cytokine mrna quantification in his to logically normal canine

8/2/2019 Cytokine mRNA Quantification in His to Logically Normal Canine

1/11

Cytokine mRNA quantification in histologically normal canineduodenal mucosa by real-time RT-PCR

I.R. Petersa,*, C.R. Helpsa, E.L. Calvertb, E.J. Halla, M.J. Daya

aSchool of Clinical Veterinary Science, University of Bristol, Langford House, Langford, Bristol BS40 5DU, UKbWALTHAM Centre, Waltham on the Wolds, Leicestershire LE14 4RT, UK

Received 23 December 2003; received in revised form 2 July 2004; accepted 26 August 2004

Abstract

CD4+ T helper cells are important for the regulation of immune responses in the intestinal mucosa and they exert their effects

through the secretion of pro-inflammatory and immunomodulatory cytokines. Human patients with inflammatory bowel

diseases (IBD) such as Crohns disease and ulcerative colitis have alterations in the normal intestinal cytokine profile. These

cytokine abnormalities have been shown at both the protein and messenger RNA (mRNA) level.

The role that mucosal cytokines play in the pathogenesis of canine IBD has only been investigated using semi-quantitative

reverse transcriptase polymerase chain reaction (RT-PCR) analysis of gut tissue, as cytokine antisera are not available for this

species. Real-time RT-PCR has been recognised to be a more accurate and sensitive method of quantifying mRNA transcripts, so

in this study TaqMan real-time RT-PCR assays for the quantification of mRNA encoding IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-

18, IFN-g, TNF-a and TGF-b in canine intestinal mucosa were developed. The amount of these templates was quantified in

normal canine duodenal mucosa (n = 8). IL-18, TGF-b and TNF-a were found to be the most abundant transcripts, with IL-10

and IFN-g present at levels approximately 10-fold less. IL-2, IL-4, IL-5, IL-6 and IL-12 were the least abundant templates, with

some RNA samples having no detectable mRNA copies.

The methods developed in this study will form the basis of further work investigating the expression of mRNA encoding

cytokines in mucosa from dogs with chronic enteropathies. In addition, these real-time PCR assays can also be used for the

quantification of canine cytokine mRNA in other diseases.

# 2004 Elsevier B.V. All rights reserved.

Keywords: Real-time RT-PCR; TaqMan assays; Dog; Duodenum; Cytokine; Interleukin

1. Introduction

Cytokines play an important role in mucosal

humoral and cell-mediated immune responses. These

proteins alter the pattern of gene expression within a

target cell upon interaction with a specific receptor on

www.elsevier.com/locate/vetimm

Veterinary Immunology and Immunopathology 103 (2005) 101111

Abbreviations: CD, Crohns disease; cDNA, complementary

DNA; Ct, threshold cycle; gDNA, genomic DNA; IBD, inflamma-

tory bowel disease; mRNA, messenger RNA; RT-PCR, reverse

transcriptase polymerase chain reaction; UC, ulcerative colitis

* Corresponding author. Tel.: +44 117 928 9230;

fax: +44 117 928 9505.

E-mail address: [email protected] (I.R. Peters).

0165-2427/$ see front matter # 2004 Elsevier B.V. All rights reserved.

doi:10.1016/j.vetimm.2004.08.020


2/11

its surface (Husband et al., 1999). CD4+ T helper

cells are important for the regulation of immune

responses in the intestinal mucosa and they play a role

in the pathogenesis of human IBD (Groux et al.,1997; Papadakis and Targan, 2000; Strober et al.,

1997, 2002). These cells exert their effects through

the secretion of pro-inflammatory (Th1: IL-2, IL-12,

IFN-g and TNF-a; Th2: IL-4 and IL-6) or

immunomodulatory (IL-10 and TGF-b) cytokines

(Papadakis and Targan, 2000; Strober et al., 1997,

2002).

Study of cytokine profiles within the gut mucosa

has led to new insights into the immunopathogenesis

of the human inflammatory enteropathies Crohns

disease and ulcerative colitis. Crohns disease (CD)

has been associated with a predominance of Th1

cytokines whereas ulcerative colitis (UC) has been

associated with a Th2 response (Fuss et al., 1996;

Niessner and Volk, 1995; Plevy et al., 1997). Studies

describing a cytokine profile difference (Th1 versus

Th2) between normal gut mucosa and that from CD

and UC patients have utilised both molecular and

protein-based approaches. The latter techniques are

not presently available for canine studies as only a few

antibodies to canine cytokines have been described

and their utility has not yet been completely assessed.

