cytoplasmic polyadenylation of activin receptor mrna and the control of pattern formation...

DEVELOPMENTAL BIOLOGY 179, 239–250 (1996)ARTICLE NO. 0254

Cytoplasmic Polyadenylation of Activin ReceptormRNA and the Control of Pattern Formationin Xenopus Development

Ruth Simon, Lin Wu, and Joel D. RichterWorcester Foundation for Biomedical Research, Shrewsbury, Massachusetts 01545

The activin receptor, a transmembrane serine–threonine kinase, is a key component necessary for pattern formation inearly Xenopus development. This protein interacts with members of the transforming growth factor b family and stimulatescells of the marginal zone to differentiate along the mesodermal pathway. In large part, this function of the activin receptorhas been inferred from observations of phenotypes induced by injected mRNA encoding wild-type or mutant forms of theprotein. Naturally occurring activin receptor mRNA is maternally inherited and contains within its 3* untranslated regionan embryonic-type cytoplasmic polyadenylation element (CPE), an oligouridylic acid sequence that promotes cytoplasmicpolyadenylation and resultant translational activation. Based on the presence of this element, we predicted in a previousreport that activin receptor mRNA expression in embryos might be regulated by cytoplasmic polyadenylation (Simon andRichter, Mol. Cell. Biol. 14, 7867–7875, 1994). In this study, we have tested this hypothesis and show that not only doendogenous and injected activin receptor mRNAs undergo cytoplasmic polyadenylation during embryogenesis, but alsothat this process is necessary for stimulating translation and inducing the morphological defects observed by mRNAoverexpression. The activin receptor CPE is bound by a Mr 36 1 103 protein in vitro, and competition for this factorbetween mRNAs in vivo inhibits activin receptor mRNA polyadenylation. This competition may be responsible for thelack of mesoderm formation observed in such injected embryos. These data suggest that cytoplasmic polyadenylationcontrols differentiation and pattern formation in early Xenopus development. q 1996 Academic Press, Inc.

Whitman and Melton, 1989; Kimelman et al., 1992; Slack,INTRODUCTION1993; Kessler and Melton, 1994).

Isolated animal caps from blastulae, which normally be-One of the earliest inductive interactions in Xenopus de- come epidermis, differentiate into mesoderm when incu-

velopment occurs between ectoderm and endoderm in the bated with various growth factors. This in vitro assay, information of mesoderm. Embryological experiments have combination with an in vivo analysis of structures formedshown that when animal and vegetal regions of a 32-cell following mRNA injection into eggs or embryos, has led tomorula are cultured in isolation, they properly differentiate the identification of several mesoderm-inducing factors. Forinto ectoderm and endoderm, respectively. Similar cultures example, fibroblast growth factor (FGF), which is mater-of the presumptive mesodermal cells of the marginal zone, nally inherited both as a protein and as a messenger RNAhowever, incorrectly produce epidermis. In contrast, mar- (Slack et al., 1987; Kimelman and Kirschner, 1987; Rosa etginal zone cells from a blastula that are cultured in isolation al., 1988) induces mesenchyme and muscle formation when

added to cultures of isolated animal caps (Kimelman et al.,differentiate into mesoderm, which indicates that progres-sive interactions between the ectoderm and endoderm are 1988; Slack and Isaacs, 1989). Members of the wnt family,

some of which are also maternally inherited (Ku and Mel-necessary for mesoderm formation (reviewed by Smith,1989). The essentials of this hypothesis were confirmed and ton, 1993), can influence mesodermal patterning depending

upon the member being tested in mRNA-injected embryosextended by Nieuwkoop (1969), who showed that animalpole cells placed in direct contact with the vegetal endo- (see Kimelman et al., 1992; Kessler and Melton, 1994).

Transforming growth factor b, (TGF b) superfamily mem-derm are induced to form mesoderm. Thus, the endodermproduces a mesoderm inducing signal(s) that is received and bers such as activin (Asashima et al., 1991; Klein and Mel-

ton, 1995) and Vg1 (Weeks and Melton, 1987), which areacted upon by the ectoderm (reviewed by Smith, 1989;

239

0012-1606/96 $18.00Copyright q 1996 by Academic Press, Inc.All rights of reproduction in any form reserved.

