cytology and predict a poor prognosis p53 mutations in mantle cell

1996 87: 4302-4310

TC Greiner, MJ Moynihan, WC Chan, DM Lytle, A Pedersen, JR Anderson and DD Weisenburger cytology and predict a poor prognosisp53 mutations in mantle cell lymphoma are associated with variant

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

reserved.Copyright 2011 by The American Society of Hematology; all rights900, Washington DC 20036.weekly by the American Society of Hematology, 2021 L St, NW, Suite Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published

use only.For personal at PENN STATE UNIVERSITY on February 23, 2013. bloodjournal.hematologylibrary.orgFrom

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml

http://bloodjournal.hematologylibrary.org/subscriptions/ToS.dtl

http://bloodjournal.hematologylibrary.org/


p53 Mutations in Mantle Cell Lymphoma Are Associated With Variant Cytology and Predict a Poor Prognosis

By Timothy C. Greiner, Michael J. Moynihan, Wing C. Chan, Debra M. Lytle, Alex Pedersen, James R. Anderson, and Dennis D. Weisenburger

Mutations of the p53 tumor suppressor gene have been described in several subtypes of nomHodgkin’s lymphoma, but the incidence of p53 mutations in mantle cell lymphoma (MCL) is unknown. We hypothesized that cases of MCL with a variant or high-grade cytology would have a higher likeli- hood of p53 mutations than typical MCL. We were also inter- ested in the prognostic significance of p53 mutations in MCL. Therefore, a series of 53 well-characterized cases of MCL with DNA from 62 tissue samples was analyzed by the polymerase chain reaction with denaturing gradient gel electrophoresis for exons 5-8 of p53. lmmunoperoxidase studies with the antibody DO-7 to p53 protein were also performed on frozen sections. We found mutations of the p53 gene in 8 of the 53 cases (15%) of MCL. Missense mutations predom- inated, and 50% of the mutations occurred at known p53

ANTLE CELL LYMPHOMA (MCL) is a subtype of M non-Hodgkin’s lymphoma (NHL) that is estimated to comprise 2.5% to 4% of NHLs in the United States.’ The neoplastic cells of MCL are thought to correspond to lymphocytes of normal primary follicles and the mantles around germinal centers of secondary follicles in lymph nodes, spleen, and other lymphoid tissues. The term MCL’.’ encompasses lymphomas that had been previously desig- nated as lymphocytic lymphoma of intermediate differentiation: centrocytic lymph~ma,~ and intermediate lymphocytic or mantle zone most of which correspond to diffuse small cleaved-cell lymphoma in the Working Formu- lation.8 Two architectural patterns are observed in MCL. The first pattem is a diffuse infiltrate that effaces the lymph node architecture, sometimes with characteristic histiocytes scat- tered among the lymphoma ~el l s .4 .~ The second pattem is a mantle zone pattern with the cells forming neoplastic nodules and infiltrating as wide mantles around residual benign germinal centers.’ The typical cytology of MCL is that of small-

From the Departments of Pathology and Microbiology, and Pre- ventive and Societal Medicine, the University of Nebraska Medical Center, Omaha, NE.

Submitted September 29, 1995; accepted January 2, 1996. Supported in part by Grant No. ROl CA61453-01 from the Na-

tional Institutes of Health, a grant from the Nebraska Cancer and Smoking Disease Research Program (LB595), and an American Cancer Society Clinical Oncology Career Development Award 95- 42 (to T.C.G.).

The methods for p53 mutation detection were initially presented at the Workshop of Molecular Pathology, Rockville, MD, in November 1994, and the mutation results in mantle cell lymphoma were presented at the USKanadian Academy of Pathology Meeting, Toronto, Canada, in March 1995.

Address reprint requests to Timothy C. Greiner, MD, Department of Pathology and Microbiology, University of Nebraska Medical Center, 600 S 42nd St, Omaha, NE 68198-3135.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact. 0 19% by The American Society of Hematology. 0006-4971/96/8710-07$3.00/0

hotspot codons. Of 21 cases with variant cytology (ie, anaplastic or blastic), 6 (28.6%) had p53 mutations as compared with only 2 of 32 cases (6.3%) with typical MCL cytology ( P = .05), and p53 mutations preceded the development of variant cytology in 2 patients. Overexpression of p53 protein was observed in 6 of the 8 cases (75%) with p53 mutations and in none of the 45 wild-type cases. The median survival of the cases with mutant p53 was only 1.3 years (all died), whereas the median survival of cases with germline p53 was 5.1 years ( P = .023). These results suggest that mutations of p53 may be one mechanism involved in the development of variant forms of MCL and indicate that p53 mutations in MCL predict a poor prognosis. 0 1996 by The American Society of Hematology.

to intermediate-sized cells with irregular nuclear contours and coarse chr~matin?~.’.~.‘~ The variant or high-grade cytological appearances described in MCL have considerable overlap with each other and include the blastic,’O~i’ anaplastic,” and centrocytoid-centroblastic types.l2.’’

Cytogenetic and molecular discoveries in MCL in recent years have helped establish MCL as a distinct clinicopatho- logical entity.3 Karyotypic analysis led to the finding of a recurring nonrandom translocation between the bcl-1 locus and the Ig heavy chain in the t(ll;14)(q13;q32).14-16 South- ern blot analysis has shown a high percentage (50% to 70%) of bcl-1 rearrangements in MCL.’7-21 The candidate oncogene is the PRADl gene located 3‘ to most of the described bcZ-1 breakpoints, and P W 1 overexpression has been found to be highly associated with MCL.21-26 However, molecular studies to date have provided no putative mechanisms for the development of variant MCL, nor have molecular genetic markers with prognostic significance been identified.

Mutations in the p53 tumor suppressor gene have been described in several subtypes of lymphoid neoplasia and occur at an overall rate of about 14%.27 The frequency of mutations ranges from 5% to 40% including anaplastic large cell lymphoma (6%),28 peripheral T-cell lymphoma (8%):7 and chronic lymphocytic leukemia (CLL; 15%).27,29 Small noncleaved-cell l y m p h ~ m a ” ~ ~ ~ ~ ~ ’ and adult T-cell leukemid lymphoma (ATL)32*33 appear to have the highest de novo rates (30% to 40%) of p53 mutations in NHL, whereas a low mutation rate is observed in low-grade NHL. However, a high incidence of p53 mutations is present in high-grade lymphoid neoplasms that result from transformation or progression of a lower-grade NHL. These include CLL, in which 40% of cases that transform to diffuse large-cell NHL were found to have p53 mutations.27 In addition, at least 25% of diffuse large-cell lymphomas that arise from follicular lymphoma appear to harbor p53

The major goal of our study was to determine the incidence of p53 mutations in MCL. First, we asked the question whether p53 mutations are present at a higher frequency in the variant or high-grade forms of MCL than in those with the typical cytology. Second, because p53 mutations are associated with a poor prognosis in Burkitt’s lymphoma (BL),3’ CLL:9 acute lymphoblastic leukemia (ALL):6 and acute my-