To date, the role that mucosal cytokines play in thepathogenesis of canine IBD has been determined

using semi-quantitative RT-PCR with gel-based

quantification to measure cytokine mRNA from

mucosal biopsies (German et al., 2000; Ridyard et

al., 2002).

Real-time RT-PCR has been recognised to be a

more accurate and sensitive method of quantifying

messenger RNA (mRNA) transcripts (Bustin, 2000,

2002) as this method allows the detection of amplicon

accumulation as it is formed rather than by conven-

tional end-point analysis. Real-time measurement ofamplicon accumulation also allows determination of

reaction efficiency and thus permits the selection of

more sensitive assays. This technique has been used to

measure cytokine profiles in tissue from human

patients with ulcerative colitis (UC) and Crohns

disease (CD) (Autschbach et al., 2002).

The aim of the present study was to develop

TaqMan real-time RT-PCR assays for the quantifica-

tion of mRNA encoding IL-2, IL-4, IL-5, IL-6, IL-10,

IL-12, IL-18, IFN-g, TNF-a and TGF-b in canine

intestinal mucosa. These assays were subsequently

used to quantify the amount of these templates present

within normal canine duodenal mucosa.

2. Materials and methods

2.1. Patients

Samples of duodenal mucosa were obtained from

eight dogs presented to the School of Clinical

Veterinary Science, University of Bristol for clinical

investigation. Six of these dogs had primary gastro-

oesophageal disease and the duodenum was sampled

by endoscopic biopsy as part of the diagnostic

investigation. In two further cases, duodenal tissue

was collected from dogs euthanased for non-GI

disease and examined postmortem. None of these

animals had a history of diarrhoea and microscopic

examination of contemporaneously collected tissue

samples revealed normal gut histology in each case.

Breeds represented included one each of rough collie,

lurcher, greyhound, West Highland white terrier,

whippet, golden retriever, Staffordshire bull terrier

and crossbred. The median age was 24 months (range:

696 months) with four females (two neutered) and

four males (three neutered). The diagnoses for the sixdogs sampled by endoscopy were chronic gastritis

(n = 5) and megaoesophagus (n = 1).

2.2. Sample collection

Dogs were prepared for endoscopy by withholding

food for 1824 h. Gastroduodenoscopy was per-

formed under general anaesthesia using a GIF-

XQ230 flexible video endoscope (Olympus Keymed,

Southend-on-Sea, UK). Multiple mucosal biopsies

were taken at the level of the caudal duodenal flexureusing FB-25K biopsy forceps (Olympus Keymed).

Samples for histology were placed in 10% neutral

buffered formalin. Biopsies for mRNA analysis were

placed in a 1.0 ml cryotube (NUNC, Fischer Scientific

Ltd., Loughborough, Leicestershire), snap frozen in

liquid nitrogen and stored at 70 8C.In the case of two control dogs, samples were

obtained from the descending duodenum within 5 min

of euthanasia. Samples were taken with biopsy forceps

from the equivalent area to the vital samples, snap

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111102


3/11

frozen and stored as above. Full thickness samples

were taken for histological examination.

2.3. RNA isolation

Two endoscopic biopsies (total tissue mass 10

19 mg) were added to 800 ml of lysis buffer (from

isolation kit) in a green Ribolyser tube (Ribolyser

System, Thermo-Hybaid Ltd.) and processed for 45 s

at 6.0 m/s to homogenise biopsies. An aliquot of

600 ml of this homogenate was added to a nuclease-

free Eppendorf tube and the sample was processed

through the RNeasy Isolation System (Qiagen Ltd.,

Crawley, UK) as per the manufacturers protocol. The

RNA was eluted in 2 ml 30 ml of nuclease-freewater.

