Ct

QHa

b

c

d

e

a

ARRAA

1

s[titHBamai1h

0d

Vaccine 27 (2009) 1145–1153

Contents lists available at ScienceDirect

Vaccine

journa l homepage: www.e lsev ier .com/ locate /vacc ine

onstruction and characterization of a replication-competent human adenovirusype 3-based vector as a live-vaccine candidate and a viral delivery vector

iwei Zhanga,b,1, Xiaobo Suc,d,1, Donald Setoe, Bo-jian Zhengb, Xingui Tiana, Huiying Shenga,aitao Lia, Youshao Wangc, Rong Zhoua,∗

Central Laboratory, Guangzhou Children’s Hospital, 318 Renmin Zhong Road, Guangzhou 510120, ChinaDepartment of Microbiology, The University of Hong Kong, Pokfulam, Hong Kong SAR, ChinaSouth China Institute of Oceanology, LED, Chinese Academy of Sciences, Guangzhou 51030, ChinaGraduate School of Chinese Academy of Sciences, Beijing 100049, ChinaDepartment of Bioinformatics and Computational Biology, George Mason University, Manassas, VA, USA

r t i c l e i n f o

rticle history:eceived 24 October 2008eceived in revised form 7 December 2008ccepted 20 December 2008vailable online 13 January 2009

a b s t r a c t

In southern China, as well as in neighboring Asian regions, human adenovirus type 3 (HAdV-3) outbreakshave become very prevalent in recent years. To address this problem regionally and globally, a recom-binant virus has been constructed, containing a full-length infectious genomic clone of HAdV-3, to actas a vaccine. This was constructed by using a bacterial homologous recombination mechanism and wasbased on the cloning, manipulation and maintenance of the full-length adenovirus genome as a stableplasmid in E. coli. The resultant recombinant viral DNA was screened, identified and characterized byduplex PCR, Western blot, indirect immunofluorescence assay and electron microscopy. This putative

vaccine strain was shown to be fully infectious in permissive cells, and no genome mutations were foundin the recombinant plasmid. To demonstrate the utility of such a vaccine, a recombinant HAdV-3 plasmidexpressing the reporter molecule eGFP was also constructed. This confirmed the recombinant proteinexpression capability. Mice immunized with this recombinant eGFP adenovirus by either intramuscularinjection, intragastric or intranasal inoculation routes raised a significant antibody response to eGFP. Ourresults have provided a solid foundation for development of a recombinant live vaccine and potential

s vect

more effective adenoviru

. Introduction

There are 52 serotypes of HAdV [1], which are classified into sixpecies based on oncogenicity in rodents, electrophoretic mobility2], genome identity [3], serum neutralization and haemagglutina-ion–inhibition tests [4]. Of these, the B species (HAdV-B) is dividednto two subspecies: B1, which includes HAdV-3, -7, -16, -21, -50 andhe simian (chimpanzee hosted) SAdV-21; and B2, which includesAdV-11, -14, -34 and -35 [3,5,6]. With the exception of HAdV-50,1 viruses are commonly associated with respiratory diseases, suchs acute respiratory disease (ARD) [7,8]. HAdV-3, -7 and species Eember HAdV-4 infections have occurred epidemically as ARD and

s outbreaks in Asia, Europe, the Americas and Oceania [9–11]; thats, it is a pandemic problem. As an example, in Japan, from 1982 to993, most respiratory-based diseases attributed to HAdV in Japanave been reported to be due to HAdV-3 [12].

∗ Corresponding author. Tel.: +86 20 3229 0712; fax: +86 20 3229 0712.E-mail addresses: zhang.qiwei@yahoo.com, zhou3218@yahoo.com (R. Zhou).

1 These authors contributed equally to this paper.

264-410X/$ – see front matter © 2008 Elsevier Ltd. All rights reserved.oi:10.1016/j.vaccine.2008.12.039

or-based delivery system for immune and gene therapy.© 2008 Elsevier Ltd. All rights reserved.

Also, recently, in the civilian population within the U.S., an out-break of HAdV-3 infection in a long-term care facility for childrenwith severe neurologic impairment was reported in 2005 [13].The HAdV-3 virus had not been endemic for a few decades inU.S. Once HAdV-3 is re-introduced, it may spread rapidly amongnon-immune young people. A close surveillance is needed inorder to prevent HAdV-3 nosocomial infections. The previousabsence of circulating HAdV-3 led to a corresponding lower levelof herd immunity, as the general population was not exposed tothe particular virus. This is reflected in the observation that theHAdV-3-specific neutralizing antibodies are very low. In China, 709patients in nine townships of Jiangsu Province were reported illwith mild respiratory tract infection, an outbreak attributed toHAdV-3 [14]. In the same year, 258 children in one kindergartenlocated in Guangzhou (Guangdong Province) were sick, infectedwith HAdV-3 [15,16]. Similar outbreaks were also reported in three

additional provinces of southern China in the last few years [17]. InTaiwan, HAdV-3 has become the predominant serotype responsi-ble for the respiratory disease outbreak in the recent years [18,19].These frequent outbreaks indicate that no or low HAdV-3 neutral-izing antibodies were produced by people before the infections.

1 cine 27

Tiftai[tapnio

a(bncvartb

btCrCbetb

uacntetsii

2

2

mcfwpafi

2

(EgT

146 Q. Zhang et al. / Vac

his relatively low prevalence of type-specific HAdV-3 antibodiesn China is also an indication of the lack of herd immunity, evidentlyalling below a critical level to prevent a pathogen from taking hold,o HAdV-3. It is likely a contributing prerequisite for the HAdV-3-ssociated epidemic outbreaks that have been particularly frequentn recent years. Fatalities have been reported with this serotype20], adding another dimension to its toll. Therefore, it makes senseo have a safe, effective, readily available and inexpensive vaccinegainst this virus in the countries with very dense and vulnerableopulations, especially where the prevalence of HAdV-3-specificeutralizing antibodies is very low. If so, it will produce high herd

mmunity to HAdV-3 in the population. Consequently, few outbreakf HAdV-3 will appear.

Most gene therapy vectors used in human clinical applicationsre currently based on species C human adenovirus serotype 5HAdV-5) or serotype 2 (HAdV-2). The species C viruses seem toe endemic as they infect the younger population giving eithero symptoms or mild respiratory symptoms [21]. As a result, thelinical applications of HAdV-2- and HAdV-5-based gene-transferectors are limited because of the more pre-existing immunitygainst them [22,23]. The lack of the coxsackie and adenoviruseceptor (CAR) or integrin expression in cells, which could affecthe safety and limit the efficacy of adenovirus vector [24,25], maye problematic as well.

