clin cancer res 2007 yue 4336 44

7/27/2019 Clin Cancer Res 2007 Yue 4336 44

1/10

2007;13:4336-4344.Clin Cancer ResWen Yue, Sanja Dacic, Quanhong Sun, et al.Cancer by Promoter Hypermethylation

in LungDutt1andRAMP2, EFEMP1Frequent Inactivation of

Updated version

http://clincancerres.aacrjournals.org/content/13/15/4336Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2011/11/21/13.15.4336.DC1.htmlAccess the most recent supplemental material at:

Cited Articles

http://clincancerres.aacrjournals.org/content/13/15/4336.full.html#ref-list-1This article cites by 43 articles, 24 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/13/15/4336.full.html#related-urlsThis article has been cited by 7 HighWire-hosted articles. Access the articles at:

E-mail alerts

related to this article or journal.Sign up to receive free email-alerts

SubscriptionsReprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

[email protected] at

To request permission to re-use all or part of this article, contact the AACR Publications

Research.on August 27, 2013. 2007 American Association for Cancerclincancerres.aacrjournals.orgDownloaded from
http://clincancerres.aacrjournals.org/content/13/15/4336http://clincancerres.aacrjournals.org/content/13/15/4336http://clincancerres.aacrjournals.org/content/suppl/2011/11/21/13.15.4336.DC1.htmlhttp://clincancerres.aacrjournals.org/content/suppl/2011/11/21/13.15.4336.DC1.htmlhttp://clincancerres.aacrjournals.org/content/13/15/4336.full.html#ref-list-1http://clincancerres.aacrjournals.org/content/13/15/4336.full.html#ref-list-1http://clincancerres.aacrjournals.org/content/13/15/4336.full.html#related-urlshttp://clincancerres.aacrjournals.org/content/13/15/4336.full.html#related-urlshttp://clincancerres.aacrjournals.org/cgi/alertshttp://clincancerres.aacrjournals.org/cgi/alertsmailto:[email protected]:[email protected]:[email protected]:[email protected]:[email protected]://clincancerres.aacrjournals.org/http://clincancerres.aacrjournals.org/http://clincancerres.aacrjournals.org/mailto:[email protected]:[email protected]://clincancerres.aacrjournals.org/cgi/alertshttp://clincancerres.aacrjournals.org/content/13/15/4336.full.html#related-urlshttp://clincancerres.aacrjournals.org/content/13/15/4336.full.html#ref-list-1http://clincancerres.aacrjournals.org/content/suppl/2011/11/21/13.15.4336.DC1.htmlhttp://clincancerres.aacrjournals.org/content/13/15/4336


2/10

Frequent Inactivation of RAMP2, EFEMP1 and Dutt1 in Lung Cancer

by Promoter Hypermethylation

Wen Yue,1Sanja Dacic,2 Quanhong Sun,2 Rodney Landreneau,3 Mingzhou Guo,4 Wei Zhou,5

Jill M. Siegfried,1Jian Yu,2 and Lin Zhang1

Abstract Purpose: The goal of this study is to identify novel genes frequently silenced by promoter hyper-methylation in lung cancer.

Experimental Designs: Bioinformatic analysis was done to identify candidate genes sig-

nificantly down-regulated in lung cancer. The effects of DNA methyltransferase inhibitor 5-aza-

2-deoxycytidine on the expression of the candidate genes were determined. Methylated CpG

sites in the promoters of the candidate genes were identified using bisulfite DNA sequencing.

Methylation-specific PCR was developed and used to analyze DNA methylation in cell lines

and clinical specimen. Pathologic and functional analyses were done to study the role of one

candidate gene, receptor activity-modifying protein 2 (RAMP2), in suppressing lung cancer cell

growth.

Results: Among 54 candidate genes down-regulated in lung cancer, 31 were found tocontain CpG islands in their promoters. Six of these 31 genes could be reactivated by 5-aza-

2-deoxycytidine in at least four of six lung cancer cell lines analyzed. Promoter hypermethyla-

tion of RAMP2, epidermal growth factor ^ containing fibulin-like extracellular matrix protein 1,

and deleted in U Twenty Twenty cells was detected in 36% to 77% of 22 lung cancer cell lines

and in 38% to 50% of 32 primary lung tumors, whereas hypermethylathion of these genes

was rarely found in the matched normal samples. The methylation frequencies of these genes

in lung cancer were similar to those of commonly used methylation markers, such as RAS

association domain family protein 1A, p16, and methylguanine-DNA methyltransferase. Immuno-

histochemistry showed that RAMP2 was down-regulated in a majority of lung tumors,

and RAMP2 down-regulation was correlated with high tumor grade. Ectopic expression of

RAMP2 inhibited lung cancer cell growth and caused apoptotic cell death. Knockdown

of RAMP2 by RNA interference stimulated cell proliferation.

Conclusions: Studying the newly identified genes may provide new insight into lung tumori-

genesis. These genes might be useful as molecular markers of lung cancer.

Lung cancer, which accounts for 12.3% of all cancers, is themost common form of cancer in the world (1). Lung cancerdevelopment is a multistage process involving activation ofoncogenes and inactivation of tumor suppressor genes (2, 3).Epigenetic changes, especially hypermethylation of CpG islandsin gene promoters, have recently emerged as an importantmechanism for tumor suppressor gene silencing (4, 5).