AID DB 8340 / 6x13$$$261 09-09-96 00:43:40 dba AP: Dev Bio

240 Simon, Wu, and Richter

from unfertilized eggs and 3-, 6-, and 12-hr embryos by phenolmaternally inherited, induce dorsal mesoderm when ap-and chloroform extraction (McGrew et al., 1989). One hundredplied to isolated animal caps as a protein or injected intomicrograms of RNA was ethanol precipitated twice and suspendedembryos as an mRNA (Thomsen and Melton, 1990; Greenin CSB buffer (25% formamide, 700 mM NaCl, 50 mM Tris–HCl,et al., 1992; Thomsen et al., 1993).pH 7.5, and 1 mM EDTA) at a concentration of 0.5 mg/ml.All of these agents are secreted ligands that interact with

The procedures for thermal elution have been outlined by Palat-receptors on the surface of responding cells. One receptor nik et al. (1979, 1984) and were followed here with only minorin particular, the activin receptor, is a key component for modifications. All binding, washing, and elutions were performedboth mesoderm (Kondo et al., 1991; Hemmati-Brivanlou in batch using a microfuge tube submersed in a water bath insteadand Melton, 1992; Mathews et al., 1992) and neural (Hem- of using a water-jacketed column. One-half gram of poly (U)–Sepha-

rose (Sigma) was swollen in 1 M NaCl and 5 mM Tris–HCl, pHmati-Brivanlou and Melton, 1994) induction. Although ac-7.5, washed extensively in EB buffer (90% formamide, 50 mMtivin receptor mRNA (two closely related species) is presentHepes, pH 7.5, 10 mM EDTA, and 0.2% SDS), and then equilibratedin oocytes, its 3* untranslated region (UTR) contains twoin CSB buffer. Before application to the matrix, RNA samples (50sequences that suggest it might be translationally activatedmg) were suspended in 1% SDS and 30 mM EDTA, heated to 707Cafter fertilization (Kondo et al., 1991; Hemmati-Brivanlou etfor 5 min, and then diluted fivefold in CSB buffer. The RNA wasal., 1992). These sequences are embryonic-type cytoplasmicthen mixed with the matrix (50 ml of gravity-packed beads) with

polyadenylation elements (CPEs), which promote cyto- constant inversion for 30 min at room temperature (257C). Theplasmic polyadenylation and resultant translational activa- beads were briefly centrifuged, the supernatant was removed, andtion (Simon et al., 1992; Simon and Richter, 1994). Based the beads washed three times with 1 ml each of LSB buffer (25%on the presence of a CPE, we predicted that the activin formamide, 0.1 M NaCl, 50 mM Tris–HCl, pH 7.5, and 10 mM

EDTA). The beads were then incubated in 0.3 ml LSB at 307C forreceptor mRNA, among others, would undergo cytoplasmic3 min and pelleted by brief centrifugation, and the supernatant waspolyadenylation in embryos and further suggested that thisremoved and saved for later analysis. The beads were washed threecould be an important process for development (Simon andtimes in LSB buffer as above, incubated at 357C for 3 min, andRichter, 1994). In this report, we show that not only doespelleted and saved. This same procedure was repeated for tempera-activin receptor mRNA indeed undergo cytoplasmic poly-tures up to 607C. After each elution, the RNA was diluted in water,adenylation, but that the cis elements controlling this eventphenol extracted, and ethanol precipitated following the addition

also stimulate translation of a reporter mRNA. We further of 2 mg of yeast tRNA.demonstrate that cytoplasmic polyadenylation is essential Polymerase chain reaction. One-tenth of each RNA samplefor producing the morphological defects that arise from eluted from the matrix was used for RT–PCR. Eleven microlitersmRNA overexpression. The CPE of activin receptor mRNA of water containing the RNA was mixed with oligo(dT)12–18 , heated

