cytological and molecular description of tvaerminnensis gen. et … · 2017. 12. 3. · cytological...

Cytological and molecular description of Hamiltosporidiumtvaerminnensis gen et sp nov a microsporidian parasite ofDaphnia magna and establishment of Hamiltosporidiummagnivora comb nov

KAREN LUISA HAAG12 J I RONNY LARSSON3 DOMINIK REFARDT14

and DIETER EBERT1

1University of Basel Zoological Institute Vesalgasse 1 4051 Basel Switzerland2Programa de Poacutes-Graduaccedilatildeo em Geneacutetica e Biologia Molecular UFRGS C Postal 15053 91501-970 Porto AlegreBrazil3University of Lund Department Cell and Organism Biology Helgonav 3 S-22362 Lund Sweden4Institute of Integrative Biology ETH Zuumlrich ETH Zentrum CHN J11 Universitaumltsstrasse 16 CH-8092 ZuumlrichSwitzerland

(Received 20 January 2010 revised 20 April and 22 July 2010 accepted 7 September 2010 first published online 15 October 2010)

SUMMARY

We describe the new microsporidium Hamiltosporidium tvaerminnensis gen et sp nov with an emphasis on itsultrastructural characteristics and phylogenetic position as inferred from the sequence data of SSU rDNA alpha- and beta-tubulin This parasite was previously identified as Octosporea bayeri Jiacuterovec 1936 and has become a model system to studythe ecology epidemiology evolution and genomics of microsporidia - host interactions Here we present evidence thatshows its differences from O bayeri Hamiltosporidium tvaerminnensis exclusively infects the adipose tissue the ovaries andthe hypodermis ofDaphnia magna and is found only in host populations located in coastal rock pool populations in Finlandand Sweden Merogonial stages ofH tvaerminnensis have isolated nuclei merozoites are formed by binary fission or by thecleaving of a plasmodium with a small number of nuclei A sporogonial plasmodium with isolated nuclei yields 8sporoblasts Elongated spores are generated by the most finger-like plasmodia The mature spores are polymorphic in shapeand size Most spores are pyriform (4middot9ndash5middot6times2middot2ndash2middot3 μm) and have their polar filament arranged in 12ndash13 coils A secondelongated spore type (6middot8ndash12middot0times1middot6ndash2middot1 μm) is rod-shaped with blunt ends and measures 6middot8ndash12middot0times1middot6ndash2middot1 μm Theenvelope of the sporophorous vesicle is thin and fragile formed at the beginning of the sporogony Cytological andmolecular comparisons with Flabelliforma magnivora a parasite infecting the same tissues in the same host species revealthat these two species are very closely related yet distinct Moreover both cytological andmolecular data indicate that thesespecies are quite distant from F montana the type species of the genus Flabelliforma We therefore propose thatF magnivora also be placed in Hamiltosporidium gen nov

Key words Ultrastructural characteristics molecular phylogeny Octosporea bayeri Flabelliforma magnivoraMicrosporidia Cladocerca

INTRODUCTION

Microsporidia are intracellular obligate parasites thatinfect many animals They pose a problem for taxo-nomy because of their small size and because only afew of their distinct features are microscopically visi-ble (Larsson 1988 1999) This problem is furtherexacerbated by the fact that taxonomists usually havepoor material on these species because many speciescannot be bred in the laboratory available life stagesare therefore incomplete While molecular toolspromised to solve this problem they raised other

difficulties concerning the correct placement of theentire phylum ndash and the species within This isbecause the extremely derived biological features ofmicrosporidia are mirrored in their DNA sequences(James et al 2006 Lee et al 2008) causing spuriousresults in tree topologies Here we report on 2 micro-sporidian species infecting the planktonic crustaceanDaphnia magna Hamiltosporidium tvaerminnensis spnov described in this paper and Flabelliformamagnivora (Larsson et al 1998) which has recentlybeen placed in the new genus Neoflabelliforma(Morris and Freeman 2010) These species showclear differences in their cytology biogeographyecology and epidemiology yet sequence data showthat they are very close to each otherBecause H tvaerminnensis sp nov resembles the

description ofOctosporea bayeri Jiacuterovec 1936 in many

Corresponding author University of Basel ZoologicalInstitute Vesalgasse 1 4051 Basel SwitzerlandTel +41 (0) 61 267 03 61 Fax +41 (0) 61 267 03 62E-mail karenhaagunibasch

447

Parasitology (2011) 138 447ndash462 copy Cambridge University Press 2010doi101017S0031182010001393

httpswwwcambridgeorgcoreterms httpsdoiorg101017S0031182010001393Downloaded from httpswwwcambridgeorgcore University of Basel Library on 30 May 2017 at 132641 subject to the Cambridge Core terms of use available at

ways previous publications incorrectly identified itas O bayeri (see for example Green 1957 1974Ebert et al 2001 Vizoso and Ebert 2004 Lass andEbert 2006 Altermatt et al 2007) O bayeri wasdescribed from D magna fromMoravia in the CzechRepublic (Jiacuterovec 1936) The species was neverfound again in the type locality neither are thereany unambiguous records from other localities Be-cause H tvaerminnensis sp nov has become a modelsystem for the study of microsporidian epidemiologyecology and evolution (references as above) andbecause a draft of its genome sequence has recentlybeen published (Corradi et al 2009) it is imperativeto clarify its taxonomic position

Both F magnivora (Larsson et al 1998) andH tvaerminnensis sp nov infect the adipose tissuethe hypodermis and the ovaries of the crustaceanD magna (Larsson et al 1998 Vizoso et al 2005)Both microsporidian species have been known forsome time but have never been properly comparedF magnivorawas placed in the genus Flabelliforma in1998 based on cytological data It is typically found inD magna but was also recorded from D pulex andD longispina (Stirnadel and Ebert 1997 Larssonet al 1998 Decaestecker et al 2005) It has beenrecorded from the UK Belgium and Russia withhighly variable prevalences although usually under50 (Mangin et al 1995 Stirnadel and Ebert 1997Larsson et al 1998 Ebert et al 2000 Decaesteckeret al 2005) (Note Mangin et al (1995) Stirnadeland Ebert (1997) and Ebert et al (2000) called thisspecies Tuzetia sp) Recently due to its moleculardivergence to the Flabelliforma-type speciesF montana and a closer relationship to a newly de-scribed hyperparasite Neoflabelliforma aurantiaeit was proposed to reassign F magnivora toNeoflabelliforma (Morris and Freeman 2010) Herewe show that it was appropriate to place F magnivorainto a different genus from F montana but we arguethat it is not close enough toN aurantiae to place it inthe genus Neoflabelliforma Instead we place it in thesame genus as H tvaerminnensis sp nov

The new species described here exclusively infectsD magna even where D magna co-occurs in thesame pond with other Daphnia species such asD pulex and D longispina (Ebert et al 2001) Trans-mission trials in the laboratory further revealed that itcannot be transmitted to clones of D lumholtzi andD similis which form the sister-taxon to D magna(B Lange and D Ebert manuscript in preparation)In addition the new species has never been recordedin places other than D magna rock pool populationson the islands of the Baltic archipelago of Sweden andFinland (Green 1957 Ebert et al 2001 Ebert2005) Both field and laboratory studies have shownthat D magna and this species experience a co-evolutionary arms race (Ebert 2008) with hostsrapidly evolving resistance (Zbinden et al 2008) andparasites showing local adaptation to their natural

host populations (Altermatt et al 2007) H tvaer-minnensis sp nov reduces host fecundity by about20 (Bieger and Ebert 2009) To understand thephylogenetic position of this species the SSU rRNAgene was sequenced and compared to other micro-sporidia To our surprise the sequence was nearlyidentical to the sequence of F magnivora (Refardtet al 2002) This finding prompted the current studywhich seeks to identify the degree of cytological andgenetic differentiation between H tvaerminnensis spnov and F magnivora Table 1 summarizes keyaspects of the biology of these species

