curcumin interferes with her-2 signaling in a redox … as a spice, dye and in therapy [1]. curcumin...
TRANSCRIPT
Central Journal of Human Nutrition & Food Science
Cite this article: Venkiteswaran S, Hsu HC, Yang PA, Thomas T, Thomas TJ (2014) Curcumin Interferes with HER-2 Signaling in a Redox-Dependent Manner in SK-BR-3 Human Breast Cancer Cells. J Hum Nutr Food Sci 2(2): 1030.
*Corresponding authorThomas TJ, Departments of Medicine, Environmental and Occupational Medicine, Rutgers Robert Wood Johnson Medical School and Rutgers Cancer Institute of New Jersey, USA, Rutgers Robert Wood Johnson Medical School, 125 Paterson Street, New Brunswick, NJ 08903, USA, Email:
Submitted: 19 December 2013
Accepted: 17 April 2014
Published: 22 April 2014
ISSN: 2333-6706
Copyright© 2014 Thomas et al.
OPEN ACCESS
Research Article
Curcumin Interferes with HER-2 Signaling in a Redox-Dependent Manner in SK-BR-3 Human Breast Cancer CellsSripriya Venkiteswaran2, Hui-Chen Hsu2, PingAr Yang2, Thresia Thomas2 and Thomas TJ1*1Departments of Medicine, Environmental and Occupational Medicine, Rutgers Robert Wood Johnson Medical School and Rutgers Cancer Institute of New Jersey, USA2Department of Medicine, Division of Clinical Immunology and Rheumatology, University of Alabama at Birmingham, USA
INTRODUCTIONCurcumin (diferuloylmethane), a polyphenolic phytochemical
is the major pigment present in turmeric, a popular spice in Oriental cuisine. Turmeric was used even at the time of Marco Polo as a spice, dye and in therapy [1]. Curcumin is a polyphenolic agent with anti-inflammatory, antioxidant, and anticarcinogenic properties [1-3]. This compound has anti-proliferative and apoptotic activity against different types of cancers, including colon cancer [4], stomach and skin tumors [5], breast cancer [6,7] prostate cancer [8], and head and neck cancer [9]. While different
cancer cell lines have varying degree of sensitivity toward curcumin, non-transformed cells are generally less sensitive [10]. Curcumin disrupts different stages of carcinogenesis, including cell proliferation, survival, angiogenesis and metastasis [11]. Curcumin inhibited cell signaling pathways involving Akt, NF-κB, AP-1 and JNK [11,12]. Curcumin also has inhibitory effects on various signaling proteins, including cyclooxygenase, nitric oxide synthase, matrix metalloproteinases and protein kinases [13,14].
We examined the effects of curcumin on Human Epidermal growth factor Receptor-2 (HER-2) over expressing human breast
Abstract
Background: Curcumin (diferuloylmethane), a major pigment of turmeric, is reported to have beneficial effects on people with cancer, cardiovascular, metabolic, and neurological diseases. The pleiotropic effects of curcumin are thought to be due to its antioxidant effects, although pro-oxidant effects are also observed.
Objective: Our purpose is to better understand the mechanism of action of curcumin in breast cancer cells to facilitate its use in breast cancer prevention and treatment.
Methods: We used SK-BR-3, a HER-2 (human epidermal growth factor receptor-2)-positive breast cancer cell line. Effects of curcumin on cell growth and cell death were determined by viability and APO-BrdU apoptosis assays. Changes in the expression of HER-2 and cell cycle regulatory genes were measured by real-time q-PCR assay. Western blot analysis quantified alterations in total HER-2 and p-HER-2.
Results: Cell viability assay showed concentration- and time- dependent effects, with an IC50 of 3.0 ± 0.5 µM. A significant 80% cells underwent apoptosis with 25 µM curcumin at 24 hours. Curcumin (10 µM) suppressed the expression of HER-2 mRNA level by 70%, as measured by real-time qRT-PCR assay. HER-2 and p-HER-2 levels were reduced by >10 µM curcumin after 16 h of treatment. Curcumin suppressed the expression of cyclins A, B1, D1 and E by 30 to 70%, whereas it increased p21expression. Curcumin (10 µM) arrested cells in the G2/M phase after 24 h of treatment. Pre-treatment of cells with the antioxidant glutathione attenuated growth inhibition induced by curcumin, with partial restoration of HER-2 levels.
Conclusion: Curcumin significantly reduced the expression of HER-2 mRNA and protein. Alteration in HER-2 signaling is dependent on cellular antioxidant levels, an important consideration in translational research.