for 10 min at 707C, and then placed on ice. To this was added 4 mlis bound by the same Mr 36 1 103 protein in cell extractsof 51 reverse transcription buffer, 2 ml of 100 mM dithiothreitol,that interacts with other embryonic-type CPEs (Simon andand 1 ml of a solution containing 10 mM each of dTTP, dATP,Richter, 1994). In vivo competition studies indicate thatdCTP, and dGTP. This mix was incubated for 2 min at 377C, supple-this factor not only mediates activin receptor mRNA poly-mented with 1 ml of AMV reverse transcriptase, and incubated atadenylation, but also its ability to promote mesoderm for-377C for 1 hr. The RNA was then digested with RNase A (1 ml ofmation. These results demonstrate that cytoplasmic poly-a 1 mg/ml stock) for 2 min at 377C and the cDNA was extracted

adenylation is important for differentiation and pattern for- with phenol/chloroform and ethanol precipitated.mation in early Xenopus development. The PCR conditions were as follows. Five microliters of cDNA

was mixed with 2 ml of 10 mM dNTP mix, 1 ml each of 25 mMstocks of the two PCR oligonucleotides specific for the activinreceptor [5* GCTTGTGAATGTTCCGTGTGC (oligo 1) and 5*MATERIALS AND METHODSCGGGATCCCGGAGGGAGGTTAAAGTCTGC (oligo 2)], 5 ml of101 PCR buffer, 5 ml 0.1 M MgCl2, 1 ml a[32P]dATP, 34 ml water,

Detection of Endogenous Activin Receptor RNA and 1 ml Taq polymerase. A 102-nucleotide activin receptor cDNAPolyadenylation fragment was then amplified for 25 cycles. The products were cen-

trifuged twice through G-25 minicolumns and analyzed directly onIn vitro RNA synthesis and polyadenylation. A portion of the a 8% polyacrylamide/urea gel.

3* UTR of B4 RNA containing 69 nucleotides was synthesized invitro in the presence of [32P]UTP (Paris et al., 1991), extracted withphenol and chloroform, ethanol precipitated, and suspended in 20 Plasmid Constructionsml of 40 mM Tris–HCl, pH 8, 10 mM MgCl2, 2.5 mM MnCl2, 25mM NaCl, 250 mM ATP, 5 mg BSA, and 1 ml RNasin (Promega). A HincII fragment from activin receptor cDNA clone XAR7

(Kondo et al., 1991), containing the most distal 3* 356 nucleotidesAfter the addition of 5 units of Escherichia coli poly(A) polymerase(Pharmacia), the mixture was incubated at 377C and an aliquot of the 549-nucleotide 3* UTR, was inserted into the HincII site of

pBluescript (Stratagene). This insert contains two embryonic CPEswas removed every 10 min. The reactions were terminated by theaddition of 10 ml of 0.5 M EDTA. Following phenol/chloroform (clone 1). To construct a plasmid that lacks these CPEs, a 5* oligo-

nucleotide (5* CCAAGCTTGGCAAAGCATTTCATTTCAG, oligo 3)extraction, the RNA was either applied directly to a 8% polyacryl-amide/urea gel or suspended in CSB buffer (see below) and used for and a 3* oligonucleotide (oligo 2) were used in a PCR reaction with

the activin receptor cDNA as a template. The amplified productpoly(U)–Sepharose chromatography and thermal elution.RNA isolation and thermal elution. Total RNA was isolated was digested with HindIII and BamHI and cloned into the HindIII/

Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.


241Polyadenylation of Activin Receptor mRNA

BamHI site of pBluescript (clone 2). This construct was linearized Analysis of Markers for Mesoderm Formationwith BamHI while the original construct (clone 1) was linearized

RNA from injected embryos (amounts of RNA were the samewith EcoRI. Both DNAs were transcribed with T3 RNA polymer-as those mentioned above) was extracted by the SDS/PAS/phe-ase. The RNA containing the CPE was digested with RNase Hnol/chloroform method (McGrew et al., 1989). RT–PCR wasfollowing the addition of oligo(dT) to remove the poly(A) tail.used to detect xbra (Brachyury), muscle actin, and translationAnother clone (clone 3) was made that encodes a truncated ac-elongation factor 1a (EF-1a) mRNAs as described by Hemmati-tivin receptor. Clone XAR7 was digested with BglII, the internalBrivanlou and Melton (1994), who also list the PCR primers forfragment was removed, and the remaining portion was religated.actin and EF-1a that were used in this study as well. The primersWhen linearized with HindIII for in vitro transcription, the productused to detect xbra were 5*ACACAGTTCATAGCAGTGACCof this clone is an mRNA encoding a protein with only the amino-and 5*CGCAACGGGTGTCCATGTTGT (sequence reported byterminal 45 amino acids of the activin receptor.Smith et al., 1991).To construct chimeric DNAs containing luciferase and activin

