ClC-5 regulates dentin development through TGF-b1pathway

Xiaohong Duan a,1,*, Yong Mao b,1, Ting Yang a, Xuan Wen a, Huan Wang c, Jin Hou a,Yang Xue d, Rong Zhang e

aDepartment of Oral Biology, School of Stomatology, The Fourth Military Medical University, 145 Changle West Road,

Xi’an, Shaanxi 710032, ChinabDepartment of Prosthodontics, School of Stomatology, The Fourth Military Medical University, Xi’an, ChinacDepartment of Orthodontics, School of Stomatology, The Fourth Military Medical University, Xi’an, ChinadDepartment of Oral Surgery, School of Stomatology, The Fourth Military Medical University, Xi’an, ChinaeDepartment of Endodontics, School of Stomatology, The Fourth Military Medical University, Xi’an, China

a r c h i v e s o f o r a l b i o l o g y 5 4 ( 2 0 0 9 ) 1 1 1 8 – 1 1 2 4

a r t i c l e i n f o

Article history:

Accepted 26 September 2009

Keywords:

ClC-5

Dentin

Odontoblast

TGF-b1

Chloride channel

a b s t r a c t

ClC-5 is one of the voltage-dependent chloride channel (ClC) family members. Mutations

involving CLCN5 cause an X-linked nephropathy associated with Dent’s disease. Some

Clcn5 gene knockout (ClC-5 KO) mice have abnormal growth of the teeth; however, the

expression and function of ClC-5 during tooth development is still unknown. Herein we

report abnormal dentin structure, decreased DSPP and increased TGF-b1 protein level in

ClC-5 KO teeth. In odontoblast-like MDPC-23 cells, the mRNA levels of Tgfb1, Dspp and Dmp-

1 were upregulated with Clcn5 RNAi after 48 h treatment; whilst there was no change in

those of TGF-beta receptor Tgfbr1 and Tgfbr2. We suggest that the dentin changes in ClC-5

KO mice might be a result of increasing TGF-b1, and the interplay between ClC-5 and TGF-b1

needs further identified.

# 2009 Elsevier Ltd. All rights reserved.

avai lable at www.sc iencedi rec t .com

journal homepage: www.intl.elsevierhealth.com/journals/arob

1. Introduction

ClC-5 is one member of the ClC chloride channel family.1 The

CLCN5 gene mutates in Dent’s disease, an X-linked nephro-

pathy associated with low molecular weight proteinuria,

hypercalciura, nephrocalcinosis and nephrolithiasis.2,3

ClC-5 is predominantly expressed in the kidney,4 but ClC-5

is also present in the liver, brain, lung, testis, small intestine

and colon.2,5–7 In the studies by Wang et al.,8 an animal model

for Dent’s disease was developed by studying mice with

* Corresponding author. Tel.: +86 29 84776169; fax: +86 29 83223047.E-mail address: xhduan@fmmu.edu.cn (X. Duan).

1 These authors contributed equally to this paper.Abbreviations: ClCN5, Clcn5, chloride channel 5 gene; TGF-b1, tgfb

factor beta receptor; DSPP, Dspp, dentin sialophosphoprotein; DMP1, D1.0003–9969/$ – see front matter # 2009 Elsevier Ltd. All rights reservedoi:10.1016/j.archoralbio.2009.09.008

targeted inactivation of the corresponding murine gene, Clcn5.

The authors reported that a small number of mutant mice

‘‘had deformities of the dorsal spine and backward growth of

the teeth, but radiologic evidence for osteopenia or rickets was

absent’’8; the mechanism by which abnormal ClC-5 affected

tooth development was not elaborated on.

Chlorine is one of the abundant elements in teeth.