MATERIALS AND METHODS

Infected specimens of Daphnia magna Straus 1820were collected from rock pools in Finland (newspecies) and from ponds in Belgium (F magnivora)Cultures were established in the laboratory followingthe procedure of Vizoso and Ebert (2004) Bothparasites can be maintained easily in monoclonalD magna cultures Vertical transmission to asexualhost eggs of both species is 100 ensuring that theparasite is not lost during host propagation

Sample preparation for cytology

Fresh squash preparations of the new species weremade according to the agar method of Hostounskyacuteand Žižka (1979) and studied using phase-contrastmicroscopy Permanent squash preparations werelightly air-dried and fixed either in methanol for atleast 15min for Giemsa staining or in Bouin-Duboscq-Brasil (BDB) solution for at least 1 h priorto staining with Heidenhainrsquos iron haematoxylinWhole animals were fixed in BDB solution overnightor longer for paraffin sectioning Specimens werethen washed and dehydrated in a graded series ofethanol cleared in butanol and embedded inParaplast (Lancer St Louis MO USA) Sectionswere cut more or less longitudinally at 10 μm andstained with haematoxylin For details on the histo-logical techniques used see Romeis (1968) Allpermanent preparations were mounted in DPX(BDH Chemicals Ltd Poole England) Measure-ments were taken using an image analysis program(MicroMacro AB Gothenburg Sweden)

For transmission electron microscopy hosts in-fected with the new species were fixed in 2middot5 (vv)glutaraldehyde in 0middot2M sodium cacodylate buffer(pH 7middot2) at room temperature (18ndash23 degC) for 24 hSpecimens were then washed in cacodylate buffer andpost-fixed in 2 (wv) osmium tetroxide in cacody-late buffer for 90min at 4 degC Following this theywere washed and dehydrated in an ascending series ofbuffer-acetone solutions to absolute acetone and thenembedded in Epon Sections were stained usinguranyl acetate and lead citrate (Reynolds 1963)

448Karen Luisa Haag and others


DNA samples PCR and sequencing

Parasite DNA samples were obtained from naturallyinfected D magna individuals maintained in thelaboratory A draft of the H tvaerminnensis genome(isolate OER-3ndash3) was obtained by shotgun sequen-cing using Illuminatrade sequencing (Solexa FasterisSA Geneva Switzerland) From 35 bp reads withthe Illumina Genome Analyzertrade we acquired898Mb of DNA sequence yielding about 34middot2ndash37middot2times coverage of the genome (the genome size isestimated at 24Mb) Reads were assembled into41804 contigs amounting to 13middot3Mb of sequencedata The length of contigs averaged 320 bp witha range from 100 bp to 8 kb (for details see Corradiet al 2009) The contigs were searched (BLASTN)for sequences that could be used as markers to analysephylogeny (alpha and beta tubulins SSU rDNA)The following primers were designed for amplify-ing the tubulin genes of F magnivora alphatub-FTATGCTCGAGGCCATTATAC alphatub-RCAAATGCACGTTTAGCAAAC betatub-FCAATATGTTCCTCGAGCTGT and betatub-RACCATCATATTTCTTGCATCG All PCR reac-tions were performed in a volume of 50 μl containing1middot25U of Taq Polymerase (Sigma) 1X reactionbuffer 1middot5 mM MgCl2 20 pmol of each primer(Microsynth) 200 μM dNTP and 100ndash500 ng of tem-plate DNA The PCR profile consisted of an initial

denaturation step at 95 degC for 5min over 35 am-plification cycles (annealing at 50 degC for 30 s exten-sion at 72 degC for 60 s denaturation at 95 degC for 30 s)and a final extension at 72 degC for 5min Ampliconswere column purified (Sigma) and sequenced directly(Macrogen Seoul South Korea)

Phylogeny reconstructions

To evaluate the phylogenetic relationship betweenthe new species and F magnivora we first comparedtheir partial sequences for alpha-tubulins (369 aa)beta-tubulins (233 aa) and SSU rDNA (1464 nt)with 8 representative microsporidian species usingSaccharomyces cerevisiae as an outgroup Agmasomapenaei and Flabelliforma montana which share ultra-structural features with the species described hereare not included in this phylogeny because theiralpha- and beta-tubulin sequences are unknownThus we used only SSU rDNA sequences (1082 nt)from another group of closely related microspor-idians to evaluate their relatedness to F magnivoraand to the species described here using Glugeaplecoglossi as outgroup GenBank Accession nos forall sequences used are provided inTable 2 Sequenceswere first assembled with CodonCode Aligner (ver-sion 302) to define regions of overlap Nucleotidesequences for alpha and beta-tubulins were translated

Table 1 Comparison of Octosporea bayeri Jirovec 1936 Flabelliforma magnivora Larsson et al 1998 and thenew species described here

(The table was compiled from Jirovec 1936Mangin et al 1995 Stirnadel and Ebert 1997 Larsson et al 1998 Ebert 2005Lass and Ebert 2006)

Trait Octosporea bayeri Flabelliforma magnivora Hamiltosporidium tvaerminnensis

Recorded Daphniahost species(excluded hosts)

D magna D magna D longispinaD pulex

D magna (D longispina D pulexD lumholtzi D similis)

Infected tissue Adipose tissue Adipose tissue hypodermisovaries

Adipose tissue hypodermis ovaries

Transmission Unknown Transovarial horizontal viasecond host was suggested(Mangin et al 1995)

Transovarial and horizontal

Reportedgeographicaldistribution

Moravia Czech Republic England Belgium Russia Finland Sweden Skerry Islands of theBaltic Sea

Habitat of hostpopulation

Large pond Permanent ponds Intermittent coastal rock pools

Mature pyriformspore type(measurements forfresh spores)

Not observed Pyriform with blunt endsone side slightly convex4middot07ndash4middot93times2middot34ndash3middot03 μm

Pyriform with blunt ends sides convexand concave slightly bent 4middot9ndash5middot6times2middot2ndash2middot3 μm

Mature elongatedspore type(measurements forfresh spores)

Elongated rod-like withblunt ends posteriorend wider straight orslightly curved 5middot5ndash9times1middot5ndash2middot5 μm

Not observed Elongated rod like with blunt endsposterior end wider straight or slightlycurved 6middot8ndash12middot0times1middot6ndash2middot1 μm

Octosporous sporegroups

Not observed Not observed Observed

449Hamiltosporidium tvaerminnensis gen et sp nov


into proteins The overlapping proteingene regionswere then aligned using default settings in Clustal Xsoftware (Thompson et al 1997) SSU rDNA align-ment regions with large gaps were excluded Inthe first analysis aligned sequences for the 3 markerswere concatenated and used as a partitioned data-set for phylogeny reconstruction with MrBayes 31(Ronquist andHuelsenbeck 2003) Both analyses ranfor 100000 generations sampling every 100th gen-eration using a mixture of models with fixed-ratematrices for the amino acid partitions and theGTR+G+I model for the SSU rDNA Aminoacid changes observed along themain branches of thistree were tracked based on parsimony usingMacClade 408

RESULTS

Pathogenicity and transmission

Although H tvaerminnensis sp nov primarilyinvaded the adipose tissue of its host infection wasalso found in the hypodermis and ovaries (Fig 1A)The infected tissue degraded into a syncytium filledwith microsporidia (Fig 1B) in the late stages ofinfection the only distinct remnants of host tissuewere mitochondria dispersed among the developingmicrosporidia (Fig 1B) In advanced infections themost immature stages of the microsporidia wereconcentrated at the periphery (Fig 1B) The para-sitersquos effect on its host has already been documented(Vizoso and Ebert 2005 Bieger and Ebert 2009)Transmission is both transovarial and horizontal(Vizoso et al 2005) The latter occurs when sporesmdashwhich can survive extended periods in the

environmentmdashare released from decaying cadavers(Lass and Ebert 2006)