Keywords•Curcumin•HER-2•Cell cycle•Polyamines•Breast cancer cells•Glutathione
Central
Thomas et al. (2014)Email:
J Hum Nutr Food Sci 2(2): 1030 (2014) 2/8
cancer cells. HER-2 is the product of the HER-2/neu or ErbB-2 gene that encodes a 185 kDa protein [15,16]. It is overexpressed in 30% of breast cancers and is associated with poor prognosis [17]. HER-2 overexpression is associated with rapid progression through the cell cycle [18]. The progression of cells through different phases of the cell cycle is controlled by a group of functionally related proteins, cyclins, Cyclin Dependent Kinases (Cdk) and their inhibitors [19,20]. Progression through the cell cycle requires activation of cyclin D (D1, D2 and D3)-Cdk4/Cdk 6 and cyclin E-Cdk2 complexes at the G1/S phase, cyclin A-Cdk2 during S phase, cyclin A-Cdk1 during G2 and cyclin B-Cdk1 during the M phase [19]. Curcumin inhibited the proliferation of head and neck cancer cells by arresting the cell cycle in the G1/S phase whereas it induced growth arrest of MCF-7 breast cancer cells in the M phase [20,21]. Curcumin has been shown to down-regulate cyclin D1 and cyclin E in human colon cancer cells [22]. In human melanoma cells, G2/M phase arrest induced by curcumin was associated with the induction of p21 and p27 [23]. The p21 and p27 proteins are broad-specificity inhibitors of cyclin/cdk complexes and are induced in response to cell growth inhibitory and DNA damaging agents [19].
Although generally considered as an anti-oxidant, curcumin can also act as a pro-oxidant under certain conditions [23,24]. At concentrations >25 µM, curcumin acts as a pro-oxidant and generates Reactive Oxygen Species (ROS) which contributes to the apoptotic action of curcumin [23,24]. We undertook the present study to gain a better understanding of the molecular mechanism(s) of action of curcumin in HER-2 over expressing breast cancer cells to determine the potential of this compound for treating HER-2-positive tumors. We found that curcumin induced potent cell growth inhibition and apoptosis in a concentration-dependent manner. We further examined the role of the redox pathway by treating cells with curcumin in the presence of exogenous glutathione. We found that glutathione modified the effects of curcumin on HER-2 signaling and cell growth.
MATERIALS AND METHODSMaterials
SK-BR-3 cell line was obtained from American Type Culture Collection (Manassas, VA). Curcumin, McCoy5A media, and anti-ß-actin antibody were obtained from Sigma Chemical Co. (St. Louis, MO). Fetal Bovine Serum was obtained from VWR (West Chester, PA). Trypsin and other additives for cell culture medium were purchased from Invitrogen (Carlsbad, CA). APO-BrdU assay kit was purchased from BD Biosciences (Franklin Lakes, NJ). Phospho-HER-2 and total HER-2 antibodies were from EMD Bioscienes (San Diego, CA).
Cell proliferation
SK-BR-3 cells were routinely maintained in McCoy 5A medium supplemented with 10% fetal bovine serum and 2 mM L-Glutamine. Cell line was authenticated by Short Tandem Repeat (STR) analysis, performed at the Johns Hopkins University (Baltimore, MD), using the Powerplex 1.2 kit from Promega (Madison, WI). For cell proliferation assay, cells were seeded at a density of 5 x 104 cells/well in 24-well plates. Cells were dosed 20 h after plating, with required concentrations of curcumin. Medium was changed and cells re-dosed at 48-hour intervals.
After the appropriate treatment periods, live cells were counted
using the trypan blue exclusion method, using a hemocytometer.
Apoptosis assay
SK-BR-3 cells (2x106cells/100 mm dish) were plated in triplicate in 100 mm dishes. After 24 h, cells were treated with appropriate concentrations of curcumin for 24, 48 and 72 h. At the indicated time point, cells were harvested in PBS, and fixed in 1% paraformaldehyde. After two washes in PBS, cells were resuspended in ethanol and stored at -20°C until further analysis. Percentage apoptosis was determined using the APO-BrdU assay kit from Pharmingen (San Diego, CA, USA). For this assay, the cell pellet was incubated with bromolated deoxyuridine triphosphate (BrdU) and TdT enzyme for 24 h at 22°C. BrdU incorporated into the 3’-hydroxyl termini of double- and single-stranded DNA was identified by staining the cells with a fluorescent labeled anti-BrdU monoclonal antibody using flow cytometry (Coulter Cytomics FC500 Flow Cytometer, Beckman Coulter, Inc. (Fullerton, CA).
Cell cycle analysis
For cell cycle analysis, SK-BR-3 cells (2x106 cells/100 mm dish) were seeded and incubated for 24 h, and then treated with curcumin for 24, 48 and 72 h. Triplicate plates from each treatment group were washed with PBS and covered with a
buffer containing 40 mM sodium citrate, 250 mM sucrose and 5% DMSO, and stored at –70°C. On the day of DNA analysis, cells were thawed, and the citrate buffer was removed. Cells were trypsinized for 10 min and then treated with a solution containing a trypsin inhibitor and RNase for 10 minutes. Cells were stained by adding propidium iodide solution in sodium citrate buffer and analyzed by a Coulter flow cytometer and cell distribution calculated with cytologic software [25].
