1

cpsA regulates mycotoxin production, morphogenesis and cell wall biosynthesis in the 1

fungus Aspergillus nidulans 2

3

Xuehuan Feng1, Vellaisamy Ramamoorthy1†, Sandesh S. Pandit, Alicia Prieto2, Eduardo A. Espeso2 and 4

Ana M. Calvo1* 5

6

1Department of Biological Sciences, Northern Illinois University, Dekalb, IL 60115, USA. 7

2Centro de Investigaciones Biológicas, CSIC, Madrid, Spain 8

†Dept. of Plant Pathology Agricultural College and Research Institute Killikulam, Vallanadu - 628 252 9

Thoothukudi District Tamil Nadu, India 10

11

12

*Author to whom correspondence should be addressed [telephone: (815) 753-0451]; fax (815) 753-0461; 13

e-mail amcalvo@niu.edu] 14

15

Summary 16

The model fungus Aspergillus nidulans synthesizes numerous secondary metabolites, including 17

sterigmatocystin (ST). The production of this toxin is positively controlled by the global regulator veA. In 18

the absence of veA (ΔveA), ST biosynthesis is blocked. Previously we performed random mutagenesis in 19

a ΔveA strain and identified revertant mutants able to synthesize ST, among them RM1. Complementation 20

2

of RM1 with a genomic library revealed that the mutation occurred in a gene designated as cpsA. While in 21

the ΔveA genetic background cpsA deletion restores ST production, in a veA wild-type background 22

absence of cpsA reduces and delays ST biosynthesis decreasing the expression of ST genes. Furthermore, 23

cpsA is also necessary for the production of other secondary metabolites, including penicillin, affecting 24

the expression of PN genes. In addition, cpsA is necessary for normal asexual and sexual development. 25

Chemical and microscopy analyses revealed that cpsA is found in cytoplasmic vesicles and it is required 26

for normal cell wall composition and integrity, affecting adhesion capacity and oxidative stress 27

sensitivity. The conservation of cpsA in Ascomycetes suggests that cpsA homologs might have similar 28

roles in other fungal species. 29

30

Key words: mutagenesis, veA, velvet, polysaccharide, cpsA, mycotoxin, cell wall, development, penicillin, 31

secondary metabolism 32

33

3

Introduction 34

Aspergillus species synthesize numerous secondary metabolites (Adrio et al., 2003; Brakhage et al., 35

2011). These compounds include antibiotics and other medical drugs as well as mycotoxins (Bennett et 36

al., 2003; Reverberi et al., 2010). The model fungus Aspergillus nidulans produces the mycotoxin 37

sterigmatocystin (ST). This mycotoxin is similar to the well-known potent carcinogenic aflatoxins (AFs) 38

(Payne and Yu, 2010; Sweeny and Dobson, 1999; Payne and Brown, 1998), produced by other 39

Aspergillus species, including the agriculturally important fungi A. flavus and A. parasiticus. Both toxins 40

are produced through a conserved biosynthetic pathway (Cole and Cox, 1981). As in the case of AF 41

genes, the genes involved in the synthesis of ST are clustered and regulated by aflR, an endogenous 42

transcription factor gene (Yu et al., 1996; Keller and Hohn, 1997; Fernandes et al., 1998). Transcription 43

of aflR, and concomitant production of ST, is positively controlled by veA, a global regulatory gene that 44

also governs sexual and asexual development in A. nidulans (Kato et al., 2003; Calvo, 2008, Calvo et al., 45

2016). A similar role was found in A. flavus and A. parasiticus, where veA controls AF production (Duran 46

et al., 2007; 2009; Calvo et al., 2004). 47

In A. nidulans, the biosynthesis of other natural products, such as penicillin (PN), is also veA-regulated 48

(Kato et al., 2003). Similar regulatory output is also observed in other fungal species, for instance, veA 49

homologs also regulate PN synthesis in Penicillium chrysogenum (Hoff et al., 2010; Veiga et al., 2012; 50

Kopke et al., 2013) and cephalosporin C production in Acremonium chrysogenum (Dreyer et al., 2007). 51

Additionally, besides affecting ST and AF production, veA also controls the biosynthesis of other 52

mycotoxins, for instance, cyclopiazonic acid and aflatrem in Aspergillus flavus (Duran et al., 2007), 53

fumonisins and fusarins in Fusarium spp, including F. verticillioides and F. fujikuroi (Myung et al., 2009; 54

Wiemann et al., 2010), trichothecenes in F. graminerum (Merhej et al., 2012), as well as dothistromin in 55

Dothistroma septosporum (Chettri et al., 2012) among others. 56

4

The use of A. nidulans as a model system has greatly enhanced our knowledge on the veA regulatory 57

mechanism of action (Calvo et al., 2016). The VeA protein, together with another velvet protein 58

denominated VelB (Bayram et al., 2008), is transported to the nucleus by the KapA α-importin, 59

particularly in the dark, a condition that promotes ST production and sexual development in this fungus 60

(Stinnett et al., 2007; Araújo-Bazán et al., 2009). This migration of KapA-VeA-VelB is negatively 61

affected under light by other proteins, such as FphA, LlmF, and Vip-VapB dimer (Palmer et al., 2013; 62

Sarikaya-Bayram et al., 2014; Purschwitz et al., 2008) promoting conidiation. In the nucleus, VeA also 63

interacts with other proteins, forming a complex with light-responsive proteins, FphA, LreA and LreB, 64

which also affects asexual and sexual morphogenesis and secondary metabolism (Purschwitz et al., 2008; 65

Röhrig et al., 2013). Furthermore, VeA also interacts with the putative methyl transferase LaeA (Bayram 66

et al., 2008; Bayram and Braus, 2012) forming the VelB-VeA-LaeA velvet complex. LaeA, also required 67

for normal mycotoxin biosynthesis (Bok and Keller, 2004), has been shown to be involved in chromatin 68

remodeling (Reyes-Dominguez et al., 2010; Bayram et al., 2010). Interestingly, not only does VeA play a 69

role as a scaffold for these complexes, but velvet proteins have been shown to bind DNA (Beyhan et al., 70

2013; Ahmed et al., 2013). 71

Our previous phylogenetic study revealed that VeA is conserved in many Ascomycetes (Myung et al., 72

2012), where in addition to governing morphogenesis and secondary metabolism, this regulator influences 73

plant pathogenicity of different mycotoxigenic fungi, for example in Aspergillus flavus (Duran et al., 74

2007; 2009), Fusarium verticillioides (Myung et al., 2012; Li et al., 2006), F. fujikuroi (Bayram et al., 75

2008), and F. graminearum (Merhej et al., 2012; Jiang et al., 2001), as well as fungal infections in 76

animals (Laskowski-Peak et al., 2012). Absence of veA homologs in these fungi resulted in a decrease in 77

virulence, coinciding with a reduction in mycotoxin production. In addition, cellular processes such as 78

oxidative stress response (Calvo et al., 2016; Baidya et al., 2014), cell wall structure synthesis (Li et al., 79

2006; Park et al., 2015), and generation of hydrolytic activity (Dhingra et al., 2012; Duran et al., 2014) 80

have all been found to be modulated by veA. 81

5

In order to discover novel genetic elements connected to the veA global regulatory mechanism we 82

previously performed random mutagenesis in a deletion veA strain, and identified several veA-dependent 83

genes involved in the regulation of ST biosynthesis (Ramamoorthy et al., 2012). For instance, rtfA, a gene 84

encoding a putative RNA polymerase transcription elongation factor-like that also regulates sexual and 85

asexual development. In the same manner, we found mtfA, encoding a novel putative C2H2 zinc finger 86

domain type transcription factor that regulates the biosynthesis of several secondary metabolites including 87

ST, and it is also important for morphogenesis in A. nidulans (Ramamoorthy et al., 2013). In the present 88

study we have investigated another selected revertant mutant, RM1. This strain presented a point mutation 89

in a gene that we designate as cpsA. This gene was initially annotated as encoding a putative 90

polysaccharide synthase. In this study we show that cpsA differentially influences ST biosynthesis in a 91

veA-dependent manner. cpsA also regulates the biosynthesis of other natural products, including PN. 92

Furthermore, cpsA is necessary for normal conidiation and sexual development in A. nidulans. 93

Importantly, our chemical analysis and microscopy observations indicated that cpsA is required for 94

normal composition and integrity of the fungal cell wall, affecting fungal adhesion and the capacity to 95

survive under exposure to environmental stresses. Our study demonstrated a profound effect of the cpsA 96

gene on cell wall biosynthesis and in the expression of numerous genes, including those involved in 97

secondary metabolism and developmental processes. 98

99

Results 100

AN9069 a putative polysaccharide synthase gene 101

Previously we reported seven revertant mutants (RMs) with restored wild-type levels of norsolorinic acid 102

(NOR), an orange intermediate used as marker of ST biosynthesis, in a strain with a ∆veA background 103

(Ramamoorthy et al., 2012). In the present study we identified the mutated gene in RM1 (Figure 1). First, 104

to examine whether one or more mutations occurred in RM1, the strain was crossed with RJH030 (yA2, 105

6

wA3, pabaA1, ΔstcE, trpC801, veA1). Analysis of the obtained progeny and dominant analysis revealed 106

that RM1 presents a single recessive mutation. Transformation of RM1-R2 with a genomic library yielded 107

colonies with wild-type phenotype. Sequencing of the inserts in rescued plasmids from these fungal 108

colonies, and comparison of these sequences with the A. nidulans genomic database 109

(http://www.aspgd.org) by BLAST analysis showed that the mutated gene in RM1 and RM1-R2 strains 110

was AN9069, annotated as a putative polysaccharide synthase gene, and was denominated cpsA. The 111

mutation was a G-A transition at nucleotide +568 of the cpsA coding region, changing the codon from 112

GAT to AAT, resulting in a substitution of glutamic acid (D) for Asparagine (N) (Figure S1). 113

Complementation of RM1 with the library plasmid containing cpsA resulted in a strain with ∆veA 114

phenotype with reduced ST intermediate production (Figure 1). 115

116

cpsA putative homologs are present in other fungal species 117

The deduced amino acid sequence of A. nidulans CpsA revealed high identity with proteins from other 118

Aspergillus species, including A. clavatus (75.4% identity), A. terreus (78.7%), A. flavus (76.5%), or A. 119

fumigatus (65.3%) (Figure S1). TMHMM predicted hydrophobic regions possibly acting as signal 120

peptide (1- 36, probability below 0.4) and transmembrane domains TM1 (309-332, probability below 121

0.4), TM2 (343-367, probability below 0.6) and TM3 (371-397, probability below 0.9) (Figure S1). 122

Analysis of other fungal genome databases revealed that CpsA is also conserved in many other 123

Ascomycetes (Table S1). An extensive alignment and phylogenetic tree is shown in Figures S2 and S3. 124

Additionally, A. nidulans CpsA was compared with putative bacterial homologs (Figure S4). CpsA 125

presents a DXD motif, conserved in glycosyltransferases (Breton et al., 2006), that is relevant for their 126

activity (Bothe et al. 2015); Busch et al., 1998; Li et al; 2001). This DXD motif was shown in crystal 127

structures to interact primarily with the phosphate groups of nucleotide donor through the coordination of 128

7

a divalent cation, typically Mn2+ (Breton et al., 2006) or Mg+2 (Weigle, 2015). In addition, CpsA contains 129

the related XDD motif (Weigel, 2015; Gulberti, et al., 2003). 130

131

cpsA affects mycotoxin biosynthesis in a veA-dependent manner 132

To further evaluate the effects of cpsA on A. nidulans mycotoxin biosynthesis, we deleted the cpsA coding 133

region in the RDAE206 strain (ΔveA, ΔstcE), creating TDAEΔcpsA (ΔcpsA, ΔveA, ΔstcE) (Figure S5) 134

(Table S2). In addition, we also deleted cpsA in a strain with a veA+ wild-type allele, RJMP1.49, 135

resulting in TRVΔcpsA (ΔcpsA, veA+) (Table S2) (Figure S5). These deletions were confirmed by 136

Southern blot analysis (Figure S5). The deletion of cpsA in a ∆veA ∆stcE background shows similar NOR 137

production levels to those in cpsA- ∆veA ∆stcE and the control veA1 ΔstcE, and higher than in ∆veA 138

∆stcE (Figure 1). However, deletion of cpsA in a strain with a veA+ genetic background, showed a delay 139

and a reduction in ST production compared with its isogenic controls strain, and the complementation 140

strain (Figure 2). As shown, the reintroduction of the wild-type allele partially rescues the phenotype 141

close to wild-type levels. It is possible that the complementation occurred at a different location, resulting 142

in the observed slight phenotypical changes. 143

ST production is affected by glucose concentration (i.e. Atoui et al., 2010). For this reason we 144

also evaluated the effect of cpsA on mycotoxin production on medium with different glucose 145

concentrations. ∆cpsA veA+ strain also showed a delay and a reduction in ST production when medium 146

with higher concentrations of glucose was used. Overexpression of cpsA also showed a reduction in ST 147

biosynthesis with respect to the controls. This difference in mycotoxin production was more notable as 148

the concentration of glucose in the medium was increased (Figure S6). In addition, our analysis revealed 149

that the synthesis of other unknown compounds was also cpsA-dependent (Figure S6). 150

The genes responsible for ST production are located in a cluster (Brown et al., 1996), among them, aflR 151

encodes a C6 zinc transcription factor that activates other genes in this cluster (Yu et al., 1996; Fernandes 152

8

et al., 1998; Brown et al., 1996). Additionally, another gene within the ST cluster, stcU, that encodes a 153

ketoreductase, is commonly used as indicator of ST cluster activation (Yu et al., 1996; kato et al., 2003; 154

Keller et al., 1995; Hicks et al., 1997). Northern analysis showed that expression of both aflR and stcU 155

was reduced in the cpsA deletion (TRVp∆cpsA) (Table S2) in comparison to the isogenic wild type and 156

complementation strain (Figure 2A). The same trend was also observed when cpsA was overexpressed. A 157

concomitant reduction in ST accumulation was detected in the deletion and overexpression cpsA cultures 158

(Figure 2B). 159

160

PN production is influenced by cpsA 161

Our chemical analysis results indicated that cpsA also affects the synthesis of other compounds in 162

addition to ST (Figure S6). It is known that production of several secondary metabolites, including ST 163

and PN, can be coregulated by certain proteins, such as VeA (Kato et al., 2003), and that, based on our 164

current study, the cpsA genetic element is VeA dependent. For these reasons, we also evaluated whether 165

cpsA influences PN production in A. nidulans. We analyzed production of this antibiotic in the ∆cpsA 166

strain (TRVpΔcpsA) and compared it with PN levels in the control strains, as well as in the cpsA 167

overexpression strain. For this assay we used a well-established bioassay using B. calidolactis as the 168

testing organism. Absence or overexpression of cpsA significantly decreased PN production with respect 169

to the control strains (Figure 3), indicating that normal cpsA expression is necessary for wild-type levels 170

of PN production. Furthermore, expression of the genes involved in PN biosynthesis, acvA, ipnA and attA 171

(MacCabe et al., 1990), was significantly down-regulated when cpsA is deleted or overexpressed, causing 172

reduction in PN biosynthesis. 173

cpsA positively affects development in A. nidulans 174

Deletion of cpsA resulted in a reduction in colony growth (Figure 4) and a drastic alteration of A. nidulans 175

morphology (Figure 5), affecting both asexual and sexual development. Absence of cpsA resulted in 176

9

severe reduction of conidial production, as well as in loss of Hülle cells (nursing cells contributing to the 177

formation of fruiting bodies), and lack of cleistothecial formation under conditions that allow the 178

production of these structures in the isogenic controls (Figure 5A-B). Interestingly, overexpression of 179

cpsA also decreased conidiation, while causing an increase in the number of Hülle cells and a slight 180

increase in cleistothecia with respect to the controls (Figure 5A-B). The reduction in conidiation in ΔcpsA 181

and OEcpsA was accompanied by a decrease in the expression of brlA, a transcription factor gene that 182

regulates early stages in conidiophore formation (Figure 5C) (Boylan et al., 1987; Adams et al., 1988). 183

This reduction in brlA expression was particularly notable in ΔcpsA. In addition, the lack of sexual 184

development in the absence of cpsA also coincided with a decrease in the expression levels of nsdD and 185

steA, both encoding transcription factors involved in sexual development (Han et al., 2001; Vallim et al., 186