More recently, vectors based entirely on HAdV-B species haveeen developed [26–29]; these have an additional advantage in thathey can also infect hematopoietic and dendritic cells. Unlike the A,, D, E and F HAdVs, which utilize the CAR as a primary attachmenteceptor [30], HAdV-3 gains entry into cells through the receptorsDX, CD46, CD80 or CD86 [31–36], rather than the CAR. HAdV-3-ased vectors can potentially infect multiple cell types that expressither no or low levels of CAR, including important gene therapyarget cells. Therefore, HAdV-3 may be an alternative to HAdV-5-ased gene-transfer vectors [31,37].

To generate a resource for the characterization of HAdV-3 forse as a gene delivery vector for immunity or gene therapy or asvector for DNA-based vaccines, a full-length infectious genomic

lone was constructed using the bacterial homologous recombi-ation machinery. In addition, to allow the characterization ofhe recombinant protein expression, a HAdV-3 expression vectorxpressing eGFP in E3 region was also constructed. These wereested using mice as models and the recombinant protein expres-ion proved successful. Three immunization methods were used,ncluding intramuscular injection, intragastric immunization andntranasal inoculation of mice with the recombinant viruses.

. Materials and methods

.1. Animals, cells, virus strains and viral genome

Female BALB/C mice (6–8 weeks) were purchased from the Ani-al Center at Sun Yat-sen University, and housed in pathogen-free

onditions. HAdV-3 strains GZ1 (Strain GZ1) was isolated originallyrom a child with ARD and cultured in HEp-2 cells [38]. The cellsere grown in Dulbecco’s modified Eagle’s medium (DMEM) sup-lemented with 100 IU penicillin ml−1, 100 mg streptomycin ml−1

nd 8% (v/v) fetal calf serum. Viral genome was extracted by modi-ed protease K-digest method without virus purification [39].

.2. Enzymes, bacteria and plasmids

Restriction enzymes were purchased from New England BiolabsMA, USA) and used according to the manufacturer’s instructions.. coli BJ5183 and pBluescript II SK (+) were purchased from Strata-ene (CA, USA). Plasmid PBR322 and pEGFP C2 were purchased fromAKARA Co. (Dalian, China).

(2009) 1145–1153

2.3. Construction of a plasmid containing the full-lengthinfectious genome of HAdV-3

To develop a plasmid containing the entire full-length genome ofHAdV-3, a strategy was employed using the highly efficient homol-ogous recombination system in E. coli BJ5183, based on recABCD,as described earlier [40,41]. First, the rescue plasmid pBRALR con-taining the left and right end of HAdV-3 genome was constructed.The PCR-generated left and right fragments, AdL and AdR, werecloned into pBR322. AdL, containing 1391 bp of the HAdV-3 leftend of the genome, was PCR-amplified using a forward primer,AdLU1 (5′-GAATTCGCGATCGCTATCTATATAATATACCTTATAGATGG-3′), containing the restriction sites EcoRI and AsiSI, and a reverseprimer, AdLD1 (5′-CTGCTGTGGATAAGCTTGAG-3′), containingthe restriction site HindIII. The AdL fragment was cloned intopBR322 using the EcoRI and HindIII restriction sites, resultingin pBRAL. AdR, encompassing 2025 bp of the HAdV-3 right endsequence of the genome, was PCR-amplified using the forwardprimer AdRU (5′-AACAAAGCTTACACTATGCATAGTCATAGTATC-3′),containing the restriction site HindIII, and the reverse primerAdRD (5′-AGTCGACGCGATCGCTATCTATATAATATACCTTATAGATG-3′), containing the restriction sites SalI and AsiSI. This fragmentwas cloned into pBRAL by using the HindIII and SalI restric-tion sites. The resultant constructed rescue plasmid pBRALRwas linearized using the unique restriction enzyme HindIIIand then dephosphorylated with calf alkaline phosphatase(Fig. 1).

Approximately 100 ng each of purified HAdV-3 genomic DNAand the linearized rescued plasmid were mixed and transformedinto 100 �l of competent E. coli BJ5183 cells by electropo-ration. The cells were grown and selected on LB-ampicillinagar plates and grown for 12–16 h. Small clones were selectedand incubated for no more than 6 h. From one clone, plas-mid DNA was extracted and identified by duplex PCR. The firstpair of primers used was GRS2624F (5′-CCCCGAAAAGTGCCACCT-3′), which is identical to the pBR322 sequence around EcoRI,and T-X-3233.W1R (5′-GATACACAAGATAAAGCAGC-3′), which isidentical to the HAdV-3 genome sequence from 2521 to2540. The product is 2646 bp. A second pair of primers,Ad33588F (5′-TCCTCACATCGTGGTAACTGG-3′), which is identicalto 33,348–33,368, and GRS2622R (5′-TCTTCTTTATCATGCAACTC-3′),which is identical to pBR322 sequence around SalI, were used,generating a 2040 bp product. Duplex PCR-positive plasmid DNAwas then transformed into DH5� cells. One colony from each plas-mid transformant was selected and grown. A Qiagen plasmid kitwas used to prepare mini-preps of the recombinant plasmid DNA.Suitable restriction enzymes (HindIII, BamHI, EcoRI, EcoRV andSalI) were chosen to identify any possible rearrangements amongthe HAdV-3 genomes. To determine the infectivity of recombi-nant clone pBRAdV, the positive plasmid DNA was digested withAsiSI, which bordered both ends of HAdV-3 genome. The linearizedHAdV-3 genome DNA released from the pBRAdV plasmid was trans-fected into HEp-2 cells using Lipofetamine 2000 (Invitrogen; CA,USA). The cells were examined for evidence of cytopathic effectdaily. At 96 h post-transfection, the cells were harvested. Cells werefrozen and thawed for three cycles and new cultured HEp-2 cellswere infected with this viral suspension. At 96 h post-infection, thevirus was harvested.