receptor sequences, the coding region of luciferase (Promega) wasdigested with XbaI and HindIII and ligated into the XbaI and HindIIIsites of pBluescript (clone 4). To construct a chimeric molecule RESULTScontaining luciferase plus the activin receptor 3* UTR containingthe CPEs, the T3 primer plus oligo 2 (above) were used for a PCRamplification with clone 1 as the template. The amplified DNA Cytoplasmic Polyadenylation of Activinwas then digested with HincII and inserted into the blunt-ended Receptor mRNAXbaI site of clone 4. This new clone is designated clone 5. Clone

In a previous report (Simon and Richter, 1994), we noted4 was linearized with XbaI and clone 5 with BamHI. Both DNAswere transcribed with T3 RNA polymerase. Following egg injection that activin receptor mRNA contains two embryonic CPE-with these RNAs, extracts were prepared from developing embryos like sequences and suggested that these might control cyto-according to the manufacturer of the luciferase assay system (Pro- plasmic polyadenylation and translation. To examine en-mega) and analyzed in a luminometer (Packard). In addition, RNA dogenous activin receptor mRNA polyadenylation, we usedwas extracted from other developing embryos and was subjected to a variety of methods, including Northern blots (McGrew etNorthern blot analysis, where the probe was radiolabeled luciferase al., 1989), an RNase protection assay (Gebauer et al., 1994),DNA.

and a PCR-based poly(A) test (Salles et al., 1992); however,none of these proved to be adequate. Consequently, we em-ployed a method based on the thermal elution profile ofAnalysis of Cytoplasmic Polyadenylationpoly(A)-containing mRNA from poly(U)–Sepharose (Palat-and Phenotypesnik et al., 1984). We first examined the resolution with

Fertilized Xenopus eggs were injected with activin receptor 3* which this method could distinguish poly(A) tails of varyingUTRs containing or lacking the CPEs and assayed for cytoplasmic length. Accordingly, we added 30-, 45-, and 55-nucleotidepolyadenylation as described in Simon et al. (1992). Other fertilized poly(A) tails to a reporter (control) RNA in vitro (Fig. 1, topeggs were injected with water, full-length activin receptor mRNA left). These RNAs were then mixed, applied to a poly(U)–(XAR7 linearized with HindIII), activin receptor mRNA lacking the

Sepharose column, and eluted with increasing heat (Fig. 1,3* UTR (and hence the CPEs) (DNA linearized with HincII), or antop middle). Although all sizes of poly(A) appeared to eluteactivin receptor mRNA containing the CPEs but encoding only aat room temperature (257C), this may be due to incomplete45-aa protein. The resulting embryos were examined for severalwashing. At 30–357C, the 30-nucleotide poly(A) tail wasdays and photos were taken with an Olympus C-35AD 35-mm

camera using an Olympus SZH stereo research microscope with a the main species that eluted from the column. In the 40–DF plan 1.5X zoom objective. 507C temperature range, the 40- and 55-nucleotide poly(A)

tails were the major elution products. Finally, at 607C, onlythe 55-nucleotide poly(A) tail eluted from the poly(U)–

RNA Competitions in Vitro and in Vivo Sepharose. A summary of this elution profile is depicted inFig. 1 (top right). Although there is some overlap, for thecDNA clones containing the wild-type 3* UTR of Cl2 RNA, andmost part, there is a clear distinction between poly(A) tailmutant forms of the UTR that lack either a functional CPE orsize and thermal elution profile.polyadenylation hexanucleotide, have been described by Simon et

al. (1992) and were referred to in that paper as clones D1-454, D1- Following the establishment of the thermal elution proce-504, and D1-454, 536-559AAGAAA, respectively. RNA synthesis, dure, we prepared egg and 3-, 6-, and 12-hr embryo RNAsegg injection, the method for making cell extracts, and UV cross- and carried them through the precise binding and elutionlinking are all described in Simon et al. (1992) and Simon and regimen as described above (Fig. 1, bottom). Instead of dis-Richter (1994). In the particular assays used here, a UV crosslinking playing the RNAs on a gel directly, however, they were usedreaction consisted of 1-ml egg extract (original protein concentra- for RT–PCR with two oligonucleotides that are specifiction of 50 mg/ml), 5 ng of radiolabeled RNA, and, where indicated,

