’s Vivid, USA). 2Dshort-axis view of the left ventricle and M-mode tracings wererecorded to measure ejection fraction (EF), fractional shortening(FS), left ventricular dimension in diastole (LVDd), leftventricular dimension in systole (LVSd), left ventricularposterior wall thickness during diastole (LVPWD), leftventricular posterior wall thickness during systole (LVPWS),stroke volume (SV) and heart rate (HR) were estimated. Cardiacoutput was calculated from SV and HR [CO = HR × SV]. Transmitral Doppler flows (ratios of E and A velocities) were recordedin an apical 4-chamber orientation with the sample volumeplaced at the tips of the mitral leaflet.

2) Measurement of the arterial systolic blood pressure

Blood pressure of animals were measured by non-invasiveblood pressure monitor (LE 5001 , LETICA scientific Instruments,Espania) from the tail of conscious rats by the tail-cuff technique.

The tail-cuff technique is a common, non-invasive andconvenient way to measure systolic blood pressure in an animalmodel. The pulsation disappears as the tail-cuff is inflated andrestart to pulsate when the tail-cuff is deflated, which equalssystolic pressure. The cuff is connected to a tail-cuffsphygmomanometer, and the blood pressure is recorded on achart (20).

The rats were conscious during measurement, warmed at 28°Cfor 30 min in a thermostatically controlled heating cabinet(UgoBasille, Italy) to detect tail artery pulse accurately. The tailwas passed from the heating cabinet through a miniaturized cuff,and a tail-cuff sensor was connected to an amplifier (ML125 NIBP,AD Instruments, Australia). The amplified pulse was recordedduring automatic inflation and deflation of the cuff. Systolic bloodpressure was defined as the cuff inflation pressure at whichwaveform become indistinguishable from baseline noise. Theaverage of at least three measurements was taken at each occasion.

3) Electrocardiogram recordings

Following the systolic blood pressure assessment, the ratswere anesthetized again with urethane (0.6 mL/100 gm, b.w.,intramuscular), and then the electrocardiogram was recorded.

In vitro tissue processing and studies

Following the heart’s functional assessment, the rats weresacrificed under ether anesthesia; the thoracic aorta was removedfor subsequent evaluation of vascular reactivity. The heart was

70

excised for biochemical measurements (cardiac tyrosinehydroxylase, norepinephrine, glucose transporter 1 (GLUT1),insulin receptor substrate 1 (IRS1), peroxisome proliferator-activated receptor g co-activator-1 (PPARg co-activator-1)(PGC-1), phosphatase and tensin homolog-induced kinase 1(PINK1), carnitine palmitoyltransferase I (CPT1), uncouplingprotein 2 (UCP2) and adenosine monophosphate-activatedprotein kinase alpha 2 (AMPKa2)).

Vascular reactivity studies of isolated aorta

The thoracic aorta was immediately excised and cut intosagittal rings 3 mm in length and transferred to organ chambersrinsed with 10 mL of freshly prepared Krebs-Heinseleit solution(NaCl 118 mM, KCl 4.7 mM, CaCl2 2.5 mM, MgSO4 1.2 mM,NaHCO3 25 mM, KH2PO4 1.2 mM, glucose 10 mM) maintained at37°C, pH 7.4 and incubated within 95% O2 and 5% CO2. Between

71

NORMAL RATS

MODEL

Fig. 1. Vascular reactivity studiesof isolated aorta. Thephenylephrine response curve (10,20 and 40 µg concentrations) onisolated rat ring was generatedfrom all the groups. Moreover, theresponse curve of isolated rat’saortic ring to cumulative doses ofacetylcholine on top of submaximaldose of 20 µg phenylephrine-induced contractions for everygroup.

every two hooks, the aorta’s rings were mounted, and the hooksattached to an isometric force transducer, which in turn connectedto the system of data acquisition (Power lab 8SP, AD Instruments)for consequence recording the tension of 1 gm for 1 h (21). Thephenylephrine response curve (10, 20 and 40 µg concentrations) onisolated rat ring was generated from all the groups. Moreover, theresponse curve of isolated rat’s aortic ring to cumulative doses ofacetylcholine can be calculated by the percentage of relaxation

induced by 20 µg acetylcholine divide by a submaximal dose of 20µg phenylephrine-induced contractions for every group (Fig. 1).