qRT-PCR
Cells were plated and treated with curcumin, as described in Apoptosis Assay above. At the end of the treatment time pe-riods, media was removed and cells treated with Trizol reagent. RNA was isolated using Trizol reagent (Invitrogen) and 2 µg RNA was reverse-transcribed using the first strand cDNA synthesis kit (Fermentas, Inc., Glen Burnie, MD) with random hexamers as primers. The expression of Her2, p21, p27, Ccna, Ccnb1, Ccnd1, Ccne and Gapdh genes was determined by real-time PCR using the SYBR Green PCR Master Mix (Bio-Rad) with the following prim-ers: 5’-CGAAGCCTCACAGAGATC-3’ and 5’-TTACACATCGGAGAA-CAGG-3’ for Her2 (173 bp); 5’-CCTGTCACTGTCTTGTACCCT-3’ and 5’-GCGTTTGGAGTGGTAGAAATCT-3’ for p21 (130 bp); 5’-CG-GCTAACTCTGAGGACAC-3’ and 5’-GTCTGCTCCACAGAACCG-3’ for p27 (196 bp); 5’-TGGGAGAATTAAGTTTGATAGATG-3’ and 5’-TGAGGTAGGTCTGGTGAAG-3’ for Ccna (192 bp); 5’-TGGTT-GATACTGCCTCTCC-3’ and 5’-GACTGCTTGCTCTTCCTC-3’ for Ccnb1 (200 bp); 5’-ATCTACACCGACAACTCCATC-3’ and 5’-CA-CAGAGGGCAACGAAGG-3’ for Ccnd1 (193 bp); 5’-GTGTCCTGGAT-GTTGACTGCCTTG and 5’-GTCGCACCACTGATACCCTGAAAC-3’ for Ccne (116 bp); 5’-CATGAGAAGTATGACAACAGCCT-3’ and 5’- AGTCCTTCCACGATACCAAAGT -3’ for Gapdh (113 bp).
A total volume of 25 µL was used for qPCR in an IQ5TM thermocycler (Bio-Rad). Amplification conditions were 95 °C for
Central
Thomas et al. (2014)Email:
J Hum Nutr Food Sci 2(2): 1030 (2014) 3/8
3 min, then 40 cycles of 95 °C for 15 s, and annealing for 30 s at 60°C. qPCR products were normalized relative to that of Gapdh to correct for template input variation. Data is presented as fold differences in expression of the indicated gene relative to Gapdh. Standard curve was produced for every target using six 4-fold serial dilution.
Western blotting
Cells (2.5 x 106/100 mm dish) were washed twice with ice-cold PBS and lysed with the addition of ice-cold lysis buffer [150 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Nonidet P-40, 2 mM EDTA, 50 mM sodium fluoride, 0.2% SDS, 1 mM sodium vanadate, and 1 X concentration of a protease inhibitor cocktail (Calbiochem, San Diego, CA)]. Thirty micrograms of protein (determined by the Bradford protein assay) was diluted in 2X SDS-PAGE Laemmli buffer [150 mM Tris-HCl (pH 6.8), 30% glycerol, 4% SDS, 7.5 mM DTT, 0.01% bromophenol blue] and separated on a 7.5, 10 or 12 % SDS-polyacrylamide gel. Proteins were transferred to PVDF membrane. After blocking with 5% nonfat milk, membrane was immunoblotted with an appropriate dilution of the primary antibody. Protein bands were visualized using horseradish peroxidase–conjugated secondary antibody with a chemiluminescence based detection system. As a control, membranes were stripped and reblotted with anti-β-actin monoclonal antibody, and blots developed using Kodak XAR Biomax film.
Statistics
All experiments were repeated at least three times. Statistical difference between control and treatment groups was determined by one-way ANOVA followed by Dunnet’s post-test (GraphPad Prism Software program, San Diego, CA). P < 0.05 was considered to be statistically significant. Gel bands were quantified using the Image J software (NIH) [26].
RESULTSEffect of Curcumin on cell proliferation and apoptosis
We first studied the effect of different concentrations of curcumin on HER-2 over expressing SK-BR-3 cells by the trypan blue exclusion method. We treated SK-BR-3 cells with vehicle alone (DMSO) or 1, 2.5, 5, or 10 µM curcumin for 24 h. Only live cells not able to uptake trypan blue were counted. DMSO treatment resulted in <5% change in cell number. Figure 1A shows results of the cell proliferation assay. We observed a dose-dependent decrease in cell number with increasing concentrations of curcumin, with an IC50 of 3.0 ± 0.5 µM at 24 h of treatment. Similar cytotoxicity was observed at 48 and 72 h of treatment, except that viable cells were eliminated at lower concentrations, with <10% cells remaining at 72 h at 10 µM concentration. These results indicate that curcumin can induce growth inhibitory and cell killing effects in HER-2 over expressing SK-BR-3 cells in a concentration-dependent manner.