DNase digestion of the RNA solution was carried

out using amplification grade DNase I (Invitrogen

Ltd., Paisley, Scotland) as per the manufacturers

instructions with the sample incubated for 15 min at

room temperature prior to addition of the EDTA. In

order to remove any residual DNase and EDTA from

the purified RNA, it was passed a second time through

the RNeasy Isolation System (Qiagen Ltd.) using the

RNA clean-up protocol. An on-column DNase

digestion step was included during this process using

the RNase-Free DNase Set (Qiagen Ltd.). The finalRNA was eluted in 2 ml 50 ml of nuclease-freewater and stored at 70 8C before use. A samplecontaining genomic DNA (gDNA) was obtained by

omitting the DNase digestion steps from the RNA

isolation protocol.

2.4. Primer and probe design

Primers and probes were designed using primer 3

(Rozen and Skaletzky, 2000) (http://www-genome.-

wi.mit.edu/cgi-bin/primer/primer3_www.cgi) usingthe canine specific GenBank sequences for IL-2

(D30710), IL-4 (AF187322), IL-5 (AF331919), IL-6

(U12234), IL-10 (U33843), IL-12p40 (AF091134),

IL-18 (Y11133). IFN-g (AF126247), TNF-a

(Z70046) and TGF-b (L34956). The G3PDH specific

assay was the same as that used previously (Peters et

al., 2003).

The primer and probe sets were designed such that

the annealing temperatures of the primers were 60 8C

and the probes 810 8C higher, and that a product of

between 80 and 200 bases pairs in length would be

obtained (Table 1). In order to minimise primer

dimer formation, the maximum self-complementarity

was 6 and the maximum 30

self-complementaritywas 2.

The targets amplified by the primer pairs were

characterised using M-fold (SantaLucia, 1998) (http://

bioinfo.math.rpi.edu/$mfold/dna/form1.cgi) in orderto predict the nature of any secondary structures which

may form at the site of primer or probe binding. Primer

or probe sequences, which bound at the site of a

predicted loop, were discarded. Primers were synthe-

sised by Invitrogen Ltd. and probes by Cruachem Ltd.

(Glasgow, Scotland) or Oswell Laboratory (South-

ampton, UK) (IL-4, IL-10 and IL-18). Primers and

probes were reconstituted in nuclease-free water

before use.

2.5. One tube/two enzyme RT-PCR

Gene specific RT-PCR amplification of G3PDH,

TNF-a and TGF-b was performed using the platinum

quantitative RT-PCR thermoscript one-step system

(Invitrogen Ltd.) using 5 ml of RNA and 0.2 mM of

the reverse primer, 0.1 mM of probe and 3 mM

MgSO4 in a final volume of 25 ml. All reactants were

mixed together as a master mix and aliquotted into a96 well PCR plate (Thermofast, Abgene) prior to

addition of 5 ml of the sample RNA. No-RT reactions

were made up in a similar manner except the

thermoscript enzyme mix was substituted with 2

units of platinum Taq DNA polymerase (Invitrogen

Ltd.). Each sample was run in triplicate, as well as no-

RT controls for G3PDH in triplicate and TNF-a/TGF-

b singly with the reactions for each target performed

in the same plate. All reactions were made up on ice

and placed in the thermocycler held at the initial

incubation temperature to minimise primerdimerformation.

The samples were placed in an MJ Research PTC-

200 DNA engine (GRI) heated to 50 8C for 20 min,

then 85 8C for 5 min and quenched on ice. The

reactions were opened and 0.2 mM of the forward

primer was added in a suitable volume of RT buffer

and nuclease free water to increase the reaction

volume to 30 ml. The samples were resealed and

placed in an iCycler IQ (Bio-Rad Laboratories Ltd.)

at 95 8C for 5 min and then 45 cycles of 95 8C for

I.R. Peters et al. / Veterinary Immunology and Immunopathology 103 (2005) 101111 103
http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgihttp://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgihttp://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgihttp://bioinfo.math.rpi.edu/~mfold/dna/form1.cgihttp://bioinfo.math.rpi.edu/~mfold/dna/form1.cgihttp://bioinfo.math.rpi.edu/~mfold/dna/form1.cgihttp://bioinfo.math.rpi.edu/~mfold/dna/form1.cgihttp://bioinfo.math.rpi.edu/~mfold/dna/form1.cgihttp://bioinfo.math.rpi.edu/~mfold/dna/form1.cgihttp://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgihttp://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi


4/11

Table 1

Primer and probe sequences used for cytokine quantification by real-time RT-PCR

Primer set Product

length

Forward primer (5030) Reverse primer (5030) 50

Fluorophore

Probe sequence (5030)

G3PDHa

90 TCAACGGATTTGGCCGTATTGG TGAAGGGGTCATTGATGGCG Hex CAGGGCTGCTTTTAACTC

IL-2a

86 GCATCGCACTGACGCTTGTA TTGCTCCATCTGTTGCTCTGTT FAM TCGCAAACAGTGCACCT

IL-4b

123 GCTCCAAAGAACACAAGCGA CATGCTGCTGAGGTTCCTGT Texas red TGCAGAGCTGCTACTGTA

IL-5a

158 GACTGGTGGCAGAGACCTTGA CGTGGGCAGTTTGGTTCTTC FAM CGAACTTGGCTGATAGG

IL-6a 102 CTCTCCACAAGCGCCTTCTC TGAAGTGGCATCATCCTTGG FAM TGGGGCTGCTCCTGGTG

IL-10b

101 CGACCCAGACATCAAGAACC CACAGGGAAGAAATCGGTGA FAM TCCCTGGGAGAGAAGCT

IL-12p40a

109 CAGCAGAGAGGGTCAGAGTGG ACGACCTCGATGGGTAGGC FAM TGGAGTGTCAGGAGGGC

IL-18b

139 TTAAAGCGGAAAGTGATGAAGG TCGGGCATATCCTCAAATACA Texas red GAAATTTGAACGACCAA

IFN-ga 113 TCAACCCCTTCTCGCCACT GCTGCCTACTTGGTCCCTGA FAM CCCCACCCGAACCTCTT

TNF-aa 84 CTGGAGTCGTGAGGCAGTG AGGGCTCTTGATGGCAGAGA FAM CGCTTCGCCGTCTCCTAC

TGF-ba 96 CTGGAGTCGTGAGGCAGTG GCAGTGTGTTATCTTTGCTGTCA FAM TTTCGCCTCAGTGCCCA

The combinations of forward and reverse primers as well as the probe used in the RT-PCR reactions. All primers were desalted when puri fied a

Primers were synthesised by Invitrogen Ltd. and probes by Cruachem Ltd.b

Primers were synthesised by Invitrogen Ltd. and probes by Oswell Laboratory.


5/11

10 s and 60 8C for 15 s during which the fluorescence

data were collected. Threshold cycle (Ct) values were

calculated as the cycle when the fluorescence of

the sample exceeded a threshold level correspondingto 10 S.D. from the mean of the baseline fluores-

cence.

The nuclease-free water passed through the RNA

isolation was analysed in a similar manner as all

other samples to control for sample contamination.

Negative results were confirmed by repetition of

the RT-PCR procedure. A negative control of

nuclease-free water and a positive control sample

with a known Ct value were included with all sample

runs.

2.6. Two tube/two enzyme RT-PCR

Two-step real-time RT-PCR was used to amplify

IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-18, IFN-g and

G3PDH. First strand complementary DNA (cDNA)

synthesis was carried out using 500 ng of random

hexamers using the ImProm-II Reverse Transc-

ription System (Promega Corporation) using 10 ml

RNA in a final volume of 20 ml. All reactions were

set up according to the manufacturers instructions

giving a final magnesium chloride concentration of

3 mM.cDNA synthesis was carried out by mixing 10 ml of

RNA with the random primers in a reaction tube.

Samples were heated to 70 8C for 5 min in the PTC-

200 DNA engine (GRI) before cooling to 4 8C for

5 min. Tubes were placed in a cold block before

addition of the reaction buffer, dNTPs, magnesium

chloride, reverse transcriptase enzyme mix and water

to make a total volume of 20 ml. Reverse transcription

was completed by heating the samples to 25 8C for

5 min, 47 8C for 30 min and finally 75 8C for 10 min

in the PTC-200 DNA engine (GRI). No-RT controlswere performed by omitting addition of the reverse

transcriptase enzyme, and no template controls were

performed by addition of nuclease-free water. Dupli-

cate RT reactions were performed for each RNA

sample. All products were diluted to a final volume of

100 ml (1:5 dilution) using EB Buffer (10 mM Tris

HCl pH 8.4, Qiagen Ltd.) and then stored at 20 8Cfor future use.