Quantitative-RT-PCR

During sacrificing, the hearts were excised and flourished withphosphate buffered-saline and cut into several pieces; part of thesecardiac pieces was rinsed in stabilizing reagent RNA later solution,

72

Fig. 2. Modulatory effect of citicolineon transcriptional levels of MPTP-treated cardiac tissue rats. Cardiactissues of MPTP-exposed rats showedsignificant (***P < 0.001) upregulationof UCP2 and AMPKa2, thensignificant (**P < 0.01) downregulationof GLUT1, IRS1, PGC1a, and PINK1were also observed when compared tothe normal control group. On the otherhand, citicoline administration toMPTP-treated rats was significantly(**P < 0.01) modulated to be close tonormal compared to MPTP controlrats. In contrast, the mRNA of CPT1expression was not different betweenthe studied groups. The data werepresented as mean ± SE.

and other pieces were freshly cleaned and then stored at –80°C forsubsequent processing. Total RNA extraction was performed fromhomogenized 25 mg of stored tissues using RNeasy Fibrous TissueMini Kit (Qiagen, Hilden, Germany). The RNA concentration wasdetermined using a UV spectrophotometer (Optima SP-3000+,Japan) at 260 and 280 nm. Reverse transcription was performed for1.5 µg of RNA using Miscript II RTPCR kit (Qiagen, Hilden,Germany) following the manufacturer’s instructions. A quantitativeRTPCR was performed with qPCR System (Life Technologies,Carlsbad, CA, USA) and QuantiTect SYBR Green Master Mix(Qiagen, Hilden, Germany). All the experiments were performed intriplicate, and the results were normalized to a b-actinhousekeeping gene. The sequences of used primers are listed inTable 1.

Fluorometric determination of norepinephrine in themyocardial tissue

The freshly stored cardiac pieces were weighed andhomogenized using a Teflon pestle homogenizer (ThomasScientific, Swedesboro, NJ, USA) in 10 volumes of 5% oftrichloroacetic acid. The homogenate was then centrifuged at

cooling 15000 rpm in a cooling centrifuge for 15 min. Thesupernatant was decanted in a chilled clean small tube forepinephrine analysis following the fluorometric methoddescribed previously using the Jenway 6200 fluorometer(Jenway Inc., Stone, UK) (22).

Tyrosine hydroxylase (HT) activity

The assay was performed by the simple fluorescence assaytechnique previously described (23). The dopa enzyme’s rapidisolation was carried out by a double column procedure (the topcolumn of Amberlite CG-50 and Aluminum oxide on the bottomcolumn). The Amberlite CG-50 column was used for erasing theinterfering substances, while the second column of aluminumoxide for dopa adsorbance. The dopa was then eluted using 0.5 Macetic acid and determined by the previously described hydroxyindole method (24).

Statistical analysis

The experiments were performed in triplicates. The datawere expressed by mean ± standard error (SE) and were

73

Gene Primer Sequence Product size

Accession number

AMPKα2 forward reverse

CGCCTCTAGTCCTCCATCAG ATGTCACACGCTTTGCTCTG

219 NM_006252.4

IRS1

forward reverse

TCCTATCCCGAAGAGGGTCT TGGGCATATAGCCATCATCA

103 NM_005544.3

SLC2A1 (GLUT1)

forward reverse

ATGTCCTATCTGAGCATCGT GTTGCTCCACATACTGGAAGC

193 NM_006516.4

PGC-1α forward reverse

CTACCGTTACACCTGTGACG AGTTGGTATCTAGGTCTGCA

140 NM_001330753.2

PINK1 forward reverse

TTGCCCCTAACACGAGGAAC ACGTGCTGACCCATGTTGAT

95 NM_032409.3

UCP2

forward reverse

ACAAGACCATTGCACGAGAG ATGAGGTTGGCTTTCAGGAG

142 NM_001381944.1

CPT1b

forward reverse

CACGGACAGGAGTGAACCC CTGTAGAGCATAGGGTGCCG

546 NM_004377.4

ACTB (β-actin) forward reverse

CTCGCCTTTGCCGATCC TCTCCATGTCGTCCCAGTTG

298 NM_001101.5

Weblink to accession numbers: https://www.ncbi.nlm.nih.gov/gene.

Table 1. Real-time qPCR primer sequences.

Control Citicoline MPTPMPTP +

CiticolineBaseline body weight Body weight at the end of the studyTyrosine hydroxylase activityNorepinephrine

MPTP group showed significant (P < 0.001) weight loss compared to the control group. Citicoline therapy to MPTP-treated ratsattenuated weight loss; however, it was not significantly effective compared to the MPTP group. Mitigation effect of citicoline onMPTP-treated cardiac tissues biochemical parameters: the tyrosine hydroxylase activity and norepinephrine were significantly (*P< 0.05) reduced in MPTP-treated rats’ cardiac tissues compared to the control. On the other hand, citicoline administration to MPTP-treated rats showed a significant (**P < 0.01) increase compared to MPTP-treated rats. The data were presented as mean ± SE.Body weight 1: at the start of the work; body weight 2: at the end of the work.

Table 2. Bodyweight and biochemical parameters of cardiac tissue in the studied groups.

statistically analyzed using GraphPad v.6.0.0 software(GraphPad, San Diego, USA). We checked normality ofdistribution by Shapiro-Wilk test. The data were analyzed usingtwo-way ANOVA and three-way ANOVA (post-hoc Tukey’stest) to compare the mean differences between the experimentalgroups.