Promoter hypermethylation has been detected in lung cancerfor a number of genes, such as p16, RAS association domain

family protein 1A (RASSF1A), and methylguanine-DNA methyl-transferase (MGMT; refs. 6 8). Further studies of the genessilenced by promoter hypermethylation in lung cancer wouldprovide invaluable insight into the mechanisms underlyinglung tumorigenesis.

Lung cancer is also the leading cause of cancer-related deathin the United States (1). When detected, lung tumors are oftenin late stages and refractory to conventional anticancertherapies. The mortality of lung cancer could be greatly reducedthrough detection of the disease at the earliest stages. Promoterhypermethylation has been used as a molecular marker for

HumanCancer Biology

Authors Affiliations: Departments of 1Pharmacology, 2Pathology, and 3Surgery,

University of Pittsburgh Cancer Institute, University of Pittsburgh School of

Medicine, Pittsburgh, Pennsylvania; 4Sidney Kimmel Comprehensive Cancer

Center at Johns Hopkins, Baltimore, Maryland; and 5Winship Cancer Institute,

Emory University School of Medicine, Atlanta, Georgia

Received1/4/07; revised 5/10/07; accepted 5/16/07.

Grant support: Postdoctoral Fellowship (W. Yue), Developmental Research

Program and Career Development Award (L. Zhang) of Lung Cancer SpecializedProgram of Research Excellence at the University of Pittsburgh Cancer Institute

(NIH grant CA90440), NIH grant CA106348 (L. Zhang), and Flight Attendant

Medical Research Institute grant (J. Yu).

The costs of publicationof this article were defrayedin partby thepayment of page

charges. This article must therefore be hereby marked advertisement in accordance

with18 U.S.C. Section1734 solely to indicate this fact.

Note: Supplementary data for this article are available at Clinical Cancer Research

Online (http://clincancerres.aacrjournals.org/).

L. Zhang is a scholar of the General Motors Cancer Research Foundation and theV

Foundation for Cancer Research.

Requests for reprints: Lin Zhang, the UPCI Research Pavilion, Room 2.42d,

University of Pittsb urgh Cancer Institute, Pittsburgh, PA15213. Phone: 412-623-

1009; Fax: 412-623-7778; E-mail: [email protected].

F2007 American Association for Cancer Research.

doi:10.1158/1078-0432.CCR-07-0015

www.aacrjournals.orgClin Cancer Res 2007;13(15) August1, 2007 4336

http://clincancerres.aacrjournals.org/http://clincancerres.aacrjournals.org/http://clincancerres.aacrjournals.org/


3/10

detection of lung cancer (9, 10). Hypermethylation of severalgenes, such as p16 and RASSF1A, can be found in tumors,smoking-damaged normal lung, sputum, and blood from lungcancer patients (11 15). However, additional methylationmarkers are necessary to achieve desirable sensitivity andspecificity for lung cancer detection (9, 10).

In this study, we attempted to identify novel genes that arefrequently inactivated in lung cancer through promoter hyper-methylation. Genes significantly down-regulated in lung cancer

were first identified through bioinformatic analysis. Those thatcontain CpG islands in their promoters and could be

reactivated by the DNA methyltransferase inhibitor 5-aza-2-deoxycytidine were further studied. Methylation-specific PCR

(MSP) was developed and used to investigate their methylationstatus in lung cancer cell lines, primary lung tumors, and their

matched normal tissues. As the result, several novel genesfrequently silenced by promoter hypermethylation in lung

cancer were identified, including receptor activity-modifyingprotein 2 (RAMP2), epidermal growth factorcontaining fibulin-

like extracellular matrix protein 1 (EFEMP1), and deleted in UTwenty Twenty cells (Dutt1). Pathologic and functional studies

were done to determine the role ofRAMP2 in suppressing lungcell growth. Further elucidation of the functions of these genes

may lead to better understanding of lung tumorigenesis. Thesegenes are potentially useful as molecular markers of lungcancer.

Materials and Methods

Bioinformatic analysis. SAGE databases6 at the National Center for

Biotechnology Information were used to identify candidate genes that

are down-regulated in lung cancer. A pool of three SAGE libraries from

lung cancer (total, 159,128 tags) was compared with a pool of threelibraries from normal lung tissues (total, 159,917 tags) using Digital

Gene Expression Displayer program. A total of 347 genes down-

regulated by at least 2-fold (P < 0.05) in lung cancer were further

analyzed using the National Center for Biotechnology Information

Expressed Sequence Tag databases (169,722 clones from 20 lung cancer

libraries; 102,337 clones from 23 normal lung libraries). Three criteriawere applied: (a) significantly down-regulated (P = 0) in lung cancer by

SAGE, (b) not significantly up-regulated by Expressed Sequence Tag

(P < 0.01), and (c) not significantly down-regulated in three other types

of cancer by SAGE (P < 0.05). Therefore, genes with contradictory

expression patterns in SAGE and Expressed Sequence Tag databases and

those ubiquitously down-regulated in different types of cancer were

excluded. In addition, seven genes reported to be down-regulated in

lung cancer were included. The expression levels (copies per cell) of the

candidate genes (Supplementary Table S1) were normalized based onthe estimation that there are f300,000 transcripts in one cell (16).

To identify CpG islands in the promoters of the candidate genes, 1 to

2 kb DNA sequence 5

to the translation initiation site of each gene wereanalyzed using CpG Island Searcher7 and CpG Island Plot8 programs.

The criteria for CpG island were (a) % GC > 55%, (b) observed CpG/expected CpG > 0.65, and (c) length > 500 bp.

