Gene, 49 (1986) 161-165

Elsevier

161

GEN 01843

Construction of a cDNA library from polyadenylated RNA of Bacillus subtilis and the determination of some 3’4erminal sequences

(Recombinant DNA; plasmid vectors; Ml3 phage; nucleotide sequencing)

Pratima Kamik, Yanamandra Gopalakrishna, and Nilima Sarkar *

Department of Metabolic Regulation, Boston Biomedical Research Institute, Boston, MA 02114 (U.S.A.) Tel. (617) 742-2010, and Department of Biological Chemistry, Harvard Medical School, Boston, MA 02115 (U.S.A.) Tel. (617) 732-1210

(Received June 19th, 1986)

(Revision received September 30th, 1986)

(Accepted October 17th, 1986)

SUMMARY

We had found previously that polyadenylated RNA constitutes a surprisingly large fraction of mRNA in both Escherichia coli and Bacillus sub&s [Gopalakrishna et al., Nucl. Acids Res. 9 (1981) 3545-3554; Biochem. 21 (1982) 2724-27291. We have also shown [Gopalakrishna and Sarkar, J. Biol. Chem. 257 (1982) 2747-27501 that polyadenylated RNA from B. subtilis can serve as a template for the synthesis of complementary DNA by reverse transcriptase using oligo(dT) as primer. In this work, we show that the cDNA thus synthesized contains sequences representative of poly(A) + RNA and can serve as template for double-stranded (ds) cDNA synthesis. The ds cDNA could be inserted into the PstI site of pBR322 and cloned in E. coli DH 1. The cDNA inserts from a few cloned recombinant pBR322 plasmids were transferred to M13mp18 bacteriophage for sequence determination. Six cDNA species had terminal oligo(dT) sequences, indicating that they represented the complement of poly(A) + RNA. This constitutes independent and direct evidence for the existence of bacterial polyadenylated mRNA and opens the way for studying the nucleotide sequences that control polyadenylation.

INTRODUCTION

Polyadenylate sequences are found in covalent linkage at the 3’-termini of eukaryotic mRNAs. The role of polyadenylated 3’-regions, as well as that of

the adjacent untranslated RNA sequences, has been the subject of intense study during the past few years, and still remains to be defined clearly (Littauer and Soreq, 1982). Until recently, it was generally accepted that the 3’-polyadenylation of mRNAs is a

* To whom correspondence and reprint requests should be

addressed, at: Department of Metabolic Regulation, Boston

Biomedical Research Institute.

Abbreviations: Ap, ampicillin; bp, base pair(s); cDNA, DNA

complementary to mRNA; ds, double-stranded; nt, nucleo-

tide(s); poly(A)+ RNA, RNA containing 3’-sequences of

oligo(A); ss, single-stranded; Tc, tetracycline.

0378-I 119/86/$03.50 0 1986 Elsevier Science Publishers B.V. (Biomedical Division)

162

eukaryotic prerogative and does not occur in prokaryotic cells. However, in the past few years, a number of studies using modified isolation proce- dures have shown that a significant fraction (15-40%) of puIse-labeled RNA is polyadenylated in E. co& B. subtilis and 3a~illus brevis, and carries poly(A) sequences at its 3’-end (Sarkar et al., 1978; Gopalakrishan et al., 1981; Gopalakrishna and Sarkar, 1982a). The presence of substantial amounts of poly(A) sequences at the 3’-end of B. subtilis RNA was confirmed by the synthesis of complementary DNA by reverse transcriptase using oligo(dT) and poly(A) + RNA as template (Gopalakrishna and Sarkar, 1982b).

In spite of these reports, the notion that poly- adenylation plays a major role in bacterial mRNA metabolism as it does in eukaryotes is still not widely accepted. This scepticism is possibly due to the fact that all studies on bacterial poly(A)+ RNA to date have been carried out with heterogeneous RNA fractions rather than with functionally or chemically defined RNA species. In this study, we describe the cloning and analysis of the nt sequence of DNA complementary to poly(A)’ RNA from B. subtilis. Our results demonstrate for the first time the feasibility of const~cting a cDNA library in bacteria using poly(A)’ RNA as a template for reverse transcriptase.

