cloning antifreeze gene from prochlorococcus marinus str. mit 9319

13
Cloning Antifreeze gene from Prochlorococcus marinus str. MIT 9319 Brandon Ramirez Serge Marraback

Upload: kurt

Post on 23-Feb-2016

37 views

Category:

Documents


0 download

DESCRIPTION

Cloning Antifreeze gene from Prochlorococcus marinus str. MIT 9319 . Brandon Ramirez Serge Marraback. Source Organism. Prochlorococcus marinus str. MIT 9313 These bacteria belong to the photosynthetic picoplankton and are probably the most abundant photosynthetic organism on Earth. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

Cloning Antifreeze gene from Prochlorococcus marinus str. MIT 9319

Brandon Ramirez Serge Marraback

Page 2: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

Source Organism Prochlorococcus marinus str. MIT 9313

These bacteria belong to the photosynthetic picoplankton and are probably the most abundant photosynthetic organism on Earth.

Prokaryotes No Introns

Currently in contact with MIT (Chisholm Laboratory) for organism

Page 3: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

Growing Prochlorococcus Marinus-cultures have

been isolated and maintained in natural seawater-based media. The compositions of which have evolved over the years

They differ in a number of ways, primarily with respect to the type and concentration of the macronutrients and metal chelators.

Page 4: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

We plan to get medium from MIT (Chisholm Laboratory)

Page 5: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

GOI: PMT1149 Accession #: NP_894980 GI: 33863420 372 bp, 124 aa Responsible for the production

of a Type I antifreeze protein

Page 6: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

Antifreeze Proteins There are 4 known Antifreeze proteins

Type I, Type II, Type III and Type IV Structure differs by type

The 4 known types evolved independently. Function is the same in all types

To bind to ice crystals and inhibit growth Has multiple repeat regions of (Threonine-

alanine(or Proline)-alanine)

Page 7: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

DNA Sequence & Primers with BioBricks

atggcgtatccggaaagccaggtggtgatgggcggcctggtgcatattccgattattattggcgtgttttgggcgctgaacaacctgaccaccggcggcagcaaagcgaaaaaagcggcggaagcgcaggcgaaacaggcggcggaagaagcggcggcgaaagcggcggcggaagcggcggcgaaacaggcggcggaacaggcggcggcgaaagcggcggcggaagcggcggcggcgaaaaaagcggcggaagcggcggcgagcgcggcgccggcggcgaccgcggcgaccccggtgagcggcgaagcggaaaccagccaggcgagcaacaacgatacccaggcgaccccggcgccggatcaggaagtgctg

No Introns (Prokaryote) and no restriction sites in code

gaattcgcggccgcttctagatggcgtatccggaaagcca

gcggcctagaccttcacgtctactagtagcggccgctgcag

5’ 3’

3’ 5’

Page 8: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

Plan for cloningExtract DNA from source organism

Gel Electrophoresis

Amplify gene by PCR

Insert gene into vector

Transformation into E. Coli cells

Test for gene transfer

Page 9: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

Vector & Regulator Vector: pSB2K3 Resistance to Kanamycin

Page 10: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

Promoter First choice: BBa_K360041

Minimum blue light promoter Weak promoter ycgF receptor is responsive to blue light, when struck with

blue light it dimerizes and binds to the ycgE repressor releasing the repressor from the promoter.

Backups: BBa_I0500

Pbad Inducible by L-arabanose

BBa_K258005 Oxygen Promoter-Vitreoscilla hemoglobin(VHb) promoter in E.

coli.

Page 11: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

Interface Cut into vector at SpeI restriction enzyme site on plasmid

Suffix of plasmid……tactagtagcggccgctgcag……atgatcatcgccggcgacgtc Cut at XbaI restriction enzyme on biobrick Prefix & Suffix of biobrickgaattcgcggccgcttctaga-GENE-tactagtagcggccgctgcaggttaagcgccggcgaagatct-GENE-atgatcatcgccggcgacgtc Ligate ……tactaga-GENE-tactagtagcggccgctgcag ……atgatct-GENE-atgatcatcgccggcgacgtc

Page 12: Cloning Antifreeze gene from  Prochlorococcus marinus  str. MIT 9319

testing Testing for freezing point depression

The possibility of lowering the freezing temperature of E. Coli

E. Coli begins to die around -18 Celcius (0 Farenheit)

With Antifreeze protein we will see if this point of cell death can be lowered

The gene will be tested for by SDS-PAGE 12.06 kD