Cell culture. The lung cancer cell lines used in the study were from

American Type Culture Collection, except for 273T and 201T which

were from the University of Pittsburgh Cancer Institute lung cancerprogram. Cells were maintained at 37jC and 5% CO2 in RPMI 1640

(Mediatech) supplemented with 10% defined fetal bovine serum

(HyClone), 100 units/mL penicillin, and 100 Ag/mL streptomycin

(Invitrogen). For demethylation, cells were treated with 5 Amol/L 5-aza-

2-deoxycytidine (Sigma) for 6 days. Fresh medium was added after

days 1, 2, and 3.Western blotting. Cell lysates were collected, and Western blotting

was done as previously described (17). The antibodies for Western

blotting included rabbit antibodies against RAMP2 (Santa CruzBiotechnology), caspase-3 (Stressgen Bioreagents), caspase-9 (Cell Sig-

naling Technology), and monoclonal antibodies against V5 (Invitro-

gen) and a-tubulin (BD Biosciences).Reverse transcriptase-PCR. Total RNA was isolated from cells using

the RNAgents Total RNA Isolation System (Promega). First-strand

cDNA was synthesized from 10 Ag of total RNA using Superscript II

reverse transcriptase (Invitrogen). Reverse transcriptase-PCR was done

to amplify the candidate genes using the touchdown PCR conditions

previously described (18). Primers for reverse transcriptase-PCR were

listed in Supplementary Table S2.Isolation of genomic DNA and bisulfite modification. Genomic DNA

was isolated from lung cancer cell lines and tissues using QIAamp DNA

Blood minikit and QIAamp DNA minikit (Qiagen), respectively. A

mixture of 0.25 Ag of genomic DNA along with 1.0 Ag of carrier salmon

sperm DNA (Promega) was used for bisulfite modification. DNA from

lung cancer cell lines was modified using the previously described

method (19). DNA from tissues was modified using the EZ DNA

Methylation Gold kit (ZYMO Research) according to the manufacturers

protocol. The modified DNA was ethanol precipitated and dissolved

into 40 AL of distilled water.Bisulfite sequencing and MSP. PCR was done in 20 AL of final

volume using one-twentieth (2 AL) of bisulfite-modified DNA and2 units of Platinum Taq DNA polymerase (Invitrogen). The cycle

conditions included 35 to 40 cycles of 95jC for 20 s, 55jC for 30 s, and

6 http://cgap.nci.nih.gov/SAGE

Table 1. Primers for MSP

Gen es Priming site Forward pr imer (5 to 3) Reverse primer (5to 3) PCR product size (bp)

RAMP2 Gen omic AGCC CC TCCGAGGAAGCGGCGCG CGGGCC GCC GGCGCGCTCC AC CC G

MSP (M) AGTTTTTTCGAGGAAGCGGCGC AACCGCCGACGCGCTCCACCCG 146

MSP (U) AGTTTTTTTGAGGAAGTGGTGT CAAACCACCAACACACTCCACCCA 148

EFEMP1 Genomic GAGCAGCTCCAGGGGACCGCCGCG TCCCCGACACGCTACCTTCG

MSP (M) GTAGTTTTAGGGGATCGTCGC TCCCCGACACGCTACCTTCG 160

MSP (U) GAGTAGTTTTAGGGGATTGTTGT TCCCCAACACACTACCTTCA 162Dutt1 Genomic AA GCGTCCGG AAA GG TCGA CG GTAAA AG TG AGCGG GCTG CG

MSP (M) AAGCGTTCGGAAAGGTCGAC ATAAAAATAAACGAACTACG 196

MSP (U) AAGTGTTTGGAAAGGTTGAT ATAAAAATAAACAAACTACA 196

NOTE: M, methylated sequence; U, unmethylated sequence.

7 http://cpgislands.usc.edu8 http://www.ebi.ac.uk/emboss/cpgplot

Inactivation of RAMP2, EFEMP1 and Dutt1 in Lung Cancer

www.aacrjournals.org Clin Cancer Res 2007;13(15) August 1, 20074337



4/10

72jC for 90 s. For bisulfite sequencing, 400 to 800 bp fragments

were amplified using the primers described in Supplementary Table S3.

PCR products were purified and sequenced using the same primers forPCR as previously described (20). If a T peak was 50% or higher

compared with a C peak at the same position, the base was considered

to be partially methylated. For MSP, 50-bp to 200-bp fragments were

amplified from bisulfite-modified DNA using the primers listed inTable 1 and the previously described primers for RASSF1A, p16 , andMGMT (15, 19, 21). The PCR products were analyzed by electropho-

resis on 2% agarose gels.

Tissue samples. The acquisition of the tissues was approved by the

Institutional Review Board at the University of Pittsburgh. Frozen

specimens, including 32 randomly selected nonsmall cell lung tumors

and their matched histologically normal lung parenchyma adjacent to

the tumors (within 1 cm of the discrete tumor margin) and the normal

lung parenchyma distal to the tumors (at least 4 cm away from the

tumors), were obtained from the University of Pittsburgh Cancer

Institute lung cancer program. The clinicopathologic characteristics of

the patients were summarized in Supplementary Table S4. Tissue

microarray slides containing 95 cores of histologically confirmed

Fig.1. Identification of candidate genes.A, strategies foridentifying novel genes silencedby promoterhypermethylationin lung cancer. B, VirtualNorthernand AnatomicViewanalyses were used to compare the expressionof the candidate genes in different tumor and normal tissues. As an example, RAMP2 was found to be specificallydown-regulated in lung cancer. C, the expressionof the candidate genes in six lung cancer cell lines with or without 5-aza-2-deoxycytidine treatment was determined byreverse transcriptase-PCR. RASSF1A and glyseraldehyde-3-phosphate dehydrogenase (GAPDH) were used as controls. MW, molecular weight marker. D, RAMP2 proteinexpression was analyzed byWestern blotting in the indicated cell lines with or without 5-aza-2-deoxycytidine treatment.