EXPERIMENTAL

(a) Synthesis of double-stranded cDNA from bac- terial poly(A)+RNA

The ss cDNA was prepared essentially as de- scribed earlier (Gop~~rishna and Sarkar, 1982b) with B. subtilis poly(A)+ RNA as template, except that the poly(A) + RNA was isolated by a different

procedure (Gopalakrishna et al., 1981). The re- iationship between cDNA and poly(A)+ RNA se- quences was examined by comparing the hybridiza- tion of 32P-labeled poly(A) + RNA and [ 32P]cDNA with Southern blots (Southern, 1975) of EcoRI frag- ments of 3. s~bt~~~ DNA. Most of the bands obtained with 32P-labeled poly(A) + RNA were also seen with the f3’P]cDNA prep~ations, indicating that the latter represented a reasonably good

r

t 1.. . . * I 2 4 6 8 IO 12 14

ELECTROPHORETIC MOBILITY (Cm)

Fig. I. Size estimation by agarose gel electrophoresis of double-

stranded DNA complementary to i?. subtilis poly(A) + RNA. We

synthesized “P-labeled ds cDNA from B. subtills poly(A)’ RNA

with [ir-32P]dATP present during second-strand synthesis. After

treatment with Sl nuclease, the cDNA was subjected to

electrophoresis at 50 V in alkaline I”/ agarose gel. Radioactivity

was determined by scanning the radioautogram of the dried gel.

The arrows indicate the electrophoretic mobility of DNA

fragments used as size markers.

facsimile of the poly(A) + RNA population (data not shown).

The synthesis of ds DNA was achieved by the sequential use of reverse transcriptase and DNA polymerase with intervening denaturation of mRNA-cDNA hybrids (Wickens et al., 1978). The extent of second-strand synthesis was about half that of the first-strand synthesis from poly(A)+ RNA. When the ds cDNA was treated with S 1 nuclease to hydrolyze the loop regions, and then subjected to electrophoresis in 1 y0 alkaline agarose, a broad peak of cDNA was seen with a size range from 200-600 nt and an average size of about 400 nt (Fig. l), in agreement with the ss length of the original cDNA preparation (Gopalakrishna and Sarkar, 1982b).

(b) Construc~on of a recombin~t plasmid cDNA library

Sequences of ds cDNA were inserted into the PstI site of plasmid vector pBR322 following standard procedures that involved prior Sl nuclease treat- ment (Maniatis et al., 1982), terminal addition of deoxycytidylate to ds cDNA, annealing with deoxyguanylate-tailed pBR322 DNA, and transfor- mation of E. coli DH 1 (Cohen and Chang, 1973). A total of 440 Tc-resistant ~~sforrn~t colonies were obtained, of which 413 were Ap-sensitive, indicative

of an insertion at the PstI site in the /?-lactamase locus. These colonies were further screened by in situ hybridization, as described by Grunstein and Hogness (1975), with [ 32P]cDNA. Of 413 Ap-sensi- tive colonies, 136 were strongly positive and 206 were moderately positive in this screening. From the most strongly positive transformants, plasmids were obtained that had inserts at their PstI sites ranging from 100-400 bp in length, the inserts of the remain- der being smaller.