2000). Furthermore, deletion of cpsA negatively affected the expression of veA (Figure 6), global 187

regulator previous described to be essential for sexual development and other biological functions (Kato 188

et al., 2003; Calvo et al., 2016; Yager, 1992; Kim et al., 2002; Calvo and Cary, 2014), as well as laeA, 189

encoding a VeA-interacting partner, LaeA, that also influences sexual development and controls 190

secondary metabolism (Bok and Keller, 2004; Bayram et al., 2010). 191

CpsA localizes in cytoplasmic vesicles 192

In the current study we also investigated the subcellular localization of CpsA in A. nidulans. With this 193

purpose, we generated two identical strains with cpsA fused to gfp. A single copy of the fusion cassette 194

was detected at the cpsA locus (data not shown). The selected transformants containing the cpsA::gfp 195

cassette presented wild-type phenotype. Microscopic observations were identical for both transformants 196

(results for TXF1.1 are shown in Figure 7). Fluorescence microscopy results indicated A. nidulans CpsA-197

GFP localizes abundantly at cytoplasmic vesicles or organelles. CMAC staining indicates that some of 198

these organelles are vacuoles. Non motile and other highly motile vesicles are likely endosomes (movie 199

1). No other structures are labeled by GFP fluorescence. For example there is no evidence of 200

accumulation at the plasma membrane. Over-expression of CpsA does not modify this distribution, only 201

10

the intensity of fluorescence detected (Figure S7 and movie 2). Thus CpsA might be exerting its role in 202

any of those vesicles, or the amount of protein at the plasma membrane is relatively low for detection. 203

Full length CpsA-GFP fusion protein was detected by Western Blot. This protein must be linked to 204

structures that cannot be solubilized in a standard buffer lacking detergents or denaturing agents (A50 205

buffer, see extensive work with this buffer in Orejas et al., 1995) corroborating the microscopy result of 206

localization in internal membranous structures. Nevertheless, the GFP moiety is detected suggesting a 207

degradation process for CpsA-GFP probably at recycling compartments as the lysosome or multivesicular 208

bodies. 209

210

cpsA is involved in regulating cell wall composition and integrity 211

Our sequence analysis suggested that cpsA could be involved in cell wall organization or synthesis. To 212

test whether cpsA has a role in cell wall integrity, we examined the effect of cell wall disrupting 213

compounds, sodium dodecyl sulphate (SDS) and calcofluor white (CFW) (Ram and Klis, 2006) in the 214

culture medium inoculated with the wild type, ΔcpsA, ΔcpsA-com, and OEcpsA (Figure 8). In both cases 215

the presence of the cell wall disrupting agent caused growth inhibition when cpsA was deleted or over-216

expressed. The observed effect was particularly drastic in the absence of cpsA. These results suggest that 217

cpsA might affect cell wall components. We examined the cell wall composition in the wild type, cpsA 218

deletion, complementation and overexpression strains as detailed in Materials and Methods. The results 219

showed that absence of cpsA led to a significant reduction of glucan, chitin and mannoprotein compared 220

to the levels of those components in the wild-type and complementation strain cell wall (Table 1). 221

Overexpression of cpsA resulted in a similar reduction of these components compared to the controls. 222

Importantly, transmission electron microscopy analysis revealed that absence of cpsA results in partial 223

detachment of the cell wall from the plasma membrane (Figure 9). This observed separation was 224

consistent only in the case of the cpsA mutant, while it was not observed in the control strains. 225

226

11

cpsA is involved in adhesion to surfaces 227

Biofilms are complex structures that offer protection from environmental stresses. Biofilm formation has 228

been shown to involve a sequential adherent process to a new surface (Finkel and Mitchell, 2011; 229

Beauvais and Muller, 2009). We examined the possible role of cpsA in A. nidulans mycelial adhesion. 230

Interesting, our results indicated that deletion of cpsA caused a notable delay and reduction in adhesion 231

capacity (Figure 10). Overexpression of cpsA also slightly decreased adhesion capacity at 24 h after 232

inoculation. In addition, we analyzed the expression of three genes that could influence biofilm formation, 233

dvrA, stuA and laeA (Figure 10B). In all cases these three genes were downregulated in the cpsA deletion 234

strain compared to the controls. 235

236

Wild-type cpsA expression levels facilitate A. nidulans growth under oxidative stress conditions 237

In order to examine the possible role of cpsA in resistance to oxidative stress, menadione was added to the 238

culture medium at different concentrations (Figure 11A). Absence of cpsA clearly resulted in growth 239

inhibition at 0.08 mM, while the growth of the isogenic control strains was inhibited at 0.2 mM under the 240

experimental conditions assayed. Overexpression of cpsA only mildly decrease fungal growth under 241

oxidative stress conditions. Furthermore, alterations in the cpsA locus reduced the expression of the 242

thioredoxin gene thiO and catalase gene catB with respect to the controls when the cultures were exposed 243

to menadione (Figure 11B-D). 244

245

Deletion of cpsA affects osmotic stress tolerance and increases sensitivity to temperature in A. 246

nidulans 247

In this study, we also examined whether cpsA was involved in survival under osmotic stress. For this 248

purpose the medium was supplemented with NaCl (0.7 M), or sorbitol (1.2 M). The addition of sorbitol 249

12

did not further decrease fungal growth in the deletion mutant (Figure S8). However, addition of NaCl did 250

reduce ∆ cpsA colony growth in comparison to the colonies of this strain grown on non-supplemented 251

GMM. Absence of cpsA also resulted in an increase in sensibility to higher temperatures (45 oC), while a 252

lower temperature (30 oC) increased fungal growth in this mutant. Unexpectedly, NaCl and sorbitol 253

supplemented ∆cpsA cultures grown at 45 oC showed an increase of vegetative growth. 254

255

Defects in cell wall is not sufficient to recover ST production in a ∆veA background 256

In order to test whether the deffects in cell wall composition and integrity observed in the cpsA mutant 257

were sufficient to lead to the recovery of ST biosynthesis in a strain with a ∆veA background, we 258

analyzed production of this mycotoxin in a double mutant ∆veA∆rlmA. The rlmA gene encodes a MADS-259

box transcription factor involved in cell wall integrity in A. nidulans (Kovácsa et al., 2013). Our results 260

indicated that alterations if the rlmA locus are insufficient to restablish toxin production in the absence of 261

veA (Figure S9). 262

263

Analysis of hyaluronic acid by SAX-HPLC and glycosyl composition of cell wall by GC-MS 264

In order to determine whether hyaluronic acid is present or absent in A. nidulans cell wall and whether its 265

synthesis is cpsA-dependent, we examined hyaluronan content in these samples at the Complex 266

Carbohydrate Research Center (Athens, GA). After digestion with hyaluronase, samples were analyzed 267

by SAX-HPLC as described in Materials and Methods section, and compared to a purified hyaluronan 268

sample undergoing the same procedure. Our results showed that hyaluronan was not present in these 269

fractions. In addition, monosaccharide composition of the wild-type and ΔcpsA cell wall fractions was 270

also analyzed by GC-MS. Hyaluronan is a polymer of D-glucuronic acid and D-N-acetylglucosamine, 271

13

however no glucuronic acid was found in these fractions (Table S3), further indicating that hyaluronan is 272

either absent of at very low concentration in the cell wall of this fungus. 273

Analysis of exopolysaccharide (EPS) glycosyl composition by GC-MS 274

In order to examine whether hyaluronan is present in A. nidulans EPS, we analyzed its glycosyl 275

composition by GC-MS as described in Materials and Methods section (Table S4). As in the case of the 276

cell wall analysis, no glucuronic acid was found in the EPS of either wild type or mutant. In addition, EPS 277

was analyzed by infrared spectroscopy (Figure S10). IR spectra from both samples were identical and 278

presented characteristics of polysaccharides with N-acetylated aminosugars. The bands at 820 and 850 279

cm-1 and the lack of signal at 890 cm-1 confirmed the alpha configuration of these polysaccharides. 280

Furthermore, the signals at 1558 and 1646 cm-1 are typical of the amide linkage from N-acetyl 281

aminosugars, which suggest N-acetylation of galactosamine units. The absence of signals in the region of 282

1700-1780 cm-1 from the carboxyl group confirms that these samples lack uronic acids, which agrees with 283

the results from monosaccharide analysis. The type of linkages was also analyzed after methylation 284

(Figure S11). The results from the methylation analysis as well as those from IR spectroscopy indicate the 285

presence of α-(1-4)-galactosaminogalactans in the EPS samples. 286

Monosaccharides detected in A. nidulans membrane 287

As mentioned above, hyaluronan is a polymer of D-glucuronic acid and D-N-acetylglucosamine. We 288

analyze the monosaccharide composition of A. nidulans wild-type in membrane in search of the presence 289

of any of these monomers, particularly glucuronic acid, which could serve as possible anchor between 290

membrane and the cell wall by binding D-N-acetylglucosamine in that structure. Furthermore, glucuronic 291

acid containing glycolipid have been reported in membranes of the phylogenetically related fungus A. 292

fumigatus (Fontaine et al., 2009). Our GC/MS analysis results are listed in Table S5. Mannitol, mannose, 293

glucose, galactose and glucosamine were detected, however glucuronic acid was not found in this sample. 294

14

295

Discussion 296

Secondary metabolites are crucial in the ecology and adaptation of fungi to their environment. The 297

biosynthesis of these compounds, also denominated natural products, is often genetically linked with 298

morphological development by shared regulatory mechanisms (Calvo, 2008; Calvo et al., 2016; Bayram 299

and Braus, 2012; Calvo and Cary, 2014; Calvo et al., 2002; Yu and Keller, 2005). Among them, one 300

member of the velvet protein family, VeA, plays a key role in connecting these two processes (Calvo, 301

2008; Calvo et al., 2016; Bayram and Braus, 2012; Calvo and Cary, 2014; Calvo et al., 2002). In A. 302

nidulans, the absence of the veA gene results in strains unable to form sexual fruiting bodies (Kim et al., 303

2002), displaying hyperconidiation by affecting the expression of brlA, a gene encoding an indispensable 304

transcription factor for the formation of conidiophores in this model fungus (Kato et al., 2003). In other 305

Aspergillus species, such as the AF-producers A. flavus and A. parasiticus, deletion of veA prevents the 306

formation of sclerotia (Calvo et al., 2004; Duran et al., 2007; Calvo and Cary, 2014), resistant structures 307

important for survival under adverse environmental conditions (Coley-Smith and Cooke, 1971; Wicklow, 308

1987). It has been established that veA has a plurality of roles. Recent transcriptome analyses revealed a 309

wide range of veA-dependent genes with a variety of functions, including numerous secondary metabolite 310

gene clusters in A. nidulans, as well as in other Aspergillus species, such as the opportunistic human 311

pathogen A. fumigatus (Dhingra et al., 2013; Lind et al., 2015) and the AF-producer A. flavus (Cary et al., 312

2015), and in other fungal genera, for example in Fusarium (Wiemann et al., 2010; Kim et al., 2013) or in 313

Penicillum spp. (Hoff et al., 2010). While the compounds associated with some of these veA-dependent 314

genes clusters are still unknown, in some cases these associations have been characterized in great depth, 315

such as the case of the mycotoxin ST in A. nidulans. 316

15

In spite its importance, the VeA mechanism of action is not fully understood. Our search for new veA-317

dependent genetic elements involved in the regulation of ST production in A. nidulans resulted in the 318

identification of cpsA, encoding a protein initially annotated as a putative polysaccharide synthase. CpsA, 319

shares limited similarity with proteins of the bi-functional glycosyltransferases family 2, hyaluronan 320

synthases, which catalyze polymerization of hyaluronan. The deduced amino acid sequence shows a 321

putative signal peptide domain and three putative transmembrane domains. Although the probability in 322

this prediction is low, these domains have also been described in other characterized hyaluronan 323

synthases, including those in humans (Watanabe and Yamaguchi, 1996). Its putative characterized 324

bacterial homolog, Cps1, is a type 3 polysaccharide synthase in Streptococcus pneumonia, involved in the 325

polymerization of Glc and GlcUA onto the growing polysaccharide chain (Chang et al., 2006). In the 326

pathogenic yeast Cryptococcus neoformans, the Cps1 homolog is a hyaluronic acid synthase needed for 327

the formation of the outer cell wall, playing an essential role in adhesion and virulence of this 328

Basidiomycete (Chang et al., 2006; Jong et al., 2007). A Cps1 putative homolog was also found in 329

Neurospora crassa by Fu et al (2014). As in the case of N. crassa, our study show that A. nidulans lacks 330

hyaluronic acid in its cell wall. Furthermore, our extensive chemical analysis indicates that this compound 331

is also absent in the exopolysaccharide, mainly composed of α-(1-4)-galactosaminogalactans. In addition, 332

no evidence of glucuronic acid in membrane was found. Nevertheless, our comparative analysis with 333

putative bacterial homologs indicated the presence of DXD and XDD motifs, conserved in 78 families of 334

glycosyltransferases (Breton et al., 2006; Bothe et al. 2016; Busch et al., 1998; Li et al; 2001). Irrefutably, 335

our results revealed a profound effect of CpsA in all aspects of A. nidulans biology. For this reason we 336

also performed a detailed microscopy study to provide additional clues of its mode of action. Our results 337

indicated that CpsA-GFP accumulates in cytoplasmic vesicles or organelles and that, based on the CMAC 338

staining, some of these organelles are vacuoles. Non motile vesicles would correspond to late-endosomes, 339

and those moving in retrograde and anterograde directions are, most probably, early endosomes (see 340

Lopez-Berges et al., 2016 and references therein). Additionally, our protein analysis also indicates that 341

16

CpsA is located and bound to internal membranous structures. Functional full-length CpsA-GFP protein 342

must locate in early and late endosomes, or other membranous compartment, such as vesicles originated 343

at the Golgi which could fuse to early endosomes. The recycling of this putative transmembrane protein 344

probably occurs in vacuoles or multivesicular bodies fused with lysosomes, as also suggested by the 345

presence of the resistant GFP fragment in the Western Blot. Further research will be carried out in our lab 346

to investigate the nature of these membranous compartment and their aggregates. 347

348 Our current study also revealed that CpsA influences ST biosynthesis in a veA-dependent manner in A. 349

nidulans. Deletion of cpsA in a strain with a veA+ allele resulted in the opposite effect on mycotoxin 350

production with respect to that observed in a strain where veA is absent, presenting a decrease in 351

accumulation of ST in comparison with the wild type. Similarly to the case of strains with a deletion veA 352

background, strains with a veA1 partially functional mutant allele (Stinnett et al., 2007; Kim et al., 2002; 353

Käfer, 1965) (commonly used in A. nidulans research laboratories), with a loss-of-function cpsA allele 354

also accumulated an abundant amount of ST. These results indicated that cpsA function is affected by the 355

veA allele. This effect on ST production was also observed in previously characterized veA-dependent 356

genes, such as rtfA (Ramamoorthy et al., 2012), and mtfA (Ramamoorthy et al., 2013). Furthermore, our 357

study also showed that cpsA affects the expression of aflR, encoding a C6 zinc transcription activator 358

necessary for the activation of other genes in the ST gene cluster (Yu et al., 1996; Fernandes et al., 1998). 359

The biosynthesis of other secondary metabolites was also impacted by the presence or absence of cpsA, 360

for instance, production of PN was reduced in the cpsA deletion mutant as well as in a strain with forced 361

overexpression of this gene. This suggests a broad effect of cpsA on A. nidulans secondary metabolism, in 362

which proper wild-type levels of cpsA expression are necessary for normal biosynthesis of these natural 363

products. 364

Besides the observed effect of cpsA in secondary metabolism, the present study indicated that cpsA also 365

affected A. nidulans development. Expression of brlA, key in the conidiation central regulatory pathway 366

17

(Boylan et al., 1987; Adams et al., 1988; Park and Yu 2012; Adams and Yu, 1998) was downregulated in 367

the absence of cpsA compared to the wild type, resulting in a reduction of conidial production. 368

Furthermore, in the cpsA deletion mutant, expression was also decreased for the nsdD, steA, and stuA 369

genes, which encode transcription factors required for sexual development (Han et al., 2001; Vallim et 370

al., 2000; Wu and Miller, 1997; Miller et al., 1992). Furthermore, the cpsA deletion strain is unable to 371

produce Hülle cells or cleistothecia under conditions that allow the production of these structures in the 372

wild type. As in the case of A. nidulans, loss of the CpsA homolog, Csp-1, negatively affected conidiation 373

and production of sexual structures in N. crassa (Fu et al., 2014). Overexpression of cpsA in A. nidulans 374

resulted in greater production of Hülle cells and cleistothecia than the wild type. These results indicate 375

that cpsA positively influences both asexual and sexual development in A. nidulans. 376