2.4. Construction of E3-defective replication-competent eGFPexpression vector

The rescue and reporter plasmid pSKE3LCMV-eGFP-SV40E3Rwas constructed by cloning the PCR-generated fragments E3L andE3R into pBluescript II SK(+) using KpnI, ClaI and SpeI, NotI, respec-tively; this plasmid was named pSKE3LR. Fragment E3L was a

Q. Zhang et al. / Vaccine 27 (2009) 1145–1153 1147

eleted

92aT

Fig. 1. Construction of the infectious clone and E3-d

73 bp segment that corresponds to the HAdV-3 genome from6,782 to 27,736 (Genbank accession no. DQ099432). This wasmplified by PCR using the primers AdE3LF (5′ GCGGGTACCAGGAC-ACTCCACCCG 3′; inserted at the restriction site KpnI) and

HAdV-3 vector expressing the eGFP reporter gene.

AdE3LR (TGAATCGATGGTAGTCCGTAGGAGGGTC 3′; inserted at therestriction site ClaI). Fragment E3R was a 1020 bp segment that cor-responds to the HAdV-3 genome from 30,900 to 31,901. This wasamplified with PCR using the primers AdE3RF (5′ TCGACTAGTATAC-

1 cine 27

G(tiECpTASCeyTHuttTGrf

2

drgHbGa3c

pattiBa

2

rc71pH3iwcJ

2

hio

148 Q. Zhang et al. / Vac

AGCTCGGTCC 3′; inserted at the restriction site SpeI) and AdE3RR5′ AATGCGGCCGCAGTGGCATCAAAGTA 3′; inserted at the restric-ion site NotI). The resulting recombinant genome is now defectiven the E3 region (3203 bp), but is still replication-competent as the3 region is not required for viral replication [42]. The reporterMV-eGFP-SV40 expression cassette was derived from the plasmidEGFP C2 using the primers CGSF (5′ GGTATCGATAGTTATTAATAG-AATCAATTAC 3′; insert at the restriction site ClaI) and CGSR (5′

ATACTAGTGCAGTGAAAAAAATGC 3′; insert at the restriction sitepeI). This amplicon was cloned into plasmid pSKE3LR via thelaI and SpeI sites, resulting in the rescue plasmid pSKE3LCMV-GFP-SV40R. This rescue plasmid was digested by EcoRV and NotI,ielding the linearized homology cassette E3LCMV-eGFP-SV40R.he plasmid pBRAdV was linearized by the unique RsrII site in theAdV-3-derived E3 region. This fragment was dephosphorylatedsing alkaline phosphatase, and the two linear fragments were co-ransformed into the BJ5183 cells. PCR was used to screen, usingwo pairs of primers (GFP1: 5′ CGCCACCATGGTGAGCAA 3′; GFP2: 5′

TACTTGTACAGCTCGTCCATGC 3′ and Ad11134F: 5′ CGAGGAGCCA-AGGAGA 3′; Ad11666R: 5′ TGCGAGCGTAGTATTTGC 3′’). Resultant

ecombinant plasmids were screened by AsiSI digestion and trans-ected into HEp-2 cells (Fig. 1).

.5. Western blotting analysis

Western blotting analysis was performed according to stan-ard protocols [43]. For the detection of recombinant adenovirusHAdV-3, the cell extracts were fractionated on a SDS-PAGEel, blotted onto nitrocellulose membrane, and probed with aAdV-3-hexon-specific polyclonal antibody, derived from rab-its (Central Laboratory of the Guangzhou Children’s Hospital,uangzhou). The signal was amplified using a HRP-labeled goatnti-rabbit IgG conjugate (Sigma–Aldrich Corp.). The chromophore,3′-diaminobenzidine (DAB) was used in order to monitor theolor-based signal.

For the screening and detection of immunized BALB/C mice, GFProtein was obtained from Millipore Corp. Samples were fraction-ted by SDS-PAGE. After blotting onto the nitrocellulose membrane,he membrane was incubated with the 50-fold diluted serum fromhe BALB/C mice that had been immunized by one of three routes:ntramuscular, intragastric or intranasal inoculations. Serum fromALB/C mice mock-immunized by wild-type HAdV-3 GZ1 was useds a control.

.6. Indirect immunofluorescence assay

The hexon protein expressed by the recombinant adenovirusHAdV-3 from pBRAdV in HEp-2 cells was evaluated using a spe-ific indirect immunofluorescence assay. HEp-2 cell monolayers at2 h post-infection with rHAdV-3 were fixed in methanol (−20 ◦C,0 min) and incubated (37 ◦C, 1 h) with 500 �l rabbit anti-hexonolyclonal antibody (Central Laboratory of Guangzhou Children’sospital). The resulting fixed monolayers were incubated (37 ◦C,0 min) with goat anti-rabbit IgG labeled with fluorescence isoth-

ocyanate (FITC) (KPL Co. Ltd., USA). Finally, the monolayers boundith the marker were covered with glycerin and examined for spe-

ific fluorescence under a fluorescence microscopy (Olympus Corp.,apan).

.7. Transmission electron microscopy (TEM)

The HEp-2 cells infected with rHAdV-3 and rAd�E3GFP werearvested at 72 h post-infection. These cells were prepared follow-

ng the standard protocols and the ultrathin section samples werebserved using TEM techniques (JEM-2010, Jeol).

(2009) 1145–1153

2.8. Growth characteristics of rHAdV-3

To evaluate the DNA replication efficiency of rHAdV-3 andrAd�E3GFP, quantitative PCR was performed with HAdV-3 usinga commercially available Q-PCR kit (Huayin Corp.; Guangzhou,China). HEp-2 cells were cultured in 24-well plates and inoculatedwith 1 × 107 DNA copies of HAdV-3 GZ1, rHAdV-3 and rAd�E3GFP,respectively. The infected cells were harvested after 12 h, 24 h, 36 h,48 h, 60 h, 72 h periods and viral genomic DNA copy numbers weredetermined. Data analyses were performed with the Origin 7.5 soft-ware (OriginLab Corp., Northampton, MA, USA). The total infectiontiters of the final harvested viruses in infectious units (IFU)/ml weredetermined using the Adeno-X rapid titer kit (Clontech).

2.9. Animal immunization

Thirty mice were divided into five groups and immunized withrecombinant adenovirus rAd�E3GFP by one of three routes: intra-muscular injection, intragastric inoculation (1010 copies/ml, 0.2 ml)and intranasal inoculation (1011 copies/ml, 0.02 ml). Control micewere intramuscularly injected with 0.2 ml wild-type HAdV-3 GZ1(1010 copies/ml) and PBS, respectively. The immunity was boostedevery 2 weeks. At 42 days after the first immunization, blood sam-ples were collected from the mice and the sera were isolated andkept frozen for the serology test.