HumanCancer Biology




5/10

nonsmall cell lung carcinomas and 49 cores of normal lung sam-

ples were purchased from US Biomax. These samples included 32

matched tumor/normal pairs and unmatched specimen (Supplemen-

tary Table S5).RAMP2 immunohistochemistry. The sections were deparaffinized by

xylene, rehydrated in decreasing concentrations of ethanol (100% twice

followed by once each of 95% and 70%), and boiled twice with each

for 5 min in 0.1 mol/L citrate buffer antigen retrieval solution (pH 6.0).

The slides were stained by rabbit anti-RAMP2 antibodies (Santa Cruz

Biotechnology) and then biotinylated goat anti-rabbit antibodies

(Vector Laboratories). The signals were detected using Vectastain Elite

avidin-biotin complex method kit following the manufacturers

instructions (Vector Laboratories). Hematoxlin was used for counter-

staining.

The staining distribution was scored based on the percentage of

positive cells: 0, 0%; 1, 1-30%; 2, 31-60%; 3, 61-100%. The signalintensity was scored using this criteria: 0, no signal; 1, weak; 2,

moderate; and 3, marked. The staining was considered to be positive if

the sum of distribution and intensity scores was >2.Transfection and RNA interference. The expression construct for

RAMP2 was generated by cloning a PCR-amplified full-length humanRAMP2 cDNA fragment into pCDNA3.1/V5-His vector (Invitrogen).

The inserts were verified by restriction digestion and DNA sequencing.

A549 and H1299 cells were transfected with RAMP2 or the control

empty pCDNA3.1 vector using Lipofectamine 2000 (Invitrogen). For

analysis of apoptosis, cells were stained with Hoechst 33258(Invitrogen) after transfection and assessed through microscopic

visualization of condensed chromatin and micronucleation as previ-

ously described (22). Treatment with pan-caspase inhibitor z-VAD-fmk

(20 Amol/L; R&D Systems) was initiated 4 h before RAMP2

transfection. For colony formation assays, cells were plated into six-

well plates at different dilutions and selected by G418 (400 Ag/mL;Invitrogen) for transfected cells for 11 to 14 days. Colonies were

visualized by crystal violet staining as previously described (23).

Fig. 2. CpG methylationof the candidate genes inlung cancer cell lines.A, CpG site distributionin the promoter regions of the candidate genes. Bisulfite sequencingregionsand positions of MSP primers were indicated. B, summary of the bisulfite sequencing results for the indicated genes in eight lung cancer cell lines and normal lymphocytes(NL). C, bisulfite-modified genomic DNA with and without promoter hypermethylation of the indicatedgenes were mixed at different ratios and analyzed by MSP (25 ngof total input DNA per reaction). The ratio of1:1000 was equivalent to 5 to 10 copies of methylated DNA mixed with 25 ng of unmethylated DNA. D, MSP was used todetermine the methylation status of the indicated genes in 22 lung cancer cell lines. Right, numbers of MSP positives. M, PCR products amplifiedusing primers specific formethylated DNA; U, PCR products amplified using primers specific for unmethylated DNA. Normal lymphocytes and in vitro methylated DNA were negative and positivecontrols, respectively. MW, molecular weight marker.





6/10

For RAMP2 knockdown, H1752 cells were transfected with the

ON-TARGETplus small interfering RNA specific for RAMP2 (J-003701-

05; Dharmacon) or the control scrambled small interfering RNA byLipofectamine 2000. After 36 h, cells were incubated with 10 Amol/L

bromodeoxyuridine (Sigma) for 2 h, then fixed and permeabilized

with cold methanol for 10 min. Bromodeoxyuridine incorporation

was visualized using monoclonal antibromo deoxyuridine Alexa-Fluor 594 antibody (Invitrogen) according to the manufacturers

protocol.

Statistical analysis. Statistical analysis was done using GraphPadPrism IV software. P values of


7/10

Calu1, H1299, and A549 cells but not in H1752 cells (Fig. 1D),consistent with reverse transcriptase-PCR results.

Identifying CpG island hypermethylation. To determine

whether the six candidate genes are inactivated in lung cancerby promoter hypermethylation, we determined their CpGisland sequences using bisulfite-modified genomic DNA from

eight lung cancer cell lines. DNA from normal lymphocytes wasused as a control. For RAMP2, EFEMP1, tissue inhibitor of

metalloproteinase 3, and Dutt1, the majority (70-100%) of theCpG sites in their promoters were either completely or partiallymethylated in several cell lines (Fig. 2A and B; SupplementaryFig. S1). The methylation patterns matched their expres-

sion changes in response to 5-aza-2-deoxycytidine treatment(Fig. 1C), suggesting that promoter methylation is responsible

for their down-regulation in lung cancer. No consistent meth-ylation was detected for SH3BGRL3 and HES2 , suggesting

that different CpG sites or other mechanisms are responsiblefor their down-regulation in lung cancer. Among the identified

genes, only tissue inhibitor of metalloproteinase 3 has previouslybeen shown to be frequently down-regulated by promoter

hypermethylation in human lung cancer (15).