However, in contrast to enormous knowledge regarding

chloride channels in other organs, limited data pertaining to

chloride channel functions have been demonstrated in tooth

1, transforming growth factor, beta 1; Tgfbr, transforming growthmp1, dentin matrix acidic phosphoprotein 1, dentin matrix protein

d.

a r c h i v e s o f o r a l b i o l o g y 5 4 ( 2 0 0 9 ) 1 1 1 8 – 1 1 2 4 1119

development, with the exception of CFTR.9,10 Recently we

showed abundant ClC channels in tooth germ and odonto-

blast-like cells. Those chloride channels might regulate cell

proliferation and the cell cycle of odontoblast.11 In our

previous data, we also found the spatial and temporal

distribution of ClC-5 during rat tooth germ development.12,13

ClC-5 emerged in epithelial thickening stage, and mainly

located in ameloblasts and odontoblast during the bell stage,

and then disappeared in the late apposition stage.

To further explore the biological role of ClC-5 during tooth

development, herein we detected the morphological and

molecular characteristic of tooth germ and odontoblasts with

Clcn5 gene knockout (ClC-5 KO) mice and ClC-5 RNAi

technique. We tested the hypothesis that ClC-5 regulates

tooth growth, especially dentin formation, through the TGF-b1

pathway.

2. Materials and methods

2.1. Animals, cell lines and antibodies

Tooth germs samples of ClC-5 KO mice8 and wild-type C57BL/6

mice were kindly provided by Dr. Sandra E. Guggino from the

core store of Hopkins Digestive Disease Basic Research

Development Center (Johns Hopkins University, Baltimore,

MD, USA). Three litters of newborn wild-type C57BL/6 mice

from the Animal Center of the Fourth Military Medical

University (Xi’an, China) were used in the western analysis.

The animal studies were approved by the Animal Care and Use

Committee at the Fourth Military Medical University. The

mouse odontoblast-like cell line (MDPC-23) was provided by

Prof. C.T. Hanks and Dr. Jacques E. Nor at the University of

Michigan (MI, USA).

The antibodies used in this study were as follows: mouse

anti-TGF-b1 antibody (R&D Systems, Minneapolis, MN, USA);

monoclonal anti-b-actin antibody (A-5441; Sigma, St. Louis,

MO, USA), HRP-conjugated sheep anti-mouse antibodies

(Amersham Biosciences, Piscataway, NJ, USA); mouse anti-

DSPP antibody (provided by Dr. Rong Zhang in School of

Stomatology of the Fourth Military Medical University);

fluorescein (FITC) affini-pure donkey anti-mouse IgG (Jackson

ImmunoResearch, 715-095-1500); Hoechst 33342 (Sigma).

2.2. Histological studies

The appearance of incisors and molars were compared

between wild-type and gene knockout mice by general

observation among 20 adult ClC-5 KO/wild-type mice.

Three-day-old pups of the wild-type and knockout mice

were over-anaesthetized with halothane. The heads of the

mice were fixed in 4% paraformaldehyde in a 0.1 mol/L

phosphate buffer (pH 7.4). After fixation, the tissues were

processed by decalcification in 5% ethylene-diamine tetra-

acetic acid (EDTA; pH 7.4) for 5–10 days at 4 8C. The specimens

were dehydrated through a graded series of ethanol and

embedded in paraffin. Five mm sections were stained with H&E

and immunofluoresent staining. The ultrastructure of the

incisor samples from wild-type and ClC-5 KO mice were

compared with transmission electron microscopy (TEM,

200 kV, JEM2000, JEOL). Four pups of wild-type or ClC-5 KO

mice were respectively performed with HE staining and TEM

examinations. Genotyping was performed at the same time.

2.3. Western blot analysis

All the incisor and molar germs from three to four newborn

mice were dissected and collected as one group. There were

about 24–32 mixed incisors and molar germs in one group.