2.10. Serological assays

HAdV-3-neutralizing sera antibody titers were determinedusing a previously described protocol [44]. Sera from mice immu-nized with rAd�E3GFP by intramuscular injection, intragastricinoculation and intranasal inoculation were tested. Anti-HAdV-3serum raised in rabbits against purified HAdV-3 (Central Laboratoryof the Guangzhou Children’s Hospital, Guangzhou) was used as pos-itive serum control. The virus neutralization titer is defined as thereciprocal of the highest serum dilution that completely preventedthe development of cytopathic effect.

3. Results

3.1. Generation and screening of recombinant HAdV-3 plasmids

The duplex PCR was performed to screen for positive clonespBRAdV, using the plasmid from homologous recombinant astemplates. When linearized HAdV-3 genome and pBRALR wererecombined, circular plasmids formed (Fig. 1). The primersGRS2624F and GRS2622R were contained within the pBR322sequence, while primers T-X-3233.W1R and Ad33588F were at bothends of HAdV-3 genome. Only recombinant circular plasmids couldproduce two fragments by this duplex PCR. In the screening ofpBRAdV, twenty positive clones were obtained by duplex PCR fromfifty selective clones (data not shown). Similarly, primers GFP1 andGFP2 amplified part of the GFP gene (720 bp) in the E3LCMV-eGFP-SV40R cassette, and primers Ad11134F and Ad11666R amplified thegene (533 bp) in linearized plasmid pBRAdV. Ten positive recom-binants pBRAd�E3GFP were obtained from forty clones by thisscreening method.

3.2. Western blot analysis of recombinant HAdV-3

To confirm the expression of hexon proteins in the enzyme-digested-pBRAdV transfected HEp-2 cells, the rHAdV-3s isolatedfrom the first to the fifth passage were analyzed by Western blotwith HAdV-3-hexon-specific polyclonal antibody (Fig. 2). A bandwas visible in the HAdV-3-infected cell extracts (lanes 2–5) at

Q. Zhang et al. / Vaccine 27 (2009) 1145–1153 1149

Fbar

af

3

rHgwf

3

a

Fp(lH

ig. 2. Western blot result of recombinant HAdV-3. The hexon proteins expressedy each passage of rHAdV-3 were detected by HAdV-3-hexon-specific polyclonalntibody. M: prestained protein marker; 1–5: the first to fifth passage of theHAdV-3.

pproximately 106 kDa size. In the first passage, no bands wereound.

.3. Indirect immunofluorescence assay

For the detection of the hexon protein expression, the indi-ect immunofluorescence assay was performed. CPE appeared inEp-2 cells infected with the fifth-passage rHAdV-3 (Fig. 3A) andreen fluorescence was observed (Fig. 3B). No green fluorescenceas found in mock-infected cells. Adenovirus-related CPE was also

ound in the cells with green fluorescence.

.4. Electron microscopic observation

Dense crystalline-like adenovirus particles, with a matrixpproach, 70–90 nm in diameter, were found in the nuclei of HEp-

ig. 3. Indirect immunofluorescence assay for the detection of the rHAdV-3 hexonrotein The HAdV-3-hexon-specific polyclonal antibody was used for the detection.A) The HEp-2 cells infected with the fifth-passage recovered HAdV-3 in ordinaryight microscope. (B) The HEp-2 cells infected with the fifth-passage recoveredAdV-3 in fluorescence microscope.

Fig. 4. Electron micrograph visualization of rHAdV-3 and rAd�E3GFP viruses. (A)Electron micrograph of rHAdV-3 (20,000×). (B) Electron micrograph of rAd�E3GFP(21,000×).

2 cells infected with rHAdV-3 and rAd�E3GFP (Fig. 4). Theseconfirmed the infectious and replication competence of both theconstructed vectors.

3.5. The identification of recombinant HAdV-3 genomic sequence

To identify if any differences in genomic sequences exist

between the recombinant and wild-type HAdV-3, a restrictionenzyme analysis of the rHAdV-3 and rAd�E3GFP genome extractedfrom transfected HEp-2 cells was performed (Fig. 5). Comparedwith the in silico restriction map produced by the Vector NTI 10.3.0software (Invitrogen Corp.; San Diego), the restriction profiles of

1150 Q. Zhang et al. / Vaccine 27 (2009) 1145–1153

Fig. 5. Restriction enzyme analysis of recombinant HAdV-3 genome. (A) The restriction profile of rHAdV-3 genome. (1) HAdV-3 genome; (2) rHAdV-3/NotI; (3) rHAdV-3/EcoRV;(4) rHAdV-3/EcoRI; (5) rHAdV-3/BamHI; (6) rHAdV-3/HindIII; (7) rHAdV-3/SmaI; M: 1 kb DNA ladder marker. (B) The in silico restriction map of rHAdV-3 genome produced byt rAd�( er. (D1

r3robaCf

3

mfltalTi(

3

c

he Vector NTI 10.3.0 software. (C) The restriction profile of rAd�E3GFP genome. (1)5) rAd�E3GFP/BamHI; (6) rAd�E3GFP/SmaI; (7) rAd�E3GFP/XbaI; M: 1 kb mark0.3.0 software.

HAdV-3 genome were consistent with that of wild-type HAdV-GZ1 strain (Fig. 5A and B). Similarly, the restriction profiles of

Ad�E3GFP genome were also consistent as well (Fig. 5C and D). Allf the PCR-generated DNA fragments were sequenced. In addition,oth ends of the genomes as well as parts of middle of the rHAdV-3nd rAd�E3GFP genome were selected at random and sequenced.ompared with the reference HAdV-3 GZ1 strain, no difference was

ound in the sequencing results.

.6. Fluorescence microscopy of rAd�E3GFP

Plasmid pBRAd�E3GFP was digested and resultant DNA frag-ents were transfected into HEp-2 cells. After 24 h, green

uorescence was found for most of the cells (Fig. 6A). At 96 h post-ransfection, the cells were harvested and ruptured by freezingnd thawing three times. Newly cultured HEp-2 cells were inocu-ated with the harvested virus and these were harvested after 96 h.his cycle was repeated until the fifth passage, where at 48 h post-nfection, strong green fluorescence was observed from HEp-2 cellsFig. 6B).

