Crime Scene InvestigationCrime Scene Investigation

Science in Motion

Cedar Crest College

Forensic Science Forensic Science in Popular Mediain Popular Media

On TV In RealityOn TV In Reality

Interrogate suspects, thus they kick down doors

Make judgments about guilt or innocence

Operate independently of other investigators– For instance, go to crime

scenes without permission

Never interrogate suspects, often go to crimes scenes long after the crime

Should never make judgments about guilt or innocence

Work as part of an investigative team and usually in a subordinate role (police are ultimately in charge)

On TV In RealityOn TV In Reality

Usually have multiple expertise

Act like detectives– Ask “why” – why would

someone do this and not that

– Rely on hunches Get DNA results in a day

Usually do not have multiple expertise

Deal only with observable and quantifiable phenomena to reach theories and conclusions

Don’t get DNA results in a day

What is Forensic Science?What is Forensic Science?

The Application of Science to the Law.

Scope of Forensic Science Scope of Forensic Science

Forensic Medicine– Deals with application of medical knowledge to legal questions

Birth/death certificates, reports infectious diseases, medical testimony in court

Forensic Anthropology– Works with forensic pathologist at crime scene

determines age, sex, ancestry, other facts in conjunction with body or skeletal remains

Forensic Odontology Questioned Document Examination Criminalistics

What is Criminalistics?What is Criminalistics?

Application of physical, chemical, and biological methods for analysis

of physical evidence taken from criminal investigations that is

Locardian in nature.

Locard Exchange Locard Exchange PrinciplePrinciple

“Every time two objects come into contact, a transfer of physical evidence occurs, and therefore creates a record of the action”

This is the guiding principle of criminalistics

Role of Criminal Investigation Role of Criminal Investigation ParticipantsParticipants

Question Police/

ADA

Medical

Examiner

Criminalist

Who? ***

***

How? *** *** *

Why? ***

Forensic BiologyForensic Biology

Commonly referred to as “DNA Testing”

Serological and DNA analyses of physiological fluids for the purpose of identification and individualization

Sources of Biological EvidenceSources of Biological Evidence

Blood Semen Saliva Urine Hair Teeth Bone Tissue

Uses of Forensic DNA TestingUses of Forensic DNA Testing

Forensic cases - matching suspect with evidence

Paternity testing - identifying father

Historical investigations Missing persons investigations Mass disasters (i.e. 9/11) Convicted felon DNA databases

How is DNA used in forensic How is DNA used in forensic analysis?analysis?

Every single cell in our body contains DNA 99.9% of human DNA is the same in everyone Only 0.1% of our DNA is unique

– Each human contains 3 billion DNA base pairs– Our unique DNA, 0.1% of 3 billion, amounts to 3

million base pairs. This provides us profiles that accurately identify a person (with the exception of twins, who share 100% identical DNA)

Crime Scene LabCrime Scene Lab

You are Forensic Scientists!As a forensic scientist, how do you work

with these tiny molecules that you cant see?– Analyzing DNA samples from a crime scene

using two methods Gel Electrophoresis

STR (Short Tandem Repeat ) Analysis

Gel ElectrophoresisGel Electrophoresis This process uses electricity to

separate DNA fragments by size as they migrate through a gel matrix

In an electric current the negatively charged DNA moves toward the positive pole in the electrophoresis chamber

Smaller DNA fragments move faster and further over a given period of time than do larger fragments.

This is how DNA fragments can be separated by size in an agarose gel

STR ( Short Tandem Repeat) STR ( Short Tandem Repeat) AnalysisAnalysis

Short tandem repeat (STR) technology is a forensic analysis that evaluates specific regions (loci) that are found on nuclear DNA

The variable (polymorphic) nature of the STR regions that

are analyzed for forensic testing intensifies the discrimination between one DNA profile and another. – For example, the likelihood that any two individuals (except

identical twins) will have the same 13-loci DNA profile can be as high as 1 in 1 billion or greater.

STRSTR’’ss

• STRs are regions of DNA where short sequences, usually between 2- 6 basepairs (bp), are repeated side-by-side

• STR’s are found surrounding the chromosomal centromere (structural center of the chromosomes)

FBIFBI’’ss CODIS CODIS DNA DatabaseDNA Database((CCombined ombined DDNA NA IIndex ndex SSystem)ystem)

The Federal Bureau of Investigation (FBI) has chosen 13 specific STR loci to serve as the standard for CODIS.

The purpose of establishing a core set of STR loci is to ensure that all forensic laboratories can establish uniform DNA databases and, more importantly, share valuable forensic information

13 CODIS Core STR Loci with Chromosomal Positions

CSF1PO

D5S818

D21S11

TH01

TPOX

D13S317

D7S820

D16S539 D18S51

D8S1179

D3S1358

FGA

VWA

AMEL

AMEL

Each person has 2 copies of each chromosome Each person has 2 copies of each chromosome so each person has 2 alleles at each locusso each person has 2 alleles at each locus

Locus or Loci– Refers to the location

on the chromosome

Allele – An alternative form of a gene

(one member of a pair) that is located at a specific position on a specific chromosome

– For STR’s The allele is the number

of repeats

Paternal Chromosome 5Paternal Chromosome 5CCCCAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCCC

Maternal Chromosome 5Maternal Chromosome 5CCCCAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCCC

Example

Locus: D5S818 Alleles: 5, 7

STR AnalysisSTR Analysis

1 2 3 4 5 6 7 8 9 10 11 12 13

vWA F13A01 THO1 FESFPS D16S539 HPRTB TPOX LPL D7S280 D5S818 D13S317 F13B CSF1PO

11,12 4,6 8,9 12, 13 8,10 11, 11 6,7 7,9 6,8 7,11 14, 15 8, 8 6,7

Forensic Case File #24857Forensic Case File #24857Death of Mrs. Lucy BellDeath of Mrs. Lucy Bell

The TimelineThe EvidenceThe SuspectsScientific investigation using biological

evidence