RESULTS

Body wight

At the end of the work, MPTP group showed significant (P < 0.001) wight loss compared to control group. Citicoline

74

Fig. 3. Citicoline regulatory effect on echocardiography of MPTP-exposed rats. The presented data elucidated during the functional

assessment of the heart. There is a significant (**P < 0.01) reduction of ejection fraction, functional shortening, and E/A ratio in MPTP-treated rats (A, B) when compared to normal control. Administration of citicoline regulates and elevates these events to be close tonormal control compared to the MPTP-treated control group. The data were presented as mean ± SE.

therapy to MPTP-treated rats attenuated wight loss however itwas not significant effect compared to MPTP group (Table 2).

Modulatory effect of citicoline on biochemical parameters ofcardiac tissues

The represented data in Table 2 show that tyrosinehydroxylase and norepinephrine were significantly decreased inthe MPTP group compared with the normal control group. Theadministration of the MPTP-treated group with citicoline at theindicated dose showed a significant (P < 0.001) increased in theindicated markers to the normal group levels compared to thecorresponding MPTP control rats.

As represented in Fig. 1, there is a significant (P < 0.001)upregulation in the mRNA levels of UCP2 and AMPKa2 in theMPTP-treated group compared with the normal control group.On the other hand, the inoculation of MPTP-treated rats withciticoline with the indicated dose showed a significant (P < 0.001)downregulation of these markers to the levels near normal ratscompared to the corresponding MPTP control rats. Moreover, themRNA levels of GLUT1, IRS1, PGC1a, and PINK1 showed asignificant (P < 0.01) downregulation at the transcriptional levelin MPTP-treated rats when compared with the normal controlgroup. On the contrary, there is a significant (P < 0.01)upregulation of mRNA levels of the same markers in the MPTP-treated group with citicoline close to the normal control group’slevel compared to the corresponding MPTP control rats. ThemRNA relative CPT1 expression showed no significant changeamong the studied groups. These results are log to the normalizedexpression values against the beta actin gene.

Regulatory effect of citicoline on the echocardiographyrecordings

The data presented in Table 3 and Fig. 3 show the relevantechocardiography readings during the heart’s functionalassessment. There was a significant (*P < 0.01) reduction of EF,FS, E/A ratio, LVDd, LVPWD ,HR, SV and CO in MPTP-treatedrats when compared to normal control. Administration of

citicoline significantly (**P < 0.01) increased EF, FS, LVDd, HR,SV and CO compared to MPTP group. No significant differencewas found in LVSd and LVPWS between the studied groups.

Regulatory effect of citicoline on the electrocardiographyrecordings

The data presented in Table 4 and Fig. 4 showed a significant(P < 0.01) prolongation of P-wave duration and a decrease of Pamplitude in the MPTP treated group compared to thecorresponding normal control group. The inoculation of theMPTP-treated group with the indicated dose of citicolinesignificantly (P < 0.001) recovered the previous events byshortening the P-wave duration and increasing the P amplitudeclose to the normal group when compared to the MPTP-treatedgroup. The P-R interval and QRS complex showed no significantchanges among the studied groups. Despite the significant (P< 0.001) elevation in the height of the ST segment from theisoelectric baseline in MPTP-treated rats, there is a significant (P< 0.001) amelioration beyond the administration of citicoline tothe MPTP-treated rats with the indicated dose to be close to thenormal control group.

Ameliorative effect of citicoline on the arterial blood pressure

The presented data in Figure 5 showed a significant (P < 0.001) depletion of systolic, diastolic blood pressure, heartrate, and mean arterial blood pressure in the MPTP-exposed groupwhen compared with the normal control group. Interestingly,citicoline administration to the MPTP-exposed rats revealed asignificant (P < 0.001) increase of the parameters compared toMPTP and for the mean and diastolic blood pressures the valuesin citicoline + MPTP group were similar to the control group.

Impact of citicoline on vascular reactivity-based aortic ringscontractions

The vascular reactivity of the aortic rings’ contraction inresponse to various phenylephrine doses has been presented in

75

Control Citicoline MPTP MPTP +

Citicoline EF % 73.24 ± 1.09 79.46 ± 2.956 46.8 ± 1.4* 69.31 ± 1.5** FS % 36.12 ± 0.84 45.13 ± 2.12 20.08 ± 0.62* 34.54 ± 0.76** E/A ratio (%) 1.87 ± 0.095 0.485 ± 0.02 0.551 ± 0.045* 0.452 ± 0.028 LVSd (cm) 0.123 ± 0.002 0.14 ± 0.005 0.133 ± 0.0042 0.12 ± 0.008 LVDd (cm) 0.36 ± 0.003 0.433 ± 0.002 0.31 ± 0.002* 0.425 ± 0.0024** LVPWD (cm) 0.145 ± 0.003 0.14 ± 0.003 0.125 ± 0.004* 0.13 ± 0.0026 LVPWS (cm) 0.395 ± 0.18 0.145 ± 0.004 0.107 ± 0.0045 0.237 ± 0.133 HR (beat/min) 409.5 ± 0.34 390 ± 1.29 252.83 ± 0.65* 375 ± 1.29** SV (ml) 0.09 ± 0.002 0.13 ± 0.002 0.045 ± 0.0034* 0.165 ± 0.004** CO (ml/min) 36.8 ± 1.06 50.68 ± 0.84 11.38 ± 0.875* 61.86 ± 1.22**