(c) Sequence analysis of cloned cDNA

Recombinant plasmid inserts larger than 100 bp were recloned into the &I site of M13mp18 RF. Clones of interest were analyzed further by cleavage with PstI and agarose gel electrophoresis. Several recombinant Ml3 clones derived from a single re- combinant plasmid were analyzed for cross-hybridi-

163

zation among themselves to identify clones with inserts in the two possible orientations. These clones were used to make ss DNA templates for se- quencing. From a total of 32 recombinant Ml3 clones, 30 had unique sequences, each of which was analyzed in both orientations to identify the 3’-end of the insert DNA representing poly(A) + RNA. Two different patterns of sequences were observed. The sequence of 22 clones contained an oligo(dG) stretch followed by various sequences. These clones represented either 5’-ends or the middle portion of the mRNA species. The sequence of eight clones contained an oligo(dG) stretch followed by oligo(dT) and then by various sequences. These are cDNA clones with a 3’-end representing the poly(A) tail of the mRNA. The nt sequences of the sense strand for six such clones are shown in Fig. 2. The poly(A) tract

was between 4 and 19 nt long and was preceded by

sequences containing all nt residues and at least one

-90 -80 -70 None 14: TTGATGCCATTCTTTGTTCCTTTTATTGTTAC

-60 -50 -40 -30 -20 -10 ATATTGCTCGGTTTTTGGTCTTCACAATATTCACCTCAACCTGCAT~~~~~TC(A)~(c)~~ ____-

*****

-100 -90 Clone 7: ACTATCAGAATGACATCAATGA+kA'TCTCATCA&'ACTGTCACT

6COAAGTTCGT~)TOCATCAG~~CAG~G~~~GCCATGTT~~'TACAGTAG~~TTAG~GA G(A),(C) 11 *****

-110 -100 -90 Clone 3: CGTCATAT-CGATATGATTAGAGTAGCTG~GTTTACTG~~GTCATCCGA

-70 Clone 6: GTCATCATAAGAATCGTCG

-60 ATATGCTGCAdGOCGGACAGTT~C~GTTTCGT~~GTTCGTCT~~CTATTGGCG(A) 19(c)14 --___ ***** **+I**

-80 -70 Clone 20: TTCCTTCGTTTTCGTTTGAAT

-60 -50 -40 -30 -20 -10 TTTCATTAAAGTGA T-CAATGAGCTCGTCCTCGAAATCCATAATTGAATCAGZW~~(A)$C)

***** 16

Fig. 2. Partial nucleotide sequence of the oligo(adenylate)-containing terminal region of B. subtilis cDNA cloned in M13mpl8. Several

recombinant plasmid clones (14,7, 3,6,20, 16) were selected from the cDNA library made from B. subtilLs poly(A)+RNA, and inserts

were recloned into the PstI site of M13mp18 RF. Sequences of the 3’-end representing the poly(A) tail of the mRNA were derived from

the recombinant Ml3 clones. The nt sequences shown are those of the strands with oligo(dA) adjacent to the oligo(dC) termini, and

the numbers indicate the distance from the start of the oligo(dA) tract. The putative consensus sequences ATT:: and TEGTC are

indicated by underlining or asterisks, respectively. The potential translation termination codons closest to the oligo(dA) tract that define

an uninterrupted reading frame are indicated by italics.

I64

translation termination codon in one of the possible reading frames.

DISCUSSION

The results presented in this paper show that DNA complementary to polyadenylated RNA from B. subtiiis represents most poly(A) + RNA sequences and can be used for the construction of cDNA libraries by the same procedures that have been employed for the preparation of eukaryotic cDNA libraries. Our earlier work having shown that poly(A) + RNA represents most mRNA sequences (Gop~~ris~a and Sarkar, 1982a), the cDNA libraries are probably fairly representative of total mRNA.

The fact that cloned cDNA sequences with terminal poly(dA) tracts were indeed found confirms the existence of poly(A)+ RNA in bacteria. The length of the oligo(dT) tracts adjacent to the terminal oligo(dG) in the sequenced DNA ranged from 4 to 19 nt, but the actual length of the poly(A) sequence could be longer in mRNA. The observed oligo(dT) tracts in the clones are limited by the length of the primer used (12-18 nt) for cDNA synthesis, the probability that second-strand cDNA synthesis is not complete, and the sensitivity of terminal oligo(dT) : oligo(dA) sequences to S 1 nuclease. The presence of terminal ohgo sequences as long as 19 nt is thus quite remarkable. The absence of polyadenylate sequences 12 nt or longer in all bacterial DNA sequences determined to date by computer search of the Genbank data base suggests that the poly(A) sequences in mRNA are added post-~~sc~ption~ly.