There were three ClC-5 KO groups and three wild-type groups

in each experiment. Dissected tooth germs from newborn

mice were collected at 4 8C in lysis buffer (1% NP-40, 0.5%

sodium deoxycholate and 0.1% sodium dodecyl sulphate [SDS]

in 0.01 mM phosphate-buffered saline [PBS]) containing

CompleteTM protease inhibitor (Roche Molecular Biochem-

icals, Mannheim, Germany). The protein samples were

separated on 12% SDS-polyacrylamide gel electrophoresis

(PAGE) and transferred to polyvinylidine difluoride (PVDF)

membranes (Bio-Rad). The western blot was performed with

mouse monoclonal anti-TGF-b1 antibody (1:50,000) and mouse

monoclonal anti-b-actin antibody (1:3000) respectively. The

secondary antibodies were HRP-conjugated sheep anti-mouse

antibodies (1:10,000). The blots were visualized using Western

Lightning Chemiluminescence Reagent Plus (Perkin Elmer Life

Sciences, Boston, MA, USA). Pixels on blots from three ClC-5

KO groups and three wild-type groups were measured using

Image J software (free from NIH website) for morphometric

analysis.

2.4. Immunofluoresent staining of tooth germ

In order to detect the protein level of DSPP and TGF-b1 in tooth

germ, 5 mm sections from tooth germs of wild-type and ClC-5

KO mice were stained with mouse anti-DSPP and mouse anti-

TGF-b1 antibody respectively, followed by staining with

fluorescein (FITC) affini-pure donkey anti-mouse IgG and

Hoechst 33342. A FluoView FV1000 confocal microscope was

used to capture pictures.

2.5. Clcn5 RNA interference

Mouse odontoblast-like cells (MDPC-23) were cultured in a-

MEM medium (Gibco, Grand Island, NY, USA) supplemented

with 10% fetal bovine serum (FBS) (Gibco), 2 mmol/L L-

glutamine, 50 mg/mL of vitamin C (Sigma), 100 IU/mL of

penicillin and 100 mg/mL of streptomycin in a humidified

atmosphere containing 5% CO2 in an incubator at 37 8C.11

The pENTR-Clcn5 27 was designed to target positions 27–47

of the complete mouse Clcn5 nucleotide sequence (Genbank

accession # NM_016691) with pENTRTM/U6 (Invitrogen), the

related short hairpin loop sequences were as follows:

NM_shrna_27_top CAC CGC TGT CAA GCC GTG TTC TAG ACG

AAT CTA GAA CAC GGC TTG ACA GC; and NM _shrna_27_-

bottom AAA AGC TGT CAA GCC GTG TTC TAG ATT CGT CTA

GAA CAC GGC TTG ACA GC. Another good construct pENTR-

Clcn5 2638 (targeting positions 2638–2658 of the complete

mouse Clcn5 nucleotide sequence, NM_016691) also showed a

similar reduction of Clcn5 mRNA level as pENTR-Clcn5 27.

Finally we chose pENTR-Clcn5 27 as the best RNAi construct in

this experiment. pENTR-LacZ was made as the RNAi control.

a r c h i v e s o f o r a l b i o l o g y 5 4 ( 2 0 0 9 ) 1 1 1 8 – 1 1 2 41120

The pENTR-Clcn5 27 was transfected into MDPC-23 cells with

Lipofectin 2000. The mRNA levels of Clcn5 and other genes were

detected by real-time PCR after a 48 h transfection.

2.6. Quantitative reverse-transcriptase/polymerasechain-reaction (RT-PCR)

Total RNAs of cells were isolated and a M-MLV reverse

transcriptase cDNA synthesis Kit (Takala) was used to synthe-

size cDNA. The primers for detecting Clcn5, Tgfb1, Tgfbr1,

Tgfbr2, Dspp, Dmp1 and Gapdh are shown in Table 1. Real-time

reverse-transcriptase-PCR (RT-PCR) analyses were performed

with SBrilliant1 SYBR1 Green QPCR Master Mix (Takala)

according to the company’s suggested procedures. PCR condi-

Fig. 1 – Histologic characters of Clcn5 gene knockout (ClC-5 KO)