.7. Growth characteristics of recombinant adenovirus

The replication of HAdV-3, rHAdV-3 and rAd�E3GFP wereompared by quantification of genomic DNA using real-time PCR

E3GFP/NotI; (2) rAd�E3GFP/EcoRV; (3) rAd�E3GFP/EcoRI; (4) rAd�E3GFP/HindIII;) The in silico restriction map of rAd�E3GFP genome produced by the Vector NTI

method; this was shown in Fig. 7. The replication efficiency ofrHAdV-3 was nearly same as that of wild-type GZ1 strain, butwas slightly higher than that of rAd�E3GFP. The efficiencies ofrAd�E3GFP and rHAdV-3 were very high, and the E3 deletion hadno apparent effect on the replication efficiency of rAd�E3GFP. Thetotal IFU/ml of HAdV-3, rHAdV-3 and rAd�E3GFP harvested at 72 hp.i. are 8 × 1010, 7.2 × 1010, 6.4 × 1010 adenoviral particles, respec-tively.

3.8. Western blot analysis of antibody against eGFP

Antibody against eGFP was detected by Western blot assay frommice immunized with rAd�E3GFP by three routes. The antibodylevel from using intranasal inoculation is the highest. Mice immu-nized by the other routes also produced detectable antibody againsteGFP even though the titer was lower than that by intranasalinjection. No antibody against eGFP was detected from the miceinoculated with wild-type HAdV-3 (Fig. 8).

3.9. HAdV-3-neutralizing antibodies from BALB/C mice by

inoculation with rAd�E3GFP

Sera from mice immunized with rAd�E3GFP by three routeswere tested for HAdV-3 neutralizing antibody by virus neutral-ization assays (Table 1). Whereas the antibody titer produced by

Q. Zhang et al. / Vaccine 27 (2009) 1145–1153 1151

Fbpr

iittc

4

a

Fhw

Fig. 8. Western blot result of antisera from mice Antibody against eGFP in sera ofmice immunized by three routes was detected by eGFP protein from Millipore Corp.

ig. 6. HAdV-3-mediated-eGFP expression in HEp-2 cells. HEp-2 cells were observedy fluorescence microscope. (A) HEp-2 cells 24 h post-transfection with fragmentedBRAd�E3GFP (100×). (B) HEp-2 cells 48 h post-infection with the fifth-passageAd�E3GFP (100×).

ntramuscular injection is the higher than the others, the titer byntranasal inoculation is lower than that by intramuscular injection;his observation is counterintuitive, for mice are not very sensitiveo the HAdV-3 infection in the upper respiratory system. In whichase, a low antibody titer was produced.

. Discussion

For the molecular manipulation of HAdV-3 and development ofvaccine, a major difficulty is that the genome is large, at approx-

ig. 7. The DNA replication curve of HAdV-3, rHAdV-3 and rAd�E3GFP. Cells werearvested at 12 h, 24 h, 36 h, 48 h, 60 h, and 72 h p.i. Viral genomic DNA copy numbersere determined by quantitative PCR with Q-PCR kit.

M: Prestained Protein Marker; (1) pooled antisera from mice by intramuscular injec-tion; (2) pooled antisera from mice by intragastric inoculation; (3) pooled antiserafrom mice by intranasal inoculation; (4) pooled antisera from mice inoculated withwild-type HAdV-3 (negative control).

imately 35 kb. However, having a full-length infectious clone is animportant milestone in developing a vaccine. Serendipitously, thisstrategy also results in a HAdV-based vector that is suitable forapplications in the gene therapy field and the vaccine delivery field.Therefore, this report presents a recombinant HAdV-3 for use as apotential vaccine and also as an alternative and suitable vector thatcan carry and express a recombinant protein.

In the screening of recombinant clones, duplex PCR analysis,together with restriction endonuclease analysis, increases the prob-ability of obtaining the desired clones. The rHAdV-3 genomic DNAwas extracted from the transfected HEp-2 cells and identified byrestriction digestion analysis. The restriction profiles were in accor-dance with that of wild-type HAdV-3 GZ strain. Both ends andportions of the middle regions were sequenced, and no sequencechange was found. All of these data confirmed that the rHAdV-3genome is consistent with that of wild-type strain.

For the construction of the expression vector pBRAd�E3GFP,the infectious genomic clone pBRAdV was linearized and theshuttle vector was fragmented initially by endonucleases beforeco-transformation into BJ5183 cells. This serves to decrease thebackground and increased the odds of selecting the correct recom-binants. In all, a 3164 bp segment in the non-essential E3 region(nt 27,737–30,900) was deleted in rAd�E3GFP genome. The left662 bp and right 218 bp flanking regions remained in place. Thisapparently does not affect the structure of the protein VIII or thefiber. In theory, the total length for the adenovirus vector insertedwith a foreign gene could be 105% long as that of wild-type strain[45]. The genomic sequence of the GZ1 strain is 35273 bp, so amaximum 4.8 kb foreign gene can be inserted into this E3-deletionvector.

A method for constructing an infectious clone based on a bacte-rial artificial chromosome (BAC) has been reported [46]. However,it was apparently not successful using this method, which wasbased on recABCD and using moderate copy number entry vectors.

Although it is not clear whether this is in part due to the genomeof the clinically isolated strain [38] being more stable than that ofHAdV-3 prototype strain GB used [46], the success reported heremay be attributed also to the shortened culture time for the sin-gle colony in LB medium from 12 h to less than 6 h. This avoids

Table 1HAdV-3-neutralizing antibody titers in adenovirus-immunized mice.

Group HAdV-3-neutralizingantibody titers

PBS 0HAdV-3-intramuscularly injected 64rAd�E3GFP-intramuscularly injected 64rAd�E3GFP-intragastricly inoculated 4rAd�E3GFP-intranasally inoculated 8

Sera from mice immunized with rAd�E3GFP by three routes were tested for HAdV-3neutralizing antibody by virus neutralization assays.

1 cine 27

tr

ytafitiiag

papIai

rAfcth1fw1atidlw[crtaopUa

7wseotltvmcecBi2ioT

[

152 Q. Zhang et al. / Vac

he potential problem for multiple recombinations because of highecombinant efficiency of BJ5183 cells.