Pre-sporal stages and life cycle

Early stages of vegetative reproduction (merogony)were rare in light microscopic preparations and ourevaluation including measurements is based onultrathin sections Meronts and merozoites wereseen as either elongated or rounded cells in directcontact with the cytoplasm of the host cell (Fig 1C)Elongated meronts measured up to 6middot2 μm in lengthin sections and rounded merozoites (Fig 1C) meas-ured up to 3middot8 μm in diameter Merogonial stageswere delimited by a thick plasma membrane about9 nmwithout external reinforcements (Fig 1C) Theelongated stages and most rounded stages showed 2nuclei that measured 1middot6ndash2middot5 μm in diameter insections (Fig 1C E) These coupled nuclei were in-terpreted as dividing stages not as diplokarya Largequantities of free ribosomes made the cytoplasm uni-formly and densely granular (Fig 1C) Nuclei had asimilar density although the granules were smaller Alarge prominent nucleoluswas often visible (Fig 1D)Vegetative reproduction occurred by binary fissionor by the fragmentation of plasmodia with a smallnumber of nuclei (4 nuclei were observed) (Fig 1E)The last generation of merozoites that matured tosporonts was often seen in chain-like arrangements(Fig 1B D)

The first sign of onset of sporogony was thesecretion of a thin envelope the primordium of thesporophorous vesicle approximately as thick as theplasma membrane (Fig 2A) The primordia were

Table 2 GenBank Accession codes for the sequences used in the phylogeny inferences

Alpha-tubulin Beta-tubulin SSU rDNA

Glugea plecoglossi AY138804 AF162084 AJ295326Brachiola algerae EU625354 EU625355 AY230191Encephalitozoon cuniculi NM_001041670 AL590443 L17072Nosema bombycis DQ091252 EF025915 L39111Antonospora locustae U66907 AY138803 AY376351Spraguea lophii U66906 AF162082 AF033197Trachipleistophora hominis AY138781 AF162081 AJ002605Saccharomyces cerevisiae NP_013625 NP_116616 gi_85666119455934ndash457733Hamiltosporidium tvaerminnensis spnov GQ496300 GQ853827 GQ843833Flabelliforma magnivora (Belgium) GQ496301 GQ843828 AJ302319F magnivora (England) mdash mdash AY649786F magnivora (Russia) mdash mdash AJ302318Flabelliforma montana mdash mdash AJ252962Agmasoma penaei mdash mdash DQ342240Neoflabelliforma aurantiae mdash mdash AY230191Glugea atherinae mdash mdash U15987Paratelohania anophelis mdash mdash AF027682Amblyospora sp mdash mdash AJ252949Gurleya vavrai mdash mdash AF394526Larssonia obtusa mdash mdash AF394527Culicosporella lunata mdash mdash AF027683Amblyospora californica mdash mdash U68473Edhazardia aedis mdash mdash AF027684



shed from the surface in a blister-like fashion(Fig 2A) but with progressive development theyunited to form a continuous rounded sac around theundivided sporont (Fig 2B) Around later finger-like dividing stages the vesicle followed the outline ofthe lobes fairly closely (Fig 7B) The newly formedenvelope was connected to the plasma membrane bytubules 32ndash58 nm in diameter with thinner wallsthan the envelope (Fig 2C)The thick sporont wall was initiated inside the

vesicle primordial (Fig 2C)mdashnot in parallel arrays ofdense material as is commonly seen in microsporidiamdashbut appearing as wide fields at several placessimultaneously on the surface (Fig 2D) It developed

rapidly to form a continuous and complete sporontwall (Fig 2E) The primordial sporont wall measuredapproximately 32 nm in thickness From the begin-ning it was composed of 2 layers an electron-densesurface layer about 14 nm thick separated from theplasma membrane by a layer of more lucent material(Fig 2D) Concurrent with the development ofthe sporont wall the nucleus divided to form arounded-oval (Fig 2E) and then ultimately a lobedplasmodium yielding 8 uninucleate sporoblasts thatmatured to spores without further division (Fig 2F)The most distinct finger-like plasmodia which hadnarrow elongated lobes produced elongated spores(Fig 4B)

Fig 1 Pathogenicity and early development of Hamiltosporidium tvaerminnensis sp nov (A) Longitudinal sectionshowing microsporidian infection of fat tissue and hypodermis (haematoxylin staining phase contrast) (B) Ultrathinsection of infected fat tissue degraded into a syncytium merogonial stages at the periphery indicates a host cellmitochondrion (C) Merozoite (D) Tetranucleate merogonial plasmodium (haematoxylin staining) (E) Chain-likearranged merozoites and sporonts M merogonial stages N nucleus NU nucleolus S sporont



Fig 2 Sporogony of Hamiltosporidium tvaerminnensis (A) Sporonts with beginning production of a sporophorousvesicle (arrows) (B) Older binucleate sporont in an almost complete sporophorous vesicle (arrows) (C) First generationof tubules arrows indicate the envelope of the sporophorus vesicle (D) Early sporont with first generation of tubulesthe sporont wall is initiated as wide areas of 2-layered material (arrows) outside the plasma membrane (E) Older sporontwith complete sporont wall and beginning production of tubules of the second generation (arrow) (F) Sporophorousvesicle with sporoblasts and tubules of the second generation arrow points at a tubular widening (G) Tubules of thesecond generation have 1 external and 1 internal component (arrows) asterisk indicates a widened region N nucleusPM plasma membrane SB sporoblast



When the sporoblasts were individualized asecond generation of tubules with more electron-dense walls appeared (Fig 2F) These tubules filledthe episporontal space like a mesh and at least someof them appeared to be continuous from the sporo-blast wall to the envelope of the sporophorous vesicle(Fig 2F) This second generation of tubules had adouble structure with a thin-walled tubulus insidea slightly thicker wall (Fig 2G) Internal tubulesmeasured about 30 nm in width external tubulesabout 80 nm Characteristically the tubules swelledup to 0middot5 μm wide at parts (Fig 2FndashG)Sporal organelles developed in the sporoblast

and immature spore in the typical manner for

microsporidia The polar filament began in theposterior of the sporoblast from a spongious Golgiapparatus (Fig 3A) The filament precursors formedin peripheral areas of electron-dense material and thefilament extended in front of the sporoblast as it grewThe membraneous surface layer of the filament grewfrom the surface membrane of the Golgi apparatus asthe filament extended (Fig 3A) TheGolgi apparatusremained in immature andmature spores as 1 ormoreelectron-dense membrane-lined posterior granules(Fig 3B)The polaroplast began in a petal-like manner as

perpendicular lamellar folds from the surface of thepolar filament (Fig 3C) The membrane that

Fig 3 Early aspects of sporal structures of Hamiltosporidium tvaerminnensis (A) Sporoblast with developing polarfilament (B) Longitudinally sectioned immature spore asterisk indicates a granular remainder of the Golgi vesicles(C) Transversely sectioned immature spore showing petal-like developing polaroplast lamellae (D) Detail of developingpolaroplast lamellae showing internal tubular primordia (arrow) A anchoring disc G Golgi vesicles N nucleusPF polar filament PP polaroplast PS polar sac



delimited the compartments of the polaroplast wascontinuous with the surface membrane of the polarfilament as found in all microsporidian spores (Vaacutevraand Larsson 1999) Sections parallel with the surfaceof the newly formed lamellae revealed an internalsystem of tubular priordial lamellae (Fig 3D)