and ClC-5 KO mice (b). In ClC-5 KO mice, dentin is irregularly arr

and dentin (D) is not clear. In some aberrant areas, odontoblast

from dentin. Bars = 100 mm. (B) TEM ultrastructure of dentin of in

dentin tubes are evenly arranged in wild-type mice, whilst in th

and arranged. Bars = 1 mm in (a) and (b); bars = 200 nm in (c) an

tions were performed as the suggestions in ABI 7500 real-time

PCR system. The melting temperature of the PCR product was

checked at the end of each PCR by recording the increase in

SYBR green fluorescence upon slowly renaturing DNA. For each

assay, standard curves were prepared by serial fold dilutions of

cell cDNA, and primer efficiencies were calculated. The relative

gene fold expression was compared between the control group

and the Clcn5 RNAi group. Each group contained four parallel

wells and the experiments were repeated for three times.

2.7. Statistical analysis

The data are expressed as the mean � SD. Comparisons

between Clcn5 knockout and wild-type mice were assessed

mice. (A) HE staining of P3 incisors from wild-type mice (a)

anged, and the boundary structure between predentin (PD)

s (O) show degeneration and enamel (E) is easily removed

cisor in wild-type (a and c) and ClC-5 KO mice (b and d). The

e ClC-5 KO group, the dentin tubes are irregularly enlarged

d (d).

Fig. 2 – Increased TGF-b1 expression in tooth germs of ClC-

5 KO mice. Western blot results of b-actin (upper) and TGF-

b1 (lower). In ClC-5 KO mice, the TGF-b1 protein level was

increased 1.65-fold (P < 0.01) (B). N = 3.

Fig. 3 – Immunofluoresent staining result of TGF-b1. The posi

(b), and the nucleus was shown as blue fluorescence (a). Odon

in ClC-5 KO homozygous group (B) than in wild-type group (d

as B) (C). Red arrow head points to the remained enamel. ‘‘c’’

images; a–d are the magnification of red asterisk (*) area in ‘‘e

were 100 mm.

Table 1 – Primer sequences of real-time PCR.

Gene name Forward primer (50–30) Reverse primer (50–30)

Clcn5 GAGGAGCCAATCCCTGGTGTA CTCTGCACGGGACAGCAAT

Tgfb1 CCGCAACAACGCCATCTATG CTCTGCACGGGACAGCAAT

Tgfbr1 GCTGACATCTATGCAATGGG TTTCTTCAACCGATGGATCA

Tgfbr2 CCGCTGCATATCGTCCTGTG AGTGGATGGATGGTCCTATTACA

Dspp ATTCCGGTTCCCCAGTTAGTA CTGTTGCTAGTGGTGCTGTT

Dmp1 GTGCCCAAGATACCCCCAG GCATCCCTTCATCATCGAACTCA

Gapdh CATGTTCCAGTATGACTCCACTC GGCCTCACCCCATTTGATGT

a r c h i v e s o f o r a l b i o l o g y 5 4 ( 2 0 0 9 ) 1 1 1 8 – 1 1 2 4 1121

by using an unpaired Student’s t-test, and P values <0.05 were

considered significant. All the experiments were repeated at

least three times.

3. Results

3.1. Appearance of tooth in ClC-5 KO mice

According to a previous report,8 7% of ClC-5 KO mice (15 of 223

examined mice) had abnormal growth of the teeth; however,

during the year in which the samples were collected, we did

not observe any teeth with backward growth; so we focused

our observations on general ClC-5 KO mice. Gross examination

revealed that the general adult ClC-5 KO mice dentition

appeared morphologically normal. No distinct colour differ-

ence was found with the enamel of ClC-5 KO mice.