Real-time PCR was performed using HotStar-Taq

Master mix (Qiagen Ltd.). Gene specific amplification

was performed using 0.2 mM of each primer, 0.1 mM

of probe and 5 ml of diluted cDNA in a final volume of

25 ml. Magnesium chloride concentrations were

adjusted to 4.5 mM in the final reaction by additionof 25 mM MgCl2.

Sample incubations were performed in an iCy-

cler IQ (Bio-Rad Laboratories Ltd.) at 95 8C for

15 min and then 45 cycles of 95 8C for 10 s and 60 8C

for 15 s during which the fluorescence data were

collected. Ct values were calculated as before.

Positive and negative controls were performed as

detailed above.

Samples were grouped together to minimise the

number of sample runs with only a single cytokine

quantified on each plate. Duplicate PCR reactions

were run for each RT repeat resulting in a total of four

Ct values for each RNA sample. A mean Ct value was

calculated for each sample using all measurable

values.

2.7. Reaction efficiency

Using the platinum quantitative RT-PCR thermo-

script one-step system, a 10-fold serial RNA dilution

curve was produced in triplicate to calculate the

reaction efficiency for TNF-a, TGF-b and G3PDH

(Fig. 1). The ImProm-II reverse transcription systemcombined with the HotStar-Taq Master mix with a 10-

fold serial RNA dilution curve was used to calculate

the reaction efficiency for IL-18 and G3PDH (Fig. 1).

Ten-fold serial dilution curves of purified PCR product

were produced for IL-2, IL-4, IL-5, IL-6, IL-10, IL-

12p40 and IFN-g using the HotStar-Taq Master mix

with the standard PCR protocol in triplicate for each

reaction product (Fig. 2). A master mix was made up

and aliquotted into the PCR plate prior to addition of

the template into each reaction tube individually. A

graph of threshold cycle (Ct) versus log10 relative copynumber of the sample from the dilution series was

produced. The slope of this graph was used to

determine the reaction efficiency:

efficiency 101=slope 1

2.8. Relative copy number calculation

G3PDH mRNA was quantified using both the one-

step and two-step protocols. The G3PDH correction



6/11

value was determined by normalising all measure-

ments to a Ct of 20 to give a G3PDH correction value.

The Ct measurement for each gene product was then

corrected by adding the G3PDH correction value to

the mean Ct value:

G3PDH correction value 20

mean Ct G3PDH RT-PCR

corrected target Ct mean Ct

G3PDH correction value

The RT-PCR was run for a maximum of 45 cycles,

therefore a relative copy number for a sample with this

value was set as 1. Samples with no measured Ct were

assigned a value of 0. All corrected Ct values were less

than 45. The relative number of gene copies in the

sample was calculated using the following equations,

as all the reactions were approximately 100% effi-

cient:

DCt 45 corrected Ct value of the sample

relative copy number 2DCt

fora 100% efficient reaction

This method of relative copy number calculationallowed comparison between dogs for a single gene

product but also gave an impression of the relative

abundance of the target in relation to the others. It is

important to note that direct comparison of copy

number cannot be made as the same Ct value in

separate RT-PCR assays does not necessarily indicate

the same number of copies in the samples, although

they are likely to be in the same order of magnitude

(e.g. a gene target with a mean Ct of 20 is much more

abundant than one with a mean Ct of 30).


Fig. 1. RNA standard curves for TNF-a, TGF-b, G3PDH and IL-18. Standard curves were produced from triplicate reactions for TNF-a, TGF-

b, G3PDH and IL-18 with a 10-fold serial dilution of RNA isolated from duodenal mucosal biopsies. The one tube/two enzyme protocol was

used for TNF-a, G3PDH (not shown) and TGF-b, whereas the twotube/two-step RT-PCR protocol was used for G3PDH and IL-18. The G3PDH

assay produced similar reaction efficiencies and dilution curves when assayed with the two protocols.