The mature spores

Mature spores were strikingly polymorphic (Fig 4AB) though pyriform spores with blunt ends

dominated These were slightly bent with 1 concaveand 1 convex side In unfixed spores the posteriorvacuole and a spherical bodymdashremainders of theGolgi apparatusmdashwere visible close to the posteriorpole (Fig 4A) Fresh pyriform spores measured 4middot9ndash5middot6times2middot2ndash2middot3 μm (Vizoso et al 2005) A second sporetype was elongated and rod-like with blunt ends anda wider posterior end (Fig 4A) These were straightor lightly curved and also exhibited vacuole andspherical granules This spore type measured 6middot8ndash12middot0times1middot6ndash2middot1 μm (Vizoso et al 2005) Both pyriform

Fig 4 Light microscopic aspect of Hamiltosporidium tvaerminnensis (A) Unfixed pyriform and elongated sporesarrows point at vacuolar regions with a granular remainder of the Golgi vesicles (B) Haematoxylin staining of maturespores and a flabelliform sporogonial plasmodium (C) Unfixed smear showing octosporous groups of spores (arrows)and 1 ejected polar filament (PF) (D) Unfixed normal pyriform spores with concave and convex sides (arrows)and macrospores (E F G) The pyriform spores from F magnivora from England (E) Belgium (F) and MoscowRussia (G)



and rod-shaped macrospores occurred frequently(Fig 4D) In cases of advanced infection host cellsand sporophorous vesicles were more likely to breakin situ and care had to be taken not to destroy thevesicles during squashing (Fig 4C)The pyriform spores and most of the elongated

spores exhibited an identical ultrastructure Thespore wall was rather thick measuring 180ndash260 nm(Fig 5A) except at its most anterior section whereabove the anchoring apparatus the thickness was re-duced to at least 65 nm The spore wall had the usual3 components From inside outwards a thick (about9 nm) plasma membrane a lucent endospore and

a symmetrically layered 40ndash45 nm thick exospore(Fig 5B) The variation in thickness was caused byvariable development of the endospore (Fig 5A)The central layer of exospore was almost membrane-like electron-dense with darker borders (Fig 5B) Itwas covered on both sides by less-dense layers ofsimilar thickness The less-dense layers were exter-nally and internally delimited by thin strata of moreelectron-dense material and at least the internalsurface was fairly granular (Fig 5B)Squashing forced the polar filament to eject

(Fig 4C) In its unejected state it was attached to acurved anchoring disc at the anterior pole of the spore

Fig 5 The mature spore of Hamiltosporidium tvaerminnensis (A) Longitudinal section (B) Detail of the spore wallshowing the layering of the exospore (arrow) (C) Longitudinally sectioned posterior region showing the coiling of thepolar filament arrows point at the most posterior wide coil (D) Transversely sectioned polar filament arrow points atthe fibril-like layer A anchoring disc EN endospore EX exospore N nucleus PF polar filament PM plasmamembrane PP polaroplast R ribosomes



(Fig 5A) The disc measured 354 nm in diameter atits widest part The straight part of the filament pro-ceeded backwards for about one third of the sporelength before turning sideways and ending in a coilthat at is outermost point touched the posteriorend of the spore (Fig 5A C) The filament usuallyformed 12ndash13 coils with slightly different diametersand arrangements (Fig 5A C) The straight part ofthe filament and the foremost 5ndash7 coils measured122ndash148 nm in width the posterior 7ndash6 coils mea-sured 84ndash110 nm in diameter Thewider coils formeda single row with the last wide coil often dislocated tothe rear so that the final part of the filament formed anirregular group of slightly more narrow coils in frontof the final wide coil (Fig 5C) The transverselysectioned polar filament exhibited a distinct layeredsubstructure a central dark area a moderately densezone with concentric layering a stratum appearing astransversely sectioned lucent fibrils an external zonewith dense and moderately dense layering and amembrane cover (which appeared electron dense insome preparations) (Fig 5D)

The mature polaroplast had an unusual construc-tion with 3 distinct lamellar regions (Fig 5A) Theanterior region was short with up to approximately 10closely arranged lamellar folds (periodicity from darkcentre to dark centre about 15 nm) (Fig 6A) Themedian section measuring about one third of thespore length had distinctly wide angular or roundedcompartments at least 280 nm wide (Fig 6A) Thesecompartments almost touched the spore wall Thefinal region also had closely packed lamellae (period-icity from dark centre to dark centre about 25 nm)It tapered towards the posterior end terminating atthe most anterior filament coil (Figs 5A and 6B)

The nucleus in the posterior half of the spore wasslender (Fig 5A) measuring 1middot45 μm at its widestsections At the posterior pole in a slightly obliqueposition was a vacuole and occasionally a posteriorgranule up to 320 nm widemdashthe membrane-like re-mainders of theGolgi apparatus Themembrane sur-rounding the polar filament forming the lamellae ofthe polaroplast and delimiting the posterior granuleand vacuole belonged to the same system and wasslightly narrower (about 6 nm wide) than the plasmamembrane The cytoplasm was fairly dense withstrands of polyribosomes around the polaroplastnucleus and filament coils (Fig 5A)

Unusual and teratological development

The species described here exhibited some develop-mental and cytological characteristics unusual tomicrosporidia For example sporophororous vesiclessometimes contained sporoblasts of 2 ages (Fig 7A)In addition sporoblasts with developing extrusionapparatuses and even mature spores were still con-nected (Fig 7B) Macrospores of both shapes

(pyriform and rod-shaped) were diplokaryotic(Fig 7C) with more filament coilsmdashat least up to 18Apart from that their sporal cytology was identicalto other spores Polyribosomes had an unusualconstruction transverse sections exhibited 9 ribo-somes arranged in acircle about 70 nmwide (Fig 7D)

Comparison to Octosporea bayeri

In earlier papers this microsporidium has been ref-erred to as Octosporea bayeri Jiacuterovec 1936 (Green1957 1974 Ebert et al 2001 Vizoso et al 2005)O bayeri a parasite of the adipose tissue was isolatedfrom D magna hosts living in Moravia (Jiacuterovec1936) It was described briefly as was typical for thetime and illustrated with a few line drawingsO bayeri produces fairly large spores that aremore or less rod-like straight or lightly curved withblunt ends The posterior vacuole is prominent inliving spores Feulgen techniques have revealed thespores to be binucleated and Giemsa staining re-vealed a metachromatic posterior granulum Nothingis known about the speciesrsquo reproductive processO bayeri shares some characteristics with the novel

Fig 6 The mature polaroplast of Hamiltosporidiumtvaerminnensis (A) Anterior part with lamellar (P1) andalmost globular (P2) chambers (B) Posterior part (P3)with lamellae A anchoring disc N nucleus PF polarfilament PS polar sac R ribosomes



species described in this paper The elongated sporesare also large and match Jiacuterovecacutes drawings The hostand pathology are identical At the most basic micro-scopic level thus there are no distinct differencesbetween this species and O bayeriKnowledge of the ultrastructure and study of