tive staining of TGF-b1 was shown as green fluorescence

toblast (O) showed a higher green fluorescence intensity

ifferent litter from B) (A) and wild-type group (same litter

is the merged image of ‘‘a’’ and ‘‘b’’; ‘‘d and e’’ are DIC

’’. E: enamel; D: dentin. Bars in a–d were 10 mm; bars in e

a r c h i v e s o f o r a l b i o l o g y 5 4 ( 2 0 0 9 ) 1 1 1 8 – 1 1 2 41122

3.2. Abnormal dentin in ClC-5 KO tooth germs

Histological evaluation of both incisors and associated

enamel showed no apparent difference between ClC-5 KO

mice and normal mice, whilst the dentin demonstrated

structural abnormalities in the ClC-5 KO mice. In wild-type

mice, the mantle dentin layer was continuous with a

narrow submantle band of tubules. The dentin zone ended

abruptly in a broad, undulating zone parallel to the dentin–

enamel junction (DEJ). ClC-5 KO mice presented an unclear

boundary between dentin and predentin. The tubular

structures were ill-defined. Enamel was easily removed

from dentin in some severe cases (Fig. 1A). The abnormal

extent of enamel and dentin varied a little among different

ClC-5 KO teeth. Transmission electron microscopy (TEM)

results showed the enlarged channel-like structures in the

dentin of ClC-5 KO mice. The shape of dentin tubules was

irregular (Fig. 1B).

We found that enamel was easily removed from dentin

during tissue section preparing in ClC-5 KO tooth germ

(Figs. 3Be and 4Be). In order to avoid that enamel’s peeling

off was due to the histological artefact, we compared tooth

germs of wild-type mice and ClC-5 KO homozygous mice in

the same litter. These two groups followed the exact same

histological procedure. The detachment of enamel was only

found in ClC-5 KO teeth.

Fig. 4 – Immunofluoresent staining result of DSPP. The positive

(b), and the nucleus was shown as blue immunofluorescence (a

intensity in ClC-5 KO homozygous group (B) than in wild-type g

litter as B) (C). Red arrow head points to the detached enamel. ‘‘c’

a–d are the magnification of red asterisk (*) area in ‘‘e’’. E: ename

3.3. Increased TGF-b1 and decreased DSPP in ClC-5 KOtooth germs

To understand the mechanism by which ClC-5 regulates

tooth development, we used western blot to detect

TGF-b1 in tooth germs. Three-day-old ClC-5 KO newborn

mice had much greater amounts of TGF-b1 (1.65-fold,

P < 0.01) in total tooth germ lysates compared with 3-day-

old wild-type mice (Fig. 2A and B). Immunofluoresent

staining results showed that odontoblasts in ClC-5 KO

tooth germ showed higher expression of TGF-b1 and

lower expression of DSPP than in wild-type group (Figs. 3

and 4).

3.4. Expression of Tgfb1, Tgfbr1, Tgfbr2, Dspp and Dmp1with Clcn5 in the MDPC-23 cell line

We confirmed the expression of Clcn5 mRNA in MDPC-23

cells.11 The RNAi method was used to knockdown the

expression of Clcn5. The mRNA of Tgfb1, Tgfbr1, Tgfbr2, Dspp

and Dmp1 were analyzed by real-time PCR. We found that the

Clcn5 RNAi construct reduced the expression of Clcn5 mRNA

expression about 81.01% in MDPC-23 cells (P < 0.01), and at the

same time, the mRNA level of Tgfb1 was upregulated 1.87-fold

(P < 0.05). To our surprise, the mRNA level of Dspp and Dmp1

was also increased in RNAi treatment group (P < 0.01). No

staining of DSPP was shown as green immunofluorescence

). Odontoblast (O) showed a lower green fluorescence

roup (different litter from B) (A) and wild-type group (same

’ is the merged image of ‘‘a’’ and ‘‘b’’; ‘‘d, e’’ are DIC images;

l; D: dentin. Bars in a–d were 10 mm; bars in e were 100 mm.

Fig. 5 – Relative gene fold expression with Clcn5 RNAi in

odontoblast-like MDPC 23 cells: real-time PCR analysis. All

five genes (Clcn5, Tgfb1, Tgfbr1, Tgfbr2, Dspp and Dmp1)

mRNA levels are adjusted to Gapdh for each reaction. The

relative changes in expression after 48 h of Clcn5 RNAi are

determined by comparison to the control mRNA level,

which is taken as 100%. Clcn5 mRNA is significantly

decreased in the RNAi group (19% of the control value),

with a subsequent increase of Tgfb1 (1.87-fold). The mRNA

level of Dspp and Dmp1 was increased in RNAi treatment

group. No significant change was found in the mRNA

levels of Tgfbr1 and Tgfbr2. *P < 0.05; **P < 0.01. N = 4.

a r c h i v e s o f o r a l b i o l o g y 5 4 ( 2 0 0 9 ) 1 1 1 8 – 1 1 2 4 1123

significant change was found in the mRNA levels of Tgfbr1 and

Tgfbr2 (Fig. 5).