Interestingly, this study showed that not only is cpsA functionally veA-dependent, but that cpsA also 377

positively affects the expression of the global regulators veA and laeA; the later encodes a putative methyl 378

transferase involved in chromatin conformation remodeling (Bok and Keller, 2004; Reyes-Dominguez et 379

al., 2010; Bayram et al., 2010; Patananan et al., 2013). Since both veA and laeA regulate hundreds of 380

genes in A. nidulans (Lind et al., 2015; Kim et al., 2013a) as well as in other fungi (i.e. Hoff et al., 2010; 381

Wiemann et al., 2010; Dhingra et al., 2012; Lind et al., 2015; Cary et al., 2015; Kim et al., 2013a; 382

Karimi-Aghcheh et al., 2013; Fekete et al., 2014) it is possible that some of the phenotypes observed in 383

the absence of cpsA, such as changes in morphological and chemical development, could be, at least in 384

part, the result of alterations in the expression of these global regulators. Moreover, veA transcriptome 385

analysis in A. nidulans indicated that cpsA expression is also dependent on veA (Lind et al., 2015), 386

suggesting a regulatory loop essential for A. nidulans fitness. 387

The absence of cpsA was also associated with defects in cell wall composition, including a decrease in 388

glucan, chitin and mannoprotein content. Moreover, transmission electron microscopy analysis revealed 389

alterations in cell wall integrity with structural changes in the cpsA deletion mutant, presenting partial 390

18

detachment of the cell wall with respect to the plasma membrane. It is possible that this partial 391

detachment could be a consequence of a disorganized assembly of the cell wall. Additionally, it is likely 392

that some of the cell wall components could be more easily lost in the cpsA mutant strain, as in the case of 393

cell wall proteins in the N. crassa Cps1 mutant (Fu et al., 2014). It has been shown that deletion of a gene 394

involved in cell wall biosynthesis may induce a compensatory effect further modifying the structure 395

(Beauvais et al., 2014; Latgé, 2010). However, our results suggest that the lack of cpsA does not lead to a 396

compensatory effect in this case. The reduction of other cell wall components and structural alterations in 397

the cpsA mutant cell wall could contribute to the observed increase in sensitivity to external stresses. For 398

example, the fungal cell wall is the first line of defense for protection against exogenous oxidative stress 399

(Fuchs and Mylonakis, 2009). Our results indicated that alterations in the expression of cpsA increases 400

sensitivity to reactive oxygen species (ROS). In addition, wild-type expression levels of cpsA are also 401

necessary for proper expression of thiO, catB (Hong et al., 2013; Kawasaki and Aguirre, 2001) and veA, 402

also known to be involved in oxidative stress response (Baidya et al., 2014), that further contributes to 403

this increased sensitivity to ROS in strains without a wild-type cpsA locus. Oxidative stress influences 404

activation of fungal development and secondary metabolism (i.e Baidya et al., 2014; Etxebeste et al., 405

2010; Amare and Keller, 2014; Roze et al., 2013). However above certain thresholds, excessive exposure 406

to ROS and other stresses in the cpsA mutant could lead to deleterious effects, negatively affecting the 407

expression of numerous genes, including those involved in sexual and asexual development, as well as 408

those involved in secondary metabolism in A. nidulans. Interestingly, in the case of ST, deletion of the 409

rlmA gene, involved in cell wall integrity (Kovácsa et al., 2013) in a ∆veA strain did not recover toxin 410

production, suggesting that although cpsA notably affects A. nidulans cell wall, this effect does not 411

appears to be solely responsible for all the biological changes observed in the absence of cpsA. 412

It is known though that the fungal cell wall not only plays an essential role in maintaining cell shape and 413

protecting the cell against mechanical damage and other environmental stresses, but it is also involved in 414

adhesion to environmental surfaces and in biofilm formation (de Groot et al., 2009; Yin et al., 2008; 415

19

Brown et al., 2014). In pathogenic fungi, biofilms cause clinical problems, including resistance to 416

antifungal drugs (Ramage et al., 2009). Importantly, our results revealed that cpsA is necessary for normal 417

adhesion to surfaces. Biofilm formation, for which adhesion is necessary, is associated with complex 418

regulation of cell surface protein synthesis, hyphal formation and secondary metabolism (Finkel and 419

Mitchell, 2011; Beauvais et al., 2014). Interestingly, physical contact of fungal mycelium with bacteria 420

has been shown to be required to elicit a response that triggers the expression of specific secondary 421

metabolite gene clusters (Schroeckh et al., 2009). This evidence supports that adhesion, which allows 422

proper physical contact with surfaces, is intimately related with secondary metabolism regulation in 423

response to this environment perception. In addition, in A. fumigatus, the secondary metabolite regulator 424

laeA, was found highly upregulated during biofilm formation (Gibbons et al., 2011). In our studies, lack 425

of proper adhesion in the cpsA mutant formation coincided with a reduction of laeA transcription, which 426

could also negatively affect secondary metabolism. The reduction in adhesion in the absence of cpsA was 427

also associated with a decrease in the expression of the developmental gene stuA, homolog of Candida 428

albicans efg1, which is necessary for biofilm formation in this pathogenic fungus (Finkel and Mitchell, 429

2011; Gibbons et al., 2014). stuA plays multiples roles in fungi; in A. nidulans, besides its described role 430

in the regulation of sexual development and possibly in adhesion, as suggested in our study, it is also 431

involved in the regulation of asexual development (Wu and Miller, 1997; Miller et al., 1992), this holds 432

true in A. fumigatus (Sheppard et al., 2005), as well as its role governing some secondary metabolite gene 433

clusters (Sheppard et al., 2005; Twumasi-Boateng et al., 2009). Interestingly, the multiple functions 434

described for stuA include the regulation of catalase-peroxidase gene cpeA in A. nidulans (Scherer et al., 435

2002), as well as cat1 in A. fumigatus (Sheppard et al., 2005). It is possible that besides the effects 436

observed in development and possibly in biofilm formation, the reduction of stuA in the cpsA mutant 437

could further contribute to accentuate the increased sensitivity to ROS. Lastly, in our study, loss of 438

adhesion capacity in ∆cpsA was also associated with a reduction in the expression of the A. nidulans 439

homolog of the A. fumigatus C2H2 zinc finger transcription factor gene dvrA (Ejzykowicz et al., 2010), 440

20

and C. albicans and C. parasilosis bcr1 (Fanning and Mitchell, 2012; Nobile and Mitchell, 2005; Ding 441

and Butler, 2007), known to play a critical role in biofilm formation. 442

In conclusion, our studies revealed that the veA-dependent genetic element cpsA in A. nidulans has a 443

profound effect on secondary metabolism and morphological development. cpsA also, proved to be 444

critical for proper cell wall composition and integrity, as well as for normal adhesion capacity. The 445

critical role of cpsA in fungal cell wall formation could in part determine resistance to environmental 446

stressors, such as presence of ROS, osmostress or temperature variation. These multiple direct or indirect 447

effects suggest a cross-talk and complex balance between different cpsA-dependent cell processes in A. 448

nidulans that could be in part mediated by the effect of cpsA on the global regulators veA and laeA. The 449

fact that the absence of cpsA results in a range of dramatic defects in this filamentous model fungus, 450

together with the conservation of cpsA in many other fungal species, makes cpsA a potential desirable 451

target in a control strategy to reduce the detrimental effects of fungi, including mycotoxin contamination. 452

Additionally, since cpsA homologs are present in multiple fungal pathogens, this gene and its gene 453

product could also be used as target for antifungal drugs. The study of A. nidulans cpsA exemplifies the 454

strong interdependence of different cellular processes necessary for fitness and survival of fungal species. 455

456

Experimental Procedures 457

Fungal strains and growth conditions 458

The A. nidulans strains used in this study are listed in Table S2. Strains were grown on glucose minimum 459

medium (GMM) (Käfer, 1977) and oat meal medium (OMM) (Butchko et al., 1999) containing the 460

appropriate supplements for the corresponding auxotrophic markers (Käfer, 1977). Ten grams per liter 461

was added in the case of solid medium. Strains were stored as 30% glycerol stocks at −80 °C. 462

463

21

Genetic techniques 464

Meiotic recombination was established between A. nidulans RM1 mutant obtained by chemical 465

mutagenesis (Ramamoorthy et al., 2012) and the RJH030 strain (pabaA1; yA2; wA3; argB2; 466

ΔstcE::argB; trpC801; veA1) as previously described (Pontecorvo et al., 1953). The progeny was 467

analyzed for the presence or absence of the veA1 allele, first by phenotypic observation and finally 468

confirmed by PCR. Colony morphology, as well as norsolorinic acid (NOR) production, were also 469

examined. The progeny of this cross showed four phenotypic groups: 1. ∆veA, ∆stcE, X- (RM1 parental 470

type); 2. ∆stcE (RJH030 parental type); 3. recombinant type ∆veA, ∆stcE (deletion veA phenotype); 4. 471

recombinant type ∆stcE, X- (RM1-R2). Dominance test was carried out by generating diploids using 472

RM1-R2 and RAV1 strains. Diploids were analyzed for NOR accumulation as well as morphological 473

development. 474

Identification of the revertant mutation in RM1 475

To identify the mutated gene originally present in RM1, the RM1-R2 (∆stcE, X-) strain was transformed 476

with the A. nidulans genomic library pRG3-AMA1-NOT1. Plasmid DNA was extracted from fungal 477

transformants showing wild-type phenotype. The end regions of the DNA inserts in the obtained plasmids 478

were sequenced. The complete DNA insert sequence was found in the A. nidulans genome database 479

(http://www.aspgd.org). To elucidate the location of the mutation in RM1, a PCR product was amplified 480

from the same locus in RM1 and sequenced. 481

482

Sequence analysis 483

The deduced amino acid sequence of cpsA (AN9069) was compared against databases from other 484

Aspergillus species and from different fungal genera, using the BLAST (blastp) tool provided by National 485

Center for Biotechnology Information (NCBI), (http://www.ncbi.nlm.nih.gov/). TMHMM website 486

(http://www.cbs.dtu.dk/services/TMHMM/) was also used for prediction of hydrophobic regions possibly 487

22

acting as signal peptide or transmembrane domains in the comparison between several CpsA homologs 488

from different Aspergillus species. The gene entry with the highest percentage of identity and the lowest 489

e-value for each of the species was selected. Pairwise sequence alignment of the proteins was performed 490

using the EMBOSS Needle tool (http://www.ebi.ac.uk/Tools/psa/emboss_needle/) from EMBL-EBI 491

(European Molecular Biology Laboratory's European Bioinformatics Institute). Percentage of similarities 492

and percentage of identities were tabulated for each of the alignments. Multiple sequence alignment was 493

performed with CpsA (A. nidulans) and homologs found across various fungal species using MAFFT 494

version 6.0 (http://mafft.cbrc.jp/alignment/server/index.html), followed by shading with the Jalview 495

2.9.0b2 software (http://www.jaview.org/) (Waterhouse et al., 2009). Generation of the phylogenetic tree 496

was performed by the MEGAv6 software (Tamura et al., 2013). Sequences were aligned using MUSCLE 497

software. A maximum-likelihood tree was generated with a bootstrap value of 1000. Accession numbers 498

for all sequences used are shown in Table S1. 499

500

Generation of the cpsA deletion and complementation strains 501

The DNA cassette used to delete cpsA was obtained by fusion PCR as previously described (Szewczyk et 502

al., 2006). The 1.4 kb 5’ UTR and 1.5 kb 3’ UTR flanking regions of cpsA were PCR amplified with 503

RM1-F1 and cps-P2, and cps-P3 and RM1-R2A primers sets, respectively (Table S6). The A. fumigatus 504

pyrG selectable marker was amplified with cps-P5 and cps-P6 primers from plasmid p1439. The 5’ and 3’ 505

UTR fragments were then PCR fused to pyrGAfum to generate the cpsA replacement construct using 506

primers RM1-F2 and RM1-R4. RDAE206 and RJMP1.49 were used as host strains. The resulting 507

transformation strains were designated as TDAE∆cpsA and TRV∆cpsA, respectively. Genomic DNA 508

from the selected transformants was analyzed by Southern blot. 509

510

23

A complementation strain was also obtained by transforming TRV∆cpsA with the cpsA wild-type allele. 511

The complementation vector was generated as follows: a DNA fragment containing the entire cpsA wild-512

type locus, including 2.0 kb of upstream and 1.0 kb downstream regions, was amplified with the primers 513

cps-com1 and cps-com2, digested with EcoRI and HindIII and ligated into pSM3 (containing pyroA), 514

previously digested with the same enzymes, resulting in pSM3-cpsA-com. The complementation vector 515

was then transformed into TRV∆cpsA using pyroA as selectable marker. Complementation was confirmed 516

by PCR. The complemented strain was designated as TRV∆cpsA-com. 517

518

Generation of cpsA overexpression strain 519

To generate the cpsA overexpression strain, the entire cpsA coding region was first PCR amplified using 520

the cps-OE1 and cps-OE2 primers, with engineered AscI and NotI sites (Table S6). The PCR product was 521

then digested with AscI and NotI, and ligated into pTDS1 vector previously digested with the same 522

enzymes. pTDS1 contains the A. nidulans gpdA promoter, trpC terminator and the pyrG marker. The 523

resulting plasmid was denominated pTDS-cpsOE. The pTDS-cpsOE vector was transformed into 524

RJMP1.49, and transformants were selected on appropriate selection medium without uridine and uracil, 525

and confirmed by diagnostic PCR using gpdApromoF and cps-OE2 primers (Table S6). 526

Toxin analysis 527

Culture plates containing 25 ml of solid GMM were top-agar inoculated with 106 spores/plate, and 528

incubated at 37 °C in the dark for 6 days. Three cores (16 mm diameter) were collected from each 529

replicate plate and extracted with 5 ml of chloroform. Alternatively, strains were incubated in GMM 530

liquid shaken cultures (106 spores/ml) at 37 °C and 250 rpm. Culture supernatants were collected and 531

extracted with chloroform. Extracts were dried overnight and then re-suspended in 500 μl of chloroform. 532

Samples were fractionated by thin-layer chromatography (TLC) using benzene and glacial acetic acid 533

[95:5 (v/v)] as solvent system for ST analysis, and chloroform: acetone: n-hexane (85:15:20) for NOR 534

24

analysis. Aluminum chloride (15% in ethanol) were then sprayed on the plates, and baked at 80 °C for 10 535

min. Metabolites present on TLC plates were visualized under 375 nm UV light. Commercial ST (Sigma) 536

was used as standard. 537

538

PN analysis 539

The PN bioassay was performed as previously described (Brakhage et al., 1992) with some modifications, 540

using Bacillus calidolactis C953 as the test organism. Briefly, twenty-five milliliters of seed culture 541

medium were inoculated using 106 spores/ml of wild type, deletion cpsA, complementation and 542

overexpression strains, and incubated at 26 °C for 48 h at 250 rpm. Mycelia were washed and transferred 543

to 20 ml of fermentation medium. Mycelial samples were harvested at 24 h and 48 h for gene expression 544

analysis. After 96 h, the culture supernatants were collected for PN analysis. Four-hundred milliliters of 545

Tryptone-Soy Agar was supplemented with 30 ml of B. calidolactis C953 culture and plated on five 150-546

mm-diameter Petri dishes. Twenty microlitres of each culture supernatant was added to 7-mm-diameter 547

wells. The plates were incubated at 55°C for 24 h, when inhibition halos were visualized and measured. 548

To verify that the observed antibacterial activity was due to the presence of PN, and not to the presence of 549

different fungal compounds in the supernatant, controls containing commercial penicillinase from 550

Bacillus cereus (Sigma, MO, USA) were also included. A standard curve using various concentrations of 551

PN G (Sigma, MO, USA) was utilized to determine PN concentration in the supernatants. 552

Morphological studies 553

Plates containing 25 ml of solid GMM medium were inoculated with 5 ml of top agar containing 106 554

spores of wild type, ∆cpsA, complementation and overexpression strains. The cultures were incubated in 555

dark or light at 37°C. Cores (7 mm diameter top agar layer) were removed from each culture after 48 h 556

and 72 h and homogenized in water. Conidia and Hülle cells were counted using a hemacytometer. 557

Identical cores were also taken to visualize cleistothecia under a dissecting microscope. To improve 558

25

visualization of fruiting bodies, the cores were sprayed with 70% ethanol to remove conidiophores. To 559

examine colony growth, each strain was point-inoculated on GMM plates and incubated under light or 560

dark conditions at 37°C for 6 days. Colony diameter was measured. Experiments were performed with 561

three replicates. 562

Gene expression analysis 563

Total RNA was extracted from lyophilized mycelia as previously described (Weber et al., 1998). 564

Gene expression levels were evaluated by Northern blot or quantitative reverse transcription-565

PCR (qRT-PCR) analysis. For Northern analysis, about 25 μg of total RNA of each sample was 566

separated by agarose gel electrophoresis and blotted as described by Sambrook and Russell 567