4302 Blood, Vol 87, No 10 (May 15), 1996 pp 4302-4310




~ 5 3 MUTATIONS IN MANTLE CELL LYMPHOMA 4303

Table 1. Immunophenotypic Characteristics and bccl Rearrangements in the Two Subgroups of MCL

Type CD5’ CDlO CD23 bcl-1 RR

Typical MCL 27/31 187.1%)t OB1 (0%) 2/27 (7.4%) 19129 (65.5%) Variant MCL 17/21 (81%) 4/21 (19%) 1/21 (4.8%) 9/20 (45%)

P = .70* P = .02 P = 1.0 P = .24

Immunohistochemical studies performed on frozen tissue. t Percentage positive; RR, detection of bcl-1 rearrangements by Southern hy-

bridization using four probes (MTC, p94, A, D)lS; the total in each group studied varied with the availability of frozen tissue or DNA. * Fisher’s exact test statistics.

eloid leukemia nostic significance of p53 mutations in MCL.

we sought to determine the prog-

MATERIALS AND METHODS

Patients and materials. A series of 53 cases of MCL from the files of the Nebraska Lymphoma Study Group (NLSG Omaha, NE) with available DNA (62 samples) was studied. Nine cases had two sequential DNA samples. In addition, frozen tissue was available for p53 immunohistochemistry on 51 samples from 47 cases, including 4 cases from which sequential biopsy specimens had been obtained. The cases originated from the NLSG catchment area in the 5-state Midwest region, and biopsy specimens were obtained after in€ormed consent. Fresh tissue received by the NLSG is typically divided into adjacent samples for frozen-section immunohistochemical studies and for molecular analysis. To establish the presence of tumor in the samples extracted for DNA, light-chain restriction was shown in the adjacent frozen section of tumor tissue in 50 of the 53 cases, and all 50 cases contained more than 50% tumor cells. Ig heavy- chain gene rearrangements were identified in the DNA of the re- maining 3 cases. The cases of MCL were centrally re-reviewed by one of the authors (D.D.W.) and were classified by architectural features into noduladmantle zone or diffuse types. In addition, the cytological features of typical intermediate lymphocytic and variant forms using previously published criteria’@’3 were also recorded. Both the typical and variant cases showed equivalent CD5 and CD23 reactivity, and no significant difference was observed in the presence of bcl-1 rearrangements by Southem analysis with four probes (Table l).19 Although infrequent in variant MCL, the reactivity of CDlO was not observed in typical MCL (Table 1).

Genomic p53 sequences were analyzed by MELT87 (a gift from Dr R. Lerman, Massachusetts Institute of Technology, Cambridge, MA) or Mac- Melt 1.0 (Bio-Rad, Hercules, CA) software to confirm the melting temperature of each exon, as described by Beck et al.” Primer se-

Polymerase chain reaction (PCR) strategies.

quences were analyzed with Oligo 4.06 Primer Analysis Software (National Biosciences Inc, Plymouth, MN). Primers with 5’ 40- nucleotide GC-clamps for one primer of each pair were synthesized on an AB1 38OB synthesizer (ABI, Foster City, CA) by a solid- phase triester method.

Our modifications of the primers from Beck et a13‘ (Table 2) include the use of a corrected sequence for the exon 7 forward strand, because the published forward primer lacked a thymidine 5 nucleotides from the 3’ end. In addition, exon 8 was amplified as a single exon product, rather than combined with exon 9, using Gai- dano’s reverse primer?’ This was performed because the difference in the melting temperature of each exon is such that analysis of a separate exon-8 product resulted in better resolution than a combined exon-8 and -9 assay.

DNA was obtained using a previously described phenol chloro- form extraction technique after proteinase-K dige~tion.3~ A total of 500 ng of MCL genomic DNA was amplified in 100 pL of PCR buffer, (10 mmoVL Tris HCl, pH 8.3; 1.5 “OIL MgC12; 50 mmoVL KCl; 0.01% gelatin) with 100 mmoVL of each deoxynucleo- side triphosphate, 2.5 U Taq polymerase enzyme (Perkin Elmer- Cetus, Norwalk, CT), and 0.5 mmol/L of each pair of primers. Reaction mixtures were incubated at 94°C for 9 minutes for denatur- ation followed by 45 cycles of 94°C for 1 minute and 15 seconds, 58°C for 1 minute and 15 seconds (60°C for exon 6), and 72°C for 30 seconds with 1 second of additional extension per each cycle. A terminal extension of 72°C for 10 minutes was performed after completion of the 45 cycles. A total of 10% of the reaction product ( IO p L ) was electrophoresed on a 2% 3:l Nusieve agarose (FMC, Rockland, ME) gel for determination of the success of amplification in producing the expected PCR product sizes.

DGGE was performed on the amplified DNA to screen for mutations and to isolate the mutated DNA for sequencing. Modifications of the electrophoresis times from Beck et al” for each exon were determined using stepwise-loading gels as described by Myers et aLQ To en- hance the recovery of the DNA compared with precipitation tech- niques, the PCR products were dried with a Savant DNA Speed Vac 110 (Savant, Fanningdale, NY). A total of 40% of a 100-pL PCR product was electrophoresed at 160 V and 60°C in 8% polyacrylamide gels (37:1, acry1amide:bisacrylamide) poured with a model 150 Gradient Former (Life Technologies, Gaithersburg, MD).4’ De- naturing conditions ranged from 35% to 65% through 60% to 80% (Table 2) in the gels analyzed on a model DGGE-4000 System (CBS Scientific Co, Inc, Del Mar, CA). After electrophoresis, the gels were stained with ethidium bromide (2 pg/mL) for 20 minutes and destained in distilled water for 10 minutes?’

The PCR products that showed a shift in the migration of the sequence from the wild-type DNA were cut

Denaturing gradient gel electrophoresis (DGGE).

Sequencing strategy.

Table 2. Primer Sequences and Conditions for DGGE of p53 Mutations

DGGE Conditionst Fragment Size p53 Exon Primers*

5 Forward C’(GC)TTCCTClTCCTGCAGTACTC-3’ 282 60%-80% for 8 hours

6 Forward 5’(GC)ACGACAGGGCTGGTTGCCCA-3’ 227 40%-70% for 6.5 hours

7 Forward 5’(GC)TCTCCTAGGlTGGCTCTGACTG-3’ 174 35%-65% for 6.5 hours

8 Forward S 'CCTATCCTGAGTAGTGGTAATC-3' 260 35%-65% for 8 hours

Reverse 5’-CTGGGCAACCAGCCCTGTCGT-3’

Reverse 5’-AGlTGCWCCAGACCTCAG-3’

Reverse 5‘GCAAGTGGCTCCTGACCTGGA-3‘

Reverse 5’(GC)AAGTGAATCTGAGGCATAAC*

(GC) is 5’-CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCG-3’. t The percentage of denaturing gradient range and electrophoresis run time at 160 V and 60°C. The best gradient for each PCR product was

* Exon 8 reverse primer contains the primer sequence described by Gaidano et al?7 determined by optimizing the previously described conditions of Beck et ala in the authors’ laboratory.




GREINER ET AL 4304

het- b * w wt -

1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3

Fig. 1. DGGE results in lymphoid cell lines with known p53 mutations.