It is of interest to examine the actual nt sequences adjacent to the poly(A) tracts, since they presumably represent the 3’-ends of mRNA molecules. The 3’-termini of bacterial mRNAs that have been examined either by RNA sequencing or by Sl nu- clease mapping, include the tryptophan operon mRNA (Wu and Platt, 1978), outer membrane lipo- protein mRNA (Pirtle et al., 1980) histidine operon mRNA of Salmonella typhimurium (Carlomagno et al., 1985) and serine hydroxymethylase mRNA (Pl~ann and Stauffer, 1985). Also, 3’-untranslated regions, in the range of 36-182 nt in length, were observed beyond the translation termination codon.

In the cDNA nt sequences analyzed here, the closest possible translation termination codons as defined by an uninterrupted reading frame (shown in italics in Fig. 2) are 1-87 nt from the start of the poly(A) tract. In all but one case, an extensive untranslated region appears to exist at the 3 ‘-end of the mRNA.

Some specific nt sequences are characteristically associated with the termini of some E. colt’ genes, as for example the repetitive extragenic palindromic (REP) sequence (Stern et al., 1984; Gilson et al., 1984) or the sequence CGCTCTTA, implicated in nusA -mediated transcription termination (Kingston and Chamberlin, 1981; Farnham et al., 1982). We have not found these sequences in our cloned cDNA segments, nor the oligo(dT) stretches associated with characteristic hairpin loops which appear to play a role in Rho-independent transcription termi- nation (Rosenberg and Court, 1979). A search for common elements in the six cloned cDNA segments revealed no sequences that could give rise to a con- sistent pattern of RNA secondary structure. Indeed, a striking aspect of the sequences was the paucity of elements that could give rise to secondary structure, with no regions of dyad symmetry involving more than five contiguous bp. The only possible common elements, indicated by underlining in Fig. 2, were the

sequences TEGTC, in five of the six cDNAs, and

ATT&$ in four of the six clones. The latter sequence

is also found in the untranslated region of nearly all bacterial mRNAs analyzed (~published observa- tions). However, the probability of random occur- rence of such short sequences is high and their presence in the 3’-untranslated regions of mRNAs could be fortuitous.

In conclusion, our results have clearly established that 3’-terminal polyadenylate sequences of B. sub- tihs mRNA can be used for establishing cDNA libraries. The studies reported here open the way for the detailed examination of nt sequences near the 3’-ends of bacterial poly(A) + RNA, especially with respect to their possible roles in mRNA metabolism or processing. Studies on retroregulation in bacterio- phage L and T7 points to the importance of 3’-termi- nal sequences in mRNA stability and gene expres- sion (Gottesman et al., 1982), and the possibility of processing at the 3’-end of prokaryotic mRNA has recently been suggested by indirect evidence (Mott et al., 1985; Plamann and Stauffer, 1985).

ACKNOWLEDGEMENTS

We are grateful to Dr. H. Paulus for helpful discussions and critical reading of the manusc~pt. This work was supported by grants from the National Institutes of Health, GM26517, and the Biomedical Research Support Program, PROS71 1, of the Public Health Services.

REFERENCES

Carlomagno, MS., Riccio, A. and Bruni, C.B. Convergently functional, Rho-independent terminator in Sff~~o~eila t_vphi-

murium. J. Bacterial. 163 (1985) 362-368. Cohen, S.N. and Chang, A.C.Y.: Recircularization and auto-

nomous replication of a sheared R factor DNA segment in Escherichia coli transformants. Proc. Natl. Acad. Sci. USA 10 (1973) 1293.