Jiacuterovecrsquos type material however clarify that themicrosporidium described here must be anotherspecies The normal spores of H tvaerminnensisare octosporous in fragile sporophorous vesicles andnot diplokaryotic Although it is not possible to verifythe diplokaryotic condition of O bayeri from thetype slides neither pyriform spores nor octosporousgroups are observable Even if a fragile sporophorousvesicle easily breaks when making smears sporegroups might be revealed if several smears arestudied as some groups of spores and sporoblastsare likely to remain in positions where host tissue ispresent in the smears There are 2 types of spores inthese slides but the large groups of smaller spores arecorrectly identified on the labels by Jiacuterovecrsquos hand asthe gut parasite Pleistophora intestinalis (now trans-ferred to the genus Glugoides) (Larsson et al 1996)Geographical distribution also suggests that the

earlier identification as O bayeri was incorrect Thespecies described here was only found in D magna

populations inhabiting rock pools on the Skerryislands of the Baltic coast of Sweden and FinlandField sampling in other European countries (RussiaUK Belgium France Switzerland Germany) re-vealed no evidence of this species (D Ebert unpub-lished observations) Two sampling expeditions to theNesyt pond in Moravia Czech Republic the typelocality of O bayeri did not reveal any microspor-idian parasite of the adipose tissue of D magna(D Ebert unpublished observations) Furthermorethe ecology of the large permanent Nesyt pond differsmarkedly from that of the small intermittent coastalrock pools on the Skerry islandsJiacuterovec (1936) justified placing this new species

in the genus Octosporea based on the shape of itsspores The type species O muscaedomesticae Flu1911 was studied at the ultrastructural level and wasproven to be diplokaryotic in all developmental stages(Ormiegraveres et al 1976) Consequently the species de-scribed here cannot be classified in the genusOctosporea

Molecular evolutionary analyses

The species described here is similar to F magnivoraand according to the present and previous analyses

Fig 7 Untypical microsporidian features of Hamiltosporidium tvaerminnensis (A) Sporophorus vesicle with bothsporoblasts and immature spores (BndashC) Flabelliform sporogonial plasmodia with still connected diplokaryotic maturemacrospores arrows point at sporophorous vesicle following the lobes of the plasmodium (D) Transversely sectionedpolyribosomes showing circles of 9 ribosomes (R) D diplokaryotic mature macrospores IS immature spores PF polarfilament N nucleus SB sporoblasts SV sporophorus vesicle



they are more related to the genus Glugea than toother well-known microsporidians such as Antono-spora and Encephalitozoon (Fig 8A Corradi et al2009 Refardt et al 2002) The tree is characterizedby very long tip branches except for the cluster withour target species Although posterior probabilitiesindicate a good statistical confidence for all cladesit is possible to verify that the internal branches aresupported by a reduced number of characters(Fig 8C D) This contrasts with the new speciesF magnivora cluster which shows a long internalbranch and very short tip branches No amino aciddifferences were found in the alpha- and beta-tubulins of either species (Fig 8C D) but 1middot3 ofthe nucleotides differ in their SSU rDNA sequences

Hamiltosporidium tvaerminnensis shares cyto-logical characteristics with Flabelliforma magnivoraF montana and with another crustacean parasiteAgmasoma penaei (Hazard and Oldacre 1975) To

clarify their phylogenetic position in a group ofclosely related microsporidians we used only theSSU rDNA sequences in a similar phylogeneticanalysis (Fig 8B) in whichGlugeawas considered asoutgroup based on a previously published SSUphylogeny (Refardt et al 2002) The tree shows thatH tvaerminnensis and F magnivora group neitherwith F montana nor with the recently describedNeoflabelliforma aurantiae Agmasoma penaei is notpresented in the tree because its partial SSU rDNAsequence is much shorter than the remaining se-quences

DISCUSSION

Phenetic relationships

The species described here shares cytological charac-teristics with 2 Flabelliforma species the type species

Fig 8 Phylogeny inferences (A) Bayesian phylogeny based on a mixed dataset containing 369 amino acids of alphatubulins 233 amino acids of beta tubulins and 1464 nucleotides of SSU rDNA Numbers indicate the posteriorprobability of each internal node (B) Bayesian phylogeny based on 1082 nucleotides of SSU rDNA (C) Unambiguousamino acid replacements of alpha tubulins plotted on the tree shown in (A) (D) Unambiguous amino acid replacementsof beta tubulins plotted on the tree shown in (A)



F montana a parasite of Diptera (sandflies) (Canninget al 1991 2001) and F magnivora also a parasiteof Daphnia magna (Larsson et al 1998) and withAgmasoma penaei a parasite of shrimps (Hazard andOldacre 1975 Clotilde-Ba and Toguebaye 1994)The uninucleate development the finger-like div-ision the 2-layered tubules of the episporontalspace and the more or less pyriform spores with1 convex and 1 concave surface are all characteristicsshared by H tvaerminnensis and the 2 FlabelliformaspeciesThe early developmental stages of the species de-

scribed here appear identical to those of F magnivora(Larsson et al 1998) The sporont walls are initiatedidentically over wide areas in both species (Larssonet al 1998) as it also is in F montana (Canning et al2001 Fig 12) However the fine structure of theprimordia of the sporont wall (exospore) differs inF montana In F magnivora and the species de-scribed here the sporont wall originates directly as alayered structure whereas in F montana the primor-dium originates as an electron-dense material withcavities and the layering is achieved during the ma-turation of the sporont (Canning et al 2001 Fig 8)In bothF magnivora and the species described in thispaper the exospores of mature spores are identicallyconstructed but differ in thickness F montana has asimilarly layered exospore with unit membrane-likeexternal and internal delimitations (Canning et al2001 Fig 25)The present species and the 2 Flabelliforma species

produce 2 generations of tubules in the episporontalspace first thin-walled tubules and thenmore thick-walled double-layered tubules In the species de-scribed here tubules disappear almost completelywhen the spores mature leaving only granularremnants In F magnivora and F montana howeversome tubules remain around mature spores (Larssonet al 1998 Fig 16 Canning et al 2001 Fig 21) InF montana and the present species second-gener-ation tubules widen in a characteristic waySpores of F magnivora and F montana are

slightly broader than spores of the present speciesF magnivora mature spores have a greater numberof filament coils than the species described hereand they are arranged as 2 irregular rows of coils(Larsson et al 1998 Figs 14 15) F montanamaturespores have a short filament with a few identicalcoils (Canning et al 2001 Fig 24) F magnivoramature spores also showno sizedifferencebetweenan-terior and posterior coils unlike the present speciesalthough immature spores exhibit slightly wideranterior coils (Larsson et al 1998 Fig 14) Theinternal organization of the filament is identical in thepresent species and F magnivora and probably alsoin F montana The polaroplast of F magnivora andF montana is the most common type for microspor-idia with 2 lamellar regions tightly arranged anteriorlamellae and wider posterior lamellae (Larsson et al

1998 Fig 20) This differs from the species describedhere In F magnivora and the species of this papersome spores remain connected until full maturation(Larsson et al 1998 Fig 22) These 2 species alsoshare circularly arranged polyribosomes (Larssonet al 1998 Fig 27)The present species shares many characteristics

with both Flabelliforma species and is clearly moreclosely related to F magnivora however even herethere are distinct cytological differences betweenthe two species beyond structure The spores ofF magnivora are smaller and more uniform they areformed in a variable number the polar filament isisofilar inmature spores and is coiled in double layersThe polaroplast does not contain an intermediateregion with wider lamellae The tubules of theepisporontal space are more persistent have thickerwalls and no characteristic widened sections Afurther very distinct difference between F magni-vora and the species described here is the presence ofthe elongated spore type in the new species which hasnever been found in any isolate of F magnivora de-spite an intensive search in infected hosts at all stagesof infection and from several localities (Larsson et al1998 D Ebert personal observations) Taken to-gether these differences indicate that the speciesdescribed here and F magnivora are different specieseven if they clearly belong to the same genusAgmasoma penaei shares several characteristics

with H tvaerminnensis it produces octosporoblasticpyriform spores the sporophorous vesicles have simi-lar 2-layered tubules and the exospores are obviouslyidentical (Hazard and Oldacre 1975 Clotilde-Baand Toguebaye 1994) However merogonial stagesand sporonts are diplokaryotic sporoblasts are notreleased by budding the polaroplast has 2 lamellarregions and the size differences between anteriorand posterior polar filament coils are so great thatthe filament clearly must be characterized as an-isofilar These differences indicate that the speciesdescribed here is clearly not an Agmasoma species aconclusion that is also supported by molecular data(not shown)Recently Morris and Freeman (2010) suggested

removing F magnivora from the genus Flabelliformabecause of its strong sequence divergence fromF montana and to place it in the new genus Neo-flabelliforma Following their reasoning we wouldneed to place the new species in this genus as wellHowever we disagree with the placement ofF magnivora in the genus Neoflabelliforma Fixedspores of Neoflabelliforma aurantiae were describedas ovoid to lageniform and the single micrographshows spores that are similar but not identical toF magnivora The anterior pole of the spores ofN aurantiae is clearly more blunt and the spores aresymmetrical The spores of F magnivora have a morepointed anterior pole and one of the sides is slightlyconvex