Lane Exon DNA Codon Mutation Reference

1 E x 7 None NA NA 23" Ex7 Namahrva 248 CGG-CAG FarrelletaP 4,5* Ex 7 Ramos 254 A T C 4 A C Farrell et ala 6 E x 7 Placenta NA Wt 7 Ex 7 Raji 234 T A C 4 A C D u t h u e t a v 8 Ex7 MC116 238 TGT-TAT GaidanoetaP 9 E x 6 SNC NA Wt

10 E x 6 Raji 213 C G A 4 A A Farrell et ala 11 E x 6 Jurkat 196 CGA-TGA Cheng and H a d 12 E x 6 Placenta NA Wt

WT is wild-type p53. The wt sequences for exons 7 and 6 were aligned for the purposes of this figure: arrows, mutations as single bands above or below the wt bands; het, paired bands of heteroduplex formations between wt and mutated sequences (heteroduplex bands usually migrate slower than homoduplex bands); NA, not applicable; lane 1, negative control with no DNA for exon 7; "lanes 3 and 5,5050 mixtures of the mutant cell lines with placenta (to show the generation of heteroduplex bands); lanes 6 and 12, wt sequence controls from placenta for exons 7 and 6, respectively; SNC, a small noncleaved cell lymphoma with wt sequences; lane 13, OX Hse 111 DNA marker. In DGGE, the fragments of DNA separate by sequence, not only by length, as seen in agarose electrophoresis. Product sizes are evaluated only in the agarose gels.

from the DGGE gels, frozen at -70°C. thawed, and serially diluted in distilled H,O to an estimated IO pglpL after comparison with a known quantity of 0x174 HaeIII DNA (Life Technologies) used in the agarose gel. A reamplification of 10 to 100 pg of the first-round PCR product using the same primers (Table 2) without GC-clamps for the appropriate exon was performed. Our goal was to remove the GC clamp, which tends to interfere in sequencing reactions. The PCR product was centrifuged with a QIAquick-Spin PCR Column Purification Kit (Quiagen, Chatsworth, CA) column to eliminate excess deoxynucleotide triphosphates and primers before sequencing. Sequencing was performed in both directions with the described exon primers without a GC clamp (Table 2). using the Dye-Labeled Dideoxy Terminator Kit (ABI) according to the manufacturer's directions, purified with a Centri Sep PSR 00105 column (Princeton Separation Inc, Adelphia, NJ) and analyzed on a automated AB1 373A fluorescent sequencing system (ABI). DNA sequences were analyzed by Analysis 1.2 (ABI) and Sequence Navigator (ABI) software to compare with the wild-type p53 sequence.

Positive controls with previously published single nucleotide p53 mutations included six lymphoid cell lines (Exon 5-CEM; Exon 6- Raji, Jurkat; Exon 7-Raji; MCI 1 6 ; Namalwa; Ramos, CEM; see Fig

1)2'.424 and a lymphoma sample with an exon-8 m~tation'~ (a gift of Dr M. Raffeld, National Cancer Institute, Bethesda, MD). Screen- ing by DGGE identified mutational shifts (Fig 1) in each control sample, and sequencing showed the published mutations.

Overexpression of p53 protein was correlated with the p53 sequence results. Immunohistochemical studies using the avidin-biotin technique were performed on 6-pm frozen sections using the monoclonal antibody DO-7 (DAKO Corp, Car- pinteria, CA) that reacts with an amino terminal epitope of the p53 pr0tein.4~ The antibody was applied at a concentration of 150 for 30 minutes, was developed with 3.3' diaminobenzidine tetrahydro- chloride, and was counterstained with hematoxylin. A positive result was recorded when the percentage of nuclei staining exceeded 5% of the cells, a threshold determined after staining normal tissues and described previously in paraffin-embedded tissue.w

Comparisons of the distributions of categor- ical data characteristics between groups were made using Fisher's 'exact' test for 2x2 tables. Survival was defined as the time to death from any cause and was estimated using the product-limit method of Kaplan and Meier.& Distributions of time-to-event data were compared using the log-rank test?'

p53 Immunohisrochembtry.

Statistical analysis.

RESULTS

p53 Mutations in MCL. A total of 32 cases of MCL showed typical cytology at diagnosis, whereas 17 cases (32%) showed variant cytology including 16 blastic and 1 anaplastic MCL. In 4 additional cases, the tumor transformed from typical cytology to blastic cytology in a subsequent biopsy specimen. Thus, 21 of our 53 cases (39.6%) showed variant MCL cytology at some time during the clinical course.

Of the 53 cases of MCL. 8 (15%) had p53 mutations (Table 3). The mutations were observed in exons 5 (1 case), 6 (1 case), 7 (3 cases), and 8 (3 cases), with 50% occumng at codons 213, 248, and 273. These codons are known to have a high frequency of p53 mutations and include CpG dinucleotides. Sequential biopsy specimens in 3 cases (cases no. 4. 5 , and 6) showed the same mutation each time. The most frequent p53 abnormality was a missense mutation, which was observed in 6 of 8 cases. Approximately equal numbers of transitions (4) and transversions (3) were observed. In addition to the missense mutations, case no. 1 had a 2-bp deletion in codons 184-185. This deletion caused a frame shift and introduced a stop codon downstream at codon 207. Case no. 2 had a nonsense mutation at codon 213.

Figure 2 shows the DGGE screening results for mutations in exon 8 for cases of MCL. Each unique mutation migrates to a different position in the denaturing gel. Typically, four bands are observed in a heterozygous case, including one band for the wild-type sequence, one band for the mutant sequence, and two heteroduplex bands representing mixtures of wild-type and mutant sequences that migrate more slowly in the gel. The presence of paired heteroduplex bands facili- tates the identification of mutated sequences, especially when the mutated cells comprise only 0.1% to 1.0% of the sample, which is the sensitivity cutoff level of DGGE in our laboratory. The presence of a strong mutant band out of proportion with the wild-type sequence band, such as those observed in cases no. 6b and 8 in Fig 2, suggests a deletion of the wild-type allele or, but less likely, mutations in both alleles, shown in Fig 1 for Namalwa (lane 2).

To study the importance of p53 mutations and overex-





n b, rt c3 ", a0

a % 0

Q (D

Q, v) a 0

Fig 2. DGGE results for exon 8 in MCL. Case, MCL with exon 8 p53 mutations; WT, MCL with wild-type exon 8 DNA; Neg control, no DNA; Placenta, wild-type control; het, heteroduplex bands; arrows, mutant p53 bands; wt, wild-type p53 bands. Note that p53 mutation shifts are present in case no. 8, case no. 6a and 6b. and case no. 7. Occasionally, a gel artifact wil l produce the appearance of doublet bands (case no. 7). which has no significance.

pression of p53 protein in the development of variant forms of MCL, cases were classified as variant MCL if any biopsy specimen showed variant cytology. In the 32 cases with only typical lymphocytic cytology, 2 cases (6.3%) had p53 mutations. However, of the 21 cases with variant cytology, 6 cases (28.6%) had p53 mutations (P = .05); 5 of the variant cases had blastic morphology, and 1 case (case no. 1) was an anaplastic MCL. No correlation between CDIO expression and p53 mutation was identified because only 1 p53 mutant case was CDIO'.