HAdV-5-based vectors have gained considerable importance forears as the basis for recombinant vaccine and gene therapy vec-ors. The major difference between the species C (mainly HAdV-5)nd the species B HAdVs is the receptor usage for cell entry. This dif-erence may help HAdV-3 to overcome host restrictions and allowt to be an alternative to HAdV-5-based gene-transfer vectors. Onhe other hand, the problem of pre-existing immunity is still anssue for all human adenovirus vectors, including HAdV-3, whilen the countries where the prevalence of neutralization antibodiesgainst HAdV-3 were low, rHAdV vectors may play a certain role inene therapy.

Respiratory illnesses due to HAdV, especially due to HAdV-Bathogens, are a very important issue locally, regionally and glob-lly. These pathogens contribute to a complex heavy toll on theopulation as reflected in the morbidity and mortality burdens.

ronically, it has been demonstrated that an inexpensive, simplend proven vaccine solution is readily at hand, both in the past andn the present!

The strong mucosal immunity can block the initial infection andeduce the progression of disease caused by these viruses [47,48].s an example, infections with B1 HAdVs are a major cause of acute

ebrile and severe respiratory illness among military recruits andivilians worldwide. From the isolation, identification and charac-erization of the first HAdVs in the early 1950s, their importanceas been realized and vaccines were prepared and deployed in the970s. Among U.S. and Canadian basic military trainees, success-ul control of ARD caused by HAdV-4 and HAdV-7 was achievedith the widespread use of live enteric-coated oral vaccines in the

970s [49]. As a result of the success of these vaccines, the ARD anddenovirus-associated pneumonia rates dropped dramatically inhe following 20-year period, which may include the effect of herdmmunity, although this is not well-understood for HAdV-basediseases. This resulted in the misperception that these particu-

ar HAdVs were no longer pathogens of concern and a decisionas made to cease production and deployment of these vaccines

50]. However, when the vaccine production ceased and the vac-ines stocks were depleted, the adenovirus-associated ARD casesebounded back to previously observed and characterized levels inhe military trainee population immediately [51–53]. As a result ofn expedited vaccine development program, new live, oral aden-virus type 4 and type 7 vaccines were re-developed (based on thereviously successful vaccines), and safety tests conducted in the.S. in 2004. These new versions of the vaccines are apparently safend induce prophylactic responses in the study population [54].

Purkayastha et al. sequenced the genomes of HAdV-4 and HAdV-vaccine strains used in the U.S. military, and compared theseith their prototype equivalents. They found that neither vaccine

train appeared to have undergone any mutation or recombinationvents that would lead to attenuated virulence [55]. Both aden-virus strains could selectively infect the lower intestinal tract ashe viruses were administered in enteric-coated capsules and wereocalized. The intestinal mucosa contains immunological structureshat serve as sites for the induction of mucosal immunity againstiral infections. Selective intestinal adenovirus infection stimulatedoderately high levels of neutralizing antibody and was not asso-

iated with any signs or symptoms of illness [56,57]. Recently, Zhut al. immunized mice with recombinant HAdV-5 expressing vac-inia virus ovalbumin and herpes simplex virus type 2 glycoprotein, separately, through a single intracolorectal administration. This

nduced more potent protection against vaccinia virus and HSV-as compared to immunization by other routes [58]. Previously

t has been noted that HAdV-3 and -7 account for 13% and 19.7%f all HAdV isolates typed in outbreaks and reported to WHO [59].he incidence of HAdV-3-caused respiratory disease has not abated

(2009) 1145–1153

and continues to be a problem worldwide, perhaps not in the U.S.Regardless, it is a major problem and it is important to have a safe,effective and inexpensive vaccine against HAdV-3. So the wild-typeHAdV-3 itself may be as a vaccine strain when administered inenteric-coated oral capsules. This report presents a suitable candi-date based on a recently isolated, characterized and modified fieldstrain [38]. No helper cells are needed and the viral titer shouldbe easy to increase. Importantly, it could be used as a bivalent ortrivalent vaccine with the delivery of more than one viral antigen,adenovirus vaccine and other respiratory or mucosal virus vaccine,such as HIV vaccine. Moreover, species B-based vectors transducethe apical pole of human epithelium with considerably greater effi-ciency than the species C-based vectors [60].

As a functional payload delivery vector, the HAdV-7 hexon hasbeen successfully expressed via its insertion into this vector (datanot shown). Work is underway to insert other neutralizing anti-gens of respiratory viruses into the E3 region of rAd�E3GFP for useas vaccines. In the next stage, the recombinant adenovirus will beoptimized for use as a vaccine, for example enteric-coated usingdifferent strategies. It is believed the rAd�E3GFP described herewill play an important role as a vaccine for preventing this particu-lar adenovirus, as well as other respiratory and enteric pathogens,from becoming epidemic-causing problems.

Acknowledgements

This work was supported by The National Natural Science Foun-dation of China Grant 30770102. We thank Professor Frederick AMurphy of University of Texas Medical Branch for the electronmicroscopy data.

References

[1] Jones II MS, Harrach B, Ganac RD, Gozum MMA, dela Cruz WP, Riedel B, et al.New adenovirus species found in a patient presenting with gastroenteritis. JVirol 2007;81(11):5978–84.

[2] Wadell G. Classification of human adenoviruses by SDS-polyacrylamidegel electrophoresis of structural polypeptides. Intervirology 1979;11(1):47–57.

[3] Wadell G, Hammarskjold ML, Winberg G, Varsanyi TM, Sundell G. Genetic vari-ability of adenoviruses. Ann N Y Acad Sci 1980;354:16–42.

[4] Davison AJ, Benko M, Harrach B. Genetic content and evolution of adenoviruses.J Gen Virol 2003;84(11):2895–908.

[5] Chmielewicz B, Benzler J, Pauli G, Krause G, Bergmann F, Schweiger B. Respira-tory disease caused by a species B2 adenovirus in a military camp in Turkey. JMed Virol 2005;77(2):232–7.

[6] Stone D, Furthmann A, Sandig V, Lieber A. The complete nucleotide sequence,genome organization, and origin of human adenovirus type 11. Virology2003;309(1):152–65.

[7] Erdman DD, Xu W, Gerber SI, Gray GC, Schnurr D, Kajon AE, et al. Molecularepidemiology of adenovirus type 7 in the United States, 1966–2000. EmergInfect Dis 2002;8(3):269–77.

[8] Hierholzer JC. Adenoviruses. In: Lenette EH, Lenette DA, Lenette ET, editors.Diagnostic procedures for viral, rickettsial and chlamydial infections. 7th ed.Washington, DC: American Public Health Association; 1995. p. 169–88.