4. Discussion

The genetic mutations of CLCN5 could cause Dent’s disease.

Dent’s disease is a rare, X-linked recessive condition that

affects the kidney.1,3 One of histological character is nephro-

calcinosis or nephrolithiasis. Until now there has been no case

report in the literature about abnormal teeth in Dent’s disease,

but the abnormal tooth growth has been reported in ClC-5 KO

mouse. The mechanism by which ClC-5 regulates the tooth

has not been explored. In this study, we used both ClC-5 KO

mice as well as the RNAi technique to study ClC-5 function in

tooth and odontoblast cell lines. We found that abnormal ClC-

5 function affected dentin formation and TGF-b1 was one of

important factor.

We did not find any distinct differences in the appearance

of enamel between wild-type and ClC-5 KO mice; however, HE

staining and TEM images demonstrated histological changes

in dentin tissues of ClC-5 KO mice being similar to the

abnormal dentin characteristic of dentinogenesis imperfecta

(DGI).14–16 These data suggest that ClC-5 might be involved in

regulating dentin formation. This is the first report that

dysfunction of chloride channels could affect dentin forma-

tion.

The expression of TGF-b1 has been reported to be increased

in the kidneys of adult ClC-5 KO mice and TGF-b1 is regarded

as a marker of calcinosis and interstitial fibrosis of the kidney

in this mouse model.17 It seemed like cutting the scar-like or

fibrosis tissue when we made tooth germ section of ClC-5 KO

mice. Then we detected the level of expression of TGF-b1 in

ClC-5 KO tooth germ. Western blot and immunofluoresent

analysis showed the increased protein level of TGF-b1 in tooth

germ and odontoblasts of ClC-5 KO mice.

The overexpressed, active TGF-b1 showed a significant

reduction in tooth mineralization, defective dentin formation

and a relatively high branching of dentinal tubules.18 The

abnormal dentin changes, decreased expression of DSPP and

abnormal increased TGF-b1 level in ClC-5 KO mice further

confirmed a positive relationship between dentin formation

and TGF-b1. We did not find a missing lingual part, a

characteristic of overexpressing TGF-b1 mice,19 in ClC-5 KO

incisor. The dentin was formed in both lingual and labial side

in ClC-5 KO incisors. Since the absence of lingual part of

incisor was found in overexpressing TGF-b1 mice, the 7% back

ward growth teeth in Wang et al’s reported ClC-5 KO mice

might be the effect of overexpression TGF-b1 in incisor.19 We

suggested that abnormal histological changes of dentin in ClC-

5 KO mice might be an effect of increasing TGF-b1 level.

TGF-b1 is a multifunctional growth factor that is expressed

in numerous cell types, including developing teeth from the

initiation stage through adulthood. Here we also found TGF-b1

expressed in MDPC-23 cell and the mRNA level of TGF-b1 was

upregulated with Clcn5 RNAi. But the mRNA of Dspp and

Dmp1 was dramatically increased, which was different from

the decreased DSPP in odontoblast of ClC-5 KO mice. TGF-b1

has been shown to induce secretion of dentin extracellular

matrix components associated with primary dentinogenesis

and to play a role in tertiary or reparative dentinogenesis.20,21

The increased Dspp and Dmp1 might be a short-term response

to the increased TGF-b1 level in the 48 h of RNAi experiment.