7/11


Fig. 2. Standard curves for IL-2, IL-4, IL-5, IL-6, IL-10, IL-12p40 and IFN-g. Standard curves were produced from triplicate reactions with a

10-fold dilution series of purified PCR products. This template was used due to the lack of an RNA sample with sufficient gene copies. The

HotStar-Taq Master mix was used with the standard PCR protocol.


8/11

3. Results

3.1. RT-PCR optimisation

A range of primerannealing temperatures was tested

for each primer set in the range from 55 to 70 8C using

the gradient function on the iCycler. All reactions were

100% efficient at 60 8C with no improvement in

sensitivity at higher or lower annealing temperatures.

The magnesium sulphate concentration was not

increased from 3 mM in the thermoscript one-step

system as this increased primerdimer formation (data

not shown). The HotStar-Taq Master mix was tested

with magnesium chloride concentrations of 3, 4.5 and

6 mM and a concentration of 4.5 mM was found to

improve the change in fluorescence of the probes

leading to an earlier Ct value when tested on the primer

and probe sets (data not shown).

The primer and probe sets were tested against a

sample which had not been treated with DNAse and

thus contained gDNA (Table 2). The intron structure

of the cytokine templates was unknown, therefore this

allowed identification of those reactions which could

detect gDNA. The assays for IL-5, IL-10, IL-18, TNF-

a and TGF-b gave negative results when tested

against gDNA. Assays for IL-2, IL-4, IL-6 and IFN-g

were able to detect genomic DNA but the Ct valueswere approximately eight cycles later than that of the

G3PDH assay.

Primerdimer formation was a problem with the

cytokine assays run with the one tube/two enzyme RT-

PCR protocol, despite the delayed addition of the

forward primer. This was likely due to primerdimer

formation involving the reverse primer alone, as well

as incomplete inactivation of the RT-enzyme byincubation at 85 8C for 5 min. This was not a problem

with the TNF-a and TGF-b assays as these transcripts


Fig. 3. Relative copy number for cytokines in normal duodenal mucosa. The relative copy number for each of the RNA samples is shown for

each cytokine target. The horizontal line corresponds to median of each group. The samples with a relative copy number of 0 had no detectable

template but they had quantifiable amounts of G3PDH mRNA.

Table 2

Cytokine primer and probe sets with genomic DNA

Sample

DNA 1 DNA 2G3PDH 25.5 16.9

IL-2 31.6 25.7

IL-4 36.3 28.2

IL-5 Negative Negative

IL-6 33.8 25.5


IL-12 32.4 26.7


IFN-g 34 25.7

TNF-a Negative Negative

TGF-b Negative Negative

The primer and probe sets were tested against two samples known to

contain gDNA using the HotStar-Master mix. TheG3PDHassay hada Ct value approximately eight cycles earlier than any of the other

transcripts reflecting the presence of pseudogenes. No-RT control

reactions were run for all targets during the RT-PCR assay to control

against quantification of gDNA.


9/11

were present at relatively high copy numbers. The two

tube/two enzyme RT-PCR protocol was used for

quantification of the other transcripts because random

hexamers were used with the RT enzyme and the gene-specific primers were not added until after it was

inactivated, therefore preventing primerdimer for-

mation.

3.2. Clinical samples

Transcripts for IL-10, IL-12p40, IL-18, TNF-a and

TGF-b could be quantified in all samples (Fig. 3).

mRNA encoding IL-2, IL-4, IL-5, IL-6 and IFN-g was

detected in 7/8, 7/8, 6/8, 6/8 and 7/8 samples,

respectively. The samples with no detectable copies

were not the same for each gene target.

The 10 cytokine mRNA transcripts quantified in

this study were present at different levels within the

canine duodenal mucosa (Fig. 3). IL-18, TGF-b and

TNF-a were the most abundant transcripts within

canine duodenal mucosa. IL-10 and IFN-g were

present at levels approximately 10-fold less than the

most abundant transcripts. IL-2, IL-4, IL-5, IL-6 and

IL-12 were the least abundant templates as some RNA

samples had no detectable copies.