F L

Citicoline regulatory effect on echocardiography of MPTP-exposed rats. There was a significant (*P < 0.01) reduction of EF, FS, E/Aratio, LVDd, LVPWD, HR, SV and CO in MPTP-treated rats when compared to normal control. Administration of citicolinesignificantly (**P < 0.01) increased EF, FS, LVDd, HR, SV and CO compared to MPTP group. No significant difference was foundin LVSd and LVPWS between the studied groups. The data were presented as mean ± SE.Abbreviations: EF, ejection fraction; FS, fractional shortening; LVDd, left ventricular internal diameter during diastole; LVSd, leftventricular internal diameter during systole; LVPWD, left ventricular posterior wall thickness during diastole; LVPWS, left ventricularposterior wall thickness during systole; IVSS, interventricular septal wall thickness during systole; IVSD, interventricular septal wallthickness during diastole; CO, cardiac output.

Table 3. Results of echocardiography in the studied groups.

Fig. 5. The results indicated a significant (P < 0.001) decrease inthe contraction force in the MPTP-treated group at doses 10, 20,and 40 µg of phenylephrine when compared to the normal controlgroup. On the other hand, there is a significant (P < 0.001)recovery of the contraction force of the aortic ring contraction atthe indicated doses of phenylephrine in the MPTP-treated groupwith citicoline near to normal levels of the control group. Thereis a significant elevation in the aortic rings’ contraction force in adose-dependent manner in all the studied groups.

DISCUSSION

The present study investigated the cardiovascular system’schemical and mechanical dysfunctions during the experimentalmodel of dysautonomia-induced rats using MPTP. Previousstudies used an experimental model of Parkinson’s disease by

using MPTP (25, 26). The main chemical dysfunction observedin the cardiovascular myocytes of MPTP-treated rats weredepletion of tyrosine hydroxylase activity, norepinephrinesecretion, decrease the relative mRNA transcription of GLUT1,IRS1, PPARg co-activator-1, PGC-1, PINK1. Furthermore, andincreased the relative mRNA transcription of uncoupling protein2 (UCP2) and adenosine monophosphate-activated protein kinasealpha 2 (AMPKa2). Moreover, the significant mechanicaldysfunctions recorded in cardiac myocytes of MPTP-treated ratswere reduced fractional cell shortening, prolongation of P-waveduration relaxation, and decreased velocities of both shorteningand re-lengthening. The administration of citicoline hasmodulated the above abnormalities.

The evidence of the anatomical studies suggested that thecardiovascular system’s sympathetic innervation is affected inneurodegenerative disorders, including synucleinopathies, whichdevelop Lewy body’s formation, and Parkinson’s disease (27).

76

Fig. 4. Citicoline regulatory effect on electrocardiography of MPTP-exposed rats. The data showed a significant (*P < 0.05)prolongation of P-wave duration and elevation of the ST segment (**P < 0.01) in the MPTP-treated group when compared to thecorresponding normal control. Citicoline administration to MPTP-treated group shows significant (**P < 0.01) recovery for the P-waveduration and ST-segment height. In comparison, the P-R and QRS intervals were not different between the studied groups. The datawere presented as mean ± SE.

Control Citicoline MPTP MPTP+Citicoline P duration (s) 0.0168 ± 0.0007 0.01706 ± 0.00039 0.03612 ± 0.001* 0.0196 ± 0.0009** P amplitude (mv) 0.0741 ± 0.00529 0.07295 ± 0.0018 –0.04642 ± 0.00160* 0.0398 ± 0.004** P-R interval (s) 0.0510 ± 0.0014 0.05183 ± 0.0017 0.0471 ± 0.0011 0.0467 ± 0.0029 QRS complex (s) 0.0154 ± 0.0007 0.0153 ± 0.0004 0.0160 ± 0.001 0.0154 ± 0.0007 ST height (mv) 0.0143 ± 0.0006 0.0142 ± 0.0006 0.2162 ± 0.0067** 0.0162 ± 0.0021**

Citicoline regulatory effect on electrocardiography of MPTP-exposed rats. The data showed a significant (*P < 0.05) prolongation ofP-wave duration and elevation of the ST segment (**P < 0.01) in the MPTP-treated group when compared to the corresponding normalcontrol. Citicoline administration to MPTP-treated group shows significant (**P < 0.01) recovery for the P-wave duration and ST-segment height. In comparison, the P-R and QRS intervals were not different between the studied groups. The data were presented asmean ± SE.