(2001). For qRT-PCR, total RNA was extracted from lyophilized mycelia using TRIsure (Bioline) 568

reagent and RNeasy Mini Kit (Qiagen) according to the manufacturer instructions. Five µg of total RNA 569

were treated with RQ1 RNase-Free DNase (Promega). cDNA was synthesized with Moloney murine 570

leukaemia virus (MMLV) reverse transcriptase (Promega). qRT-PCR was performed with the Applied 571

Biosystems 7000 Real-Time PCR System using SYBR green dye for fluorescence detection. A. nidulans 572

actin gene expression was used as reference, and the relative expression levels were calculated using the 573

2-ΔΔCT method (Livak and Schmittgen, 2001). Primer pairs used are shown in Table S6. 574

575

Study of cpsA subcellular localization 576

Aspergillus nidulans RJMP1.49 strain was transformed with a cpsA::gfp::pyrGA.fum DNA cassette 577

generated by fusion PCR as previously described (Szewczyk et al., 2006). Specifically, the cpsA coding 578

region and the 3’ UTR were PCR amplified with RM1-F4 and cpsgfp-P2, and cpsgfp-P3 and RM1-R2A 579

primers sets, respectively. The gfp::pyrGA.fum fragment was amplified with cpsgfp-P5 and cpsgfp-P6 580

primers from plasmid p1439 (Stinnett et al., 2007). The fragments were then PCR fused to generate the 581

cpsA::gfp::pyrGA.fum cassette using primers RM1-F5 and RM1-R3. Two transformants (TXF1.1 and 582

26

TXF1.2) were selected for further study. An overexpression strain, gpdA(p)::cpsA::gfp::pyrGA.fum was also 583

constructed as follows: cpsA::gfp was PCR amplified from TXF1.1 genomic DNA using RM1-Cps-OE1 584

and GFPR + notI primers (Table S6), digested with AscI and NotI and ligated to pTDS1 vector previously 585

digested with the same enzymes. The resulting plasmid was designated as pSSP4.1. The vector was then 586

transformed into TSSP7.1 resulting in strain TSS19.1. Conidia from the selected transformants, TXF1.1 587

TXF1.2 and TSS19.1 were inoculated as previously described (Stinnett et al., 2007). Conidia were 588

allowed to germinate on coverslip submerged in Watch minimal medium (WMM) (Peñalva, 2005) and 589

incubated for 16 h. Time lapse microscopy was done using Stream acquisition with 200 ms exposure per 590

frame using Metamorph software and a DMI6000b inverted microscope equipped with GFP and CMAC 591

(UV) detection filters. Images were acquired with a Hamamatsu ORCA-ERII high-sensitivity 592

monochrome digital CCD camera. Staining with CMAC (Molecular Probes) was carried out adding 593

CMAC 10 µM to the culture and incubating during 5 min at 25 oC followed by three washes with WMM. 594

CMAC (7-amino-4-chloromethylcoumarin) is commonly used for vacuole staining (acidic pH in vacuoles 595

activates this dye). Stack of images was converted to mov (Quicktime) using ImageJ software and 596

QTmoviemaker plugging. Movie 3 (showing only motile particles) is a stack of images from Movie 2 597

subjected to "Walking average" subroutine of ImageJ (4 images for media calculation) and then to "stack 598

difference" (image interval set to 1). Both ImageJ pluggins were obtained from EMBL, 599

https://www.embl.de/eamnet/html/body_kymograph.html. 600

601

Protein extraction and Western blot 602

Conidia of wild type and CpsA-GFP strain were inoculated in GMM and cultivated at 37 oC for 18 h in an 603

orbital shaker at 250 rpm. Mycelia were collected and lyophylized. A fraction of each mycelium mat was 604

subjected to protein extraction with an alkaline lysis protocol and another part to standardized protein 605

extraction using A50 buffer as indicated in (Hernandez-Ortiz and Espeso, 2013). Only the soluble fraction 606

27

of A50 buffer extraction is normally collected and used for further analyses. In this manuscript we kept 607

the insoluble fraction, which was treated with the alkaline lysis protocol to analyze insoluble proteins or 608

those linked to endomembranes or plasma membrane. SDS-PAGE and Western blotting was performed 609

using standard procedures. Proteins were transferred to nitrocellulose using the Transblot System from 610

BioRad. Mouse antibodies clones 7.1 and 13.1 against GFP were obtained from Sigma (1/5000 dilution). 611

Secondary anti-mouse antibody was obtained from Jackson (1/4000 dilution). Western blot was 612

developed using the ECL chemiluminescent kit. Images were taken using a BioRad Chemidoc Imaging 613

system and processed using Image Lab software (BioRad). 614

615

Cell wall stress assay 616

To test for possible alterations in the cell wall caused by either deletion or overexpression of cpsA, we 617

exposed the wild type, ∆cpsA, complementation and overexpression strains to SDS or calcofluor white 618

(CFW) as previously described by Riche et al (2009). GMM was amended with various concentrations of 619

SDS (0, 0.001%, 0.002%, 0.003%, 0.004%, 0.005%), or calcofluor white (CFW) (0, 2, 4, 6, 8, 10 μg/ml). 620

The strains were then point-inoculated on these media, and incubated at 37 °C for 3 days. 621

622

Cell wall chemical analysis 623

Conidia (106 spores/ml) from wild type, ∆cpsA, complementation and overexpression strains were 624

inoculated in 50 ml of liquid GMM and incubated for 48 h at 37 °C and 250 rpm. Mycelium was 625

harvested by filtration using miracloth, and washed twice with sterile distilled water. Five milligrams of 626

dry mycelium was finely ground. Each sample was boiled in 1 ml of buffer A (2% SDS, 50 mM Tris-HCl, 627

100 mM Na-EDTA, 40 mM β-mercaptoethanol, 1 mM PMSF) for 15 min (Riche et al.,2009). 628

Mannoprotein was extracted with 1M NaOH at 75 °C for 1 h and quantified as previous described (de 629

Groot et al., 2008; Kapteyn et al., 2001). Glucan and chitin were digested in 96% formic acid at 100 oC 630

for 4 h (Li et al., 2006). Formic acid was evaporated and residues were dissolved in 1 ml of distilled water. 631

28

The contents of glucan and chitin were evaluated by the quantification of released glucose and N-632

acetylglucosamine after digestion. Glucose concentration was measured by the phenol-sulphuric acid 633

method at 490 nm (Dubois et al., 1956). N-acetylglucosamine concentration was measured at 520 nm by 634

the method described by Lee et al (2005). The experiment included five replicates. 635

636

Transmission Electron Microscopy 637

Samples were fixed in 2.5% glutaraldehyde in Millonig’s phosphate buffer for 3 h at 4 oC, rinsed (3 x 10 638

min) in Millonig’s phosphate buffer followed by a treatment with 1% osmium tetroxide (OsO4) for 2 h at 639

room temperature. Then the samples were rinsed again (3 x 10 min) in Millonig’s phosphate buffer, 640

dehydrated in graduated ethanol series and cleared in acetone. The specimens were embedded using an 641

EMBed-812 kit (Electron Microscopy Sciences) and sectioned with a Reichert Om-U2 ultramicrotome 642

using a Diatome diamond knife. Samples were stained with 2% uranyl acetate (Watson) followed by lead 643

citrate (Sato). The fixation/dehydration/embedding was repeated twice (two separate experiments) with 644

similar results. For each samples, twenty images were visualized. Samples were visualized with a Hitachi 645

H-600 transmission electron microscope. Micrographs were taken with a SIA L12C digital camera 646

operated using MaxIm DL version 5.08 software. 647

648

Adhesion assay 649

The possible effect of cpsA on A. nidulans adhesion capacity was tested using 96 well plates as previously 650

described (Mowat et al., 2007; Pierce et al., 2008; Coffey and Anderson, 2014). Briefly, one hundred and 651

thirty microliters of inoculated GMM (105 spores/ml) were placed in each of the 96 wells on polystyrene 652

culture plates, and incubated at 37 °C for 24 h, 48 h and 72 h respectively. Then, the supernatant was 653

removed and the mycelium attached to the surface was washed 3 times with distilled water before adding 654

130 µl of Crystal violet 0.01% in water. After 20 min at room temperature, the wells were washed 3 times 655

29

with distilled water and were dried at room temperature. One hundred and thirty microliters of acetic acid 656

30% were used for distaining. OD was measured at 560 nm. 657

Oxidative and osmotic stress assays 658

In order to test whether cpsA affects A. nidulans response to oxidative stress, a method described by 659

Tribus et al (2005) was used with some modifications. Solid GMM containing various concentrations of 660

menadione (0, 0.04, 0.08, 0.12, 0.16, 0.20 mM) in 24 well plates were point-inoculated with the wild 661

type, ∆cpsA, complementation and overexpression strains and incubated at 37 °C for 3 days. GMM 662

without menadione was used as control. 663

664

Expression analysis of thiO and catB genes was examined by qRT-PCR and Northern blot, respectively, 665

using the primers listed in Table S6.The strains (106 spores/ml) were inoculated in liquid GMM and 666

incubated at 37°C in the dark for 48 h a 250 rpm. After that, approximately the same amount of mycelium 667

from each strain were transferred to GMM with or without menadione (0.08 mM). 668

669

To test sensitivity to osmotic stress, the wild type, ∆cpsA, complementation and overexpression strains 670

were point-inoculated on GMM and GMM supplemented with 0.7 M NaCl, or 1.2 M sorbitol. The 671

cultures were also grown at different temperatures, 30 °C, 37 °C and 45°C, to examine whether cpsA 672

function is affected by this parameter. 673

674

Generation of ∆rlmA and ∆veA∆rlmA double mutant 675

The DNA cassette used to delete rlmA by gene replacement was obtained by the fusion PCR method as 676

previously described (Szewczyk et al., 2006). The 1.3 kb 5’ UTR and 1.5 kb 3’ UTR of rlmA were 677

amplified from genomic DNA with primers ANrmlA_P1, ANrmlA_P2 and ANrmlA_P3, ANrmlA_P4, 678

respectively. The A. fumigatus pyrG selectable marker was amplified with ANrmlA_P5_pyrGafum and 679

30

ANrmlA_P6_pyrGafum primers from plasmid p1439. The 5’ UTR and 3’ UTR fragments were fused to 680

pyrGA.fum using ANrlm_p7 and ANrlm_p8 primers. TSSP7.1 strain was used as host for the 681

transformation, generating TSSP15.1. The DNA cassette also used to delete rlmA in TXF3.1 (∆veA), 682

generating TSSP16.1. Deletion of rlmA and veA was confirmed by PCR. 683

684

Analysis of hyaluronic acid and glycosyl composition of cell wall fractions 685

Plates containing 25 ml of liquid GMM were inoculated with 106 spores/ml of wild type, ∆cpsA, 686

complementation and overexpression strains. The cultures were then incubated in dark at 37 °C for 48 h, 687

when mycelium was collected by filtration using Miracloth. The cell wall samples were obtained as 688

follows: mycelium was first washed with 1xPBS and lyophilized. Then samples were ground, washed 689

with 1xPBS four times, and boiled in water for 10 min, followed by four additional washes with 1xPBS 690

and water. The cell wall samples were sent to the Complex Carbohydrate Research Center (Athens, GA) 691

for analysis. Approximately 0.5 g of each cell wall fraction was suspended in 5 mL of HA buffer (50 mM 692

sodium acetate, pH 6) and hyaluronase (from Streptomyces hyalurolyticus), final concentration 0.05 693

U/mL. The digestion was carried out at 55 oC for 24 h. A second aliquot of enzyme was added at that 694

time and the reaction was allowed to continue for another 24 h. The reaction was then stopped by boiling 695

for 10 min and filtered through a C18 SPE cartridge to separate out any remaining solids and to remove 696

any remaining protein from solution. The filtrate was then lyophilized and reconstituted in 500 µl of water 697

and analyzed by HPLC. Compounds were separated using an Agilent system with a 4.6x250 mm Waters 698

Spherisorb analytical column with 5μm particle size at 25°C, and a solvent gradient (solvent A: 2.5 mM 699

sodium phosphate, pH 3.5 and solvent and solvent B:) 2.5 mM sodium phosphate, 1.2 M NaCl, pH 3.5), 700

and a flow rate of 1 mL/min. Detection was performed by post-column derivatization. Briefly, the eluent 701

from the column was combined with a 1:1 mixture of 0.25 M NaOH and 1% 2-cyanoacetamide pumped 702

at a flow rate of 0.5 mL/min from a post column reactor. The eluent was heated to 130 °C in a 10-m 703

31

reaction coil, then cooled in a 50-cm cooling coil and measured with a fluorescence detection (λex = 346 704

nm, λem = 410). Identification and quantification was determined by comparison with a digestion of 705

Hyaluronan as positive control. 706

707

Cell wall monosaccharide components were analyzed by GC-MS. Approximately 2 mg of wild type and 708

ΔcpsA cell wall samples were placed in screw-cap tubes, 1 µl of 1 mg/mL inositol was added as internal 709

standard, and the samples were lyophilized. Methyl glycosides then were prepared from the dried samples 710

by methanolysis with 3 M HCl in methanol at 100 °C for 2 h, and re-N-acetylation with pyridine and 711

acetic anhydride in methanol. The samples then were per-O-trimethylsilylated (TMS) with a Tri-Sil 712

reagent (Thermo Scientific) at 80 °C for 30 min. Analysis of the TMS methyl glycosides was performed 713

on a Agilent 7890A gas chromatograph equipped with a Supelco EC-1 fused silica capillary column (30 714

m x 0.25 mm ID) and interfaced to a Agilent 5975C inert MSD. 715

716

Analysis of EPS 717

To assess whether hyaluronan is present in EPS of A. nidulans, its glycosyl composition of the EPS was 718

analyzed by GC-MS in our laboratory. EPS was first precipitated from culture supernatants of wild type 719

and cpsA mutant strain with 1 volume of ethanol 96% and dialyzed with water using a membrane with a 3 720

kDa cutoff. Samples were first hydrolyzed with 3 M trifluoroacetic acid (TFA) at 121 °C for 1 h, and 721

derivatized and analyzed as previously reported (Bernabé et al., 2011). 722

In addition, EPS was also analyzed by infrared spectroscopy. Infrared spectra were obtained by the KBr 723

technique. In brief, approximately 2 mg of dry sample were thoroughly mixed in a mortar with 300 mg of 724

KBr and maintained in a desiccator. The pellet was prepared by using a hydraulic press, applying a 725

pressure of 2 tons for 2 minutes and then 10 tons for 6 min. The spectra were recorded in a FTIR 4200 726

32

type A instrument (Jasco Corporation, Tokyo, Japan). Light source of transmittance was in the middle 727

range infrared 700–4000 cm-1. The detector used was triglycine-sulfate (TGS) with resolution 4 cm-1. 728

The type of linkages in the EPS was also analyzed after methylation of dry samples (1-3 mg). Then 729

samples were dissolved in dimethyl sulfoxide and processed according to the method of Ciucanu and 730

Kerek (1984). The per-O-methylated polysaccharides were hydrolyzed with 3 M TFA, reduced with 731

NaBD4, derivatized to their corresponding partially methylated alditol acetates, and analyzed GC-MS as 732

previously described (Shaaban et al., 2010). 733

Analysis of monosaccharides in membrane 734

Protoplasts from the wild-type strain TRV50.2 were prepared from mycelium grown on GMM for 16 h. 735

Four grams of mycelium was treated with Glucanex (Novozymes) for 1.5 h in 1.2 M MgSO4, 10 mM 736

phosphate buffer at pH 6.5. Protoplasts were purified as described in the transformation protocol from 737

Tiburn et al 1993 (Tilburn et al 1983). Protoplasts were lyophilized. The sample was hydrolyzed with 738

TFA under the same conditions described for EPS analysis, and the compounds released were derivatized 739

both as alditol acetates and as TMS-oxymes before GC/MS analysis. 740

741

Acknowledgements 742

This work was supported by NIH Grant 2R15AI081232-02 awarded to Ana Calvo. This research was also 743

supported in part by the National Institutes of Health (NIH)-funded Research Resource for Integrated 744

Glycotechnology” (NIH grant no. 5P41GM10339024) to Parastoo Azadi at the Complex Carbohydrate 745

Research Center. AMC also thanks Jessica Lohmar, Tim Satterlee, Parastoo Azadi, Yanbin Yi, Scott 746

Grayburn, Lori Bross, James Horn, and Barbara Ball for their technical support. 747