In 2 cases, the p53 mutation preceded the development of variant cytology. In case no. 4, approximately 1% of the

tumor cells had a p53 mutation in the initial biopsy specimen (case no. 4a), but the mutation was more prominent in a subsequent biopsy specimen obtained 1 year later (case no. 4b). Figure 3 shows the pair of weak heteroduplex bands from the initial biopsy specimen (case no. 4a), which migrate to the same position as the bands from the subsequent biopsy specimen (case no. 4b). Morphologically, this tumor began with a mantle zone pattern and typical lymphocytic cytology (Fig 4A). but recurred with blastic cytology (Fig 4B) while retaining the mantle zone pattern. Case no. 5, which also changed from typical cytology to a variant form, also showed an architectural change from a mantle zone pattern to a diffuse pattern.

A previously described polymorphism at codon 2 13 (CGA +

CGG)48.49 was observed in 3 of the 53 cases (5.5%). Figure 5 shows that the bands of the polymorphic sequence migrate to a different position in the gel than that of the mutation at the same codon 213 observed in case no. 2, which differs by only two nucleotides (CGA -, TGA).

Overexpression of the p53 protein was observed in 6 of the 8 cases with sequenced mutations using the antibody DO-7 (Table 3). None of the other 45 cmes without a p53 mutation was positive with DO- 7, which includes the 3 cases with the polymorphism at codon 213. Overexpression of p53 was present in the 2 mutated cases with stop codons (cases no. 1 and 2). because codons 207 and 213 are downstream from the DO-7 epitope.

For the survival analysis, 15 patients were eliminated because of a lack of follow-up information (2 cases) or because they represented referrals at the time of relapse ( 1 3 cases). After these exclusions, 6 cases with p53 mutations and 32 cases with wild-type p53 remained for the survival analysis. The choice of chemotherapy provided no selection bias because a similar percentage received curative therapy in the p53 mutation group (4 of 6; 66.7%) and in the wild-type group (25 of 32; 74%; P = .16). Curative therapy was defined as a protocol including adriamycin or an adriamycin-like drug. There was a significant difference in the median survival of the MCL cases with p53 mutations as compared with that of those without mutations. The median survival of MCL cases with wild-type p53 was 5.1

p53 Immunohistochemistry in MCL

Survival andysis.

Table 3. p53 Mutations in MCL

Case No.

1 2 3 4a 4b 5a 5b 6a 6b 7 8

Pattern-Cytology

D-V D-T D-V MZ-T MZ-V MZ-T D-V D-T D-T D-V D-V

~ 5 3 lmmuno DO-7 Exon Codon

P 5 P 6 N 7 N 7 ND 7 P 7 P 7 P 8 ND 8 P 8 P 8

184-5 213 234 248 248 248 248 266 266 273 278

DNA Changes

GATAGC-GAGCGA CGA-TGA TAC-TGC CGG-CAG CGG-CAG CGG-CAG CGG-CAG GGA-GTA GGA-GTA CGT-CCT CCT-ACT

-

Amino Acid Change Mutation Type ~~

AspSer+GluArg Arg-Stop Tyr-Cys Arg-Gln Arg-Gln Arg-Gln Arg-Gln G I y-Va I Gly-Val Arg-Pro Pro-Thr

Deletion 2 bp Nonsense Missense Missense Missense Missense Missense Missense Missense Missense Missense

Underlined nucleotides in case no. 1 were deleted, resulting in a stop codon at 207. Abbreviations: N, negative p53 protein expression; P, positive p53 protein expression in greater than 5% of cells; ND, not done because no

tissue was available; MZ, architectural pattern wherein tumor cells expand around germinal centers; D, diffuse pattern wherein the infiltrate effaces the lymph node architecture; T, typical lymphocytic cytology; V, variant cytology.




4306 GREINER ET AL

het-

> wt-

Fig 3. DGGE results for exon 7 in sequential biopsy specimens of MCL case no. 4 het, heteroduplex bands; arrows, mutant p53 band; wt, wild-type p53 band. Triplicate analyses of the biopsy specimen in case no. 4a with typical MCL from 1989 show heteroduplex bands. Case no. 4b is an analysis of the variant [blastic) form observed in 1990. The mutant p53 band (arrow) is easily identified in case no. 4b. The heteroduplex pair of bands observed in case no. 4b is also present in case no. 4a. indicating that a small population of cells with the mutant p53 sequence is also present in the earlier 1989 biopsy specimen. The mutant band is not observed in case no. 4a because the mutant sequence has been consumed in the heteroduplex bands. WT is an MCL case with wild-type DNA.

years, whereas all those with p53 mutations have died, with a median survival of only 1.3 years (P = .023; Fig 6). Multi- variate analysis to determine if p53 mutations represent an independent prognostic factor apart from variant morphology could not be performed because of the small number of cases with mutations.

I..- ",--.-

I

DISCUSSION

To assay mutations of the p53 gene in lymphoid neo- most invest~gators27.?8.31.~?.34.~5.sn have used modifica-

tions of the single-stranded conformation polymorphism protocol originally described by Orita et al.5' In contrast to single-stranded conformation polymorphism. DGGE uses double-strand PCR products in a computer-calculated5' and empirically determined denaturing gradient polyacrylamide gel"" constructed with increasing urea and formamide con- centrations to isolate mutated sequence~.~' Sheffield et als3 showed the analytical capabilities of GC-clamped DGGE to detect single base mutations in hemoglobin sequences with 100% ~ensitivity.'~ Metzger et alss first described the application of GC-clamped DGGE in detecting p53 mutations in ependymomas. This method was then applied by other inves- tigators in rat"' and human t ~ m o r s . ~ ~ . ~ " Beck et a13* showed that a refined GC-clamped DGGE protocol can separate single base changes in p53 with high resolution and efficiency. A 40-nucleotide sequence of guanines and cytosines (GC- clamp), synthesized at the 5' end of one of the primers, provides the high-resolution capability. In view of these features and our experience with the DGGE technique?' we chose DGGE as our mutation-screening assay.

In this study, we found p53 mutations in 15% of our cases of MCL. We also showed two other new significant findings. We found that (1) p53 mutations are highly associated with the variant cytology of MCL (28.6% of variant cases) and (2) p53 mutations appear to predict a poor prognosis. This report identifies p53 mutations in a large series of cases of MCL. Preliminary reports of smaller groups of cases59-62 at the recent USKanadian Academy of Pathology meeting suggested findings similar to ours,6' ie, that p53 mutations and/or p53 overexpression may occur in MCL. Cazorla et al'" observed a p53 mutation in 1 of 14 cases (7%) of MCL, with the single mutation observed in one of four (25%) blastic variants. Finkelstein and associatesM reported p53 mutations in 2 of 18 cases (11%) of MCL and in 1 of 6 (16.7%) other lymphomas with bcl-1 rearrangements. In 23 cases of MCL with bcl-l rearrangements, Louie et a]"' observed p53 overexpression in 5 cases (16.6%). of which only

Fig 4. [A) Case no. 4a. MCL with typical lymphocytic cytology; note the admixed histiocytes (arrows). IBI Case no. 4b. MCL with blastic cytology; the arrows identify histiocytes for nuclear size comparison with MCL. The tissue from both biopsy specimens was processed in 85 (mercuric chloride) fixative and stained with hematoxylin and eosin. (Original magnifica- tion x 400.)