4. Discussion

In this study real-time RT-PCR reactions were

designed to measure tissue expression of mRNA

encoding a panel of mucosal cytokines. Real-time

RT-PCR is particularly useful for this purpose as it is a

sensitive and reproducible technique that allows

accurate quantification of these relatively rare tem-

plates. Some of the cytokine transcripts were present at

relatively low copy numbers that would be unlikely to

be detected by conventional gel quantification. Theability to produce a linear dilution curve over a wide

range of template concentrations in such assays is

important due to the wide variation in copy numbers

within the samples measured. Loss of linearity of the

dilution series in the more dilute samples due to primer

dimer formation or poor enzyme performance would

lead to underestimation of the copy numbers present

within these samples. As many of the cytokine

transcripts were present at low copy numbers, this

could overestimate the differences between individuals.

These low copy number cytokines required well-

designed assays with good sensitivity for quantifica-

tion. It was also important to eliminate any factors

which could interfere with the assay, especiallyprimerdimer formation and genomic DNA contam-

ination. Elimination of gDNA contamination is

important when utilising a housekeeper gene for

normalisation, as genomic contamination is a sig-

nificant problem when housekeeper genes such as

G3PDH (German et al., 2000; Overbergh et al., 1999)

and b-actin (Overbergh et al., 1999; Stordeur et al.,

2002) are used in RT-PCR, as these genes are

associated with the presence of multiple pseudogenes

(Hanauer and Mandel, 1984; Ng et al., 1985). DNase

digestion either during the purification step (Mena et

al., 2002) or on the purified RNA (Leutenegger et al.,

1999; Mena et al., 2002; Stordeur et al., 2002) has

been used to eliminate this problem. For these reasons,

the two tube/two-step RT-PCR method and double

DNase digestion were selected for the analyses

described in this study.

All assays were tested against gDNA as the intron

positions within the target genes were unknown,

preventing design of reactions which would not

amplify gDNA. The assays for IL-5, IL-10, IL-18,

TNF-a and TGF-b mRNA did not amplify gDNA,

whereas the other assays had Ct values approximatelyeight cycles later than that of the G3PDH assay. This is

probably due to the presence of the G3PDH

pseudogenes resulting in many more copies of this

target per cell compared with the other gene targets.

The RNA samples in this study all had no-RT Ct

values of greater than 33 for the G3PDH assay and all

the other targets had negative results for the no-RT

controls.

All 10 cytokine mRNAs could be quantified in the

majority of samples tested in this study. Samples

which had a negative result were difficult to assign avalue for their relative copy number, as the lowest

number of gene copies which the assays could detect

was unknown. Absolute quantification against a

plasmid standard curve with a known number of gene

copies allows the limit of detection of an assay to be

determined. However, the use of a standard containing

millions of plasmid gene copies to produce a dilution

series increases the risk of cross-contamination. The

sensitivity of real-time PCR means that only a few

copies from such a standard need contaminate an RNA



10/11


11/11

Fujiwara, S., Yasunaga, S., Nakayama, H., Doi, K., Masuda, K.,

Ohno, K., Tsujimoto, H., 2002. Quantitative analysis of cytokine

messenger RNAs in the duodenal mucosa in dogs with small

intestinal inflammatory bowel disease. J. Vet. Intern. Med. 16,

327.Fuss, I.J., Neurath, M., Boirivant, M., Klein, J.S., de la Motte, C.,

Strong, S.A., Fiocchi, C., Strober, W., 1996. Disparate

CD4+

lamina propria (LP) lymphokine secretion profiles in

inflammatory bowel disease. Crohns disease LP cells manifest

increased secretion of IFN-g, whereas ulcerative colitis LP

cells manifest increased secretion of IL-5. J. Immunol. 157,

12611270.

German, A.J., Helps, C.R., Hall, E.J., Day, M.J., 2000. Cytokine

mRNA expression in mucosal biopsies from German shepherd

dogs with small intestinal enteropathies. Dig. Dis. Sci. 45, 717.

Groux, H., OGarra, A., Bigler, M., Rouleau, M., Antonenko, S., de

Vries, J.E., Roncarolo, M.G., 1997. A CD4+ T-cell subset

inhibits antigen-specific T-cell responses and prevents colitis.

Nature 389, 737742.

Hanauer, A., Mandel, J.L., 1984. The glyceraldehyde 3 phosphate

dehydrogenase gene family: structure of a human cDNA and of

an X chromosome linked pseudogene; amazing complexity of

the gene family in mouse. EMBO J. 3, 2627 2633.