Table 4. Assessment of electrocardiography recordings.

77

Fig. 5. Ameliorative impact of citicoline on arterial blood pressure of MPTP-treated rats. The MPTP-exposed rats showed a significant(**P < 0.01) reduction of systolic, diastolic blood pressure, mean arterial blood pressure, and heart rate compared to the normal controlgroup. Contrary, citicoline administration to MPTP rats revealed a significant (**P < 0.01) recovery of mentioned events compared tothe MPTP-treated rats. The data were presented as mean ± SE.

Fig. 6. Regulatory effect of citicolineon aortic ring contraction of MPTP-treated rats. The contraction force ofaortic rings showed a significant (**P< 0.01) decrease in MPTP-exposedrats at the indicated doses ofphenylephrine compared to thenormal control group. On thecontrary, the citicoline administrationof MPTP-exposed rats showed asignificant (**P < 0.01) recovery closeto normal control rats. The data werepresented as mean ± SE.

The current study documented that the cardiac system’ssympathetic denervation occurred in MPTP-treated rats (28) andwas modulated upon administration of citicoline. Other previousstudies confirmed our results that shown depletion of cardiacnorepinephrine in MPTP-treated rats (29). Ren et al., studies (25)demonstrated that the number of b-adrenergic receptors is likelyto share the decreased adrenergic responsiveness and eventuallyimpair mechanical cardiac functions in MPTP-treated mice. Eventhough sympathetic denervation may lead to postsynapses’supersensitivity due to lack of neural uptake of norepinephrine,various denervation-based-supersensitivity models remaincontroversial. Besides, Amino et al., (30) demonstrated that thecardiac nerve fibers and terminals were morphologically wellpreserved in the MPTP-treated mice, despite cardiac sympatheticdysfunction indicated by the significant decreases in the contentsof cardiac noradrenaline and dopamine. Furthermore, MPTPfundamental impact focuses on its ability to cross the blood-brainbarrier after activation to MPP+, and this active form selectivelyenters the postganglionic sympathetic nerves through monoaminetransporter (9). The MPP+ eventually recruited in mitochondriaresulted in catecholamine neurodegeneration.

It is noteworthy that citicoline administration regulatedcardiac catecholamine levels near the normal control, matchedwith previous investigations (31). The tyrosine hydroxylaseactivity in the dopaminergic neurons has been reduced in MPTP-treated rats and then increased near to normal level uponciticoline administration. The critical effect of citicoline could bedue to the regulation of neuroinflammatory signaling.

Multiple studies reported that citicoline protects from heartdamage caused by ischemia/reperfusion processes by reducingmitochondrial permeability. The results indicated the regulationof oxidative phosphorylation and cis-aconitase mitochondrialenzyme, which results in avoidance of oxidative disruption ofmitochondrial DNA and the release of cytokines (32). Theprotective effect of citicoline upon the dopaminergic system hasbeen investigated previously based on its pharmacologicalactions (33).

The most dominant heart problems found in the currentresearch were decreased cardiac contraction and P waves’prolongation during the time of relaxation, associated with thereduced maximal velocity of contraction/relaxation in MPTP-treated rats. Moreover, depletion of systolic, diastolic bloodpressure, heart rate, and mean arterial blood pressure in MPTP-exposed rats were also observed. These results were confirmedby previous studies that reported that changes of heart ratevariability through electrocardiographic assessment inParkinson’s disease model was used MPTP (34, 35). Variousfactors may have disrupted the heart’s mechanical functions,including impaired functions of contractile proteins like actinand myosin isoforms, decreased availability of intracellular Ca2+

due to affected myofilament Ca2+ sensitivity, despite otheralternatives that may exist but remain to be unclear.

The electrocardiogram can also be used in isolatedLangendorff rat hearts, as demonstrated by Regev et al. (36) intheir study that evaluated the ventricular arrhythmia and theinterobserver agreement on ventricular fibrillation. Furthermore,Bernikova et al. (37) evaluated the electrical activity by EEG inreperfusion arrhythmogenesis and correlated it to the duration ofrepolarization using tetraethylammonium (TEA) that blocksoutward potassium currents and pinacidil that opens ATP-sensitive potassium channels.