Fig 5. DGGE resutts for exon 6 in MCL het, heteroduplex bands; arrow, mutant p53 bands; wt, wild- type p53 bands; p, polymorphism band; Wr, MCL with wild-type exon 6 DNA; case no. 2, MCL with p53 mutation at codon 213 (CGA -t TGA); POLY, 3 MCLs with paired biopsy specimens that have the codon 213 polymorphism (CGA + CGG); Jurkat, positive control cell line with a codon 196 mutation (CGA - TGA); Neg Control, no DNA.

het: * M- p-

2 had p53 mutations (10.1%).@ A median survival of 12 months was observed in the cases with p53 expression versus 63 months in the p53-negative cases.@ However, Louie et alM could not show a correlation of p53 mutations with prognosis because only 2 cases had mutations. In addition, because no variant cases were identified in their series, the association of p53 mutations with variant cytology was not made.@ Finally, Zoldan et alh2 observed p53 mutations in 1 of 10 cases (10%) of typical MCL and 1 of 4 (25%) MCL variants. These studies, taken in aggregate, support our data that show a low incidence of p53 mutations in MCL. Individ- ually, these reports had insufficient cases to show a strong association of p53 mutations with variant MCL; however, in composite, they support our observation that a higher frequency of p53 mutations is observed in variant MCL.

The occurance of variant MCL, which have larger nuclei and finer chromatin than typical MCL, is still an evolving concept, as reflected by the recent workshops on low-grade B-cell disorders conducted by the Society for Hematopathol- ogy in 1993 and on MCL conducted by the the European Lymphoma Task Force in 1994.' An interesting finding in our study was the observation of variant cytology in 21 of 53 cases (39.6%) at some time during the clinical course. This is identical to the results of a recent study of the natural history of MCL published by Norton et a17 who found that 39.4% of cases of MCL (26 of 66 cases) eventually developed transformation. The fact that transformation was found on rebiopsy or at autopsy in 24% (16 of 66) of these cases undersores an important point. Obtaining multiple biopsy specimens is necessary for the identification of the transformation to variant MCL and for studying the molecular patho- genesis of this process. Previous emphasis on diagnosing MCL as having only a lymphocytic cytology with infrequent transformation has a priori de-emphasized the importance of perfoming biopsies at relapse or evaluation at autopsy.

We asked the question of whether variant MCLs were associated with a specific type of p53 mutation. However, other than localization of 50% of mutations at codons with

CpG dinucleotides, a spectrum of mutations was observed. To our knowledge, the deletion of two nucleotides in codons 184-1 85 has not been previously reported in hematopoietic neoplasms. However, a single nucleotide deletion at the first position in codon 185 has been observed in breast cancer." The CGA + TGA nonsense mutation at codon 21 3 has been reported frequently in hematologic malignancies, including BL and BL cell line^^^*^" ATL,"' myelodysplastic syndrome (MDS) progressing to AML,h7 and chronic myelogenous leukemia (CML) progressing to a blast crisis.hx

Our finding of frequent missense mutations parallels those of previous reports on other subtypes of NHL.27.'n.34 The TAC --* TGC mutation at codon 234 has been described in a BL cell line.27 The CGG -, CAG mutation at codon 248 has been described in BL and in BL cell Iines,27.30.43 transformed follicular NHL,34 CLL? immunoblastic NHL,h9 ALL,7n a T- cell line,"* CML in blast crisis,7' ATL,'* and MDS7' Hsiao

0.11

0.04 . . . . . . .. 0 2 4 6 8

Years

Fig 6. Survival of patients with MCL. The solid line represents 32 patients with wild-type p53 sequences, and the dashed line represents 6 patients with p53 mutations.




4308 GREINER ET AL

et a174 have shown that human T-cell acute leukemia cells with this CGG + CAG at mutation codon 248 have higher proliferation and metastasis rates as compared with those of wild-type p53 cells when implanted in SCID mice. The other mutations reported in Table 3 in our study have not been studied with this method. The CGT + CCT mutation at codon 273 has been reported in Ah4L.73 The mutations at codons 266 and 278 have not been previously reported in lymphoid tumors.7s

In addition to the p53 mutations, a polymorphism at codon 213 was found at about the same rate as that reported by other^.^,^^ Because there is no change in the amino acid sequence in the protein (Arg -f Arg), this polymorphism is thought to have no functional effect on the p53 protein.

The occurrence of p53 mutations has been suggested as one mechanism of clinical progression in NHL74 in the transformation of a low-grade to a high-grade lymphoid process, such as the transformation of CLL" or follicular l y m p h ~ m a ~ . ~ ~ to large-cell lymphoma; and in the progression of chronic or smoldering ATL to the aggressive phase of ATL." Recently, mutations in p53 have been associated with high-grade MDS and progression to AML.67 A parallel observation has been described in CML progressing to blast crisis.6' In these settings, patients with p53 mutations have a poor prognosis.

We propose that a similar molecular mechanism involving p53 may be responsible for both the development of some cases of variant MCL and the poor prognosis in the mutant MCL. It is known that the p53 protein regulates the cyclin D 1 -cyclin-dependent kinase complex in the cell cycle via the p21 (WAFUCipl) gene.77 Cyclin D1 participates in checkpoint control via phosphorylation of the retinoblastoma protein before the transition from G1 to S - p h a ~ e . ~ ~ . ~ ' Recent "knockout" experiments in human cell lines with bcl-1 rearrangements have shown that cyclin D-1 is required for rapid G1 progre~sion.~~ As mentioned earlier, high levels of cyclin D1 mRNA and protein are present in MCLzL-26 and are hypothesized to be on~ogenic.'~ Although elevated, the effect of cyclin D1 may be somewhat inhibited by the presence of wild-type p53. However, in cases with mutant p53, this inhibitory effect may be lost, thus further enhancing the growth-promotional effect of cyclin D1. The loss of p53 regulation of cyclin D 1 may be one of the molecular mechanisms explaining the higher mitotic rate and proliferative fraction observed in blastic variants of MCL.11.13 Other molecular lesions within cell cycle control may exist in the subset of variant MCLs without p53 mutations. The potential for finding other molecular abnormalities may be predicted by recent discoveries regarding the transformation of follicular lymphoma to diffuse large-cell NHL, wherein abnormalities of c-myc,'o ~ 5 3 , ~ ~ , ' ' and b~l-6'~-'~ have been implicated.

Discordance between the results of p53 immunohistochemistry and mutational analysis has been observed in NHL28*34.84 and, recently, in MCL.@ No mutations were identified in 3 of 5 MCL cases that were positive by p53 immunoperoxidase in the study by Louie et al." In our study, there was relatively good concordance between protein overexpression and detected mutations. Antibody DO-7 appears to be specific in identifying mutations in exons 5-8 in our study, because no case was positive in the presence of wild-type

sequence. In our study, antibody DO-7 identified p53 overexpression in 6 of 8 cases (75%) with sequenced p53 mutations. We believe that the negative immunoperoxidase result on case no. 4a was secondary to the low number of mutant cells present (0.1% to l%), as estimated from the DGGE of the first biopsy specimen (case no. 4a; see Fig 3). This hypothe- sis cannot be confirmed because no frozen tissue was available from the subsequent biopsy specimen (case no. 4b) with variant MCL.