[9] Frantzidou F, Pavlitou A, Mataftsi A, Dumaidi K, Georgiadis N. Molecular epi-demiology of adenovirus strains isolated from patients with ocular disease inthe area of Thessaloniki, Greece (1998–2002). J Med Virol 2005;75:440–6.

[10] Herbert FA, Wilkinson D, Burchak E, Morgante O. Adenovirus type 3 pneumoniacausing lung damage in childhood. Can Med Assoc J 1977;116:274–6.

[11] Martone WJ, Hierholzer JC, Keenlyside RA, Fraser DW, D’Angelo LJ, WinklerWG. An outbreak of adenovirus type 3 disease at a private recreation centerswimming pool. Am J Epidemiol 1980;111:229–37.

12] Yamadera S, Yamashita K, Akatsuka M, Kato N, Hashido M, Inouye S, et al.Adenovirus surveillance, 1982–1993. Japan. A report of the National Epidemio-logical Surveillance of Infectious Agents in Japan. Jpn J Med Sci Biol 1995;48(4):199–210.

[13] James L, Vernon MO, Jones RC, Stewart A, Lu X, Zollar LM, et al. Outbreak ofhuman adenovirus type 3 infection in a pediatric long-term care facility-Illinois,2005. Clin Infect Dis 2007;45(4):416–20.

[14] Xu W, Cui A, Shi Z, Wang H, Zhang Y, Tang Z, et al. Etiological research of theunknown mild respiratory tract infectious disease in an outbreak in Jiangsuprovince. Chin J Virol 2005;21(5):325–31.

[15] Zhu B, Su X, Gong S, Bai P, Zhou R, Liu X. Etiological research of human ade-novirus type 3 causing acute respiratory disease in children. J Mod Clin MedBioeng 2005;11:134–5.

cine 27

[

[

[

[

[

[[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[59] Wadell G. Adenoviruses. In: Zuckerman AJ, Banatvala JE, Pattison JR, editors.

Q. Zhang et al. / Vac

16] Liu W, Song T, Zhou R, Liu Y, Chen X, Zhou X, et al. An outbreak of chil-dren pharyngo-conjuctival fever induced by type III adenovirus. Dis Surveill2005;20(4):176–9.

17] Tang L, Xiong Y, Huo D, Liu X, Shi Z, Cui A, et al. A study on the epidemiologyand pathology of four cities’ Adenovirus outbreaks of China in 2004. Dis Surveill2006;21(6):285–7.

18] Chen H-L, Chiou S-S, Hsiao H-P, Ke G-M, Lin Y-C, Lin K-H, et al. Respiratory ade-noviral infections in children: a study of hospitalized cases in Southern Taiwanin 2001–2002. J Trop Pediatr 2004;50(5):279–84.

19] Chang S, Lee C-N, Lin P-H, Huang H-H, Chang L-Y, Ko W, et al. A community-derived outbreak of adenovirus type 3 in children in Taiwan between 2004 and2005. J Med Virol 2008;80(1):102–12.

20] Kajon AE, Murtagh P, Garcia Franco S, Freire MC, Weissenbacher MC, Zorzopu-los J. A new genome type of adenovirus 3 associated with severe lower acuterespiratory infection in children. J Med Virol 1990;30(1):73–6.

21] Tatsis N, Ertl HC. Adenoviruses as vaccine vectors. Mol Ther 2004;10(4):616–29.22] Vogels R, Zuijdgeest D, van Rijnsoever R, Hartkoorn E, Damen I, de Bethune MP,

et al. Replication-deficient human adenovirus type 35 vectors for gene trans-fer and vaccination: efficient human cell infection and bypass of preexistingadenovirus immunity. J Virol 2003;77(15):8263–71.

23] Su XB, Ma X, Hong ZY, Wu HB, Wang YS, Chen L. Epidemiological study of humantype 5 adenovirus in Guangzhou using chemiluminescence for neutralizingantibody assay. Nan Fang Yi Ke Da Xue Xue Bao 2007;27(9):1323–6.

24] Tomko RP, Xu R, Philipson L. HCAR and MCAR: the human and mouse cellularreceptors for subgroup C adenoviruses and group B coxsackieviruses. Proc NatlAcad Sci USA 1997;94(7):3352–6.

25] Fechner H, Haack A, Wang H, Wang X, Eizema K, Pauschinger M, et al. Expressionof coxsackie adenovirus receptor and alphav-integrin does not correlate withadenovector targeting in vivo indicating anatomical vector barriers. Gene Ther1999;6(9):1520–35.

26] Seshidhar Reddy P, Ganesh S, Limbach MP, Brann T, Pinkstaff A, Kaloss M, etal. Development of adenovirus serotype 35 as a gene transfer vector. Virology2003;311:384–93.

27] Stone D, Ni S, Li Z-Y, Gaggar A, DiPaolo N, Feng Q, et al. Development andassessment of human adenovirus type 11 as a gene transfer vector. J Virol2005;79(8):5090–104.

28] Gao W, Robbins PD, Gambotto A. Human adenovirus type 35: nucleotidesequence and vector development. Gene Ther 2003;10:1941–9.

29] Nan X, Peng B, Hahn TW, Richardson E, Lizonova A, Kovesdi I, et al. Develop-ment of an Ad7 cosmid system and generation of an Ad7 E1E3HIVMN env/revrecombinant virus. Gene Ther 2003;10:326–36.

30] Roelvink PW, Lizonova A, Lee JG, Li Y, Bergelson JM, Finberg RW, et al. Thecoxsackievirus-adenovirus receptor protein can function as a cellular attach-ment protein for adenovirus serotypes from subgroups A, C, D, E, and F. J Virol1998;72(10):7909–15.

31] Sirena D, Lilienfeld B, Eisenhut M, Kalin S, Boucke K, Beerli RR, et al. The humanmembrane cofactor CD46 is a receptor for species B adenovirus serotype 3. JVirol 2004;78(9):4454–62.

32] Tuve S, Wang H, Ware C, Liu Y, Gaggar A, Bernt K, et al. A new group B adenovirusreceptor is expressed at high levels on human stem and tumor cells. J Virol2006;80(24):12109–20.

33] Short JJ, Vasu C, Holterman MJ, Curiel DT, Pereboev A. Members of adenovirusspecies B utilize CD80 and CD86 as cellular attachment receptors. Virus Res2006;122(1–2):144–53.