To further study their CpG island methylation, we developedMSP assays forRAMP2, EFEMP1, and Dutt1. In vitro methylatedDNA and normal lymphocytes were used as controls. Promoter

hypermethylation of all three genes could be reliably detectedby MSP, with PCR results matching bisulfite sequencing results

(data not shown). We also optimized PCR primers andconditions so that MSPs for these three genes were as sensitiveas those for analyzing p16, MGMT, and RASSF1A (Fig. 2C).

Promoter hypermethylation in lung cancer cell lines and

tumors. Next, we used MSP to determine whether these threegenes are frequently targeted by promoter hypermethylation

in lung cancer cell lines. The results indicated that all threegenes were methylated in a large fraction of 22 lung cancer celllines analyzed, with methylation detected in 14 (63.6%) for

RAMP2, 8 (36.4%) for EFEMP1, and 17 (77.3%) for Dutt1,

respectively (Fig. 2D). In comparison, promoter hypermeth-ylation of RASSF1A, p16, and MGMT was detected in 20(90.9%), 11 (50.0%), and 11 (50.0%) of these cell lines, re-

spectively (Fig. 2D).MSP was then used to analyze their methylation status in

tumor and normal tissues. Matched samples from 32 patients,including their lung tumors, histologically normal lung

tissues adjacent to the tumors, and histologically normal lungtissues distal to the tumors, were examined (Supplementary

Table S4). The representative data were shown in Fig. 3A. Theresults indicated that RAMP2 was methylated in 14 tumors

(43.8%), 4 adjacent normal (12.5%), and 1 distal normal

Fig. 4. Expression of RAMP2 in lung tumor andnormal lung tissuesdetermined by immunohistochemistry. RAMP2 expression was analyzed byimmunohistochemistry for a panel of samples on a tissue microarray, including95 cores of pathologically confirmed nonsmall cell lung tumors and 49 coresof normal lung samples. Among the95 tumors, 32 had matchednormalsamples, whereas the rest were unmatched (SupplementaryTable S5). A,immunohistochemistry results for two matched tumor and normal pairs.Magnification,200. RAMP2 is predominantly expressed in the cytoplasm ofnormal cells. B, bronchial epithelium with positive RAMP2 staining. Magnification:200 (top),400 (bottom). C, summary of RAMP2 staining results in lungtumors andnormal tissues. **, RAMP2 expressionin lung tumor and normal lungtissues was significantly different by Fishers exact test (P < 0.001); ***, lossof RAMP2 expression was correlated with high tumor grade bym2 exact test(P < 0.05).





8/10

(3.2%) samples (Fig. 3B). Similarly, EFEMP1 and Dutt1 weremethylated in a large fraction of lung tumors but rarely

methylated in the adjacent or distal normal tissues (Fig. 3B). In

comparison, methylation of RASSF1A, p16, and MGMT wasdetected in 14 (43.8%), 15 (46.9%), and 12 (37.5%) lungtumors, respectively, and in one to three normal samples

(Fig. 3B). Therefore, the methylation frequencies of the newlyidentified genes in lung cancer were similar to those of

commonly used methylation markers. Analysis of six represen-tative MSP-positive tumors by bisulfite sequencing verified thatover 90% of the CpG sites in the RAMP2 promoter weremethylated in each tumor (data not shown). In all cases, if a

methylation event was detected for a distal normal sample, itwas also found in the matched adjacent normal and tumor

tissues (Fig. 3B). Together, these results suggested that RAMP2,EFEMP1, and Dutt1 are frequently inactivated by promoter

hypermethylation in lung cancer.Expression of RAMP2 in lung tumors. To determine whether

promoter hypermethylation leads to loss of gene expression,immunohistochemistry was used to examine the expression of

RAMP2, the most consistently methylated gene we identified,

in three representative tumors showing RAMP2 hypermethyla-tion and their matched normal samples. In each case, strong

RAMP2 staining was detected in the normal samples but notin the corresponding tumor tissues (Fig. 3C).

An additional panel of tumor and normal samples on a tissuemicroarray, including 95 nonsmall cell lung tumor and 49

normal samples, among which were 32 matched pairs, wereanalyzed by immunohistochemistry for RAMP2 expression. The

representative results were shown in Fig. 4A and B. Amongthese samples, 89.8% (44 of 49) of normal lung specimen were

positive for RAMP2 staining, whereas only 22.1% (21 of 95) ofthe tumor samples were positive for RAMP2 expression

(Supplementary Table S5). The difference between the tumorand normal samples was highly significant (P < 0.001, Fisher

exact test; Fig. 4C). Among the 32 matched pairs, 22 tumorscompletely lose RAMP2 expression compared with their

matched normal samples (Fig. 4A; Supplementary Table S5).Furthermore, loss of RAMP2 expression was found to be

correlated with tumor grade, with RAMP2 immunostainingdetected in 58.3% (7 of 12) of grade 1 tumors but in only