Importantly, p53 mutations appear to be the first molecular marker to identify patients with MCL who will have a poor prognosis. The results of our survival analysis of p53 mutations in MCL parallel those of analyses previously described in small noncleaved-cell lymphoma:' CLL,29 MDS? CML,6' ATL,72 and ALL.36 Clearly, p53 mutations in most hematologic malignancies portend a poor prognosis,8' and our study indicates the importance of detection of p53 mutations in MCL. Other studies in MCL would be useful to confirm our results.

REFERENCES 1. Weisenburger DD: Mantle cell lymphoma, in Knowles DM

(ed): Neoplastic Hematopathology. Baltimore, MD, Williams & Wil- kins, 1992, p 617

2. Raffeld M, Jaffe ES: bcl-I, t(l1; 14), and mantle cell-derived lymphomas. Blood 78:259, 1991

3. Zucca E, Stein H, Coiffier B: European Lymphoma Task Force (ELW): Report of the workshop on mantle cell lymphoma (MCL). Ann Oncol 5507, 1994

4. Berard CW, Dorfman RF: Histopathology of malignant lymphomas. Clin Haematol 3:39, 1974

5. Lennert K, Stein H, Kaiserling E: Cytological and functional criteria for the classification of malignant lymphomata, Br J Cancer 31:29, 1975 (suppl 11)

6. Weisenburger DD, Nathwani BN, Diamond LW, Winberg CD, Rappapon H: Malignant lymphoma, intermediate lymphocytic type: A clinicopathologic study of 42 cases. Cancer 48:1415, 1981

7. Weisenburger DD, Kim H, Rappaport H: Mantle-zone lymphoma: A follicular variant of intermediate lymphocytic lymphoma. Cancer 49:1429, 1982

8. Non-Hodgkin's Lymphoma Pathologic Classification Project: National Cancer Institute sponsored study of classifications of non- Hodgkin's lymphoma: Summary and description of a working formulation for clinical usage. Cancer 49:2112, 1982

9. Jaffe ES, Bookman MA, Longo DL: Lymphocytic lymphoma of intermediate differentiation-mantle zone lymphoma: A distinct subtype of B-cell lymphoma. Hum Path01 18:877, 1987

IO. Lardelli P, Bookman MA, Sundeen J, Longo DL, Jaffe ES: Lymphocytic lymphoma of intermediate differentiation: Morpho- logic and immunophenotypic spectrum and clinical correlations. Am J Surg Pathol 14:752, 1990

11. Mederios LJ, Jaffe ES: Low-grade B-cell lymphomas not specified in the working formulation, in Jaffe ES (ed): Surgical Pathology of the Lymph Nodes and Related Organs. Philadelphia, PA, Saunders, 1995, p 221

12. Lennert K, Mohri N: Histopathology and diagnosis of non- Hodgkin's lymphomas: Malignant lymphoma, centrocytic (Centrocytoma), in Lennert K (ed): Malignant Lymphomas Other Than Hodgkin's Disease. Berlin, Germany, Springer-Verlag, 1978, p 284

13. Ott MM, Ott G, Kuse R, Porowski P, Gunzer U, Feller AC, Mtiller-Hermelink HK: The anaplastic variant of centrocytic lymphoma is marked by frequent rearrangements of the bcl-I gene and high proliferation indices. Histopathology 24:329, 1994





14. Weisenburger DD, Sanger WG, Armitage JO, Purtilo D T Intermediate lymphocytic lymphoma: Immunophenotypic and cytogenetic findings. Blood 69:1617, 1987

15. Leroux D, LeMerc’hadour F, Gressin R, Jacob M-C, Keddari E, Monteil M, Caillot P, Jalbert P, Sotto J J Non-Hodglun’s lymphoma with t(11;14)(q13;q32): A subset of mantle “/intermediate lymphocytic lymphoma? Br J Haematol77:346, 1991

16. Vandenberghe E, De Wolf-Peters C, van den Oord J, Wlo- darski I, Delabie J, Stul M, Thomas J, Michaux JL, Mecucci C, Cassiman JJ, van den Berghe H: Translocation (1 1; 14): A cytogenetic anomaly associated with B-cell lymphomas of non-follicle cen- tre cell lineage. J Path01 163:13, 1991

17. Mederios LJ, Van Krieken JH, Jaffe ES, Raffeld M: Associa- tion of bcl-1 rearrangements with lymphocytic lymphoma of intermediate differentiation. Blood 76:2086, 1990

18. Rimokh R, Berger F, Delsol G, Charrin C, Berth& M-F, Ffrench M, Garoscio M, Felman P, Coiffier B, Bryon P-A, Rochet M, Gentilhomme 0, Germain D, Magaud J-P Rearrangement and overexpression of the BCCIPRAD-I gene in intermediate lymphocytic lymphomas and in t(l lql3)-bearing leukemias. Blood 81:3063, 1993

19. Williams ME, Swerdlow SH, Rosenberg CL, Amold A Char- acterization of chromosome 11 translocation breakpoints at the bcl- 1 and PRADl loci in centrocytic lymphoma. Cancer Res 52:5541s, 1992 (suppl)

20. de Boer CJ, Loyson S, Kluin PM, Kluin-Nelemans HC, Schu- uring E, van Krieken JHJM: Multiple breakpoints within the bcl-1 locus in B-cell lympoma: Rearrangements of the cyclin D1 gene. Cancer Res 53:4148, 1993

21. Rimokh R, Berger F, Delsol G, Charrin C, Berth&, Ffrench M, Garoscio M, Felman P, Coiffier B, Bryon, P-A, Rochet M, Gentil- homme 0, Germain D, Magaud J-P: Rearrangement and overexpression of the BCL-1IPRAD-I gene in intermediate lymphocytic lymphomas and in t(llql3)-bearing leukemias. Blood 81:3063,1993

22. Rosenberg CL, Wong E, Petty EM, Bale AE, Tsujimoto Y, Hanis NL, Amold A: PRAD1, a candidate BCLl oncogene: Map- ping and expression in centrocytic lymphoma. Proc Natl Acad Sci USA 88:9638, 1991

23. Bosch F, Jares P, Camp E, Lopez-Guillermo A, Pins MA, Villamor N, Tassies D, Jaffe ES, Montserrat E, Rozman C, Cardesa A: PRAD-1ICyclin D1 gene overexpression in chronic lymphoproli- ferative disorderes: A highly specific marker of mantle cell lymphoma. Blood 84:1716, 1994

24. Oka K, Ohno T, Kita K, Yamaguchi M, Takakura N, Nishii K, Miwa H, Shirakawa S: PRADl gene over-expression in mantle- cell lymphoma but not in other low-grade B-cell lymphomas, including extranodal lymphoma. Br J Haematol 86:786, 1994