In the next set of experiments, we quantified the effect of curcumin on apoptosis of SK-BR-3 cells for 24, 48 and 72 h using the APO-BrdU assay. In this assay, Terminal Deoxynucleotidyl Transferase (TdT) catalyzes the addition of bromolated deoxyuridine triphosphates (Br-dUTP) to the 3’-hydroxyl termini
of double- and single-stranded DNA. After incorporation, these sites were identified by flow cytometry by staining the cells with a fluorescein-labeled anti-BrdU monoclonal antibody. Figure 1B shows the effect of curcumin on apoptosis of SK-BR-3 cells. Percentage of apoptosis (± SD) in cells treated with 5 and 10 µM curcumin for 24 h were 5.0 ± 0.71 % and 12.0 ± 1.5 %, respectively. However, there was a remarkable increase in apoptosis when cells were treated with 25 µM (79.6 ± 1.3 %) or 50 µM (87.8 ± 1.9 %) curcumin. In vehicle treated cells, apoptosis was 2.28 ± 0.04 %. Apoptotic cells remained in the range of 7 to 12% after 72 h of treatment with 10 µM curcumin.
Effect of curcumin on cell cycle of SK-BR-3 cells
We next determined the effect of curcumin on the distribution of cells in different phases of cell cycle by curcumin treatment. Cells were treated with DMSO or 5, 10, 25 and 50 µM curcumin for 24 h. As shown in Table 1, we observed distinct effects on cell cycle depending on the concentration of curcumin. At 10 µM
120 A
100
8024 h48 h72 h
60
40
20
00 2 4 6 8 10 12
Curcumin Concentration, µM
µΜ
µΜ
µΜ
µΜ
100 # # # #
B 80 # #
60
40
20*
024 h 48 h 72 h
Treatment, Hours
Cel
lNum
ber,
Perc
entC
ontr
olA
popt
osis
,Per
cent
Figure 1 A) Effect of curcumin on viability of SK-BR-3 cells. SK-BR-3 cells were treated with different concentrations of curcumin for 24, 48 and 72h. At these time-points, cells were counted by trypan blue exclusion using a hemocytometer. Experiments were conducted 3 separate times and mean ± SD are shown. B) Effect of curcumin on apoptosis of SK-BR-3 cells. Cells were treated with different concentrations of curcumin for 24, 48 and 72h. Apoptisis was determined by APO-BrdU assay kit. Experiments were conducted 3 separate times and mean ± SD are shown (* P < 0.05; # P < 0.001).
Central
Thomas et al. (2014)Email:
J Hum Nutr Food Sci 2(2): 1030 (2014) 4/8
concentration, curcumin caused the cells to accumulate in the G2/M phase. However, cells appeared to be evenly distributed between G1, S and M phases 24 h of treatment with 25 and 50 µM curcumin.
Effect of curcumin on mRNA levels of critical cell signaling and cell cycle regulatory genes
SK-BR-3 cells are critically dependent on the over expression of HER-2 protein and the subsequent up-regulation of cell signaling pathways. We therefore examined the expression of Her-2 gene in response to curcumin treatment using real-time qPCR analysis. We also determined mRNA levels of cell cycle regulatory proteins such as cyclins and cyclin dependent kinase inhibitors. As shown in Figure 2, HER2 mRNA levels were reduced by 65 to 70% at 10 to 50 µM curcumin treatment for 16 h to 24 h. However, cyclin dependent kinase inhibitors that
are typically induced by growth inhibitory and apoptotic agents showed differential effects at different concentrations. There was a remarkable 5-fold increase in p21 mRNA in samples treated with 10 µM curcumin, for 16 h, but there was a 50% decrease from the highest level at 25 and 50 µM concentrations. At the 24 h time point, p21 remained 2.5-fold at higher than the control at all concentrations of curcumin. The p27Kip1 mRNA showed a less remarkable effect of about 30% increase in cells treated with 10 µM curcumin and a decrease from the maximum at higher curcumin concentrations. There was a 30 to 40% decrease of p27 mRNA level compared to the control in cells treated with 50 µM curcumin for 16 or 24 h.
Cyclin A and cyclin B1 are generally induced in the S and G2/M phases of cell cycle whereas cyclin D1 and cyclin E are induced in the G1 phase. Interestingly, curcumin was not able to alter cyclin A (Ccna) and cyclin B1 (Ccnb1) mRNA levels at 10 µM
Curcumin Conc., μM G1 S G2/M
0 56.05 ± 2.3 20.82 ± 1.6 23.17 ± 0.5
5 59.38 ± 0.9# 17.65 ± 0.8 22.76 ± 1.2
10 24.82 1.1* 20.07 ± 0.6 56.14 ± 1.1*
25 32.69 ± 0.8* 31.47 ± 3.5* 36.77 ± 3.9*
50 33.24 ± 1.6* 28.98 ± 2.0* 38.49 ± 3.0*
Table 1: Effect of Curcumin on Cell Cycle Distribution of SK-BR-3 Cells.
SK-BR-3 cells (2x106) were treated with curcumin for 24 h. Cells were stained by adding propidium iodide solution in sodium citrate buffer and analyzed by a Coulter flow cytometer. Floating cells were not collected. Percentage distribution of cells in different phases of cell cycle was calculated with cytologic software. Data are the mean ± SD of three separate experiments and the p values were determined by ANOVA followed by Dunnet’s post-test comparing curcumin treated groups with control group (* P < 0.01; # P < 0.05).