There are some obvious cytological differences be-tween N aurantiae and F magnivora The exosporeof N aurantiae originates as parallel strands of elec-tron-dense material (Fig 4 A inMorris and Freeman(2010)) not as wide areas as in F magnivora Bothspecies produce tubular exospore projections duringthe sporogony Obviously N aurantiae producesonly 1 generation of tubules while F magnivora likeH tvaerminnensis produces 2 generations The lastgeneration of tubules of F magnivora is distinctlydouble-layered different from the tubules ofN aurantiae The characteristics of the spore ofNaurantiae areverygeneral but someobviousdiffer-ences to F magnivora are apparent The exosporeof N aurantiae forms external projections and thepolaroplast is described as uniform not divided into2 or more regions

Phylogenetic relationships and genetic divergence

The close relationship of F magnivora and thenew species here described is supported by their re-duced molecular divergence A phylogenetic tree ofall microsporidian species with SSU rRNA alpha-tubulin and beta-tubulin genes available in GenBanksupports the sister species status forF magnivora andthe new species justifying their placement in 1 genusTheir alpha andbeta tubulin amino acid sequences areidentical while several unambiguous replacementsoccur along the remaining branches of the treeTubulin genes have not been obtained forFmontanaA penai and the recently described speciesN aurantiae Nevertheless the phylogeny inferredfrom SSU sequences only further indicates that thespecies described here is the closest relative ofF magnivora It must be emphasized that the powerof DNA sequences for identifying species is limitedwhen species pairs have very recent origins (Tautzet al 2003) The buildup of sequence differences thatcan serve as unequivocal diagnostic charactersdepends on the mutation and fixation rates whichfor nuclear neutral sites amount 0middot1ndash0middot2 permillionyears (combined estimates) Unfortunately the gen-omeofH tvaerminnensis seems tobepoor in repetitivesequences which have a higher mutation rate but weare attempting to isolate microsatellites which couldbe used as population genetic markers for both thespecies described here and F magnivora Our pre-liminary results on 6 microsatellite loci show acomplete lack of polymorphism inH tvaerminnensisbut not for 2 loci in F magnivora with no sharedalleles between the two species (data not shown)Together with the cytological and ecological data ourmolecular studies fit with a scenario of very recentspeciation possibly after the last glaciation when theScandinavian ice sheet started to melt down (about10000 years BP)

An alternative explanation for our findings is thatH tvaerminnensis simply represents a subspecies or

an ecotype of F magnivora We do not think that thisis the case because the morphologic and ecologicalcharacters that distinguish the two species are notpolymorphic across Europe in F magnivora andthere are no intermediate states Moreover our mol-ecular data suggest that the species described here iscompletely asexual (data not shown) Asexual repro-ductionmight have led to reproductive isolation andconsequently to specialization and speciation

CONCLUSION

We propose placing the species described here in anew genus called Hamiltosporidium and name itH tvaerminnensis Based on its close relationshipwith F magnivora we further propose transferringF magnivora to Hamiltosporidium Molecular differ-ences between F montana and F magnivora justifytheir placement into different genera Our data areconsistent with the hypothesis thatH tvaerminnensisrecently split from F magnivora forming a newspecies Further investigations into the similaritiesand differences of these two species may allow adeeper understanding of the process that led to thisspeciation event

Description

Hamiltosporidium gen novMerogonial and sporogonial stages with isolatednuclei Sporogony by more or less flabelliformbudding in a sporophorous vesicle produced at thebeginning of sporogony the number of sporoblastsvariable about 8 Sporont wall initiated as a 2-layeredstratum Episporontal space with 2 generations oftubules first generation thin-walled second gener-ation 2-layered formed in the sporoblastogenesisTubules reduced when spores mature Spores pyri-form and elongated with more or less isofilar polarfilament and a polaroplast with 2ndash3 basically lamellarregions

Derivation of name in honour of William DonaldHamilton FRS (1 August 1936ndash7 March 2000) forhis contributions to the role of infectious diseases inthe ecology and evolution of natural populations

Species 1 Hamiltosporidium tvaerminnensissp nov type speciesPre-sporal development merogonial stages with iso-lated nuclei merozoites formed by binary fission orcleaving of a plasmodium with a small number ofnuclei It is unknown if there is more than 1merogonial cycle

Sporogony octosporoblastic A sporogonial plas-modium with isolated nuclei yields 8 sporoblastsby budding or the sporont divides into 2 daughtercells each giving rise to a tetranucleate plasmodiumElongated spores are generated by the most flabelli-form plasmodia



Spores polymorphic in shape and size Themajority of spores are pyriform with 1 concaveand 1 convex side Posterior vacuole and refractiveglobule visible in living spores Unfixed pyriformspores measure 4middot9ndash5middot6times2middot2ndash2middot3 μm Elongatedrod-shaped spores with blunt ends measure unfixed6middot8ndash12middot0times1middot6ndash2middot1 μm The spore wall measures 160ndash280 nm with a 40ndash45 nm wide 5-layered exosporeThe polar filament is normally arranged in 12ndash13coils Anterior 5ndash7 coils in one row of coils are122ndash148 nm wide posterior 6ndash7 coils in an irregulargroup of coils measure 84ndash110 nm in diameterPolaroplast with 3 regions densely arranged lamellaewide chamber-like lamellae and posterior densely ar-ranged lamellae Nucleus in sections up to 1middot45 μm inwidth in the posterior half of the spore Macrosporesdiplokaryoticwith increasednumber of polarfilamentcoilsSporophorous vesicle a thin fragile envelope is

formed at the beginning of the sporogony Thin-walled 32ndash58 nm wide tubules are formed at thebeginningofsporogonyWhensporoblastsformasec-ond type of double-layered tubules (internal tubulusabout 30 nm wide external tubulus about 80 nm indiameter) appears filling the episporontal space asa meshwork These tubules characteristically haveswollen areas Tubules disappear during the matu-ration of the spores leaving a granular remainderTissues involved adipose tissue hypodermis and

ovariesType host Daphnia magna Straus 1820

(Crustacea Cladocera Daphniidae)Type locality Rock pool on the Skerry island Oumlren

7middot5 km south-west of Tvaumlrminne Zoological StationHanko South-West FinlandTypes Syntypes on slides No 090512-A-(1-5)

The sequences of the draft genome are available athttpwwwncbinlmnihgov (GenBank Accessioncode ACSZ000000001)Deposition of types in the International Protozoan

Type Slide Collection at Smithsonian InstitutionWashington DC USADerivation of name the species was first found at

Tvaumlrminne Zoological station in South-WestFinland (Green 1957)

Species 2 Hamiltosporidium magnivora(Larsson Ebert Mangin amp Vaacutevra 1998)Synonym Flabelliforma magnivora (Larsson et al