26.5% (9 of 34) grade 2 and 10.4% (5 of 49) of grade 3/grade 4

Fig. 5. RAMP2 suppressed lung cancer cell proliferation. A, V5-tagged RAMP2 or the control pCDNA vector was transfected intoA5 49 and H1299 cells. Expression ofRAMP2 at 48 h after transfection was analyzed byWestern blotting. B, cells were plated out at 48 h after RAMP2 transfection and selected for G418 resistance. Colonieswere visualized by crystal violet staining11to 14 days later (left). The numbers of colonies were counted andplotted (right). C, RAMP2 was transfected into A549 and H1299cells in the presence or absence of the pan-caspase inhibitor z-VAD-fmk. Apoptosis was analyzed by nuclear staining with Hoechst 33258 at the indicated time aftertransfection. D, after H1299 cells were transfected with RAMP2 , caspase-9 and caspase-3 were analyzed byWesternblotting.The arrows indicatedactive caspasefragments. E, RAMP2 small interfering RNA or the control-scrambled small interfering RNA duplex was transfected into H1752 cells.Western blotting was used to verifyknockdown of RAMP2 at 36 h after transfection (top). Bromodeoxyuridine incorporation was analyzed as described in the Materials and Methods (bottom). a-Tubulin wasused as the loading control forWestern blotting. Columns, averages of three experiments; bars, SD.

HumanCancer Biology




9/10

tumors (P < 0.05, m2 exact test; Fig. 4C). We found that RAMP2was expressed in the airway, bronchial epithelial cells, and

occasionally in type II pneumocytes, with positive staining in

the cytoplasm of these cells (Figs. 3D and 4A and B).Suppression of lung cancer cell proliferation by RAMP2. To

study the functional role of RAMP2 in suppressing lung cancer

cell growth, we constructed a RAMP2 expression vector.Transfection of RAMP2 into A549 and H1299 lung cancer cells

significantly suppressed cell proliferation by over 80% incolony formation assays (Fig. 5A and B). Analysis of cell mor-phology indicated that a significant fraction of the cells con-tained condensed chromatin and fragmented nuclei after

RAMP2 transfection (Fig. 5C; Supplementary Fig. S2). Activa-tion of caspase-3 and caspase-9 was detected (Fig. 5D).

Furthermore, pretreating cells with the pan-caspase inhibitorz-VAD-fmk inhibited RAMP2-induced nuclear fragmentation

and caspase activation (Fig. 5C and D; Supplementary Fig. S2),suggesting that RAMP2 suppresses lung cancer cell growth by

inducing apoptosis.To further study the role of RAMP2 in suppressing lung

cancer cell proliferation, we used RNA interference to knock

down RAMP2 in H1752 cells (Fig. 5E), which lacked RAMP2promoter methylation (Fig. 2B) and expressed a normal level ofRAMP2 protein (Fig. 1D). After down-regulation of RAMP2, the

fraction of cells with bromodeoxyuridine incorporation, whichis an indicator of cell proliferation, was significantly increased

(Fig. 5E; Supplementary Fig. S3), suggesting that suppression ofRAMP2 is sufficient to stimulate cell proliferation.

Discussion

In this study, we identified several novel genes frequently

silenced in lung cancer, includingRAMP2, EFEMP1, and Dutt1.Promoter hypermethylation of these genes was detected in

large fractions of lung cancer cell lines and primary lungtumors, whereas hypermethylation of these genes was rarely

found in the matched normal samples. The approach we usedis similar to those used in several recent studies in which genessilenced by promoter hypermethylation in esophageal, gastric,

and prostate cancers were identified through microarray

analysis of cancer cells treated with 5-aza-2-deoxycytidine orthe histone deacetylase inhibitor trichostatin A (3032).

Analysis of 32 sets of tumor/normal samples from ourinstitution did not reveal an association between the methyl-ation markers and histologic type or tumor stage, which might

be explained by the small sample size and the fact that most of

the tumors were in stage I (Supplementary Table S4). Wedetected methylation of RAMP2 and Dutt1 in a small fraction

of distal and adjacent normal lung tissues (Fig. 3B). Thesemethylation events might be found for two reasons. First,because all of the samples were collected from lung cancer

patients with a smoking history, their histologically normallung tissues were likely to be damaged by tobacco exposure,

and therefore were not true normal. Alternatively, themethylation events might be due to an epigenetic field effect

and/or infiltrating tumor cells as reported in other studies (33).Further studies using true normal tissues, i.e., those from

healthy and normal individuals, will be necessary to determine

whether these genes are methylated in normal tissues.Pathologic and functional analysis results suggested that

one of the genes we identified, RAMP2 , plays a role in

suppressing lung cancer cell growth. RAMP2 encodes a familymember of single-transmembrane domain proteins called

RAMP (34). It has not been reported in any previous studiesto be silenced by promoter hypermethylation. RAMP family

proteins are required to transport the calcitonin receptorlikereceptor to the plasma membrane. A specific combination of

RAMP members and calcitonin receptorlike receptor definesthe ligand affinity of the receptor for either calcitonin or

adrenomedullin. It has been suggested that adrenomedullinspecificity for the calcitonin receptor like receptor is con-

ferred by RAMP2 (34). Interestingly, adrenomedullin wasshown to suppress prostate cancer cell growth in vitro andin vivo (35). It is possible that inactivation of RAMP2 confers

lung cancer cells a growth advantage by inhibiting the

function of adrenomedullin.EFEMP1, also known as fibulin-3, belongs to the fibulin

family of widely expressed extracellular matrix proteins thatregulate cell proliferation in a context-specific manner (36).

They mediate cell-to-cell and cell-to-matrix communication, as

well as provide organization and stabilization to extracellular

matrix structures during organogenesis and vasculogenesis.