The current study showed evidence of cardiac functiondysregulation using the MPTP-animal model. Upregulation ofmitochondrial protein; uncoupling protein 2 family observed inMPTP-treated rats due to excessive production of reactive oxygenspecies which activated UCP2 transcription to regulate andcontrol the excessive ROS production through negative feedback

(38). The function of AMPK in the heart is not cleared yet andbecome active during stress-induced hypertrophy. The presentinvestigation showed upregulation of the AMPKa2 transcriptionin the MPTP-treated group. Furthermore, the increasing ofAMPKa2 mediates the adiponectin’s antihypertrophic effects(39). The AMPK can also influence the metabolic activity of geneexpression. It plays a role in skeletal muscle exercise by increasingthe peroxisome proliferator activated-receptor g-coactivator-1a(PGC-1a) similar to what happened in our study; it was increasedto upregulate the transcription of PGC-1a and Glut1 to regulatethe mitochondrial oxidation pathways (40).

In the same perspective of observing metabolic andinflammatory markers in cardiovascular diseases Badacz et al. (41)showed in their study an association between proinflammatorycytokines, chemokines and the atherosclerotic plaque with internalcarotid artery stenosis.

Citicoline is involved in patients’ protection of memorydisorders against the excessive generation of oxidative stresses.In the present study, citicoline contributed to cardiac recoverywhen administered to MPTP-treated rats. The citicoline functionsimproved the mitochondrial dysfunctions and mitophagy byameliorating UCP2, AMPK-a2 transcriptions (42). Severalstudies introduced valuable evidence on citicoline’s protectiveeffect upon myocardial dysfunction during the rats’ heartreperfusion (25). Similarly, citicoline proved a protectivefunction against calcium retention through modulation of PGC-1a, which regulates the oxidative metabolism and biogenesis ofmitochondria for cardiac dysautonomia (43).

Additional studies demonstrated that citicoline aid in thesynthesis of phosphatidylcholine that is a vital structure of cellmembranes and mediators of cell signaling. Another likelymechanism of the protective effect of citicoline in the presentstudy is its action to block inflammation by inhibitingphospholipase A2. This enzyme is involved in the breakdown ofmembrane phospholipids into arachidonic acid. The oxidativemetabolism of arachidonic acid contributes to the generation ofneuroinflammation and reactive oxygen species (ROS). Byblocking phospholipase A2, citicoline may contribute to thereduction of inflammation, ROS formation, and neuronaldamage (44). Citicoline causes an increase in SIRT1 (silentinformation regulator 1, SIRT1). SIRT1 belongs to the histonedeacetylase family and regulates metabolic homeostasis andneuronal aging (45). In the cardiovascular system, activation ofSIRT1 can not only protect at the cellular level against oxidativestress, but also offer increased survival at the systemic level tolimit coronary heart disease and cerebrovascular disease (46).

The present study evaluated the effect of citicoline therapyon cardiovascular function and investigated some biochemicalmarkers’ levels. Citicoline improved cardiac contractility,electrical activity, blood pressure, and vascular reactivity.Citicoline also increased cardiac norepinephrine and tyrosinehydroxylase and improved markers related to ROS scavenger,mitochondrial permeability, calcium homeostasis on the cellularlevel, metabolic homeostasis, and mitochondrial biogenesis.Further studies are needed using electron microscopy andinvestigating other levels as post transcriptional or translationallevels required to validate the changes of the metabolic markers(UCP2, AMPKa2, GLUT1, IRS1, PGC1a, PINK1, and CPT1)through immunohistochemistry or Western blot analysis forbetter evaluation of the citicoline’s cellular and molecular effectson cardiovascular autonomic dysfunction.Availability of data: The data that support the findings of this

study are available from the corresponding author (S.N. Amin).

Acknowledgement: We would like to thank Dr. Ahmed OmarElkady (M.Sc. cardiology, Military medical academy, Egypt) forhis kind help in echocardiography.

78

Source of funding: No fund received for the present work.

Conflict of interests: None declared.

REFERENCES

1. Loewy AD, Spyer LK. Central Regulation of AutonomicFunctions. New York, Oxford University Press, 1990.

2. Higgins CB, Vatner SF, Braunwald E. Parasympatheticcontrol of the heart. Pharmacol Rev 1973; 25: 119-155.

3. Jain S, Goldstein DS. Cardiovascular dysautonomia inParkinsons disease: from pathophysiology to pathogenesis.Neurobiol Dis 2012; 46: 572-580.

4. Goldstein DS. Dysautonomia in Parkinson’s disease:neurocardiological abnormalities. Lancet Neurol 2003; 2:669-676.

5. Post KK, Singer C, Papapetropoulos S. Cardiac denervationand dysautonomia in Parkinson’s disease: a review ofscreening techniques. Parkinsonism Relat Disord 2008; 14:524-531.

6. Sundstrom E, Stromberg I, Tsutsumi T, Olson L, Jonsson G.Studies on the effect of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) on central catecholamineneurons in C57BL/6 mice. Comparison with three otherstrains of mice. Brain Res 1987; 405: 26-38.

7. Przedborski S, Jackson-Lewis V, et al. Unilateral MPTP-induced parkinsonism in monkeys. A quantitativeautoradiographic study of dopamine D1 and D2 receptorsand re-uptake sites. Neurochirurgie 1991; 37: 377-382.