Figure 2 Effects of curcumin on the expression of HER-2 and other mRNAs by qRT-PCR. Cells were treated with different concentrations of curcumin for 16 and 14 h. HER-2, p21, p27, cyclin A, Cyclin B1, cyclin D1 and Cyclin E mRNAs were quantified.
Central
Thomas et al. (2014)Email:
J Hum Nutr Food Sci 2(2): 1030 (2014) 5/8
concentration, but at higher concentrations, there was a 50 to 60% decrease in the mRNA levels of these genes, both at 16 and 24 h of treatment. Cyclin D1 (Ccnd1) and cyclin E (Ccne) showed 50 to 75% decrease after treatment with 10 to 50 µM curcumin, both at 16 and 24 h of treatment.
Effect of curcumin on HER-2 protein levels
Considering the critical role of HER-2 protein in the regulation of SK-BR-3 cells, we next examined the effect of curcumin on HER-2 protein levels. Since HER-2 kinase activity is regulated by its phosphorylation status, we determined the levels of total HER-2 and p-HER-2 proteins by Western immunoblots. To examine the potential of early changes in phosphorylation status, SK-BR-3 cells were treated with curcumin for 4, 8, 16 and 24 h. Proteins from cell lysates were then analyzed by Western blotting and probed for
p-HER-2, total-HER-2 and β-actin (Figure 3A). Relative band intensities with reference to those of β-actin are presented in Figures 3B. We found that curcumin caused a time- and dose-dependent reduction in both p-HER-2 and total-HER-2 levels. Furthermore, 25 and 50 µM concentrations significantly reduced p-HER-2 levels by 4 h. By 24 h, both p-HER-2 and total-HER-2 levels were reduced by 80 to 90 % in cells treated with 25 and 50 µM curcumin.
Effect of Glutathione pre-treatment of SKBR-3 cells on curcumin induced cell death/growth inhibition
In order to understand the mechanism of action of curcumin
on SK-BR-3 cells, we examined the role of the ROS pathway since curcumin has been reported to generate ROS as a precursor to inducing cell death. SK-BR-3 cells were pre-treated with 5 mM glutathione according to the protocol of Syng-Ai et al. [27] for 1 h before treatment with curcumin. Cells were then harvested at the end of 24 h and viable cells counted using a hemocytometer. Results are presented in Figure 4. We found that pre-treatment with glutathione significantly attenuated the growth inhibition induced by curcumin in SK-BR-3 cells. Glutathione (5 mM) exerted protective effect on the cytotoxicity of curcumin at 5 to 50 µM concentrations. Cells treated with 50 μM curcumin resulted in 90% reduction in viable cell number, however, pre-treatment with glutathione resulted in only ~ 60% reduction of cell number.
Since glutathione pre-treatment rescued SK-BR-3 cells from cell death, we next examined the effect of glutathione on HER-2 protein levels (Figure 5). SK-BR-3 cells were treated with 0, 5, 10, 25 and 50 µM curcumin for 24 h after pre-treatment with glutathione. Cells were harvested and cell lysates subjected to Western blotting. Cells treated with 25 to 50 µM curcumin plus 5 mM glutathione showed a 2-fold induction of total-HER-2 protein levels compared to samples treated with curcumin alone. However, HER-2 protein levels were still lower than that of the control group. These results showed that glutathione was capable to partially restoring total-HER-2 level.
DISCUSSIONOur results indicate that curcumin is capable of inhibiting
A
B
Time of Treatment Time of Treatment
1.2 pHER-2 HER-2 Curcumin Conc. µM
0.8 *
* **
Curcumin Conc. µM
1.2
0.8 *
0.4 * * *
* 0.4
* *
0 04 h 8 h 16 h 24 h 4 h 8 h 16 h 24 hR
elat
ive
Ban
dIn
tens
ity
Figure 3 Western blot analysis of p-HER-2 and HER-2 in SK-BR-3 cells treated with curcumin. SK-BR-3 cells were treated with vehicle (DMSO) or 5, 10, 25, 50 μM curcumin for 4, 8, 16 and 24 h. Cells were lysed and protein subjected to western blotting. A. Bands corresponding to HER-2 and p-HER-2 proteins. B. Densitometric quantification of HER-2 and p-HER-2. Data are the mean ± SD of three experiments (* P < 0.01; # P < 0.05).
Central
Thomas et al. (2014)Email:
J Hum Nutr Food Sci 2(2): 1030 (2014) 6/8
the growth of HER-2-positive SK-BR-3 cells. Curcumin caused cell growth inhibition with an IC50 of 3.0 µM, although apoptosis was not significant at <5 µM concentrations. In contrast, majority of cells (>80%) underwent 25 and 50 µM concentrations. At 10 µM concentration, curcumin induced G2/M arrest, although, at higher concentration, cells were evenly distributed in G1, S, and G2/M phases. Real-time qPCR analysis showed that HER-2 mRNA level was reduced by 65 to 70% at 10 to 50 µM curcumin. Significant decreases in HER-2 protein and p-HER-2 levels were also observed after curcumin treatment. Pre-treatment with glutathione partially reversed the growth inhibition induced by curcumin and restored HER-2 protein levels.