25. Yang W-I, Zukerberg LR, Motokura T, Arnold A, Hanis NL: Cyclin D1 (Bcl-1, PRAD1) protein expression in low-grade B-cell lymphomas and reactive hyperplasia. Am J Path01 145236,1994

26. de Boer CJ, van Krieken JHJM, Kluin-Nelemans HC, Kluin PM, Schuuring E: Cyclin D1 messenger RNA overexpression as a marker for mantle cell lymphoma. Oncogene 101833, 1995

27. Gaidano G, Ballerini P, Gong JZ, Inghirami G, Neri A, New- comb EW, Magrath IT, Knowles DM, Dalla-Favera R: p53 mutations in human lymphoid malignancies: Association with Burkitt lymphoma and chronic lymphocytic leukemia. Proc Natl Acad Sci USA 88:5413, 1991

28. Cesarman E, Inghirami G, Chadbum A, Knowles DM: High levels of p53 protein expression do not correlate with p53 gene mutations in anaplastic large cell lymphoma. Am J Path01 1435445, 1993

29. El Rouby S, Thomas A, Costin D, Rosenberg CR, Potmesil M, Silbex R, Newcomb EW: p53 gene mutation in B-cell chronic lymphocytic leukemia is associated with drug resistance and is independent of MDRlIMDR3 gene expression. Blood 82:3452, 1993

30. Bhatia KG, Gutikrrez MI, Huppi K, Siwarski D, Magrath IT: The pattern of p53 mutations in Burkitt’s lymphoma differs from that of solid tumors. Cancer Res 52:4273, 1992

31. Gutierrez MI, Bhatia K, Diez B, Muriel FS, Epelman S , DeAndreas ML, Huppi K, Magrath I: Prognostic significance of p53 mutations in small non-cleaved cell lymphomas. Int J Oncol 4:567, 1994

32. Cesarman E, Chadburn A, Inghirami G, Gaidano G, Knowles DM: Structural and functional analysis of oncogenes and tumor suppressor genes in adult T-cell leukemiaflymphoma shows frequent p53 mutations. Blood 803205, 1992

33. Sakashita A, Hattori T, Miller CW, Suzushima H, Asou N, Takatsuki K, Koeffler Hp: Mutations of the p53 gene in adult T- cell leukemia. Blood 79:477, 1992

34. Sander CA, Yano T, Clark HM, Harris C, Long0 DL, Jaffe ES, Raffeld M: p53 mutation is associated with progression in follicular lymphomas. Blood 82:1994, 1993

35. LoCoco F, Gaidano G, Louie DC, Offit K, Chaghti RSK, Dalla-Favera R p53 mutations are associated with histologic transformation of follicular lymphoma. Blood 82:2289, 1993

36. Diccianni MB, Yu J, Hsiao M, Mukherjee S , Shao L-E, Yu AL: Clinical significance of p53 mutations in relapsed T-cell acute lymphoblastic leukemia. Blood 843105, 1994

37. Wattel E, Preudhomme C, Hecquet B, Vanrumbeke M, Ques- ne1 B, Dervite I, Morel P, Fenaux P p53 mutations are associated with resistance to chemotherapy and short survival in hematologic malignancies. Blood M3148, 1994

38. Beck JS, Kwitek AE, Cogen PH, Metzger AK, Duyk GM, Sheffield VC: A denaturing gmhent gel electrophoresis assay for sensitive detection of p53 mutations. Hum Genet 91:25, 1993

39. Sambrook J, Fritsch EF, Maniatis T (eds): Molecular Cloning: A Laboratory Manual (ed 2). Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989

40. Myers RM, Maniatis T, Leman LS: Detection and localization of single base changes by denaturing gradient gel electrophoresis. Methods Enzymol 155:501, 1987

41. Greiner TC, Raffeld MR, Lutz C, Dick F, Jaffe ES: Analysis of T cell receptor-y gene rearrangements by denaturing gradient gel electrophoresis of GC-clamped PCR products: Correlation with tumor specific sequences. Am J Path01 136:46, 1995

42. Cheng J, Haas M: Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines. Mol Cell Biol 10:5502, 1990

43. Farrell PJ, Allan, GJ, Shanahan F, Vousden KH, Crook T: p53 is frequently mutated in Burkitt’s lymphoma cell lines. EMBO J 102879, 1991 44. Duthu A, Debuire B, Romano J, Ehrhart JC, Fiscella M, May

E, Appella E, May P p53 mutations in Raji cells: Characterization and localization relative to other Burkitt’s lymphomas. Oncogene 7:2161, 1992

45. Tenaud C, Negoescu A, Labat-Mobur F, Legros Y, Soussi T, Brambilla E: p53 immunolabeling in archival paraffin-embedded tissues: Optimal protocol based on microwave heating for eight anti- bodies on lung carcinomas. Mod Path01 72353, 1994 46. Kaplan GL, Meier P Nonparametric estimation from incom-

plete observations. J Am Stat Assoc 53:457, 1958 47. Pet0 R, Pike MC, Armitage P, Breslow NE, Cox DR, Howard

SV, Mantel N, McPherson K, Pet0 J, Smith PG: Design and analysis of randomized clinical trials requiring prolonged observation of each patient. II: Analysis and examples. Br J Cancer 35:1, 1977

48. Carbone D, Chiba I, Mitsudomi T: Polymorphism at codon 213 within the p53 gene. Oncogene 6:1691, 1991

49. Mazars G-R, Jeanteur P, Lynch HT, Lenoir G, Theillet C: Nucleotide sequence polymorphism in a hotspot mutation region of the p53 gene. Oncogene 7:781, 1992

50. Ichikawa A, Hotta T, Takagi N, Tsushita K, Kinoshita T,




4310 GREINER ET AL

Nagai H, Murakami Y, Hayashi K, Saito H: Mutations of p53 gene and their relation to disease progression in B-cell lymphoma. Blood 79:2701, 1992

5 1. Orita M, Suzuki Y, Sekiaya T, Hayashi K: Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5:874, 1989

52. Lerman LS, Silverstein K Computational simulation of DNA melting and its application to denaturing gradient gel electrophoresis. Methods Enzymol 155:482, 1987

53. Sheffield VC, Cox DR, Lerman LS, Myers RM: Attachment of a 40-base-pair G+C-rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes. Proc Natl Acad Sci USA 86:232, 1989

54. Abrams ES, Murdaugh SE, Lerman LS: Comprehensive detection of single base changes in human genomic DNA using denaturing gradient gel electrophoresis and a GC clamp. Genomics 7:463, 1990

55. Metzger AK, Sheffield VC, Duyk G, Daneshvar L, Edwards MSB, Cogen PH: Identification of a germ-line mutation in the p53 gene in a patient with an intracranial ependymoma. Proc Natl Acad Sci USA 88:7825, 1991

56. Fukuda 1, Ogawa K Detection of p.53 gene mutations in rat hepatocellular carcinoma cell lines by denaturing gradient gel electrophoresis. Mol Carcinog 7:257, 1993

57. Renault B, van den Broek M, Fodde R, Wijnen J, Pellegata NS, Amadori D, Khan PM, Ranzani GN: Base transitions are the most frequent genetic changes at p53 in gastric cancer. Cancer Res 53:2614, 1993