We have found ClC-5 in ameloblasts of tooth germs12

previously (supplementary Fig. 1). In this study, enamel of ClC-

5 KO mice was easily peeled off from dentin, which might be

an effect of increasing TGF-b1 level.22 In TGF-b1 overexpres-

sing mice, ameloblasts began to detach from dentin from the

early secretory stage.22 The changes of enamel or ameloblast

in ClC-5 KO mice might function as a trigger signal of the

decrease in Dspp and result in different response of Dspp in

vivo and in vitro model. The biological role of ClC-5 in enamel

formation needs our further study.

The relationship between ClC chloride channels and the

TGF-b1 signalling pathway is still an open question. A recent

report suggested that ClC-3-like voltage-gated chloride chan-

nels play a critical role in TGF-b-induced apoptosis of human

airway epithelial cells. ClC-3 RNAi abolished Cl� current and

enhanced TGF-b1-induced cell apoptosis.23

Many cells synthesize TGF-b1 and almost all of them have

specific receptors for this peptide. Three TGF-b receptor types

can be distinguished by their structural and functional

properties. Receptor types I and II have similar ligand binding

affinities and both of them have a high affinity for TGF-b1.

After Clcn5 gene was silenced in MDPC-23, neither of Tgfbr1

and Tgfbr2 changed significantly. To understand the mechan-

isms between ClC-5 and TGF-b1 in dentin development, we

need further research in a common pathway related to TGF-

b1, ClC-5 and tooth development. In the future study, we

might also detect other items such as proteoglycan or GAG

side chain to find more data about the effect of increasing TGF-

b1 in ClC-5 KO mice.

a r c h i v e s o f o r a l b i o l o g y 5 4 ( 2 0 0 9 ) 1 1 1 8 – 1 1 2 41124

In summary, here we showed abnormal dentin structure in

ClC-5 KO mice and we suggest the abnormal ClC-5 function

affects dentin formation through TGF-b1 pathway.

Acknowledgements

We thank Sandra E. Guggino of Johns Hopkins University (JHU)

for providing samples of Clcn5 gene knockout mice, William B.

Guggino (JHU) for helpful suggestions, as well as Jennifer Sipes

(JHU) for technical support. We are also thankful for support

from the National Natural Science Foundation of China

(30371540).

Funding: National Natural Science Foundation of China

(30371540).

Competing interests: None declared.

Ethical approval: Not required.

Appendix A. Supplementary data

Supplementary data associated with this article can be

found, in the online version, at doi:10.1016/j.archoral-

bio.2009.09.008.

r e f e r e n c e s

1. Jentsch TJ, Stein V, Weinreich F, Zdebik AA. Molecularstructure and physiological function of chloride channels.Physiol Rev 2002;82(2):503–68.

2. Edmonds RD, Silva IV, Guggino WB, Butler RB, Zeitlin PL,Blaisdell CJ. ClC-5: ontogeny of an alternative chloridechannel in respiratory epithelia. Am J Physiol Lung Cell MolPhysiol 2002;282(3):L501–7.

3. Lloyd SE, Pearce SH, Fisher SE, Steinmeyer K, Schwappach B,Scheinman SJ, et al. A common molecular basis for threeinherited kidney stone diseases. Nature 1996;379(6564):445–9.

4. Takeuchi Y, Uchida S, Marumo F, Sasaki S. Cloning, tissuedistribution, and intrarenal localization of ClC chloridechannels in human kidney. Kidney Int 1995;48(5):1497–503.

5. Cornejo I, Niemeyer MI, Sepulveda FV, Cid LP. Cloning,cellular distribution and functional expression of smallintestinal epithelium guinea pig ClC-5 chloride channel.Biochim Biophys Acta 2001;1512(2):367–74.

6. Scherer CR, Linz W, Busch AE, Steinmeyer K. Geneexpression profiles of CLC chloride channels in animalmodels with different cardiovascular diseases. Cell PhysiolBiochem 2001;11(6):321–30.

7. Vandewalle A, Cluzeaud F, Peng KC, Bens M, Luchow A,Gunther W, et al. Tissue distribution and subcellularlocalization of the ClC-5 chloride channel in rat intestinalcells. Am J Physiol Cell Physiol 2001;280(2):C373–81.