Curcumin is known to induce apoptotic activity against a variety of cancers, including, stomach and skin tumors as well as breast and prostate cancer cells [3,5,6,11]. However, induction of apoptosis depends on curcumin concentration, cell type, and environmental factors [28]. Cells treated with 25 and 50 µM curcumin showed a remarkable reduction in cell viability and increase in apoptosis at the 24 h time point. It has been reported that curcumin can cause cell growth inhibition without inducing apoptosis in leukemia cells [28], a finding similar to our results of lack of apoptosis at <5 µM curcumin. In some breast cancer cell lines, curcumin-induced cell killing has been reported to differ from classical apoptosis [29].
Inhibition of cell growth was also associated with a decrease in p-HER-2 as well as total-HER-2 protein levels. Curcumin has been shown to deplete and accelerate the degradation of HER-2 protein by causing its dissociation from the molecular chaperone, GPR94 [3]. These results are consistent with other studies that have shown an inhibition of HER-2 signaling by Herceptin or the down-regulation of erbB2/neu promoter activity as a mechanism
of cell growth inhibition in HER-2 over expressing tumor cells [29,30].
We observed that curcumin treatment of SK-BR-3 cells caused cells to arrest in the G2/M phase at 10 µM curcumin concentration. In addition, p21 was also induced at this concentration. The low level of apoptosis at 10 µM curcumin might stem from the observation that for efficient apoptosis, cells must escape G2 arrest which is an initial response to DNA damage [31]. At 24 h, cells treated with 25 and 50 µM curcumin showed an induction of p27 mRNA and increased accumulation of S phase cells. Similar to the effects seen herein, dasatanib, a tyrosine kinase inhibitor represses growth of head and neck cancers and lung cancers by inducing p27 and affecting the G1/S phase transition of the cells [32].
We also examined whether the effect of curcumin is related to its role as a modulator of the redox state of the cell. While curcumin is reported to induce apoptosis by depletion of glutathione and generation of ROS in breast cancer cells [33], it is also a potent scavenger of a variety of ROS [34]. Curcumin can act as pro-oxidant in the presence of metals ions like copper in the environment or at high concentrations in vitro [35]. At 10 µM concentration, curcumin acts as an anti-oxidant; however, at 50 µM it generates superoxide radicals and acts as a pro-oxidant [23,24]. Oxidative stress signals induced by the formation of ROS and glutathione depletion are considered as important activators of apoptosis [35]. We observed that pre-treatment of cells with 5 mM glutathione reduced growth inhibitory effects of curcumin and partially restored HER-2 protein levels.
The mechanism by which ROS modulates HER-2 protein levels is not known although it can be speculated that cysteine thiol modification is involved. Within the acidic intracellular
120
100
80
# *
# *
60# * #
* *
40
20
0
Curcumin Concentration, µµM
* *
0 5 10 25 50 5 +Glut
10 +Glut
25 +Glut
50 +Glut
0 +Glut
Cel
lNum
ber,
Perc
ent
Figure 4 Effect of glutathione pre-treatment of SK BR-3 cells on curcumin-induced growth inhibition and death. Cells were treated with 5 mM glutathione for 1 h before addition of curcumin. Cells were harvested after 24 h and counted using the trypan blue exclusion assay. Results shown are the mean ± SD from three experiments (* P <0.01, comparing control with treatment groups; # P <0.01, comparing curcumin treated group with its respective curcumin + glutathione treated group.
Central
Thomas et al. (2014)Email:
J Hum Nutr Food Sci 2(2): 1030 (2014) 7/8
environment of cells, curcumin exists in the bis-keto form which is a potent H-atom donor [36]. As a result, curcumin can also directly interact and modify thiols groups present on cysteine groups on proteins like NF-B and AP-1 and modulate their transcriptional activity [37]. HER-2 protein has two cysteine rich extracellular subdomains that are thought to play an important role in ligand-dependent transactivation [38]. Therefore, it is possible that curcumin modifies HER-2 and hastens its degradation or turnover rate. One of its other targets includes thioredoxin reductase, an enzyme involved in combating oxidative stress by maintaining reduced thioredoxin [39]. Lack of reduced thioredoxin can lead to S-phase arrest as it is involved in DNA synthesis through its interaction with ribonucleotide reductase [39]. Apoptosis induction through ROS may be only part of the cell death mechanism since glutathione supplementation resulted in only partial restoration of number of viable cells. Alternatively, ROS may cause irreversible damage to other growth factor signaling pathways important for cell growth.