for the activin receptor. When starting with egg RNA, the50 or 500 ng of unlabeled RNA. For the RNA competition experi-predicted 102-nucleotide product was amplified mostlyments in vivo, each egg was injected with 0.25 ng of radiolabeledfrom material that eluted at 30–357C. In the 3-hr embryoactivin receptor 3* UTR RNA and, where indicated, 25 or 125 ngRNA, this product was amplified mostly from the 30–457Cof unlabeled Cl2 3* UTR RNA. The injection volume was about

10 nl. fractions, indicating a lengthening poly(A) tail. In the 6-hr




FIG. 1. Polyadenylation of activin receptor mRNA. Denaturing polyacrylamide gel electrophoresis and autoradiography of a 32P-labeled69-nucleotide control RNA that was used as a substrate for in vitro polyadenylation by E. coli poly(A) polymerase, which added tails of30, 40, and 55 nucleotides (top left). These RNAs were mixed, bound to poly(U)–Sepharose, and eluted with increasing heat (top middle).A summary of this elution profile is at the top right. Having determined the resolution of the thermal elution procedure, RNA from eggsand 3-, 6-, and 12-hr embryos was applied to poly(U)–Sepharose and eluted under identical conditions as the control RNA. RT–PCR inthe presence of [32P]dATP and denaturing polyacrylamide gel electrophoresis and autoradiography were then used to determine the thermalelution profile of activin receptor RNA (bottom). The amplified product was 102 nucleotides.

embryo RNA, the amplified product was detected in all contiguous uridine residues, which we surmise act as theCPEs of this RNA. To test this, we injected fertilized eggsfractions and even in the material eluting at 55 and 607C.

Finally, when using 12-hr embryo RNA, very little of the with two different RNAs, one containing nearly the entire 3*UTR, which includes both putative CPEs, and one that hadproduct was amplified from the 30–407C fractions, but was

clearly evident in the 45–607C fractions (Fig. 1, bottom). A these sequences deleted. RNA was then extracted from devel-oping embryos and analyzed for cytoplasmic polyadenylationcomparison of these elution profiles with those of poly(A)

of defined size indicates that activin receptor RNA in the (Fig. 2). As expected, the wild-type 3* UTR underwent polyade-nylation beginning at 3 hr and continuing up to 9 hr postfertil-egg has a poly(A) tail of about 30 nucleotides that lengthens

progressively during embryogenesis until it reaches a maxi- ization, which is a profile virtually indistinguishable fromthose observed with injected Cl1 and Cl2 RNAs, the prototyp-mum of 45 to 60 nucleotides. Although such molecules in

the 12-hr embryo likely represent both maternal and zygotic ical embryonically polyadenylated RNAs (Simon et al., 1992;Simon and Richter, 1994). In addition, this poly(A) tail length,transcripts, these data do show that activin receptor mRNA

undergoes cytoplasmic poly(A) elongation, which is espe- about 80 nucleotides, is similar to that acquired by endoge-nous activin receptor mRNA (Fig. 1). However, the RNA lack-cially evident at 3 and 6 hr postfertilization where there is

no zygotic transcription. We also show this same phenome- ing the CPEs did not undergo polyadenylation and was evenpartially degraded at 9 hr postfertilization. Whether the lack ofnon in injected embryos (see below).

A minimum of 12 uridine residues is necessary to promote a poly(A) tail at this time was responsible for the degradation isunclear. Nonetheless, these data show that two CPEs in thecytoplasmic polyadenylation in Xenopus embryos (Simon et

al., 1992; Simon and Richter, 1994). Within the 3* UTR of the activin receptor 3* UTR promote cytoplasmic polyadenyla-tion.activin receptor mRNA are two regions that each contain 14




FIG. 2. Cytoplasmic polyadenylation of injected activin receptor 3* UTR. A radiolabeled activin receptor 3* UTR, containing the CPEand AAUAAA polyadenylation signals, was injected into fertilized eggs; total RNA was later extracted from developing embryos. TheRNA was then analyzed by denaturing polyacrylamide gel electrophoresis and autoradiography. A similar RNA that lacked the CPEs wasinjected and analyzed as above.