8. Liu X, Wei B, Bi Q, et al. MPTP-induced impairment ofcardiovascular function. Neurotox Res 2020; 38: 27-37.

9. Fukumitsu N, Suzuki M, Fukuda T, Kiyono Y, Kajiyama S,Saji H. Reduced 125I-meta-iodobenzylguanidine uptakeand norepinephrine transporter density in the hearts of micewith MPTP-induced parkinsonism. Nucl Med Biol 2006; 33:37-42.

10. Natale G, Kastsiushenka O, Fulceri F, Ruggieri S, PaparelliA, Fornai F. MPTP-induced parkinsonism extends to asubclass of TH-positive neurons in the gut. Brain Res 2010;1355: 195-206.

11. Algeri S, Ambrosio S, Garofalo P, Gerli P. Peripheral effectsof 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)and its main metabolite 1-methyl-4-phenylpyridinium ion(MPP+) in the rat. Eur J Pharmacol 1987; 141: 309-312.

12. Sbardella D, Coletta A, Tundo GR, et al. Structural andfunctional evidence for citicoline binding and modulation of20S proteasome activity: novel insights into its pro-proteostatic effect. Biochem Pharmacol 2020; 177: 113977.doi: 10.1016/j.bcp.2020.113977

13. Grieb P. Beneficial effects of exogenous CDP-choline(citicoline) in EAE. Brain 2015; 138: e388. doi:10.1093/brain/awv140

14. Secades J, J, Dlvarez-Sabin J, Rubio F, Lozano R, DavalosA, Castillo J. Citicoline in intracerebral hemorrhage: adouble-blind, randomized, placebo-controlled, multi-centrepilot study. Cerebrovasc Dis 2006; 21: 380-385.

15. Turkkan A, Alkan T, Goren B, Kocaeli H, Akar E, Korfali E.Citicoline and postconditioning provides neuroprotection ina rat model of ischemic spinal cord injury. Acta Neurochir(Wien) 2010; 152: 1033-1042.

16. Salamah A, Mehrez M, Faheem A, El Amrousy D. Efficacyof citicoline as a neuroprotector in children with post cardiacarrest: a randomized controlled clinical trial. Eur J Pediatr2021; 180: 1249-1255.

17. Safavi M, Hosseini-Sharifabad A, Seyed-Yousefi Y, RabbaniM. Protective effects of citicoline and benfotiamine each

alone and in combination on streptozotocin-induced memoryimpairment in mice. Clin Psychopharmacol Neurosci 2020;18: 81-92.

18. Zhang Q, Heng Y, Mou Z, et al. Reassessment of subacuteMPTP-treated mice as animal model of Parkinson’s disease.Acta Pharmacol Sin 2017; 38: 1317-1328.

19. Watson CJ, Hunt F, Messer S, et al. In situ normothermicperfusion of livers in controlled circulatory death donationmay prevent ischemic cholangiopathy and improve graftsurvival. Am J Transplant 2019; 19: 1745-1758.

20. Wilde E, Aubdool AA, Thakore P, et al. Tail-cuff technique andits influence on central blood pressure in the mouse. J Am HeartAssoc 2017; 6: e005204. doi: 10.1161/JAHA.116.005204

21. Csanyi G, Lepran I, Flesch T, Telegdy G, Szabo G, Mezei Z.Lack of endothelium-derived hyperpolarizing factor (EDHF)up-regulation in endothelial dysfunction in aorta in diabeticrats. Pharmacol Rep 2007; 59: 447-455.

22. White CE. Fluorometric analysis. Anal Chem 1960; 32: 47-53.23. Nagatsu T, Oka K, Numata (Sudo) Y, Kato T. A simple and

sensitive fluorescence assay for tyrosine hydroxylaseactivity. Anal Biochem 1979; 93: 82-87.

24. Johansson B, Roos. B-E. 5-Hydroxyindole acetic acid andhomovanillic acid in cerebrospinal fluid of patients withneurological diseases. Eur Neurol 1974; 11: 37-45.

25. Ren J, Porter JE, Wold LE, Aberle NS, Muralikrishnan D,Haselton JR. Depressed contractile function and adrenergicresponsiveness of cardiac myocytes in an experimentalmodel of Parkinson disease, the MPTP-treated mouse.Neurobiol Aging 2004; 25: 131-138.

26. Rodriguez-Cruz A, Romo-Mancillas A, Mendiola-PrecomaJ, Escobar-Cabrera JE, Garcia-Alcocer G, Berumen LC.Effect of valerenic acid on neuroinflammation in a MPTP-induced mouse model of Parkinson’s disease. IBRO Rep2019; 8: 28-35.