In conclusion, we demonstrate that curcumin causes potent cell growth inhibition in SK-BR-3 cell lines, a HER-2 over expressing human breast cancer cell line. Curcumin caused G2/M arrest at 10 µM concentration and a high levels of apoptosis at 25 and 50 µM concentrations. Curcumin also caused a decrease in total HER-2 and p-HER-2 and alterations in the expression different cell cycle regulatory genes. Generation of ROS might contribute to curcumin’s anti-proliferative action. Thus, growth inhibitory effects of curcumin in SK-BR-3 cells can be attributed to pleiotropic effects of curcumin on redox-regulated growth signaling pathways. Since antiproliferative effects can be restored by exogenous glutathione, cellular redox status is an important
factor in curcumin sensitivity of breast cancer cells.
ACKNOWLEDGEMENT This study was supported, in part, by grants, CA 42439 and
CA 80163 from the National Institutes of Health and a grant (PC28-11) from the Foundation of the University of Medicine and Dentistry of New Jersey
REFERENCES1. Esatbeyoglu T, Huebbe P, Ernst IM, Chin D, Wagner AE, Rimbach G.
Curcumin--from molecule to biological function. Angew Chem Int Ed Engl. 2012; 51: 5308-5332.
2. Goel A, Aggarwal BB. Curcumin, the golden spice from Indian saffron, is a chemosensitizer and radiosensitizer for tumors and chemoprotector and radioprotector for normal organs. Nutr Cancer. 2010; 62: 919-930.
3. Hong RL, Spohn WH, Hung MC. Curcumin inhibits tyrosine kinase activity of p185neu and also depletes p185neu. Clin Cancer Res. 1999; 5: 1884-1891.
4. Agarwal B, Swaroop P, Protiva P, Raj SV, Shirin H, Holt PR. Cox-2 is needed but not sufficient for apoptosis induced by Cox-2 selective inhibitors in colon cancer cells. Apoptosis. 2003; 8: 649-654.
5. Azuine MA, Bhide SV. Chemopreventive effect of turmeric against stomach and skin tumors induced by chemical carcinogens in Swiss mice. Nutr Cancer. 1992; 17: 77-83.
6. Ramachandran C, Fonseca HB, Jhabvala P, Escalon EA, Melnick SJ. Curcumin inhibits telomerase activity through human telomerase reverse transcritpase in MCF-7 breast cancer cell line. Cancer Lett. 2002; 184: 1-6.
7. Sun SH, Huang HC, Huang C, Lin JK. Cycle arrest and apoptosis in MDA-
Figure 5 Effect of curcumin on total-HER-2 in SK BR-3 cells pre-treated with 5 mM glutathione. Cells were treated with vehicle (DMSO) alone or 5, 10, 25, 50 μM curcumin for 24 h. Cells were lysed and protein subjected to western blotting. A. Bands representing HER-2 protein. B. Relative band intensities of HER-2 protein.
Central
Thomas et al. (2014)Email:
J Hum Nutr Food Sci 2(2): 1030 (2014) 8/8
Venkiteswaran S, Hsu HC, Yang PA, Thomas T, Thomas TJ (2014) Curcumin Interferes with HER-2 Signaling in a Redox-Dependent Manner in SK-BR-3 Human Breast Cancer Cells. J Hum Nutr Food Sci 2(2): 1030.
Cite this article
MB-231/Her2 cells induced by curcumin. Eur J Pharmacol. 2012; 690: 22-30.
8. Mukhopadhyay A, Bueso-Ramos C, Chatterjee D, Pantazis P, Aggarwal BB. Curcumin downregulates cell survival mechanisms in human prostate cancer cell lines. Oncogene. 2001; 20: 7597-7609.
9. Wilken R, Veena MS, Wang MB, Srivatsan ES. Curcumin: A review of anti-cancer properties and therapeutic activity in head and neck squamous cell carcinoma. Mol Cancer. 2011; 10: 12.
10. Khar A, Ali AM, Pardhasaradhi BVV, Varalakshmi C, Anjum R, Kumari AL. Induction of stress response renders human tumor cell lines resistant to curcumin-mediated apoptosis: role of reactive oxygen intermediates. Cell Stress Chaperones. 2001; 6: 368-376.
11. Aggarwal BB, Kumar A, Bharti AC. Anticancer potential of curcumin: preclinical and clinical studies. Anticancer Res. 2003; 23: 363-398.
12. Sharma RA, Gescher AJ, Steward WP. Curcumin: the story so far. Eur J Cancer. 2005; 41: 1955-1968.
13. Shakibaei M, Mobasheri A, Lueders C, Busch F, Shayan P, Goel A. Curcumin enhances the effect of chemotherapy against colorectal cancer cells by inhibition of NF-κB and Src protein kinase signaling pathways. PLoS One. 2013; 8: e57218.
14. Lin JK. Molecular targets of curcumin. Adv Exp Med Biol. 2007; 595: 227-243.
15. Gutierrez C, Schiff R. HER2: biology, detection, and clinical implications. Arch Pathol Lab Med. 2011; 135: 55-62.
16. Tafe LJ, Tsongalis GJ. The human epidermal growth factor receptor 2 (HER2). Clin Chem Lab Med. 2011; 50: 23-30.
17. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, McGuire WL. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science. 1987; 235: 177-182.