Interestingly, it was found that EFEMP1 is a binding pattern oftissue inhibitor of metalloproteinase 3 (37). Recent studiesshowed that fibulin-3 and another fibulin family member,fibulin-5, could antagonize tumor angiogenesis in vivo (38),

suggesting that concerted deregulation of a set of antiagiogenic

factors, such as fibulin-3 and tissue inhibitor of metalloprotei-nase 3, contributes to tumor progression.

Dutt1 (Robo1) is a member of the neural cell adhesion

molecule family of receptors. It is localized in 3p12, afrequently altered region in lung cancer (3). Targeted disruption

of Dutt1 in mice caused abnormalities in lung development

and predisposed mice to lung adenocarcinomas and lympho-mas (39, 40). Epigenetic alterations of Dutt1 in rat lung tumorshave been reported (41). The high frequency of human Dutt1

hypermethylation in lung tumors suggested that it alsofunctions as a tumor suppressor.

Promoter hypermethylation has been proposed to be usefulas molecular markers for cancer detection (9, 10). Because

hypermethylation of a single gene only occurs in a subset oftumors and, depending on tumor staging, tumor DNA is

circulated in only a fraction of patients (42), it is critical todevelop a panel of methylation markers for improvement of

sensitivity and specificity. For example, a recent study showedthat a combination of eight specific methylation markers

allowed detection of renal cancer with good sensitivity andreasonable specificity (43). Future studies will address whether

the genes identified in this study can be combined with

commonly used methylation markers, such as RASSF1A, p16,and MGMT, for lung cancer detection.

Together, our studies identified several novel genes thatare frequently silenced by promoter hypermethylation in

lung cancer. Understanding the functions of these genes

may provide new insight into pathogenesis of lung cancer.These genes might be useful as molecular markers of lung

cancer.

Acknowledgments

We thank Autumn Gaither Davis and Dr.Weiping Zhang for technical assistance

and Dr. Jin Jen at National Cancer Institute for help withimmunohistochemistry.





10/10

References1. Jemal A, Murray T, Ward E, et al. Cancer statistics,

2005. CACancerJ Clin 2005;55:10 ^30.

2.Vogelstein B, Kinzler KW. Cancer genes andthe path-ways they control. Nat Med 2004;10:789^ 99.

3. Minna JD, Roth JA, GazdarAF. Focus onlung cancer.Cancer Cell 2002;1:49 ^ 52.

4. Egger G, Liang G, Aparicio A, Jones PA. Epigeneticsin human disease and prospects for epigenetic thera-py. Nature 2004;429:457 ^ 63.

5. HermanJG, Baylin SB. Gene silencing in cancer in as-sociation with promoter hypermethylation. N Engl JMed 2003;349:2042^ 54.

6. Agathanggelou A, Honorio S, Macartney DP, et al.Methylation associated inactivation of RASSF1A fromregion 3p21.3 in lung, breast and ovarian tumours.Oncogene 2001;20:1509 ^ 18.

7. Zochbauer-Muller S, Fong KM, MaitraA, et al.5 CpGisland methylation of the FHITgene is correlated withloss of gene expression in lung and breast cancer.Cancer Res 2001;61:3581 ^ 5.

8. Esteller M, Corn PG, Baylin SB, Herman JG. A genehypermethylation profile of humancancer. Cancer Res2001;61:3225 ^ 9.

9. Belinsky SA. Gene-promoter hypermethylation as abiomarker in lung cancer. Nat Rev Cancer 2004;4:707^ 17.

10. HermanJG.Epigenetics inlung cancer: focus on pro-

gressionand early lesions.Chest 2004;125:119 ^ 22S.11. Belinsky SA, Nikula KJ, Palmisano WA, et al.

Aberrant methylation of p16(INK4a) is an early eventinlung cancer anda potential biomarker for early diag-nosis. Proc Natl Acad Sci U S A 1998;95:11891^ 6.

12. Esteller M, Sanchez-Cespedes M, Rosell R, et al.Detection of aberrant promoter hypermethylation of tu-mor suppressor genes inserum DNA fromnon-small celllung cancer patients.CancerRes1999;59:67 ^ 70.

13. Ahrendt SA, Chow JT, Xu LH, et al. Moleculardetection of tumor cells inbronchoalveolarlavagefluidfrom patients with early stage lung cancer. J NatlCancer Inst1999;91:332 ^ 9.

14. Palmisano WA, Divine KK, Saccomanno G, et al.Predicting lung cancer by detecting aberrant pro-moter methylation in sputum. Cancer Res 2000;60:5954^8.

15. Zochbauer-Muller S, Fong KM, Virmani AK, et al.Aberrant promoter methylation of multiple genes innon-small cell lung cancers. C ancer Res 2001;61:249^55.

16. Hastie ND, Bishop JO. The expression of threeabundance classes of messenger RNA in mousetissues. Cell 1976;9:761 ^ 74.

17. Ming L, Wang P, Bank A, Yu J, Zhang L. PUMA dis-sociates Bax andBCL-XL to induce apoptosis in coloncancer cells. J Biol Chem 2006;281:16034 ^ 42.

18. Yu J,Yue W,Wu B, Zhang L. PUMA sensitizes lungcancer cells to chemotherapeutic agents and irradia-tion. Clin Cancer Res 2006;12:2928^ 36.

19. Herman JG, Graff JR, Myohanen S, Nelkin BD, Bay-lin SB. Methylation-specific PCR: a novel PCR assayfor methylation status of CpG islands. Proc Natl Acad

Sci U S A1996;93:9821 ^ 6.20. Zhang L, ZhouW,VelculescuVE, et al. Gene Expres-

sion Profiles in Normal and Cancer Cells. Science1997;276:1268 ^ 72.