27. Iwanaga K, Wakabayashi K, Yoshimoto M, et al. Lewybody-type degeneration in cardiac plexus in Parkinson’sand incidental Lewy body diseases. Neurology 1999; 52:1269-1271.

28. Takatsu H, Nishida H, Matsuo H, et al. Cardiac sympatheticdenervation from the early stage of Parkinson’s disease:clinical and experimental studies with radiolabeled MIBG.J Nucl Med 2000; 41: 71-77.

29. Amino T, Orimo S, Itoh Y, Takahashi A, Uchihara T,Mizusawa H. Profound cardiac sympathetic denervationoccurs in Parkinson disease. Brain Pathol 2005; 15: 29-34.

30. Amino T, Uchihara T, Tsunekawa H, et al. Myocardial nervefibers are preserved in MPTP-treated mice, despite cardiacsympathetic dysfunction. Neurosci Res 2008; 60: 314-318.

31. Przedborski S, Kostic V, Jackson-Lewis V, et al. Transgenicmice with increased Cu/Zn-superoxide dismutase activityare resistant toN-methyl-4-phenyl-1,2,3,6-tetrahydropyri-dineinducedneurotoxicity. J Neurosci 1992; 12: 1658-1667.

32. Hernandez-Esquivel L, Pavon N, Buelna-Chontal M,Gonzalez-Pacheco H, Belmont J, Chavez E. Citicoline (CDP-choline) protects myocardium from ischemia/reperfusioninjury via inhibiting mitochondrial permeability transition.Life Sci 2014; 96: 53-58.

33. Mao J, Liu S, Fu C. Citicoline retards myopia progressionfollowing form deprivation in guinea pigs. Exp Biol Med(Maywood) 2016; 241: 1258-1263.

34. Rahman F, Pechnik S, Gross D, Sewell L, Goldstein DS.Low frequency power of heart ratevariability reflectsbaroreflex function, not cardiac sympathetic innervation.Clin Auton Res 2011; 21: 133-141.

35. Valappil RA, Black JE, Broderick MJ, et al. Exploring theelectrocardiogram as a potential tool to screen for premotorParkinson’s disease. Mov Disord 2010; 25: 2296-2303.

79

36. Regev A, Takacs H, Farkas AS, et al. Application ofventricular tachyarrhythmia definitions of the updatedLambeth Conventions provides incompatibility with earlierresults, masks antifibrillatory activity and reduces inter-observer agreement. J Physiol Pharmacol 2019; 70: 37-49.

37. Bernikova OG, Sedova KA, Durkina AV, Azarov JE.Managing of ventricular reperfusion tachyarrhythmias -focus on a perfused myocardium. J Physiol Pharmacol2019; 70: 757-763.

38. Azzu V, Brand MD. The on-off switches of themitochondrial uncoupling proteins. Trends Biochem Sci2010; 35: 298-307.

39. Shibata R, Ouchi N, Ito M, et al. Adiponectin-mediatedmodulation of hypertrophic signals in the heart. Nat Med2004; 10: 1384-1389.

40. Reznick RM, Shulman GI. The role of AMP-activatedprotein kinase in mitochondrial biogenesis. J Physiol 2006;574: 33-39.

41. Badacz R, Podolec J, Przewlocki T, et al. The role ofchemokine CCL5/RANTES and metalloproteinase-9 asinflammatory modulators in symptomatic internal carotidartery stenosis. J Physiol Pharmacol 2019; 70: 545-555.

42. Synoradzki K, Grieb P. Citicoline: a superior form ofcholine? Nutrients 2019; 11: 1569. doi:10.3390/nu11071569

43. Yilmaz M, Coskun C, Yalcin M, Savci V. CDP-cholineprevents cardiac arrhythmias and lethality induced by

short-term myocardial ischemia-reperfusion injury in therat: involvement of central muscarinic cholinergicmechanisms. Naunyn-Schmiedeberg’s Arch Pharmacol2008; 378: 293-301.

44. Adibhatla RM, Hatcher JF. Citicoline decreasesphospholipase A2 stimulation and hydroxyl radicalgeneration in transient cerebral ischemia. J Neurosci Res2003; 73: 308-315.

45. Hurtado O, Hernandez-Jimenez M, Zarruk JG, et al. Citicoline(CDP-choline) increases Sirtuin1 expression concomitant toneuroprotection in experimental stroke. J Neurochem 2013;126: 819-826.

46. Chong ZZ, Wang S, Shang YC, Maiese K. Targetingcardiovascular disease with novel SIRT1 pathways. FutureCardiol 2012; 8: 89-100.

R e c e i v e d : January 17, 2021A c c e p t e d : February 26, 2021

Author’s address: Dr. Shaimaa Nasr Amin, Department ofBasic Medical Sciences, Faculty of Medicine, HashemiteUniversity, Zarqa, Jordan.E-mail: shaimaa599@yahoo.comORCID: 0000-0001-9232-2389

80