18. Timms JF, White SL, O’Hare MJ, Waterfield MD. Effects of ErbB-2 overexpression on mitogenic signalling and cell cycle progression in human breast luminal epithelial cells. Oncogene. 2002; 21: 6573-6586.
19. Musgrove EA. Cyclins: roles in mitogenic signaling and oncogenic transformation. Growth Factors. 2006; 24: 13-19.
20. Aggarwal S, Takada Y, Singh S, Myers JN, Aggarwal BB. Inhibition of growth and survival of human head and neck squamous cell carcinoma cells by curcumin via modulation of nuclear factor-kappaB signaling. Int J Cancer. 2004; 111: 679-692.
21. Holy JM. Curcumin disrupts mitotic spindle structure and induces micronucleation in MCF-7 breast cancer cells. Mutat Res. 2002; 518: 71-84.
22. Moragoda L, Jaszewski R, Majumdar AP. Curcumin induced modulation of cell cycle and apoptosis in gastric and colon cancer cells. Anticancer Res. 2001; 21: 873-878.
23. Bhaumik S, Anjum R, Rangaraj N, Pardhasaradhi BV, Khar A. Curcumin mediated apoptosis in AK-5 tumor cells involves the production of reactive oxygen intermediates. FEBS Lett. 1999; 456: 311-314.
24. Joe B, Lokesh BR. Role of capsaicin, curcumin and dietary n-3 fatty
acids in lowering the generation of reactive oxygen species in rat peritoneal macrophages. Biochim Biophys Acta. 1994; 1224: 255-263.
25. Thomas T, Thomas TJ. Estradiol control of ornithine decarboxylase mRNA, enzyme activity, and polyamine levels in MCF-7 breast cancer cells: therapeutic implications. Breast Cancer Res Treat. 1994; 29:189–201.
26. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012; 9: 671-675.
27. Syng-Ai C, Kumari AL, Khar A. Effect of curcumin on normal and tumor cells: role of glutathione and bcl-2. Mol Cancer Ther. 2004; 3: 1101-1108.
28. Piwocka K, Zabłocki K, Wieckowski MR, Skierski J, Feiga I, Szopa J, et al. A novel apoptosis-like pathway, independent of mitochondria and caspases, induced by curcumin in human lymphoblastoid T (Jurkat) cells. Exp Cell Res. 1999; 249: 299-307.
29. Mehta K, Pantazis P, McQueen T, Aggarwal BB. Antiproliferative effect of curcumin (diferuloylmethane) against human breast tumor cell lines. Anticancer Drugs. 1997; 8: 470-481.
30. Zhang Y, Yu D, Xia W, Hung MC. HER-2/neu-targeting cancer therapy via adenovirus-mediated E1A delivery in an animal model. Oncogene. 1995; 10: 1947-1954.
31. Wendt J, Radetzki S, von Haefen C, Hemmati PG, Güner D, Schulze-Osthoff K, et al. Induction of p21CIP/WAF-1 and G2 arrest by ionizing irradiation impedes caspase-3-mediated apoptosis in human carcinoma cells. Oncogene. 2006; 25: 972-980.
32. Johnson FM, Saigal B, Talpaz M, Donato NJ. Dasatinib (BMS-354825) tyrosine kinase inhibitor suppresses invasion and induces cell cycle arrest and apoptosis of head and neck squamous cell carcinoma and non-small cell lung cancer cells. Clin Cancer Res. 2005; 11: 6924-6932.
33. White EL, Ross LJ, Schmid SM, Kelloff GJ, Steele VE, Hill DL. Screening of potential cancer preventing chemicals for induction of glutathione in rat liver cells. Oncol Rep. 1998; 5: 507-512.
34. Yoshino M, Haneda M, Naruse M, Htay HH, Tsubouchi R, Qiao SL, et al. Prooxidant activity of curcumin: copper-dependent formation of 8-hydroxy-2’-deoxyguanosine in DNA and induction of apoptotic cell death. Toxicol In Vitro. 2004; 18: 783-789.
35. Igney FH, Krammer PH. Death and anti-death: tumour resistance to apoptosis. Nat Rev Cancer. 2002; 2: 277-288.
36. Sharma RA, Euden SA, Platton SL, Cooke DN, Shafayat A, Hewitt HR, et al. Phase I clinical trial of oral curcumin: biomarkers of systemic activity and compliance. Clin Cancer Res. 2004; 10: 6847-6854.
37. Na HK, Surh YJ. Transcriptional regulation via cysteine thiol modification: a novel molecular strategy for chemoprevention and cytoprotection. Mol Carcinog. 2006; 45: 368-380.
38. Kumagai T, Katsumata M, Hasegawa A, Furuuchi K, Funakoshi T, Kawase I, et al. Role of extracellular subdomains of p185c-neu and the epidermal growth factor receptor in ligand-independent association and transactivation. Proc Natl Acad Sci U S A. 2003; 100: 9220-9225.
39. Fang J, Lu J, Holmgren A. Thioredoxin reductase is irreversibly modified by curcumin: a novel molecular mechanism for its anticancer activity. J Biol Chem. 2005; 280: 25284-25290.