748

33

REFERENCES 749

Adams, T.H., Boylan, M.T., and Timberlake, W.E. (1988) brlA is necessary and sufficient to direct 750

conidiophore development in Aspergillus nidulans. Cell 54: 353-362. 751

Adams, T.H., and Yu, J.H. (1998) Coordinate control of secondary metabolite production and asexual 752

sporulation in Aspergillus nidulans. Curr Opin Microbiol 1: 674-677. 753

Adrio, J.L., and Demain, A.L. (2003) Fungal biotechnology. Int Microbiol 6: 191-199. 754

Ahmed, Y.L., Gerke, J., Park, H.S., Bayram, Ö., Neumann, P., Ni, M., et al. (2013) The velvet family of 755

fungal regulators contains a DNA-binding domain structurally similar to NF-κB. PLoS Biol 756

11(12):e1001750. 757

Amare, M.G., and Keller, N.P. (2014) Molecular mechanisms of Aspergillus flavus secondary metabolism 758

and development. Fungal Genet Biol 66:11-18. 759

Araújo-Bazán, L., Dhingra, S., Chu, J., Fernández-Martínez, J., Calvo, A.M., and Espeso, E.A.(2009) 760

Importin alpha is an essential nuclear import carrier adaptor required for proper sexual and asexual 761

development and secondary metabolism in Aspergillus nidulans. Fungal Genet Biol 46 (6-7):506-515. 762

Atoui, A., Kastner, C., Larey, C.M., Thokala, R., Etxebeste, O., Espeso, E.A., et al. (2010) Cross-talk 763

between light and glucose regulation controls toxin production and morphogenesis in Aspergillus 764

nidulans. Fungal Genet Biol 47: 962-972. 765

Baidya, S., Duran, R.M., Lohmar, J.M., Harris-Coward, P.Y., Cary, J.W., Hong, S.Y., et al. (2014) VeA 766

is associated with the response to oxidative stress in the aflatoxin producer Aspergillus flavus. Eukaryot 767

Cell 13: 1095-1103. 768

Bayram, Ö.S., Bayram, Ö., Valerius, O., Park, H.S., Irniger, S., Gerke, J., et al. (2010) LaeA control of 769

Velvet family regulatory proteins for light-dependent development and fungal cell-type specificity. PLoS 770

Genet 6(12): e1001226. 771

Bayram, O., and Braus, G.H. (2012) Coordination of secondary metabolism and development in fungi: 772

the velvet family of regulatory proteins. FEMS Microbiol Rev 36: 1-24. 773

34

Bayram, O., Krappmann, S., Ni, M., Bok, J.W., Helmstaedt, K., Valerius, O., et al. (2008) 774

VelB/VeA/LaeAcomplex coordinates light signal with fungal development and secondary metabolism. 775

Science 320:1504-1506. 776

Beauvais, A., Fontaine, T., Aimanianda, V., and Latgé, J.P. (2014) Aspergillus cell wall and biofilm. 777

Mycopathologia 178: 371-377. 778

Beauvais, A., and Muller, F.M. (2009) Biofilm formation in Aspergillus fumigatus. In: Latge JP, 779

Steinbach WJ, eds. Aspergillus fumigatus and aspergillosis. Washington (D.C.): ASM Press. pp 149-157. 780

Bennett, J.W., and Klich, M. (2003) Mycotoxins. Clin Microbiol Rev 16: 497-516. 781

Bernabé, M., Salvachúa, D., Jiménez-Barbero, J., Leal, J.A, and Prieto, A. (2011). Structures of wall 782

heterogalactomannans isolated from three genera of entomopathogenic fungi. Fungal Biology 115:862-783

870. 784

Beyhan, S., Gutierrez, M., Voorhies, M., and Sil, A. (2013) A temperature-responsive network links cell 785

shape and virulence traits in a primary fungal pathogen. PLoS Biol 11(7): e1001614. 786

Bok, J.W., and Keller, N.P. (2004) LaeA, a regulator of secondary metabolism in Aspergillus spp. 787

Eukaryot Cell 3: 527-35. 788

Bothe, M., Dutow, P., Pich, A., Genth, H., and Klos, A. (2015) DXD motif-dependent and -independent 789

effects of the Chlamydia trachomatis cytotoxin CT166. Toxins (Basel). 7: 621-637. 790

Boylan, M.T., Mirabito, P.M., Willett, C.E., Zimmerman, C.R., and Timberlake, W.E. (1987) Isolation 791

and physical characterization of three essential conidiation genes from Aspergillus nidulans. Mol Cell 792

Biol 7: 3113-3118. 793

Brakhage, A.A., Browne, P., and Turner, G. (1992) Regulation of Aspergillus nidulans penicillin 794

biosynthesis and penicillin biosynthesis genes acvA and ipnA by glucose. J Bacteriol 174, 3789-3799. 795

Brakhage, A.A., and Schroeckh, V. (2011) Fungal secondary metabolites – strategies to activate silent 796

gene clusters. Fungal Genet Bio 48: 15-22. 797

35

Breton, C., Snajdrová, L., Jeanneau, C., Koca, J., and Imberty, A. (2006) Structures and mechanisms of 798

glycosyltransferases. Glycobiology16: 29R-37R. 799

Brown, N.A., Dos Reis, T.F., Goinski, A.B., Savoldi, M., Menino, J., Almeida, M.T., et al. (2014) The 800

Aspergillus nidulans signalling mucin MsbA regulates starvation responses, adhesion and affects 801

cellulase secretion in response to environmental cues. Mol Microbiol 94: 1103-1120. 802

Brown, D.W., Yu, J.H., Kelkar, H.S., Fernandes, M., Nesbitt, T.C., Keller, N.P., et al. (1996) Twenty-five 803

coregulated transcripts define a sterigmatocystin gene cluster in Aspergillus nidulans. Proc Natl Acad Sci 804

USA 93: 1418-1422. 805

Busch, C., Hofmann, F., Selzer, J., Munro, S., Jeckel, D., and Aktories, K. (1998) A common motif of 806

eukaryotic glycosyltransferases is essential for the enzyme activity of large clostridial cytotoxins. J Biol 807

Chem 273: 19566-19572. 808

Butchko, R.A., Adams, T.H., and Keller, N.P. (1999) Aspergillus nidulans mutants defective in stc gene 809

cluster regulation. Genetics 153: 715-720. 810

Calvo, A.M. (2008) The VeA regulatory system and its role in morphological and chemical development 811

in fungi. Fungal Genet Biol 45: 1053-1061. 812

Calvo, A.M., Bok, J., Brooks, W., and Keller, N.P. (2004) veA is required for toxin and sclerotial 813

production in Aspergillus parasiticus. Appl Environ Microbiol 70: 4733-4739. 814

Calvo, A.M., and Cary, J.W. (2014) Association of fungal secondary metabolism and sclerotial biology. 815

Frontiers Review 5(768): 1-42. 816

Calvo, A.M., Lohmar, J.M., Ibarra, B., and Satterlee, T. (2016) Mycota Series. Volume I. 3rd Edition. 817

Velvet Regulation of Fungal Development. Ed.: J Wedland. Springer International Publishing. 475-497. 818

Calvo, A.M., Wilson, R.A., Bok, J.W., and Keller, N.P. (2002) Relationship between secondary 819

metabolism and fungal development. Microbiol Mol Biol Rev 66: 447-459. 820

36

Cary, J.W., Han, Z., Yin, Y., Lohmar, J.M., Shantappa, S., Harris-Coward, P.Y., et al. (2015) 821

Transcriptome analysis of Aspergillus flavus reveals veA-dependent regulation of secondary metabolite 822

gene clusters, including the novel aflavarin cluster. Eukaryot Cell 14: 983-997. 823

Chang, Y.C., Jong, A., Huang, S., Zerfas, P., and Kwon-Chung, K.J. (2006) CPS1, a homolog of the 824

Streptococcus pneumoniae type 3 polysaccharide synthase gene, is important for the pathobiology of 825

Cryptococcus neoformans. Infect Immun 74: 3930-3938. 826

Chettri, P., Calvo, A.M., Cary, J.W., Dhingra, S., Guo, Y., McDougal, R.L., et al. (2012) The veA gene of 827

the pine needle pathogen Dothistroma septosporum regulates sporulation and secondary metabolism. 828

Fungal Genet Biol 49:141-151. 829

Ciucanu, I., and Kerek, F. (1984). A simple and rapid method for the permethylation of carbohydrates. 830

Carbohydrate Research 131:209-217. 831

Coffey, B.M., and Anderson, G.G. (2014) Biofilm Formation in the 96-Well Microtiter Plate. Methods 832

Mol Biol 1149: 631-641. 833

Cole, R.J., and Cox, R.H. (1981) Handbook of Toxic Fungal Metabolites. New York: Academic Press. 834

Coley-Smith, J.R., and Cooke, R.C. (1971) Survival and germination of fungal sclerotia. Annu Rev 835

Phytopathol 9: 65-92. 836

de Groot, P.W., Brandt, B.W., Horiuchi, H., Ram, A.F., de Koster, C.G., and Klis, F.M. (2009) 837

Comprehensive genomic analysis of cell wall genes in Aspergillus nidulans. Fungal Genet Biol 1: S72-838

81. 839

de Groot, P.W., Kraneveld, E.A., Yin, Q.Y., Dekker, H.L., Gross, U., de Koster, C.G., et al. (2008) The 840

cell wall of the human pathogen Candida glabrata: differential incorporation of novel adhesin-like wall 841

proteins. Eukaryot Cell 7: 1951-1964. 842

Dhingra, S., Andes, D., and Calvo, A.M. (2012) VeA regulates conidiation, gliotoxin production and 843

protease activity in the opportunistic human pathogen Aspergillus fumigatus. Eukaryotic Cell 11: 1531-844

1543. 845

37

Dhingra, S., Lind, A.L., Lin, H.C., Tang, Y., Rokas, A., and Calvo, A.M. (2013) The fumagillin gene 846

cluster, an example of hundreds of genes under veA control in Aspergillus fumigatus. PLoS One 8(10): 847

e77147. 848

Ding, C., and Butler, G. (2007) Development of a gene knockout system in Candida parapsilosis reveals 849

a conserved role for BCR1 in biofilm formation. Eukaryot Cell 6: 1310-1319. 850

Dreyer, J., Eichhorn, H., Friedlin, E., Kurnsteiner, H., and Kuck, U. (2007) A homologue of the 851

Aspergillus velvet gene regulates both cephalosporin C biosynthesis and hyphal fragmentation in 852

Acremonium chrysogenum. Appl Environ Microbiol 73(10): 3412-3422. 853

Dubois, M., Gilles, K.A., Hamilton, J.K., Rebers, P.A., and Smith, F. (1956) Colorimetric method for 854

determination of sugars and related substances. Anal Chem 28: 350-356. 855

Duran, R.M., Cary, J.W., and Calvo, A.M. (2007) Production of cyclopiazonic acid, aflatrem, and 856

aflatoxin by Aspergillus flavus is regulated by veA, a gene necessary for sclerotial formation. Appl 857

Microbiol Biotechnol 73: 1158-1168. 858

Duran, R.M., Cary, J.W., and Calvo, A.M. (2009) The role of veA on Aspergillus flavus infection of 859

peanuts, corn and cotton. Open Mycol J 3: 27-36. 860

Duran, R.M., Gregersen, S., Smith, T.D., Bhetariya, P.J., Cary, J.W., Harris-Coward, P.Y., et al. (2014) 861

Aspergillus flavus veA in the production of extracellular proteins during growth on starch substrates. Appl 862

Microbiol Biotechnol 98: 5081-5094. 863

Ejzykowicz, D.E., Solis, N.V., Gravelat, F.N., Chabot, J., Li, X., Sheppard, D.C., et al. (2010) Role of 864

Aspergillus fumigatus DvrA in host cell interactions and virulence. Eukaryot Cell 9: 1432-1440. 865

Etxebeste, O., Ugalde, U., and Espeso, E.A. (2010) Adaptative and developmental responses to stress in 866

Aspergillus nidulans. Curr Protein Pept Sci 11: 704-718. 867

Fanning, S., and Mitchell, A.P. (2012) Fungal biofilms. PLoS Pathog 8(4): e1002585. 868

38

Fekete, E., Karaffa, L., Karimi Aghcheh, R., Németh, Z., Fekete, E., Orosz, A., et al. (2014) The 869

transcriptome of lae1 mutants of Trichoderma reesei cultivated at constant growth rates reveals new 870

targets of LAE1 function. BMC Genomics 15: 447. 871

Fernandes, M., Keller, N.P., and Adams, T.H. (1998) Sequence-specific binding by Aspergillus nidulans 872

AflR, a C-6 zinc cluster protein regulating mycotoxin biosynthesis. Mol Microbiol 28: 1355-1365. 873

Finkel, J.S., and Mitchell, A.P. (2011) Genetic control of Candida albicans biofilm development. Nat Rev 874

Microbiol 9: 109-118. 875

Fontaine, T., Lamarre, C., Simenel, C., Lambou K, Coddeville, B., Delepierre, M., et al. (2009) 876

Characterization of glucuronic acid containing glycolipid in Aspergillus fumigatus mycelium. Carbohydr 877

Res 344:1960-1967. 878

Fu, C., Sokolow, E., Rupert, C.B., and Free, S.J. (2014) The Neurospora crassa CPS-1 polysaccharide 879

synthase functions in cell wall biosynthesis. Fungal Genet Biol 69: 23-30. 880

Fuchs, B.B., and Mylonakis, E. (2009) Our paths might cross: the role of the fungal cell wall integrity 881

pathway in stress response and cross talk with other stress response pathways. Eukaryot Cell 8: 1616-882

1625. 883

Gibbons, J.G., Beauvais, A., Beau, R., McGary, K.L., Latgé, J.P., and Rokas, A. (2011) Global 884

transcriptome changes underlying colony growth in the opportunistic human pathogen Aspergillus 885

fumigatus. Eukaryot Cell 11: 68-78. 886

Gulberti, S., Fournel-Gigleux, S., Mulliert, G., Aubry, A., Netter, P., Magdalou, J., et al. (2003) The 887

functional glycosyltransferase signature sequence of the human beta 1,3-glucuronosyltransferase is a 888

XDD motif. J Biol Chem 278: 32219-32226. 889

Han, K.H., Han, K.Y., Yu, J.H., Chae, K.S., Jahng, K.Y., and Han, D.M. (2001) The nsdD gene encodes a 890

putative GATA type transcription factor necessary for sexual development of Aspergillus nidulans. Mol 891

Microbiol 41: 299-309. 892

39

Hernández-Ortiz, P., and Espeso, E.A. (2013) Phospho-regulation and nucleocytoplasmic trafficking of 893

CrzA in response to calcium and alkaline-pH stress in Aspergillus nidulans. Mol Microbiol 89: 532-551. 894

Hicks, J.K., Yu, J.H., Keller, N.P., and Adams, T.H. (1997) Aspergillus sporulation and mycotoxin 895

production both require inactivation of the FadA G alpha protein dependent signaling pathway. FMBO J 896

16: 4916-4923. 897

Hoff, B., Kamerewerd, J., Sigl, C., Mitterbauer, R., Zadra, I., Kürnsteiner, H., et al. (2010) Two 898

components of a velvet-like complex control hyphal morphogenesis, conidiophore development, and 899

penicillin biosynthesis in Penicillium chrysogenum. Eukaryot Cell 9:1236-1250. 900

Hong, S.Y., Roze, L.V., and Linz, J.E. (2013) Oxidative stress-related transcription factors in the 901

regulation of secondary metabolism. Toxins 5: 683-702. 902

Jiang, J., Liu, X., Yin, Y., and Ma, Z. (2011) Involvement of a velvet protein FgVeA in the regulation of 903

asexual development, lipid and secondary metabolisms and virulence in Fusarium graminearum. Plos 904

One 6(11): e28291. 905

Jong, A., Wu, C.H., Chen, H.M., Luo, F., Kwon-Chung, K.J., Chang, Y.C., et al. (2007) Identification 906

and characterization of CPS1 as a hyaluronic acid synthase contributing to the pathogenesis of 907

Cryptococcus neoformans infection. Eukaryot Cell 6: 1486-1496. 908

Käfer, E. (1965) Origins of translocations in Aspergillus nidulans. Genetics 52: 217-232. 909

Käfer, E. (1977) Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Adv 910

Genet 19: 33-131. 911

Kapteyn, J.C., ter Riet, B., Vink, E., Blad, S., De Nobel, H., Van Den Ende, H., et al. (2001) Low 912

external pH induces HOG1-dependent changes in the organization of the Saccharomyces cerevisiae cell 913

wall. Mol Microbiol 39: 469-479. 914

Karimi-Aghcheh, R., Bok, J.W., Phatale, P.A., Smith, K.M., Baker, S.E., Lichius, A., et al. (2013) 915

Functional analyses of Trichoderma reesei LAE1 reveal conserved and contrasting roles of this regulator. 916