34] Short JJ, Pereboev AV, Kawakami Y, Vasu C, Holterman MJ, Curiel DT. Adenovirusserotype 3 utilizes CD80 (B7.1) and CD86 (B7.2) as cellular attachment receptors.Virology 2004;322(2):349–59.

35] Gaggar A, Shayakhmetov DM, Lieber A. CD46 is a cellular receptor for group Badenoviruses. Nat Med 2003;9:1408–12.

36] Fleischli C, Sirena D, Lesage G, Havenga MJE, Cattaneo R, Greber UF, et al. SpeciesB adenovirus serotypes 3, 7, 11 and 35 share similar binding sites on the mem-brane cofactor protein CD46 receptor. J Gen Virol 2007;88(11):2925–34.

37] Havenga M, Vogels R, Zuijdgeest D, Radosevic K, Mueller S, Sieuwerts M, et al.Novel replication-incompetent adenoviral B-group vectors: high vector stabil-ity and yield in PER.C6 cells. J Gen Virol 2006;87(8):2135–43.

38] Zhang Q, Su X, Gong S, Zeng Q, Zhu B, Wu Z, et al. Comparative genomic analysisof two strains of human adenovirus type 3 isolated from children with acuterespiratory infection in southern China. J Gen Virol 2006;87(6):1531–41.

[

(2009) 1145–1153 1153

39] Shinagawa M, Matsuda A, Ishiyama T, Goto H, Sato G. A rapid and simple methodfor preparation of adenovirus DNA from infected cells. Microbiol Immunol1983;27(9):817–22.

40] Chartier C, Degryse E, Gantzer M, Dieterle A, Pavirani A, Mehtali M. Efficientgeneration of recombinant adenovirus vectors by homologous recombinationin Escherichia coli. J Virol 1996;70(7):4805–10.

41] Youil R, Toner TJ, Su Q, Kaslow DC. Rapid method for the isolation of full lengthadenoviral genomes by bacterial intermolecular homologous recombination. JVirol Methods 2001;92:91–7.

42] Kajon AE, Xu W, Erdman DD. Sequence polymorphism in the E3 7.7K ORF ofsubspecies B1 human adenoviruses. Virus Res 2005;107(1):11–9.

43] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nded. NY: Cold Spring Harbor Laboratory Press; 1989.

44] Bangari DS, Mittal SK. Porcine adenoviral vectors evade preexisting humoralimmunity to adenoviruses and efficiently infect both human and murine cellsin culture. Virus Res 2004;105(2):127–36.

45] Jin Q. Adenovirus. In: Jin Q, editor. Medical molecular virology. Beijing: SciencePress; 2001. p. 691–710.

46] Sirena D, Ruzsics Z, Schaffner W, Greber UF, Hemmi S. The nucleotide sequenceand a first generation gene transfer vector of species B human adenovirusserotype 3. Virology 2005;343(2):283–98.

47] Ogra PL, Faden H, Welliver RC. Vaccination strategies for mucosal immuneresponses. Clin Microbiol Rev 2001;14(2):430–45.

48] Santosuosso M, McCormick S, Xing Z. Adenoviral vectors for mucosal vaccina-tion against infectious diseases. Viral Immunol 2005;18(2):283–91.

49] Dudding BA, Wagner SC, Zeller JA, Gmelich JT, French GR, Top Jr FH. Fatal pneu-monia associated with adenovirus type 7 in three military trainees. N Engl JMed 1972;286(24):1289–92.

50] U.S. Army Center for Health Promotion and Preventive Medicine. Adenovirus,type 4, among military trainees, Fort Jackson, SC, Fort Gordon, GA. Med SurveillMonthly Rep 1997; 3(7):12–3.

51] Gray GC, Goswami PR, Malasig MD, Hawksworth AW, Trump DH, Ryan MA,et al. Adult adenovirus infections: loss of orphaned vaccines precipitates mili-tary respiratory disease epidemics. For the Adenovirus Surveillance Group. ClinInfect Dis 2000;31(3):663–70.

52] Kajon AE, Moseley JM, Metzgar D, Huong HS, Wadleigh A, Ryan MA, et al. Molec-ular epidemiology of adenovirus type 4 infections in US military recruits in thepostvaccination era (1997–2003). J Infect Dis 2007;196(1):67–75.

53] Russell KL, Hawksworth AW, Ryan MA, Strickler J, Irvine M, Hansen CJ, etal. Vaccine-preventable adenoviral respiratory illness in US military recruits,1999–2004. Vaccine 2006;24(15):2835–42.

54] Lyons A, Longfield J, Kuschner R, Straight T, Binn L, Seriwatana J, et al. Adouble-blind, placebo-controlled study of the safety and immunogenicity oflive, oral type 4 and type 7 adenovirus vaccines in adults. Vaccine 2008;26(23):2890–8.

55] Purkayastha A, Su J, McGraw J, Ditty SE, Hadfield TL, Seto J, et al. Genomic andbioinformatics analyses of HAdV-4vac and HAdV-7vac, two human adenovirus(HAdV) strains that constituted original prophylaxis against HAdV-relatedacute respiratory disease, a reemerging epidemic disease. J Clin Microbiol2005;43(7):3083–94.

56] Couch RB, Chanock RM, Cate TR, Lang DJ, Knight V, Huebner RJ. Immunizationwith Types 4 and 7 Adenovirus by Selective Infection of the Intestinal Tract. AmRev Respir Dis 1963;88(Suppl.):394–403.

57] Edmondson WP, Purcell RH, Gundelfinger BF, Love JW, Ludwig W, Chanock RM.Immunization by selective infection with type 4 adenovirus grown in humandiploid tissue culture. II. Specific protective effect against epidemic disease.JAMA 1966;195(6):453–9.

58] Zhu Q, Thomson CW, Rosenthal KL, McDermott MR, Collins SM, Gauldie J.Immunization with adenovirus at the large intestinal mucosa as an effec-tive vaccination strategy against sexually transmitted viral infection. MucosalImmunol 2008;1(1):78–88.

Principles and practice of clinical virology. 4th ed. John Wiley and Sons; 2000.p. 307–27.

60] Lecollinet S, Gavard F, Havenga MJ, Spiller OB, Lemckert A, Goudsmit J, et al.Improved gene delivery to intestinal mucosa by adenoviral vectors bearingsubgroup B and d fibers. J Virol 2006;80(6):2747–59.