Husband, A., Beagley, K., McGhee, J., et al., 1999. Mucosal

cytokines. In: Ogra, P.L., Mestecky, J., Lamm, M.E. (Eds.),

Mucosal Immunology. Academic Press, San Diego, pp. 541

559.

Leutenegger, C.M., Mislin, C.N., Sigrist, B., Ehrengruber, M.U.,

Hofmann-Lehmann, R., Lutz, H., 1999. Quantitative real-time

PCR for the measurement of feline cytokine mRNA. Vet.

Immunol. Immunopathol. 71, 291305.

Mena,A., Ioannou, X.P., Van Kessel, A., Van Drunen Little-Van DenHurk, S., Popowych, Y., Babiuk, L.A., Godson, D.L., 2002. Th1/

Th2 biasing effects of vaccination in cattle as determined by

real-time PCR. J. Immunol. Methods 263, 1121.

Ng, S.Y., Gunning, P., Eddy, R., Ponte, P., Leavitt, J., Shows, T.,

Kedes, L., 1985. Evolution of the functional human beta-actin

gene and its multi-pseudogene family: conservation of noncod-

ing regions and chromosomal dispersion of pseudogenes. Mol.

Cell Biol. 5, 27202732.

Niessner, M., Volk, B.A., 1995. Altered Th1/Th2 cytokine profiles in

the intestinal mucosa of patients with inflammatory bowel disease

as assessed by quantitative reversed transcribed polymerase chain

reaction (RT-PCR). Clin. Exp. Immunol. 101, 428435.

Overbergh, L., Valckx, D., Waer, M., Mathieu, C., 1999. Quantifica-tion of murine cytokine mRNAs using real time quantitative

reverse transcriptase PCR. Cytokine 11, 305312.

Papadakis, K.A., Targan, S.R., 2000. Role of cytokines in the

pathogenesis of inflammatory bowel disease. Annu. Rev.

Med. 51, 289298.

Peters, I.R., Helps, C.R., Batt, R.M., Day, M.J., Hall, E.J., 2003.

Quantitative real-time RT-PCR measurement of mRNA encod-

ing alpha-chain, pIgR and J-chain from canine duodenal

mucosa. J. Immunol. Methods 275, 213222.

Plevy, S.E., Landers, C.J., Prehn, J., Carramanzana, N.M., Deem,

R.L., Shealy, D., Targan, S.R., 1997. A role for TNF-a and

mucosal T helper-1 cytokines in the pathogenesis of Crohns

disease. J. Immunol. 159, 62766282.

Ridyard, A.E., Nuttall, T.J., Else, R.W., Simpson, J.W., Miller, H.R.,

2002. Evaluation of Th1, Th2 and immunosuppressive cytokine

mRNA expression within the colonic mucosa of dogs with

idiopathic lymphocyticplasmacytic colitis. Vet. Immunol.

Immunopathol. 86, 205214.

Rozen, S., Skaletzky, H.J., 2000. Primer3 on the WWW for General

Users and for Biologist Programmers. Humana Press, Totowa,

NJ, pp. 365386.

SantaLucia Jr., J., 1998. A unified view of polymer, dumbbell, and

oligonucleotide DNA nearest-neighbor thermodynamics. Proc.

Natl. Acad. Sci. U.S.A. 95, 14601465.

Stordeur, P., Poulin, L.F., Craciun, L., Zhou, L., Schandene, L., de

Lavareille, A., Goriely, S.,Goldman, M.,2002. Cytokine mRNA

quantification by real-time PCR. J. Immunol. Methods 259, 5564.

Strober, W., Fuss, I.J., Blumberg, R.S., 2002. The immunology of

mucosal modelsof inflammation.Annu. Rev. Immunol. 20, 495

549.

Strober, W., Kelsall, B., Fuss, I., Marth, T., Ludviksson, B., Ehr-

hardt, R., Neurath, M., 1997. Reciprocal IFN-g and TGF-b

responses regulate the occurrence of mucosal inflammation.

Immunol. Today 18, 6164.


cytokine mrna quantification in his to logically normal canine

Documents