G3 (Bethesda) 3: 369-378. 917

40

Kato, N., Brooks, W., and Calvo, A.M. (2003) The expression of sterigmatocystin and penicillin genes in 918

Aspergillus nidulans is controlled by veA, a gene required for sexual development. Eukaryot Cell 2: 1178-919

1186. 920

Kawasaki, L., and Aguirre, J. (2001) Multiple catalase genes are differentially regulated in Aspergillus 921

nidulans. J Bacteriol 183: 1434-1440. 922

Keller, N.P., and Hohn, T.M. (1997) Metabolic pathway gene clusters in filamentous fungi. Fungal Genet 923

Biol 21: 17-29. 924

Keller, N.P., Segner, S., Bhatnagar, D., and Adams, T.H. (1995) stcS, a putative P-450 monooxygenase, 925

is required for the conversion of versicolorin A to sterigmatocystin in Aspergillus nidulans. Appl Environ 926

Microbiol 61: 3628-3632. 927

Kim, H.S., Han, K.Y., Kim, K.J., Han, D.M., Jahng, K.Y., and Chae, K. (2002) The veA gene activates 928

sexual development in Aspergillus nidulans. Fungal Genet Biol 37: 72-80. 929

Kim, H.K., Lee, S., Jo, S.M., McCormick, S.P., Butchko, R.A.E, Proctor, R.H., et al. (2013a) Functional 930

roles of FgLaeA in controlling secondary metabolism, sexual development, and virulence in Fusarium 931

graminearum. PLoS One 8(7), e68441. 932

Kopke, K., Hoff, B., Bloemendal, S., Katschorowski, A., Kamerewerd, J., and Kück, U. (2013) Members 933

of the Penicillium chrysogenum velvet complex play functionally opposing roles in the regulation of 934

penicillin biosynthesis and conidiation. Eukaryot Cell 12: 299-310. 935

Kovács, Z., Szarka, M., Kovács, S., Boczonádi, I., Emri, T., Abe, K., et al. (2013) Effect of cell wall 936

integrity stress and RlmA transcription factor on asexual development and autolysis in Aspergillus 937

nidulans. Fungal Genet Biol 54: 1-14. 938

Laskowski-Peak, M.C., Calvo, A.M., Rohrssen, J., and Smulian, A.G. (2012) VEA1 is required for 939

cleistothecial formation and virulence in Histoplasma capsulatum. Fungal Genet Biol 49: 838-846. 940

Latgé, J.P. (2010) Tasting the fungal cell wall. Cell Microbiol 12: 863-872. 941

41

Lee, J.I., Yu, Y.M., Rho, Y.M., Park, B.C., Choi, J.H., Park, H.M., et al. (2005) Differential expression of 942

the chsE gene encoding a chitin synthase of Aspergillus nidulans in response to developmental status and 943

growth conditions. FEMS Microbiol Lett 249: 121-129. 944

Li, J., Rancour, D.M., Allende, M.L., Worth, C.A., Darling, D.S., Gilbert, J.B., et al. (2001) The DXD 945

motif is required for GM2 synthase activity but is not critical for nucleotide binding. Glycobiology 11: 946

217-229. 947

Li, S., Myung, K., Guse, D., Donkin, B., Proctor, R.H., Grayburn, W.S., et al. (2006) FvVE1 regulates 948

filamentous growth, the ratio of microconidia to macroconidia and cell wall formation in Fusarium 949

verticillioides. Mol Microbiol 62: 1418-1432. 950

Lind, A.L., Wisecaver, J.H., Smith, T.D., Feng, X., Calvo, A.M., Rokas, A. (2015) Examining the 951

evolution of the regulatory circuit controlling secondary metabolism and development in the fungal genus 952

Aspergillus. PLoS Genet 11(3): e1005096. 953

Livak, K.J., and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real-time 954

quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408. 955

López-Berges, M.S., Pinar, M., Abenza, J.F., Arst, H.N. Jr., and Peñalva, M.A. (2016) The Aspergillus 956

nidulans syntaxin PepA(Pep12) is regulated by two Sec1/Munc-18 proteins to mediate fusion events at 957

early endosomes, late endosomes and vacuoles. Mol Microbiol 99: 199-216. 958

MacCabe, A.P., Riach, M.B., Unkles, S.E., and Kinghorn, J.R. (1990) The Aspergillus nidulans npeA 959

locus consists of three contiguous genes required for penicillin biosynthesis. EMBO J 9: 279-287. 960

Merhej, J., Urban, M., Dufresne, M., Hammond-Kosack, K.E., Richard-Forget, F., and Barreau, C. (2012) 961

The velvet gene, FgVe1, affects fungal development and positively regulates trichothecene biosynthesis 962

and pathogenicity in Fusarium graminearum. Mol Plant Pathol 13:363-374. 963

Miller, K.Y., Wu, J., and Miller, B.L. (1992) StuA is required for cell pattern formation in Aspergillus. 964

Genes Dev 6:1770-1782. 965

42

Mowat, E., Butcher, J., Lang, S., Williams, C., and Ramage, G. (2007) Development of a simple model 966

for studying the effects of antifungal agents on multicellular communities of Aspergillus fumigatus. J Med 967

Microbiol 56: 1205-1212. 968

Myung, K., Li, S., Butchko, R.A., Busman, M., Proctor, R.H., Abbas, H.K., et al. (2009) FvVE1 regulates 969

biosynthesis of the mycotoxins fumonisins and fusarins in Fusarium verticillioides. J Agric Food Chem 970

57: 5089-5094. 971

Myung, K., Zitomer, N.C., Duvall, M., Glenn, A.E., Riley, R.T., and Calvo, A.M. (2012) The conserved 972

global regulator VeA is necessary for symptom production and mycotoxin synthesis in maize seedlings 973

by Fusarium verticillioides. Plant Pathol 61: 152-160. 974

Nobile, C.J., and Mitchell, A.P. (2005) Regulation of cell-surface genes and biofilm formation by the C. 975

albicans transcription factor Bcr1p. Curr Biol 15: 1150-1155. 976

Orejas, M., Espeso, E.A., Tilburn, J., Sarkar, S., Arst, H.N. Jr., and Peñalva, M.A. (1995) Activation of 977

the Aspergillus PacC transcription factor in response to alkaline ambient pH requires proteolysis of the 978

carboxy-terminal moiety. Genes Dev 9: 1622-1632. 979

Palmer, J.M., Theisen, J.M., Duran, R.M., Grayburn, W.S., Calvo, A.M., and Keller, N.P. (2013) 980

Secondary metabolism and development is mediated by LlmF control of VeA subcellular localization in 981

Aspergillus nidulans. PLoS Genet 9(1), e1003193 982

Park, H.S., and Yu, J.H. (2012) Genetic control of asexual sporulation in filamentous fungi. Curr Opin 983

Microbiol 15: 669-677. 984

Park, H.S., Yu, Y.M., Lee, M.K., Maeng, P.J., Kim, S.C., and Yu, J.H. (2015) Velvet-mediated repression 985

of β-glucan synthesis in Aspergillus nidulans spores. Sci Rep 5:10199. 986

Patananan, A.N., Palmer, J.M., Garvey, G.S., Keller, N.P., Clarke, and S.G. (2013) A novel 987

automethylation reaction in the Aspergillus nidulans LaeA protein generates S-methylmethionine. J Biol 988

Chem 288: 14032-14045. 989

43

Payne, G.A., and Brown, M.P. (1998) Genetics and physiology of aflatoxin biosynthesis. Annul Rev 990

Phytopathol 36: 329-362. 991

Payne, G.A., and Yu, J. (2010) Ecology, development and gene regulation in Aspergillus flavus. In: 992

Machida, M. and Gomi, K. (eds) Aspergillus: Molecular Biology and Genomics. Caister Academic Press, 993

Norfolk, UK. p. 157-171. 994

Peñalva, M.A. (2005) Tracing the endocytic pathway of Aspergillus nidulans with FM4-64. Fungal Genet 995

Biol 42: 963-975. 996

Pierce, C.G., Uppuluri, P., Tristan, A.R., Wormley, F.L. Jr Mowat, E., Ramage, G., et al. (2008) A simple 997

and reproducible 96-well plate-based method for the formation of fungal biofilms and its application to 998

antifungal susceptibility testing. Nat Protoc 3: 1494-1500. 999

Pontecorvo, G., Roper, J.A., Hemmons, L.M., Mackdonald, K.D., and Bufton, A.W.J. (1953) The 1000

genetics of Aspergillus nidulans. Adv Genet 5: 141-238. 1001

Purschwitz, J., Müller, S., Kastner, C., Schöser, M., Haas, H., Espeso, E.A., et al. (2008) Functional and 1002

physical interaction of blue- and red-light sensors in Aspergillus nidulans. Curr Biol 18:255-259. 1003

Ram, A.F., and Klis, F.M. (2006) Identification of fungal cell wall mutants using susceptibility assays 1004

based on Calcofluor white and Congo red. Nat Protoc 1: 2253-2256. 1005

Ramage, G., Mowat, E., Jones, B., Williams, C., and Lopez-Ribot, J. (2009) Our current understanding of 1006

fungal biofilms. Crit Rev Microbiol 35: 340-355. 1007

Ramamoorthy, V., Dhingra, S., Kincaid, A., Shantappa, S., Feng, X., Calvo, A.M. (2013) The putative 1008

C2H2 transcription factor MtfA is a novel regulator of secondary metabolism and morphogenesis in 1009

Aspergillus nidulans. PLoS One 8(9): e74122. 1010

Ramamoorthy, V., Shantappa, S., Dhingra, S., and Calvo, A.M. (2012) veA-dependent RNA-pol II 1011

transcription elongation factor-like protein, RtfA, is associated with secondary metabolism and 1012

morphological development in Aspergillus nidulans. Mol Microbiol 85: 795-814. 1013

44

Reverberi, M., Ricelli, A., Zjalic, S., Fabbri, A.A., and Fanelli, C. (2010) Natural functions of mycotoxin 1014

and control of their biosynthesis in fungi. Appl Microbiol Biotechnol 87: 899-911. 1015

Reyes-Dominguez, Y., Bok, J.W., Berger, H., Shwab, E.K., Basheer, A., Gallmetzer, A., et al. (2010) 1016

Heterochromatic marks are associated with the repression of secondary metabolism clusters in Aspergillus 1017

nidulans. Mol Microbiol 76:1376-1386. 1018

Richie, D.L., Hartl, L., Aimanianda, V., Winters, M.S., Fuller, K.K., Miley, M.D., et al. (2009) A role for 1019

the unfolded protein response (UPR) in virulence and antifungal susceptibility in Aspergillus fumigatus. 1020

PLoS Pathog 5(1): e1000258. 1021

Röhrig, J., Kastner, C., and Fischer, R. (2013) Light inhibits spore germination through phytochrome in 1022

Aspergillus nidulans. Curr Genet 59: 55-62. 1023

Roze, L.V., Hong, S.Y., and Linz, J.E. (2013) Aflatoxin biosynthesis: current frontiers. Annu Rev Food 1024

Sci Technol 4: 293-311. 1025

Sambrook, J., and Russell, D.W. (2001) Molecular cloning: a laboratory manual, 3rd edition. Cold Spring 1026

Laoratory, Cold Spring Harbor, New York. 1027

Sarikaya-Bayram, O., Bayram, O., Feussner, K., Kim, J.H., Kim, H.S., Kaever, A., et al. (2014) 1028

Membrane-bound methyltransferase complex VapA-VipC-VapB guides epigenetic control of fungal 1029

development. Dev Cell 29:406–420. 1030

Scherer, M., Wei, H., Liese, R., and Fischer, R. (2002) Aspergillus nidulans catalase-peroxidase gene 1031

(cpeA) is transcriptionally induced during sexual development through the transcription factor StuA. 1032

Eukaryot Cell 1: 725-735. 1033

Schroeckh, V., Scherlach, K., Nützmann, H.W., Shelest, E., Schmidt-Heck, W., Schuemann, J., et al. 1034

(2009) Intimate bacterial-fungal interaction triggers biosynthesis of archetypal polyketides in Aspergillus 1035

nidulans. Proc Natl Acad Sci USA 106:14558-14563. 1036

45

Shaaban, M., Palmer, J., EL-Naggar, W.A., EL-Sokkary, M.A., Habib, E.E., and Keller, N.P. (2010) 1037

Involvement of transposon-like elements in penicillin gene cluster regulation. Fungal Genet Biol 47:423-1038

432. 1039

Sheppard, D.C., Doedt, T., Chiang, L.Y., Kim, H.S., Chen, D., Nierman, W.C., et al. (2005) The 1040

Aspergillus fumigatus StuA protein governs the up-regulation of a discrete transcriptional program during 1041

the acquisition of developmental competence. Mol Biol Cell 16: 5866-5879. 1042

Stinnett, S.M., Espeso, E.A., Cobeno, L., Araujo-Bazan, L., and Calvo, A.M. (2007) Aspergillus nidulans 1043

VeA subcellular localization is dependent on the importin alpha carrier and on light. Mol Microbiol 63: 1044

242-255. 1045

Sweeny, M.J., and Dobson, A.D. (1999) Molecular Biology of Mycotoxin Biosynthesis. FEMS Microbiol 1046

Lett 175(2): 149-163. 1047

Szewczyk, E., Nayak, T., Oakley, C.E., Edgerton, H., Xiong, Y., Taheri-Talesh, N., et al. (2006) Fusion 1048

PCR and gene targeting in Aspergillus nidulans. Nat Protoc 1: 3111-3120. 1049

Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013) MEGA6: Molecular 1050

Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol 30: 2725-2729. 1051

Tilburn, J., Scazzocchio, C., Taylor, G.G., Zabicky-Zissman, J.H., Lockington, R.A., and Davies, R.W. 1052

(1983) Transformation by integration in Aspergillus nidulans. Gene 26: 205-221. 1053

Tribus, M., Galehr, J., Trojer, P., Brosch, G., Loidl, P., Marx, F., et al. (2005) HdaA, a major class 2 1054

histone deacetylase of Aspergillus nidulans, affects growth under conditions of oxidative stress. Eukaryot 1055

Cell 4: 1736-1745. 1056

Twumasi-Boateng, K., Yu, Y., Chen, D., Gravelat, F.N., Nierman, W.C., and Sheppard, D.C. (2009) 1057

Transcriptional profiling identifies a role for BrlA in the response to nitrogen depletion and for StuA in 1058

the regulation of secondary metabolite clusters in Aspergillus fumigatus. Eukaryot Cell 8: 104-115. 1059

Vallim, M.A., Miller, K.Y., and Miller, B.L. (2000) Aspergillus SteA (sterile12-like) is a homeodomain-1060

C2/H2-Zn+2 finger transcription factor required for sexual reproduction. Mol Microbiol 36: 290-301. 1061

46

Veiga, T., Nijland, J.G., Driessen, A.J., Bovenberg, R.A., Touw, H., van den Berg, M.A., et al. (2012) 1062

Impact of velvet complex on transcriptome and penicillin G production in glucose-limited chemostat 1063

cultures of a β-lactam high-producing Penicillium chrysogenum strain. Omics16: 320-33. 1064

Watanabe, K., and Yamaguchi, Y. (1996). Molecular identification of a putative human hyaluronan 1065

synthase. J Biol Chem 271:22945-22948. 1066

Waterhouse, A.M., Procter, J.B., Martin, D.M.A., Clamp, M., and Barton, G.J. (2009) Jalview Version 2 - 1067

a multiple sequence alignment editor and analysis workbench. Bioinformatics 25:1189-1191. 1068

Weber, K., Bolander, M.E., and Sarkar, G. (1998) PIG-B: a homemade monophasic cocktail for the 1069

extraction of RNA. Mol Biotechnol 9: 73-77. 1070

Weigel, P.H. (2015) Hyaluronan synthase: the mechanism of initiation at the reducing end and a 1071

pendulum model for polysaccharide translocation to the cell exterior. Int J Cell Biol 2015: 367579. 1072

Wicklow, D.T. (1987) Survival of Aspergillus flavus sclerotia in soil. Trans Br Mycol Soc 89: 131-134. 1073

Wiemann, P., Brown, D.W., Kleigrewe, K., Bok, J.W., Keller, N.P., Humpf, H.U., et al. (2010) FfVel1 1074

and FfLae1, components of a velvet-like complex in Fusarium fujikuroi, affect differentiation, secondary 1075

metabolism and virulence. Mol Microbiol 77, 972-994. 1076

Wu, J., and Miller, B.L. (1997) Aspergillus asexual reproduction and sexual reproduction are 1077

differentially affected by transcriptional and translational mechanisms regulating stunted gene expression. 1078