21. Burbee DG, Forgacs E, Zochbauer-Muller S, et al.Epigenetic inactivation of RASSF1A in lung andbreastcancers and malignant phenotype suppression. JNatlCancer Inst 2001;93:691^ 9.

22. Kohli M, Yu J, Seaman C, et al. SMAC/Diablo-de-pendent apoptosis induced by nonsteroidal antiin-flammatory drugs (NSAIDs) in colon cancer cells.Proc Natl Acad Sci U S A 2004;101:16897^ 902.

23. Wang P,YuJ, Zhang L.The nuclear function of p53 isrequired for PUMA-mediated apoptosis induced byDNA damage. Proc Natl Acad Sci U S A 2007;104:4054^9.

24. Boon K, Osorio EC, Greenhut SF, et al. An anatomyof normal and malignant gene expression. Proc Natl

Acad Sci U S A 2002;99:11287^ 92.25. Nacht M, DrachevaT, GaoY, et al. Molecular charac-

teristics of non-small cell lung cancer. Proc Natl AcadSci U S A 2001;98:15203^ 8.

26. KinnulaVL, CrapoJD. Superoxide dismutases in thelung and human lung diseases. Am J Respir Crit CareMed 2003;167:1600 ^ 19.

27. Dallol A, Da Silva NF, Viacava P, et al. SLIT2, ahuman homologue of the Drosophila Slit2 gene, hastumor suppressoractivity andis frequentlyinactivatedin lung and breast cancers. Cancer Res 2002;62:5874 ^ 80.

28. Zabarovsky ER, Lerman MI, Minna JD. Tumor sup-pressor genes on chromosome 3p involved in thepathogenesis of lung and other cancers. Oncogene2002;21:6915 ^ 35.

29. Miller YE, Minna JD, Gazdar AF. La ck of expressionof aminoacylase-1 in small cell lung cancer. Evidencefor inactivation of genes encoded by chromosome3p. JClin Invest 1989;83:2120 ^ 4.

30. Yamashita K, Upadhyay S, Osada M, et al. Pharma-cologic unmasking of epigenetically silenced tumorsuppressor genes in esophageal squamous cell carci-noma. Cancer Cell 2002;2:485^ 95.

31. Lodygin D, Epanchintsev A, Menssen A, Diebold J,Hermeking H. Functional epigenomics identifiesgenes frequently silenced in prostate cancer. CancerRes 2005;65:4218^ 27.

32. Yamashita K, Park HL, Kim MS, et al. PGP9.5 meth-ylation in diffuse-type gastric cancer. Cancer Res2006;66:3921 ^ 7.

33. Dammann R, Strunnikova M, Schagdarsurengin U,et al. CpG island methylation and expression of

tumour-associated genes in lung carcinoma. Eur JCancer 2005;41:1223 ^ 36.

34. McLatchie LM, Fraser NJ, Main MJ, et al. RAMPsregulate the transport and ligand specificity of thecalcitonin-receptor-like receptor. Nature 1998;393:333^9.

35. Abasolo I,Yang L, Haleem R, et al. Overexpressionof adrenomedullin gene markedly inhibits proliferationof PC3 prostate cancer cells in vitro and in vivo. MolCell Endocrinol 2003;199:179 ^ 87.

36. Gallagher WM, Currid CA, Whelan LC. Fibulins andcancer: friend or foe? Trends Mol Med 2005;11:336^40.

37. Klenotic PA, Munier FL, Marmorstein LY, Anand-Apte B. Tissue inhibitor of metalloproteinases-3(TIMP-3) is a binding partner of epithelial growth fac-tor-containing fibulin-like extracellular matrix protein 1(EFEMP1). Implications for macular degenerations.

J Biol Chem 2004;279:30469 ^ 73.38. Albig AR, NeilJR, SchiemannWP. Fibulins 3 and 5

antagonize tumor angiogenesis in vivo. Cancer Res2006;66:2621 ^ 9.

39. Xian J, Aitchison A, Bobrow L, et al. Targeted dis-ruption of the 3p12 gene, Dutt1/Robo1, predisposesmice to lung adenocarcinomas and lymphomas withmethylation of the gene promoter. Cancer Res 2004;64:6432^7.

40. Xian J, Clark KJ, Fordham R, et al. Inadequate lungdevelopment and bronchial hyperplasia in mice with atargeted deletion in the Dutt1/Robo1 gene. Proc NatlAcad Sci U S A 2001;98:15062 ^ 6.

41. TsujiuchiT, Sasaki Y, Oka Y, Kuniyasu H,Tsutsumi M.Alterations of the Dutt1/Robo1gene in lung adenocar-cinomas induced by N-nitrosobis(2-hydroxypropyl)-amine in rats. Mol Carcinog 2004;40:241^ 6.

42. Jen J,Wu L, Sidransky D. An overviewon the isola-tion and analysis of circulating tumor DNA in plasmaand serum. Ann N Y Acad Sci 2000;906:8 ^ 12.

43. Hoque MO, BegumS,Topaloglu O,et al. Quantitativedetection of promoter hypermethylation of multiplegenes in the tumor, urine, and se rum DNA of patientswith renalcancer. Cancer Res2004;64:5511 ^ 7.

HumanCancer Biology


clin cancer res 2007 yue 4336 44

Documents