1998)Details on the cytology and type locality are given

in Larsson et al (1998)

ACKNOWLEDGEMENTS

The authors are greatly indebted to Rita Walleacuten at theDepartement of Cell and Organism Biology University ofLund and to Juumlrgen Hottinger at Basel University Wethank Ellen Decaestecker and Mike Jansen for providingsamples from Belgium

FINANCIAL SUPPORT

The project was supported by the Swiss National ScienceFoundation (to KH DE and DR) and the BrazilianCNPq (process 2014012007-0) (KH)

REFERENCES

Altermatt F Hottinger JW and Ebert D (2007)Parasites promote host gene flow in a metapopulationEvolutionary Ecology 21 561ndash575

Bieger A and Ebert D (2009) Expression of parasitevirulence at different host population densities undernatural conditions Oecologia (Berlin) 160 247ndash255

Canning E U Curry A Cheney S ALafranchi-Tristem N J Ebert D Refardt DKillick-Kendrick M and Killick-Kendrick R(2001) Flabelliforma montana (Phylum Microsporidia)from Phlebotomus ariasi (Diptera Psychodidae)ultrastructural observations and phylogeneticrelationships European Journal of Protistology 37207ndash221

Canning E U Killick-Kendrick R andKillick-Kendrick M (1991) A new microsporidianparasite Flabelliforma montana ng nsp infectingPhlebotomus ariasi (Diptera Psychodidae) in FranceJournal of Invertebrate Pathology 57 71ndash81

Clotilde-Ba F L and Toguebaye B S (1994)Ultrastructure and development of Agmasoma penaei(Microspora Thelohaniidae) found in Penaeus notialis(Crustacea DecapodaPenaeidae) from SenegalEuropean Journal of Protistology 30 347ndash353

Corradi N Haag K L Pombert J F Ebert DandKeeling P J (2009) Draft genome sequence of theDaphnia pathogen Octosporea bayeri insights into thegene content of a large microsporidian genome and amodel for host-parasite interactions Genome Biology 10R106

Decaestecker E Declerck S De Meester L andEbert D (2005) Ecological implications of parasites innatural Daphnia populations Oecologia (Berlin) 144382ndash390

Ebert D (2005) Ecology Epidemiology and Evolution ofParasitism in Daphnia httpwwwncbinlmnihgoventrezqueryfcgidb=Books Bethesda (MD) NationalLibrary of Medicine (US) National Center forBiotechnology Information

Ebert D (2008) Host-parasite coevolution insights fromthe Daphnia-parasite model system Current Opinion inMicrobiology 11 290ndash301

Ebert D Hottinger JW and Pajunen V I (2001)Temporal and spatial dynamics of parasites in aDaphnia metapopulation which factors explain parasiterichness Ecology 82 3417ndash3434

Ebert D Lipsitch M and Mangin K L (2000)The effect of parasites on host population density andextinction experimental epidemiology with Daphniaand six microparasites American Naturalist 156459ndash477

Green J (1957) Parasites and epibionts of Cladocerain rock pools of Tvaumlrminne archipelago ArchivumSocietatis Zoologicae Botanicae Fennicae lsquoVanamorsquo 125ndash12



Green J (1974) Parasites and epibionts of CladoceraTransactions of the Zoological Society of London 32417ndash515

Hazard E I and Oldacre SW (1975) Revision ofMicrosporida (Protozoa) close to Thelohania withdescriptions of one new family eight new genera andthirteen new species US Department of AgricultureTechnical Bulletin 1530 1ndash104

Hostounskyacute Z and Žižka Z (1979) A modificationof the ldquoagar cushion methodrdquo for observation andphotographic recording microsporidian sporesJournal of Protozoology 26 41Andash42A

James T Y Kauff F Schoch C L Matheny P BHofstetter V Cox C J Celio G Gueidan CFraker E Miadlikowska J Lumbsch H TRauhut A Reeb V Arnold A E Amtoft AStajich J E Hosaka K Sung G-H Johnson DOrsquoRourke B CrockettM BinderM Curtis JMSlot J C Wang Z Wilson AW Schuumlssler ALongcore J E OrsquoDonnell K Mozley-Standridge S Porter D Letcher PMPowell M J Taylor JW White MMGriffith GW Davies D R Humber R AMorton J B Sugiyama J Rossman A YRogers J D Pfister D H Hewitt D Hansen KHambleton S Shoemaker R A Kohlmeyer JVolkmann-Kohlmeyer B Spotts R ASerdani M Crous PW Hughes KWMatsuura K Langer E Langer GUntereiner W A Luumlcking R Buumldel BGeiser DM Aptroot A Diederich PSchmitt I Schultz M Yahr R Hibbett D SLutzoni F McLaughlin D J Spatafora JWand Vilgalys R (2006) Reconstructing the earlyevolution of Fungi using a six-gene phylogeny NatureLondon 443 818ndash822 doi 101038nature05110

Jiacuterovec O (1936) Uumlber einige in Daphnia magnaparasitierende Mikrosporidien Zoologischer Anzeiger116 136ndash142

Larsson J I R (1988) Identification of Microsporidiagenera (Protozoa Microspora) ndash a guide with commentson the taxonomy Archiv fuumlr Protistenkunde 136 1ndash37

Larsson J I R (1999) Identification of MicrosporidiaActa Protozoologica 38 161ndash197

Larsson J I R Ebert D Mangin K L and Vavra J(1998) Ultrastructural study and description ofFlabelliforma magnivora sp n (Microspora Duboscqiidae) a microsporidian parasite of Daphniamagna (Crustacea Cladocera Daphniidae) ActaProtozoologica 37 41ndash52

Larsson J I R Ebert D Vavra J and Voronin V N(1996) Redescription of Pleistophora intestinalisChatton 1907 a microsporidian parasite of Daphniamagna and Daphnia pulex with establishment of thegenus Glugoides (Microspora Glugeidae) EuropeanJournal of Protistology 32 251ndash261

Lass S and Ebert D (2006) Apparent seasonality ofparasite dynamics analysis of cyclic prevalence patternsProceedings of the Royal Society of London B 273199ndash206

Lee S C Corradi N Byrnes III E JTorres-Martinez S Dietrich F S Keeling P J

and Heitman J (2008) Microsporidia evolved fromancestral sexual fungi Current Biology 18 1ndash5

Mangin K L Lipsitch M and Ebert D (1995)Virulence and transmission modes of twomicrosporidia in Daphnia magna Parasitology 111133ndash142

Morris D J and Freeman M A (2010)Hyperparasitism has wide-ranging implications forstudies on the invertebrate phase of myxosporean(Myxozoa) life cycles International Journal forParasitology 40 357ndash369

Ormiegraveres R Baudoin J Brugerolle G andPralavorio R (1976) Ultrastructure de quelques stadesde la Microsporidie Octosporea muscaedomesticae Fluparasite de Ceratitis capitata (Wiedemann) (DiptegravereTrypetidae) Journal of Eukaryotic Microbiology 23320ndash328

Refardt D Canning E U Mathis A Cheney S ALafranchi-Tristem N J and Ebert D (2002) Smallsubunit ribosomal DNA phylogeny of microsporidiathat infectDaphnia (Crustacea Cladocera) Parasitology124 381ndash389

Reynolds E S (1963) The use of lead citrate at highpH as an electron-opaque stain in electron microscopyThe Journal of Cell Biology 17 208ndash212

Romeis B (1968) Mikroskopische Technik ROldenbourg Muumlnchen Germany and Wien Austria

Ronquist F and Huelsenbeck J P (2003) MrBayes 3Bayesian phylogenetic inference under mixed modelsBioinformatics 19 1572ndash1574