Mol Cell Biol 17: 6191-6201. 1079

Yager, L.N. (1992) Early developmental events during asexual and sexual sporulation in Aspergillus 1080

nidulans. Biotechnology 23: 19-41. 1081

Yin, Q.Y., de Groot, P.W., de Koster, C.G., and Klis, F.M. (2008) Mass spectrometry-based proteomics 1082

of fungal wall glycoproteins. Trends Microbiol 16: 20-26. 1083

Yu, J.H., Butchko, R.A.E., Fernandes, M., Keller, N.P., Leonard, T.J., and Adams, T.H. (1996) 1084

Conservation of structure and function of the aflatoxin regulatory gene aflR from Aspergillus nidulans 1085

and A. flavus. Curr Genet 29: 549-555. 1086

47

Yu, J.H., and Keller, N.P. (2005) Regulation of secondary metabolism in filamentous fungi. Annu Rev 1087

Phytopathol 43: 437-458. 1088

1089

48

1090

1091

1092

49

Table S1. Sequence analysis of CpsA homologs in different fungi using NCBI BLAST and NEEDLE 1093

Pairwise sequence alignment. 1094

NCBI (National Center for Biotechnology Information)

EMBOSS Needle-Pairwise Sequenc Alignment (global alignment) (EBLOSUM 62)

Accession Number E-value (Blastp)

Length % Identity % similarity

Aspergillus nidulans AN9069(AspGD) 455

Aspergillus terreus NIH2624 XP_001209243.1 0.0 437 78.7 85.7

Neosartorya fischeri NRRL 181 XP_001262883.1 0.0 437 77.6 85.3

Aspergillus oryzae RIB40 XP_001825520.2 0.0 437 76.9 84.6

Aspergillus niger CBS 513.88 XP_001395099.2 0.0 437 76.0 84.4

Aspergillus flavus NRRL3357 XP_002380722.1 0.0 432 76.5 84.2

Penicillium oxalicum 114-2 EPS30883.1 0.0 437 75.2 84.8

Aspergillus clavatus NRRL 1 XP_001272298.1 0.0 437 75.4 84.2

Penicillium roqueforti CDM29186.1 0.0 437 72.5 84.2

Byssochlamys spectabilis No. 5 GAD99635.1 0.0 438 72.0 82.8

Talaromyces stipitatus ATCC 10500 XP_002488246.1 0.0 453 69.0 78.8

Talaromyces marneffei ATCC 18224

XP_002153204.1 0.0 453 70.7 82.1

Ajellomyces dermatitidis ATCC 18188

EGE77411.1 0.0 443 63.4 76.9

Arthroderma otae CBS 113480 XP_002846165.1 0.0 450 61.4 73.2

Arthroderma gypseum CBS 118893

XP_003171383.1 0.0 455 62.6 75.1

Aspergillus fumigatus Af293 XP_746682.1 0.0 366 65.3 71.6

Coccidioides immitis RS EAS29292.2 0.0 442 62.7 73.6

50

Trichophyton soudanense CBS 452.61

EZF76299.1 0.0 463 62.1 74.9

Trichophyton tonsurans CBS 112818

EGE00026.1 0.0 461 61.6 73.8

Trichophyton rubrum CBS 118892 XP_003233075.1 0.0 462 62.2 75.1

Uncinocarpus reesii 1704 XP_002582796.1 0.0 478 58.6 70.8

Cladophialophora psammophila CBS 110553

EXJ66589.1 0.0 460 61.8 72.3

Trichophyton interdigitale H6 EZF28355.1 0.0 452 57.8 70.0

Cladophialophora yegresii CBS 114405

EXJ61611.1 0.0 459 62.3 73.6

Coccidioides posadasii C735 delta SOWgp

XP_003067944.1 0.0 455 57.7 67.8

Cladophialophora carrionii CBS 160.54

ETI27167.1 0.0 459 61.1 73.2

Aspergillus ruber CBS 135680 EYE94145.1 0.0 302 54.7 60.2

Aspergillus kawachii IFO 4308 GAA91101.1 0.0 302 54.7 59.8

Exophiala dermatitidis NIH/UT8656

EHY56476.1 0.0 469 59.2 71.2

Capronia coronata CBS 617.96 EXJ83412.1 0.0 461 59.7 69.0

Capronia epimyces CBS 606.96 EXJ87365.1 0.0 461 57.1 71.5

Endocarpon pusillum Z07020 ERF70808.1 0.0 655 42.3 52.0

Paracoccidioides sp. 'lutzii' Pb01 XP_002789730.1 0.0 509 49.7 60.4

Penicillium digitatum Pd1 EKV11345.1 8e-180 303 52.5 58.7

Cyphellophora europaea CBS 101466

ETN46808.1 7e-178 462 58.0 72.5

Blastomyces dermatitidis ATCC 26199

EQL38488.1 6e-169 352 52.1 61.9

Trichophyton rubrum CBS 100081 EZF44401.1 6e-156 367 50.2 59.7

51

Dothistroma septosporum NZE10 EME46318.1 6e-156 465 52.6 67.6

Histoplasma capsulatus H143 EER44516.1 1e-149 304 43.9 53.3

Cercospora fijiensis CIRAD86 EME83393.1 4e-147 473 49.8 63.7

Paracoccidioides brasiliensis Pb18 EEH48190.1 2e-142 473 55.9 69.3

Baudoinia panamericana UAMH 10762

EMC98785.1 3e-142 457 49.7 63.3

Arthrobotrys oligospora ATCC 24927

EGX50474.1 6e-142 436 49.0 66.3

Sphaerulina musiva SO2202 EMF13967.1 1e-140 493 45.5 59.2

Zymoseptoria tritici IPO323 XP_003857553.1 4e-138 471 48.3 62.9

Macrophomina phaseolina MS6 EKG18474.1 4e-131 453 49.4 62.4

Marssonina brunnea f. sp. 'multigermtubi' MB_m1

XP_007296604.1 1e-125 522 40.0 54.9

Sclerotinia sclerotiorum 1980 UF-70

XP_001587297.1 5e-124 513 39.8 56.2

Blumeria graminis f. sp. tritici 96224

EPQ64353.1 8e-124 481 41.8 59.2

Blumeria graminis f. sp. hordei DH14

CCU81486.1 2e-123 481 42.6 60.4

Metarhizium acridum CQMa 102 EFY86657.1 2e-122 489 41.1 58.8

Botrytis cinerea B05.10 XP_001548088.1 2e-122 514 38.5 55.3

Metarhizium anisopliae ARSEF 23 EFZ03703.1 3e-122 495 41.2 58.4

Botrytis cinerea T4 CCD48940.1 1e-121 514 38.4 55.2

Trichoderma atroviride IMI 206040

EHK40282.1 1e-121 526 38.7 53.9

Pestalotiopsis fici W106-1 ETS75078.1 1e-121 507 40.8 50.0

Pyrenophora tritici-repentis Pt-1C-BFP

XP_001934872.1 2e-121 464 44.2 59.3

Fusarium verticillioides 7600 EWG36475.1 2e-121 529 38.4 53.2

52

Fusarium fujikuroi IMI 58289 CCT62864.1 9e-121 529 38.2 53.5

Fusarium oxysporum Fo5176 EGU78390.1 1e-120 529 38.2 53.2

1095

Table S2. Fungal strains used in this study. 1096

Strain name Pertinent genotype Source

FGSC4 Wild type (veA+) FGSC

RDAE206 yA2, pabaA1, pyrG89; argB2, ∆stcE::argB, ∆veA::argB Ramamoorthy et al. (2012)

RDAEp206 yA2; ΔstcE::argB, ΔveA::argB Ramamoorthy et al. (2012)

RAV1 yA2, pabaA1, pyrG89; wA3; argB2, ∆stcE::argB; veA1 Ramamoorthy et al. (2012)

RAV1p yA2; wA3; ΔstcE::argB; veA1 Ramamoorthy et al. (2012)

RAV2 yA2; wA3; argB2, ∆stcE::argB; pyroA4; veA1 Ramamoorthy et al. (2012)

RJH030 yA2; wA3; pabaA1; argB2; ΔstcE::argB; trpC801; veA1 Ramamoorthy et al. (2012)

RM1 yA2, pabaA1, pyrG89; argB2, ∆stcE::argB, ∆veA ::argB,

cpsA- This study

RM1p yA2, ΔstcE::argB, ΔveA ::argB, cpsA-, This study

RM1-R2 yA2, pyrG89; pabaA1; wA3; argB2, ∆stcE::argB, cpsA-,

veA1 This study

RM1p-R2 yA2; wA3; ΔstcE::argB, cpsA-, veA1 This study

RM1-R2-com yA2, pyrG89; pabaA1, wA3; argB2, ∆stcE::argB, cpsA-,

pRG3-AMA-NOT1- cpsA::pyr4; veA1 This study

RM1p-R2-com yA2, pyrG89; wA3; argB2, ∆stcE::argB, cpsA-, pRG3-

AMA-NOT1- cpsA::pyr4; veA1 This study

RJMP1.49 pyrG89; argB2, ∆nkuA::argB; pyroA4; veA+ Shaaban et al. (2010)

53

TRV50 argB2, ∆nkuA::argB; pyroA4; veA+ Ramamoorthy et al. (2012)

TRV50.2 argB2, ∆nkuA::argB; veA+ Ramamoorthy et al. (2012)

TRV∆cpsA pyrG89; argB2, ∆nkuA::argB; ∆cpsA::pyrG A.fum; pyroA4;

veA+ This study

TRVp∆cpsA ∆nkuA::argB; ∆cpsA::pyrGA.fum; veA+ This study

TRV∆cps-com

pyrG89; argB2, ∆nkuA::argB, ∆cpsA::pyrG A.fum;

pyroA::cpsA; pyroA4; veA+ This study

OEcpsA pyrG89; pyroA4, argB2, ∆nkuA::argB,

alcA(p)::cpsA::trpC(t)::pyr4; veA+ This study

OEpcpsA pyrG89; argB2, ∆nkuA::argB,

alcA(p)::cpsA::trpC(t)::pyr4; veA+ This study

TDAE∆cpsA pabaA1, pyrG89; ∆cpsA::pyrG A.fum, ∆stcE::argB,

∆veA::argB This study

TDAEp∆cpsA

TDAEp∆cpsA-

com

TXF1

∆cpsA::pyrGA.fum, ∆stcE::argB, ∆veA::argB

pyrG89; ∆ cpsA::pyrGA.fum, ∆stcE::argB, ∆veA::argB,

cpsA;:pyrG

pyrG89; pyroA4, ∆nkuA::argB; cpsA::gfp::pyrG, veA+

This study

This study

This study

_____________________________________________________________________________ 1097

FGSC, Fungal Genetics Stock Center. p, prototrophs obtained by transformation with the wild-type allele of the 1098

indicated auxotrophic marker genes. 1099

1100

54

1101

Table S3. Glycosyl composition analysis of cell wall fractions by GC-MS

Sample Glycosyl residue Mass (µg) Mol % WT Ribose (Rib) n.d. - Arabinose (Ara) n.d. - Rhamnose (Rha) n.d. - Fucose (Fuc) n.d. - Xylose (Xyl) n.d. - Glucuronic Acid (GlcA) n.d. - Galacturonic acid (GalA) n.d - Mannose (Man) 75.0 9.0 Galactose (Gal) 154.3 18.5 Glucose (Glc) 513.6 61.8 N-Acetyl Galactosamine (GalNAc) n.d. - N-Acetyl Glucosamine (GlcNAc) 108.4 10.6 Σ= 851.3 Sample Glycosyl residue Mass (µg) Mol % Deletion Ribose (Rib) n.d. - Arabinose (Ara) n.d. - Rhamnose (Rha) n.d. - Fucose (Fuc) n.d. - Xylose (Xyl) n.d. - Glucuronic Acid (GlcA) n.d. - Galacturonic acid (GalA) n.d. - Mannose (Man) 102.5 9.4 Galactose (Gal) 309.2 28.3 Glucose (Glc) 606.7 55.5 N-Acetyl Galactosamine (GalNAc) n.d. - N-Acetyl Glucosamine (GlcNAc) 93.0 6.9 Σ= 1111.4

1102

55

1103

Table S4. Monosaccharides (%) released from the

exopolysaccharide (EPS) after acid hydrolysis with

3 M TFA for 1 h at 120 ºC, detected as alditol acetates.

WT ∆cpsA

Mannose 0.7 0.7

Glucose 0.6 0.6

Galactose 29.1 22.9

Galactosamine 9.8 7.5

1104

Table S5. Monosaccharides (%) identify in membrane of A. nidulans wild

type using GC/MS after acid hydrolysis with 3 M TFA for 1 h at 120 ºC.

% Mannitol 2.5

Mannose 1.5

Glucose 22.7

Galactose 1.2

Glucosamine 1.6

1105

1106

56

1107

Table S6. Primers used in this study. 1108

Name Sequence (5’→ 3’)

RM1-F1

RM1-F2

ATCTGCTACTTGTGGTTCGGGAG

TACGCCTTAATCCAGACGGTCTCC

RM1-R2A

RM1-R4

cpsA-P2

cpsA-P3

cpsA-P5

cpsA-P6

AAAGAGAGGCAAAGTCACCGAACG

GAGTTTACGGACATTTGCTTGTGC

GCGGTGCCCAATGTGCCAAACGATCCC

CAGTACAGGGTGCCATGTCGGCGTGC

GGGATCGTTTGGCACATTGGGCACCGCACCGGTCGCCTCAAACAATGCTCT

GCACGCCGACATGGCACCCTGTACTGGTCTGAGAGGAGGCACTGATGCG

cps-com1 NNNNNGAATTCTGACAGGAACGGCAGTTAGCACGC

cps-com2 NNNNNNNAAGCTTCTAGGGCAAAGAGCTCTTGG

cps-OE1 NNNNNGGCGCGCCATGCACATAACGTATATGCGAGCGTTCATC

cps-OE2

gpdApromoF

NNNNNNNNNNNGCGGCCGCTCAGGAGATATCGGCCGAGGTTACAC

AAGTACTTTGCTACATCCATACTCC

RM1-F4 ATGTGACGGTCATAATCCCTACGC

RM1-F5 TCACTCGATGGATGGTCTCACA

RM1-R3 ACGTAACTAGGGCAAAGAGC

cpsgfp_P2 GGAGATATCGGCCGAGGTTAC

cpsgfp_P3 GCGTGGGCGGGTTCTCGTCGC

57

cpsgfp_P5

cpsgfp_P6

aflR-F

aflR-R

stcU-F

stcU-R

stuA-F

stuA-R

dvrA-F

dvrA-R

laeA-F

laeA-R

aatA-Q1

aatA-Q2

ipnA-Q1

ipnA-Q2

acvA-Q1

acvA-Q2

18SQ1

18SQ2

actinQ1

actinQ2

stuAQ1

stuAQ2

veAQ1

GTAACCTCGGCCGATATCTCCGGAGCTGGTGCAGGCGCTGGAGCC

GCGACGAGAACCCGCCCACGCGTCTGAGAGGAGGCACTGATGCG

GAGCCCCCAGCGATCAGC

CGGGGTTGCTCTCGTGCC

TTATCTAAAGGCCCCCCCATCAA

ATGTCCTCCTCCCCGATAATTACCGTC

ATGGCCAGCATGAATCAACCTCAACCG

GGTGGCGTAGGAAACGTATGTGCG

ACATCTCTTCGCCACCGGACCGC

GCCGCAACTCGGCTTCTGTCGGT

ATGACCTCTCCAGCGCACAACCACTACAGC

TCTTAATGGTTTCCTAGCCTGGTATATGTGCAG

CCATTGACTTCGCAACTGGCCTCATTCATGGCAAA

ATGACAATCTCCGATACTTCGCGTTCCGCACCCTTT

TCCCTACCCCGAGGCTGCTATCAAGACG

CATTTCACCCGATGGATGGGCGCTTT

CGTGACTAAACTGCTGCGGGTGGATAACGA

TGAACGGACTGGTATGGTGCGATTGTGG

GAGACCTCGGCCCTTAAATAGCCCGGTC

CCCAGAACATCTAAGGGCATCACAGACCTGTTATTGC

ATGGAAGAGGAAGTTGCTGCTCTCGTTATCGACAATGGTTC

CAATGGAGGGGAAGACGGCACGGG

TGTCACCAACCACCCTGTTCCCAC

CTTCTCTTCGAGCAACGCAGACACCC

TGTCGAACAGAGTCATATACTCTAGTCGATTCTTCTAGAGCATTTTGTG

58

ANThiOF_int ATGGGTGCCTCTGAACAC

ANThiOR_int CTAAGCAAGCAGAGCCTTGAT

catB-For GCCAATGCCGTCTGTCCGT

catB-Rev GTGGAACTTGACGAGCTTGGTGG

1109

1110

59

Figure Legends 1111

Figure 1. TLC analysis of NOR production in GMM cultures. (A) The strains ∆ veA ∆stcE 1112