58. Van den Broek MH, Jhanwar SC, Fodde R, Chaganti RSK, Khan P M: p53 mutations in colorectal cancers in the patients of metropolitan New York. Anticancer Res 13:1769, 1993

59. Cazorla M, Hernandez L, Campo E, Peinado MA, Bosch F, Piris MA, Montserrat E, Cardesa A: p53 gene mutations in mantle cell lymphomas. Mod Pathol 8:107A, 1995 (abstr)

60. Finkelstein SD, Williams ME, Swerdlow SH: p53 mutations in centrocyticlmantle cell lymphoma (CCIMCL). Mod Pathol 8:llOA, 1995 (abstr)

61. Louie D, Jaslow R, Offit K, Parsa N, Chaganti R: Prognostic significance of p53 overexpression in non-Hodgkin’s lymphomas with t(11;14)(q13;q32). Mod Path01 8:115A, 1995 (abstr)

62. Zoldan MC, Inghirami G, Masuda Y, Vandekerckhove F, Frizzera G: Large cell variants of mantle cell lymphoma (MCL): Cytologic characteristics predict poor outcome. Mod Pathol8; 124A, 1995 (abstr)

63. Greiner TC, Moynihan MJ, Chan WC, Lytle DM, Weisen- burger DD: p53 mutations in mantle cell lymphoma. Mod Path01 8:l l lA. 1995 (abstr) 64. Louie DC, Offit K, Jaslow R, Parsa NZ, Muery VVVS,

Schluger A, Chaganti RSK: p53 overexpression as a marker of poor prognosis in mantle cell lymphomas with t(l1; 14)(q13;q32). Blood 86:2892, 1995

65. Norton AJ, Matthews J, Pappa V, Shamash J, Love S, Rohati- ner AZS, Lister TA: Mantle cell lymphoma: Natural history defined in a serially biopsied population over a 20-year period. Ann Oncol 6:249, 1995

66. Hartmann A, Rosanelli G, Blaszyk H, Cunningham JM, McGovern EM, Schroeder JJ, Schaid DJ, Kovach JS, Sommer SS: Novel pattem of p53 mutation in breast cancers from Austrian women. J Clin Invest 95:686, 1995

67. Adamson DJA, Dawson AA, Bennett B, King DJ, Haites NE: p53 mutation in the myelodysplastic syndromes. Br J Haematol 89:61, 1995

68. Mori N, Wada M, Yokota J, Terada M, Okada M, Teramura M, Masuda M, Hoshino S, Motoji T, Oshimi K, Mizoguchi H:

Mutations of the p53 tumour suppressor gene in haematologic neoplasms. Br J Haematol 81:235, 1992

69. Nakamura H, Said JW, Miller CW, Koeffler H P Mutation and protein expression of p53 in acquired immunodeficiency syndrome- related lymphomas. Blood 82:920, 1993

70. Nakai H, Misawa S , Tanaka S, Nishigalu H, Taniwaki M, Yokota S, Horiike S, Takashima T, Seriu T, Nakagawa H, Fuji H, Shimazaki C, Okada H, Toguchida J, Ishizaki K, Abe T, Kashima K: p53 gene mutations and loss of a chromosome 17p in Philadelphia chromosome (Ph’)-positive acute leukemia. Leukemia 10: 1547,1993

71. Feinstein E, Cimino G, Gale RP, Alimena G, Berthier R, Kishi K, Goldman J, Zaccaria A, Berrebi A, Canaani E p53 in chronic myelogenous leukemia in acute phase. Proc Natl Acad Sci USA 88:6293, 1991

72. Nishimura S, Asou N, Suzushima H, Okubo T, Fujimoto T, Osato M, Yamasaki H, Lisha L, Takatsuki K: p53 gene mutation and loss of heterozygosity are associated with increased risk of disease progression in adult T cell leukemia. Leukemia 9:598, 1995

73. Lai J-L, Pruedhomme C, Zandecki M, Flactif M, Vanrumbeke M, Lepelley P, Wattel E, Fenaux P Myelodysplastic syndromes and acute myeloid leukemia with 17p deletion. An entity characterized by specific dysgranulopoyeses and a high incidence of P53 mutations. Leukemia 9:370, 1995

74. Hsiao M, Low J, Dom E, Ku D, Pattengale P, Yeargin J, Haas M: Gain-of-function mutations of the p53 gene induce lympho- hematopoietic metastatic potential and tissue invasiveness. Am J Pathol 145:702, 1994

75. Newcomb EW: P53 gene mutations in lymphoid diseases and their possible relevance to drug resistance. Leuk Lymphoma 17:211, 1995

76. Ichikawa A, Hotta T, Takagi N, Tsushita K, Kinoshita T, Nagai H, Murakami Y, Hayashi K, Saito H: Mutations of p53 gene and their relation to disease progression in B-cell lymphoma. Blood 79:2701, 1992

77. Hunter T, Pines J: Cyclins and cancer II: Cyclin D and CDK inhibitors come of age. Cell 79:573, 1994

78. Cordon-Cardo C: Mutation of cell cycle regulators. Biological and clinical implications for human neoplasia. Am J Pathol 147545, 1995

79. Lukas J, Jadayel D, Bartikova J, Nucleva E, Dyer MJS, Strauss M, Bartek J: BCL-l/cyclin-Dl oncoprotein oscillates and subverts the G1 phase control in B-cell neoplasms canying the t( 11; 14) translocation. Oncogene 92159, 1994

80. Yano T, Jaffe ES, Longo DL, Raffeld M: MYC rearrangements in histologically progressed follicular lymphomas. Blood 80:758, 1992

81. Ye BH, Lista F, LoCoco F, Knowles DM, Offit K, Chaganti RSK, Dalla-Favera R: Alterations of a zinc finger-encoding gene, BCL-6, in diffuse large-cell lymphoma. Science 262:747, 1993

82. Bastard C, Deweindt C, Kerchaert JP, Lenormand B, Rossi A, Pezzella F, Fruchart C, Duval C, Monconduit M, Tilly H: LAZ3 rearrangements in non-Hodgkin’s lymphoma: Correlation with his- tology, immunophenotype, karyotype, and clinical outcome in 217 patients. Blood 83:2423, 1994

83. Otsuki T, Yano T, Clark HM, Bastard C, Kerckaert JP, Jaffe ES, Raffeld M: Analysis of LA23 (BCL-6) status in B-cell non- Hodgkin’s lymphomas: Results of rearrangement and gene expression studies and a mutational analysis of coding region sequences. Blood 85:2877, 1995

84. Villuendas R, Pins MA, Algara P, Shchez-Beato M, S h - chez-Verde L, Martinez JC, Orradre JL, Garcia P, Lopez C, Martinez P: The expression of p53 protein in non-Hodgkin’s lymphomas is not always dependent on p53 gene mutations. Blood 82:3151, 1993

85. Imamura J, Miyoshi I, Koeffler HP: p53 in hematologic malignancies. Blood 84:2412, 1994




cytology and predict a poor prognosis p53 mutations in mantle cell

Documents