8. Wang SS, Devuyst O, Courtoy PJ, Wang XT, Wang H, Wang Y,et al. Mice lacking renal chloride channel CLC-5, are a modelfor Dent’s disease, a nephrolithiasis disorder associated

with defective receptor-mediated endocytosis. Hum MolGenet 2000;9(20):2937–45.

9. Wright JT, Kiefer CL, Hall KI, Grubb BR. Abnormal enameldevelopment in a cystic fibrosis transgenic mouse model. JDent Res 1996;75(4):966–73.

10. Wright JT, Hall KI, Grubb BR. Enamel mineral composition ofnormal and cystic fibrosis transgenic mice. Adv Dent Res1996;10(2):270–4.

11. Hou J, Situ Z, Duan X. ClC chloride channels in tooth germand odontoblast-like MDPC-23 cells. Arch Oral Biol2008;53(9):874–8.

12. Duan XH. Spatial–temporal distribution of CLC-5 in rat toothgerm development. J Dent Res 2004;83(special issue A):2741.

13. Hou J, Duan XH, Si-Tu ZQ. Expression of CIC-5 in rat toothgerm development. Hua Xi Kou Qiang Yi Xue Za Zhi2007;25(5):444–6. 453.

14. Lindau B, Dietz W, Lundgren T, Storhaug K, Noren JG.Discrimination of morphological findings in dentine fromosteogenesis imperfecta patients using combinations ofpolarized light microscopy, microradiography andscanning electron microscopy. Int J Paediatr Dent 1999;9(4):253–61.

15. Malmgren B, Lundberg M, Lindskog S. Dentinogenesisimperfecta in a six-generation family A clinical,radiographic and histologic comparison of twobranches through three generations. Swed Dent J1988;12(3):73–84.

16. Siar CH. Quantitative histological analysis of the humancoronal dentine in dentinogenesis imperfecta types I and II.Arch Oral Biol 1986;31(6):387–90.

17. Cebotaru V, Kaul S, Devuyst O, Cai H, Racusen L, GugginoWB, et al. High citrate diet delays progression of renalinsufficiency in the ClC-5 knockout mouse model of Dent’sdisease. Kidney Int 2005;68(2):642–52.

18. Thyagarajan T, Sreenath T, Cho A, Wright JT, Kulkarni AB.Reduced expression of dentin sialophosphoprotein isassociated with dysplastic dentin in mice overexpressingtransforming growth factor-beta 1 in teeth. J Biol Chem2001;276(14):11016–20.

19. Opsahl S, Septier D, Aubin I, Guenet JL, Sreenath T, KulkarniA, et al. Is the lingual forming part of the incisor a structuralentity? Evidences from the fragilitas ossium (fro/fro) mousemutation and the TGFbeta1 overexpressing transgenicstrain. Arch Oral Biol 2005;50(2):279–86.

20. Unterbrink A, O’Sullivan M, Chen S, MacDougall M. TGFbeta-1 downregulates DMP-1 and DSPP in odontoblasts.Connect Tissue Res 2002;43(2–3):354–8.

21. Magne D, Bluteau G, Lopez-Cazaux S, Weiss P, Pilet P,Ritchie HH, et al. Development of an odontoblast in vitromodel to study dentin mineralization. Connect Tissue Res2004;45(2):101–8.

22. Haruyama N, Thyagarajan T, Skobe Z, Wright JT, Septier D,Sreenath TL, et al. Overexpression of transforminggrowth factor-beta1 in teeth results in detachment ofameloblasts and enamel defects. Eur J Oral Sci 2006;114(Suppl 1):30–4.

23. Cheng G, Shao Z, Chaudhari B, Agrawal DK. Involvement ofchloride channels in TGF-beta1-induced apoptosis ofhuman bronchial epithelial cells. Am J Physiol Lung Cell MolPhysiol 2007;293(5):L1339–47.

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具