(RDAEp206), veA1 ∆stcE (RAV1p), cpsA- ∆veA ∆stcE (RM1p), cpsA- cpsA+ ∆veA ∆stcE (RM1p-com), 1113

cpsA- veA1 ∆stcE (RM1p-R2), ∆ cpsA ∆veA ∆stcE (TDAE∆cpsA), ∆cpsA cpsA+ ∆ veA ∆stcE 1114

(TDAE∆cpsA-com) (Table S2), were top-agar inoculated and incubated at 37 °C in the dark for 5 days. 1115

NOR production was analyzed by TLC. (B) Intensity of NOR bands. Densitometry was carried out with 1116

GelQuant.NET software. NOR band intensity was normalized using the intensity corresponding to 1117

RDAEp206 as 1. The letters above the bars represent significantly different values (P ≤0.05, Tukey test). 1118

1119

Figure 2. cpsA is necessary for normal expression of ST genes and mycotoxin production in A. 1120

nidulans strains with a veA+ wild-type background. (A) Wild type (TRV50.2) (WT) veA+ control, 1121

∆cpsA (TRVp∆cpsA), complementation (TRVp∆cpsA-com)(com), and overexpression (OEpcpsA)(OE) 1122

strains were inoculated in liquid GMM. Mycelia were collected after 48 and 72 h of culture in a shaker 1123

incubator at 250 rpm at 37 °C. Expression of aflR and stcU was analyzed by Northern blot. rRNA serves 1124

as loading control. Asterisk indicates not detected. Densitometry of the Northern blot results is shown. 1125

(B) TLC analysis of ST production in 72 h cultures described in (A), densitometry of ST band intensity is 1126

shown. 1127

Figure 3. cpsA affects penicillin production. A) Extracts from wild-type (WT) veA+ control, ΔcpsA, 1128

complementation (com) and overexpression (OE) strains were analyzed for penicillin content as described 1129

in Materials and Methods section. (B) Quantification of penicillin content in the analyzed extracts. Values 1130

are means of three replicates. (C) qRT-PCR gene expression analysis by of acvA, ipnA and aatA from 1131

mycelial samples collected after 24 h and 48 h of incubation in PN inducing medium. The relative 1132

expression was calculated using the 2−ΔΔCT method, as described by Livak and Schmittgen (2001). Values 1133

60

were normalized to the expression levels in the wild type, considered 1. Error bars represent standard 1134

errors. The letters above the bars represent significantly different values (P ≤0.05). 1135

Figure 4. cpsA positively affects A. nidulans colony growth. (A) Photographs of wild-type (WT) veA+ 1136

control, ΔcpsA, complementation (com) and overexpression (OE) strains point-inoculated on GMM plates 1137

and incubated at 37 °C in either light or dark for 6 days. (B) Colony growth measured as colony diameter. 1138

Standard error is shown. Means are average of three replicates. 1139

Figure 5. cpsA is necessary for proper asexual and sexual development. (A) Micrographs of wild-type 1140

(WT) veA+ control, ΔcpsA, complementation (com) and overexpression (OE) strains point-inoculated 1141

GMM cultures incubated at 37 °C in either light or dark for 6 days. Samples were observed two 1142

centimeters from the inoculation point. Images were captured with an upright Leica MZ75 1143

stereomicroscope. Scale bar corresponds to 200 µm. (B) Quantitative analysis of production of conidia, 1144

Hülle cells and cleistothecia from top-agar inoculated GMM cultures incubated at 37 °C in either light or 1145

dark for 48 h and 72 h, in the case of conidia and Hülle cells, and 6 days in the case of cleistothecia. 1146

Asterisk indicates not detected. The experiment included three replicates. (C) qRT-PCR gene expression 1147

analysis of brlA, nsdD, steA and stuA from mycelial samples from 48 h and 72 h GMM liquid stationary 1148

cultures. The relative expression was calculated using the 2−ΔΔCT method, as described by Livak and 1149

Schmittgen (2001). Values were normalized to the expression levels in the wild type, considered 1. Error 1150

bars represent standard errors. 1151

Figure 6. Expression of veA and laeA is positively affected by cpsA. qRT-PCR gene expression 1152

analysis of veA and laeA from liquid stationary GMM cultures 48 h and 72 h after incubation in the dark 1153

at 37 oC. The relative expression was calculated using the 2−ΔΔCT method, as described by Livak and 1154

Schmittgen (2001). Levels in the wild type, considered 1. Error bars represent standard errors. The letters 1155

above the bars represent significantly different values (P ≤0.05). 1156

1157

61

Figure 7. Localization of CpsA protein. (A) Cellular localization of CpsA-GFP fusion protein expressed 1158

by its endogenous promoter. Cells were grown for 16 h at 25 C. CpsA accumulates at small vesicles 1159

resembling vacuoles and endosomes. The kymograph obtained from a stack of 90 images for 12 seconds 1160

(200 ms exposure each) along the line shown in GFP inset. Dashed line square indicates the limits of 1161

movie 1. Kymograph shows the presence of static and motile vesicles migrating in an anterograde (to the 1162

tip) and retrograde (from tip to base of cells) modes. (B) CMAC staining confirm the presence of CpsA-1163

GFP in small vacuoles. Details of the aggregates are shown at the bottom of the images. Asterisks 1164

indicate cell tips. Scale bar represents 5 micrometers. (C) Detection of CpsA-GFP fusion using GFP 1165

antibodies. TE indicates a total extract using an alkaline lysis protocol. Soluble protein from A50 1166

extraction protocol is shown in line SN. Insoluble protein in A50 treatment was analyzed in line P. An 1167

overexposure of the filter on the CpsA-GFP fusion region is shown. In both protocols a band 1168

corresponding to GFP is visualized as indication of protein degradation in vacuoles or MVs 1169

(multivesicular bodies)/lysosomes. 1170

1171

Figure 8. Absence of or overexpression of cpsA increases sensitivity to SDS and CFW. (A) Wild-type 1172

(WT) veA+ control, ΔcpsA, complementation (com) and overexpression (OE) strains were point 1173

inoculated on GMM containing SDS (A) and CFW (B) at different concentrations. Cultures were 1174

incubated at 37 °C in dark for 3 days. 1175

1176

Figure 9. cpsA is required for proper attachment of the cell wall to the plasma membrane. 1177

Transmission electron microscopy images of wild-type (WT) veA+ control, ΔcpsA, complementation 1178

(com) and overexpression (OE) strains. The strains were grown in liquid stationary GMM cultures at 1179

37°C for 48 h. Mycelia were fixed and stained with 2% uranyl acetate and 0.2% lead citrate. The arrows 1180

show the cell structure alteration with detachment of plasma membrane and cell wall. Micrographs were 1181

acquired with different magnifications represented by panels in (A) and (B). 1182

62

1183

Figure 10. cpsA is involved in adhesion to surfaces. (A) Conidia of wild-type (WT) veA+ control, 1184

ΔcpsA, complementation (com) and overexpression (OE) strains were inoculated in liquid GMM (105 1185

spores/ml), and incubated at 37 °C for 24 h and 48 h as stationary cultures. Mycelium was stained with 1186

Crystal violet as described in Materials and Methods section. The 48 h samples in panel A were dilluted 1187

2-fold for measurement at 560 nm. (B) Expression analysis of laeA, dvrA, and stuA by Northern blot. The 1188

strains were inoculated (105 spores/ml) in Petri dishes containing 20 ml of liquid GMM, and incubated at 1189

37 °C for 48 h and 72 h as stationary cultures. rRNA serves as loading control. Densitometry of the 1190

Northern blot results is shown. 1191

Figure 11. cpsA is necessary in resistance to oxidative stress in A. nidulans. (A) Wild-type (WT) veA+ 1192

control, ΔcpsA, complementation (com) and overexpression (OE) strains were point-inoculated on GMM 1193

containing different concentrations of menadione and incubated at 37 °C in dark for 3 days. Expression 1194

analysis of thiO by qRT-PCR (B) and catB by Northern blot (C and D). The strains were incubated in 1195

liquid GMM at 250 rpm at 37°C in the dark for 48 h. After that, mycelia were transferred to GMM with 1196

or without menadione (0.08 mM). rRNA serves as loading control. Densitometry of the Northern blot 1197

results is shown. 1198

1199

Figure 12. Model of the role of cpsA in A. nidulans. cpsA is necessary for proper attachment of the cell 1200

wall to the plasma membrane, and the normal cell wall composition and integrity that protect fungal cells 1201

from environmental stresses. All the genes in this model are downregulated in the absence of cpsA. The 1202

cpsA gene positively influences the expression of the master regulators veA, laeA and stuA, and is 1203

required for normal sexual and asexual development, secondary metabolism and biofilm formation. 1204

Supplemental Figures 1205

63

Figure S1. RM1 presents a single mutation in cpsA gene. (A) Complementation insert from the 1206

genomic library plasmid in the RM1 mutant and corresponding genomic fragment in the RM1 mutant. 1207

The red arrow shows the point mutation at nucleotide +568 of the cpsA coding region, from GAT to 1208

AAT, resulting in a change from glutamic acid (D) to Asparagine (N). (B) Alignment of the deduced 1209

amino acid sequences of A. nidulans cpsA and putative homologs in other Aspergillus species. The 1210

species compared are: Aspergillus terreus (NIH2624), Aspergillus clavatus (NRRL 1), Aspergillus 1211

fumigatus (Af293), Aspergillus niger (CBS 513.88, asterisk after residue A304 indicates the exclusive 1212

presence of 76 non-conserved amino acids, coordinates 305-380, in A.niger CpsA putative homolog), 1213

Aspergillus oryzae (RIB40), and Aspergillus flavus (NRRL 3357). Accession numbers of protein 1214

sequence are located in Table S1. The alignment was performed with MAFFT 1215

(http://www.ebi.ac.uk/Tools/msa/mafft/ ) multiple sequence alignment software program. Conserved 1216

residues are highlighted in blue with Jalview 2.9.0b2 (http://www.jaview.org/)) software program. The 1217

conserved domain, GT2_HA, is indicated with an orange bar (amino acid residues, 45-290), predicted 1218

Signal peptide and TM domains are indicated with cian and brown boxes, respectively. 1219

1220

Figure S2. Conservation of CpsA in different fungal genera. Multiple sequence alignment of CpsA 1221

putative homologs. Alignment was generated using MAFFT. The alignment was visualized by Jalview 1222

with conserved residues in dark blue. Species represented in alignment are: Aspergillus nidulans (Anid), 1223

Histoplasma capsulatum (Hcap), Trichoderma reesei (Tree), Botrytis cinerea (Bcin), Fusarium 1224

oxysporum (Foxy), Neurospora crassa (Ncra), Coccidioides immitis (Cimm), Stachybotrys chartarum 1225

(Scha), Acremonium chrysogeum (Achr), Crytococcus neoformans (Cneo), Coprinopsis cinera (Ccin), 1226

and Sphaerobolus stellastus (Sste). Accession numbers of each protein sequence are located in Table S1. 1227

1228

Figure S3. CpsA Phylogenetic Tree. Phylogenetic tree of CpsA putative homologs from different fungal 1229

species. Phylogenetic trees constructed using MEGA v6.0. Trees were constructed with Maximum-1230

64

Likelihood model with a bootstrap value of 1000. Green branches indicate Aspergillus spp., blue branches 1231

indicate other Ascomycota outside of Aspergillus, and red represents species from Basidomycota. 1232

Figure S4. Alignment of the deduced amino acid sequences of A. nidulans cpsA and putative 1233

bacterial homologs. The species compared are: Streptomyces pneumoniae, Streptacidiphilus albus, 1234

Actinomadura macra, Piscicoccus intestinalis, Frankia elaeagni, and Pseudonocardia acacia. The 1235

alignment was performed with MAFFT (http://www.ebi.ac.uk/Tools/msa/mafft/) multiple sequence 1236

alignment software program. Conserved residues are highlighted in black with BOXshade 1237

(http://www.ch.embnet.org/) software program. The conserved domain, GT2_HA, is underlined (amino 1238

acid residues, 45-290). DDD and XDD motifs are indicated with red boxes. 1239

1240

Figure S5. Generation of A. nidulans cpsA deletion, complementation and overexpression strains. 1241

(A) Schematic diagram showing the replacement of cpsA with the A. fumigatus pyrG gene (pyrGA. fum) by 1242

a double-crossover event. XhoI restriction sites and probe template used in the Southern blot analysis to 1243

confirm the proper integration of the cassette are shown. (B) Southern blot analysis results of 1244

TDAE∆cpsA and TRV∆cpsA transformants. The expected band sizes were 5.6 kb for wild type (WT) and 1245

3.1 kb for ∆cpsA. (C) Linear diagram of cpsA complementation plasmid pSM3-cpsA-com. The 1246

complementation strain was confirmed by diagnostic PCR, using primers RM1-F5 (F) and cps-OE2 (R) 1247

the expected 0.9 kb PCR product is shown. (C) Linear diagram of cpsA overexpression plasmid pTDS-1248

cpsOE. The overexpression transformants were confirmed by PCR with primers gpdApromoF (F) and 1249

cps-OE2 primers (R) yielded the predicted 1.8 kb product. (D) Expression analysis of cpsA by Northern 1250

blot. Wild type veA+ control (WT), ∆cpsA, complementation (com) and overexpression (OE) strains were 1251

inoculated in liquid GMM and incubated at 37 °C for 72 h. Densitometry of the Northen blot results is 1252

shown. Asterisk indicates not detected. 1253

65

Figure S6. Effect of cpsA deletion in ST production in GMM cultures containing different glucose 1254

concentrations. Wild type veA+ control (WT), ∆cpsA, complementation (com) and overexpression (OE) 1255

strains were top-agar inoculated and incubated at 37 °C in the dark for 2, 3 and 6 days. ST production was 1256

analyzed as described in the Materials and Methods section. White arrows indicate additional unknown 1257

compounds whose synthesis is cpsA-dependent. 1258

Figure S7. Localization of overexpressed CpsA-GFP. Fusion CpsA-GFP was overexpressed using the 1259

gpdA promoter. A micrograph of strain TSSP19.1 (Table S1) Localization of OE-CpsA-GFP is nearly 1260

identical to that observed using the cpsA endogenous propmoter. A kymograph shows the presence of 1261

static (grey triangles) and motile fluorescence accumulations, probably early endosomes. These 1262

organelles move in anterograde (c) or retrograde (b) direction and some reached the tip of the cell but 1263

rapidly migrate in opposite direction (a). Accumulation of CpsA-GFP at the plasma membrane was not 1264

detected. 1265

1266

Figure S8. Effect of cpsA on the resistance to osmotic stress and temperature changes. Wild type 1267

veA+ control (WT), ∆cpsA, complementation (com) and overexpression (OE) strains were point 1268

inoculated on GMM or GMM containing 0.7 M NaCl or 1.2 M of sorbitol, and incubated at 30 oC, 37°C 1269

or 45 oC in dark for 3 days. 1270

1271

Figure S10. Deletion of rlmA in the absence of veA does not rescue ST production. (A) Diagrams and 1272

verification of rlmA deletion in TSSP15.1 (∆rlmA) and TSSP16.1 (∆veA ∆rlmA) and (B) veA deletion in 1273

TXF2.1p (∆veA) and also in TSSP16.1 (∆veA ∆rlmA). The strains were confirmed by diagnostic PCR, 1274

obtaining the expected 2.7 kb (using primers ANrmlA_P1 (F) and pyrG_Afum_R (R)), and 2.8 kb 1275

products (using primers veAF5'UTR (F) and pyroAR)), respectively. (C) TLC analysis of ST from wild 1276

type (WT), ∆veA, ∆ rlmA and ∆veA∆rlmA double mutant from top-agar inoculated GMM cultures 1277

66

incubated for 72 h at 37 oC. ST standard (ST) was included on both sides of the TLC plate. (D) 1278

Densitometry of ST performed using GelQuantNET software. ST band intensity was normalized with 1279

respect to that of the wild type considered as 1. 1280

1281

Figure S10. Infrared spectroscopy analysis. Infrared spectra were obtained from wild type and cpsA 1282

mutant by the KBr method described in Materials and Methods. IR spectra from both samples were 1283

identical. 1284

1285

Figure S11. Linkage types in EPS. The type and abundance (%) of the linkages were deduced by 1286

methylation analysis of the EPS from A. nidulans wild type (wt) and cpsA mutant (mut). After 1287

derivatization to their corresponding partially methylated alditol acetates, samples were analyzed by GC-1288

MS as described in Materials and Methods. 1289

1290