Farnham, P.J., Greenblatt, J. and Platt, T.: Effects of NusA protein on transcription termination in the tryptophan operon of Escherichia coli. Cell 29 (1982) 945-951.

Gilson, E., Clement, J., Brutlag, D. and Hofnung, M.: A family of dispersed repetitive extragenic palindromic DNA se- quences in E. co&. EMBO J. 3 (1984) 1417-1421.

Gopal~~shna, Y., Langley, D. and Sarkar, N.: Detection ofhigh levels ofpolyadenylate-cont~ning RNA in bacteria by the use of a single-step RNA isolation procedure. Nucl. Acids Res. 9 (1981) 3545-3554.

Gopalakrishna, Y. and Sarkar, N.: Characterization of poly- adenylate-containing ribonucleic acids from Bacillus subtilis.

Biochem. 21 (1982a) 2724-2729. Gopalakrishna, Y. and Sarkar, N.: The synthesis of DNA com-

plementary to polyadenylate-containing RNA from Bacillus subtilis. J. Biol. Chem. 257 (1982b) 2747-2750.

Gottesman, M., Oppenheim, A. and Court, D.: Retroregulation: control of gene expression from sites distal to the gene. Cell 29 (1982) 727-728.

Grunstein, M. and Hogness, D.S.: Colony hybridization: a method for the isolation of cloned DNAs that contain a

165

specific gene. Proc. Natl. Acad. Sci. USA 72 (1975) 3961-3965.

Kingston, R.E. and Chamberlin, M.J.: Pausing and attenuation of in vitro transcription in the rrnE operon of E. co&. Cell 27 (1981) 523-531.

Littauer, U.Z. and Soreq, H.: The regulatory function of poly(A) and adjacent 3’ sequences in translated RNA. Prog. Nucl. Acid Res. 27 (1982) 53-83.

Maniatis, T.M., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Labora- tory, Cold Spring Harbor, NY, 1982.

Mott, J.E., Galloway, J.L. and Platt, T.: Maturation ofEscherichia

cob’ tryptophan operon mRNA: evidence for 3’ exonucleoly- tic processing aRer Rho-dependent termination. EMBO J. 4 (1985) 1887-1891.

Pirtle, R.M., Pirtle, I.L. and Inouye, M.: Messenger ribonucleic acid ofthe lipoprotein of the ~sche~ch~u coli outer membrane. J. Biol. Chem. 2% (1980) 199-209.

Plamann, M.D. and Stauffer, G.V.: Ch~acterization of a &-acting regulatory mutation that maps at the distal end of the Escherichia colt glyA gene. J. Bacterial. 161 (1985) 650-654.

Rosenberg, M. and Court, D.: Regulatory sequences involved in the promotion and termination of RNA transcription. Annu. Rev. Genet. 13 (1979) 319-353.

Sarkar, N., Langley, D. and Paulus, H.: Isolation and characteri- zation of polyadenylate-containing RNA from Bacillus brevis.

Biochemistry 17 (1978) 3468-3474. Southern, E.: Detection of specific sequences among DNA

fragments separated by electrophoresis. J. Mol. Biol. 98

(1975) 503-517. Stern, M.J., Ames, G.F., Smith, N.H., Robinson, EC. and

Higgins, C.F.: Repetitive extragenic palindromic sequences: a major component of the bacterial genome. Cell 37 (1984) 1015-1026.

Wickens, M.P., Buell, G.N. and Schimke, R.T.: Synthesis of double-stranded DNA complementary to lysozyme, ovo- mucoid, and ovalbumin mRNAs. J. Biol. Chem. 253 (1978) 2483-2495.

Wu, A.M. and Platt, T.: Transcription termination: nucleotide sequence at 3’-end of tryptophan operon in Escherichia co&.

Proc. Natl. Acad. Sci. USA 75 (1978) 5442-5446.

Communicated by D.T. Denhardt.