Stirnadel H A and Ebert D (1997) Prevalencehost specificity and impact on host fecundity ofmicroparasites and epibionts in three sympatricDaphnia species Journal of Animal Ecology 66 212ndash222

Tautz D Arctander P Minelli A Thomas R Hand Vogler A P (2003) A plea for DNA taxonomyTrends in Ecology and Evolution 18 70ndash74

Thompson J D Gibson T J Plewniak FJeanmougin F and Higgins D G (1997) TheClustalX windows interface flexible strategies formultiple sequence alignment aided by quality analysistools Nucleic Acids Research 25 4876ndash4882

Vaacutevra J and Larsson J I R (1999) Structure of themicrosporidia InTheMicrosporidia andMicrosporidiosis(ed Wittner M and Weiss LM) pp 7ndash84ASM Press Washington DC USA

Vizoso D B and Ebert D (2004)Within-host dynamicsof a microsporidium with horizontal and verticaltransmission Octosporea bayeri in Daphnia magnaParasitology 128 31ndash38

Vizoso D B and Ebert D (2005) Mixed inoculations ofa microsporidian parasite with horizontal and verticalinfections Oecologia (Berlin) 143 157ndash166

Vizoso D B Lass S and Ebert D (2005) Differentmechanisms of transmission of the microsporidiumOctosporea bayeri a cocktail of solutions for theproblem of parasite permanence Parasitology 130501ndash509

Zbinden M Haag C R and Ebert D (2008)Experimental evolution of field populations ofDaphnia magna in response to parasite treatmentJournal of evolutionary Biology 21 1088ndash1078



ways previous publications incorrectly identified itas O bayeri (see for example Green 1957 1974Ebert et al 2001 Vizoso and Ebert 2004 Lass andEbert 2006 Altermatt et al 2007) O bayeri wasdescribed from D magna fromMoravia in the CzechRepublic (Jiacuterovec 1936) The species was neverfound again in the type locality neither are thereany unambiguous records from other localities Be-cause H tvaerminnensis sp nov has become a modelsystem for the study of microsporidian epidemiologyecology and evolution (references as above) andbecause a draft of its genome sequence has recentlybeen published (Corradi et al 2009) it is imperativeto clarify its taxonomic position

Both F magnivora (Larsson et al 1998) andH tvaerminnensis sp nov infect the adipose tissuethe hypodermis and the ovaries of the crustaceanD magna (Larsson et al 1998 Vizoso et al 2005)Both microsporidian species have been known forsome time but have never been properly comparedF magnivorawas placed in the genus Flabelliforma in1998 based on cytological data It is typically found inD magna but was also recorded from D pulex andD longispina (Stirnadel and Ebert 1997 Larssonet al 1998 Decaestecker et al 2005) It has beenrecorded from the UK Belgium and Russia withhighly variable prevalences although usually under50 (Mangin et al 1995 Stirnadel and Ebert 1997Larsson et al 1998 Ebert et al 2000 Decaesteckeret al 2005) (Note Mangin et al (1995) Stirnadeland Ebert (1997) and Ebert et al (2000) called thisspecies Tuzetia sp) Recently due to its moleculardivergence to the Flabelliforma-type speciesF montana and a closer relationship to a newly de-scribed hyperparasite Neoflabelliforma aurantiaeit was proposed to reassign F magnivora toNeoflabelliforma (Morris and Freeman 2010) Herewe show that it was appropriate to place F magnivorainto a different genus from F montana but we arguethat it is not close enough toN aurantiae to place it inthe genus Neoflabelliforma Instead we place it in thesame genus as H tvaerminnensis sp nov

The new species described here exclusively infectsD magna even where D magna co-occurs in thesame pond with other Daphnia species such asD pulex and D longispina (Ebert et al 2001) Trans-mission trials in the laboratory further revealed that itcannot be transmitted to clones of D lumholtzi andD similis which form the sister-taxon to D magna(B Lange and D Ebert manuscript in preparation)In addition the new species has never been recordedin places other than D magna rock pool populationson the islands of the Baltic archipelago of Sweden andFinland (Green 1957 Ebert et al 2001 Ebert2005) Both field and laboratory studies have shownthat D magna and this species experience a co-evolutionary arms race (Ebert 2008) with hostsrapidly evolving resistance (Zbinden et al 2008) andparasites showing local adaptation to their natural

host populations (Altermatt et al 2007) H tvaer-minnensis sp nov reduces host fecundity by about20 (Bieger and Ebert 2009) To understand thephylogenetic position of this species the SSU rRNAgene was sequenced and compared to other micro-sporidia To our surprise the sequence was nearlyidentical to the sequence of F magnivora (Refardtet al 2002) This finding prompted the current studywhich seeks to identify the degree of cytological andgenetic differentiation between H tvaerminnensis spnov and F magnivora Table 1 summarizes keyaspects of the biology of these species

MATERIALS AND METHODS

Infected specimens of Daphnia magna Straus 1820were collected from rock pools in Finland (newspecies) and from ponds in Belgium (F magnivora)Cultures were established in the laboratory followingthe procedure of Vizoso and Ebert (2004) Bothparasites can be maintained easily in monoclonalD magna cultures Vertical transmission to asexualhost eggs of both species is 100 ensuring that theparasite is not lost during host propagation

Sample preparation for cytology

Fresh squash preparations of the new species weremade according to the agar method of Hostounskyacuteand Žižka (1979) and studied using phase-contrastmicroscopy Permanent squash preparations werelightly air-dried and fixed either in methanol for atleast 15min for Giemsa staining or in Bouin-Duboscq-Brasil (BDB) solution for at least 1 h priorto staining with Heidenhainrsquos iron haematoxylinWhole animals were fixed in BDB solution overnightor longer for paraffin sectioning Specimens werethen washed and dehydrated in a graded series ofethanol cleared in butanol and embedded inParaplast (Lancer St Louis MO USA) Sectionswere cut more or less longitudinally at 10 μm andstained with haematoxylin For details on the histo-logical techniques used see Romeis (1968) Allpermanent preparations were mounted in DPX(BDH Chemicals Ltd Poole England) Measure-ments were taken using an image analysis program(MicroMacro AB Gothenburg Sweden)

For transmission electron microscopy hosts in-fected with the new species were fixed in 2middot5 (vv)glutaraldehyde in 0middot2M sodium cacodylate buffer(pH 7middot2) at room temperature (18ndash23 degC) for 24 hSpecimens were then washed in cacodylate buffer andpost-fixed in 2 (wv) osmium tetroxide in cacody-late buffer for 90min at 4 degC Following this theywere washed and dehydrated in an ascending series ofbuffer-acetone solutions to absolute acetone and thenembedded in Epon Sections were stained usinguranyl acetate and lead citrate (Reynolds 1963)

































RESULTS





























The mature spores





































DISCUSSION





















CONCLUSION


Description


















ACKNOWLEDGEMENTS


FINANCIAL SUPPORT


REFERENCES










































































RESULTS





























The mature spores





































DISCUSSION





















CONCLUSION


Description


















ACKNOWLEDGEMENTS


FINANCIAL SUPPORT


REFERENCES





























































The mature spores





































DISCUSSION





















CONCLUSION


Description


















ACKNOWLEDGEMENTS


FINANCIAL SUPPORT


REFERENCES











































































DISCUSSION





















CONCLUSION


Description


















ACKNOWLEDGEMENTS


FINANCIAL SUPPORT


REFERENCES



























































CONCLUSION


Description


















ACKNOWLEDGEMENTS


FINANCIAL SUPPORT


REFERENCES























































ACKNOWLEDGEMENTS


FINANCIAL SUPPORT


REFERENCES












































cytological and molecular description of tvaerminnensis gen. et … · 2017. 12. 3. · cytological...

Documents