Computing For Biology

An online course for A-level students

Runs 18th to 29th August 2014

TCGATTCCAGAACTAGGCATTATAGATAGATTCAGATAGGACATAGATCGATTCAGATAGGATATAATCGATAGATTAGATTAGATTAAGATTCCAGATAGGATATAGATAG

110111110101010011010110111101010100110101101010011010110111111101010100110101101111010101001101011011010101

00110101101

http://sysmic.ac.uk/comp-bio-course

Computers play a vital role in much modern biological research. Experimental advances mean scientists often collect huge amounts of data that needs to be examined and analysed; faster processors mean it is possible to simulate ever more complex biological processes.  This course provides an introduction to programming so that biology students can boost their skills and get a head start in their academic and research careers.

Why is computing important to biologists?

The course will introduce students to computer programing using examples from biology.  We start with basic steps in computer programming leading to the use of software tools and libraries to perform advanced tasks. Support will be provided in interactive Q&A sessions and through forums staffed by course tutors. 

Programme

1 - Mathematics in Nature Patterns can be seen throughout the natural world. What maths lie behind these patterns and can we explain how they come about? 

2 - Bioinformatics As sequencing DNA becomes faster and cheaper we may soon all have access to our own genetic code.  How can we deal with this data and determine its implications?

3 – The Web of Life

Interactions in nature form complex networks such as food webs, or the system of chemical reactions taking place in every organism.  How can biologists use computers to help study these systems?

 4 - SimLife In the near future colonies of digital organisms might live out their lives within computer processors.

How can we create simulations which give us insights into the natural world.

5 – Complexity and chaos Scientists often find that the way biological systems behave can be difficult or impossible to predict by intuition.  How can sets of simple rules lead to complex behaviour? 

Course Details  No previous computer programming experience is required.

Each of the five sessions includes background reading and programming activities. They should take 2-3 hours to complete although extension tasks are available.

Online support will be available during the period 18th – 29th August. You are free to work on the sessions at a pace that suits you over this period.

Software Details The Python language will be used in programming activities.

All required software will be made available for download and installed by students from the start of August. Online support on how to install the software will be availble.

Students will need access to a PC (running Windows /Mac OS / Linux) on which they can install this software.

Sign up and find further information at:

sysmic.ac.uk/comp-bio-course

Questions?

email: computing4biology@sysmic.ac.uk

All images taken from WikiMedia Commonsexcept WATOR 2 graphic from http://www.kanitrino.de