Translational Control by Cytoplasmic ing the CPEs, or an activin receptor mRNA containing bothPolyadenylation CPEs, and the resulting embryos were examined for mor-

phological defects several days later. Figure 4 (top) shows aHaving established that the activin receptor 3* UTR un-number of these embryos 2 days after injection. Under lowdergoes polyadenylation, we wanted to determine whethermagnification, it is clear that embryos injected with waterthis would result in translational activation. To this end, we(Fig. 4a) or an activin receptor mRNA lacking the CPEs (Fig.injected fertilized eggs with luciferase RNA or a modified4b) are indistinguishable and appear normal. The embryosluciferase RNA that contained the activin receptor 3* UTR.that received an activin receptor mRNA containing bothExtracts from developing embryos were then tested for lu-CPEs, however, are obviously abnormally small and some-ciferase activity. Figure 3 shows that although there waswhat rounded (Fig. 4c). Under higher magnification, water-some accumulation of luciferase activity during the courseinjected embryos appear normal (Fig. 4d), whereas activinof the experiment when the luciferase mRNA was injected,receptor mRNA (plus the CPEs)-injected embryos clearlyby 12 hr there was nearly 10-fold greater activity when thelack posterior structures (Fig. 4e), similar to what was ob-injected mRNA contained the activin receptor 3* UTR.served by Kondo et al. (1991) or, in a few cases, have otherThus, activin receptor mRNA 3* UTR-mediated cyto-gross abnormalities (Fig. 4f).plasmic polyadenylation stimulates translation during em-

To more fully explore the morphological defects inducedbryogenesis. We also note that in these experiments, as wellby the activin receptor, we have performed a number ofas those that follow, all injected RNAs have about the sameadditional injection experiments, which are summarized instability (Fig. 3, inset).Table 1. Injection of 50 or 100 ng/ml of activin receptormRNA lacking the CPEs had little effect on embryonic de-

Cytoplasmic Polyadenylation and Pattern velopment. Only when RNA was injected at a concentra-Formation tion of 200 ng/ml were some defects observed that were

similar to those depicted in Fig. 4. In contrast, the injectionOverexpression of different activin receptor mRNAs canof activin receptor mRNA containing the CPEs inducedinduce phenotypes such as the truncation of posterior struc-clear defects in patterning at 50 ng/ml, which increased dra-tures (Kondo et al., 1991), a bifurcated axis (Mathews et al.,matically at 100 ng/ml. At 200 ng/ml, all the injected em-1992), or ectopic dorsal axial structures (Hemmati-Brivan-bryos had morphological defects.lou et al., 1992). Moreover, expression of a truncated activin

To be certain that the defects in patterning were not duereceptor, which acts as a dominant negative mutation, canto polyadenylation per se, we injected an additional mRNAinduce aberrant neural structures (Hemmati-Brivanlou andthat, although containing both CPEs, would encode onlyMelton, 1994). To determine whether the overexpressionthe amino-terminal 45 amino acids of the activin receptorphenotype induced by injected activin receptor RNA could(Table 1). This would be too small to act as a dominantbe controlled by cytoplasmic polyadenylation, we per-negative mutation. This RNA had no effect on embryogene-formed the following initial experiment. Fertilized eggs

were injected with water, an activin receptor mRNA lack- sis even when injected at a concentration as high as 200




FIG. 3. The 3* UTR of activin receptor mRNA stimulates translation. The 3* UTR of activin receptor mRNA was appended to the codingsequence of luciferase mRNA and injected into fertilized eggs. Extracts were then prepared from developing embryos and examined forluciferase activity. For comparison, luciferase mRNA lacking the activin receptor 3* UTR was also injected and extracts from developingembryos were analyzed as above. The inset shows a Northern blot analysis of these same injected RNAs from developing embryos.

ng/ml. Also, as mentioned earlier, these RNAs have nearly egg extracts. Figure 5A shows that the signals for both pro-teins were significantly diminished, indicating a competi-the same stability in injected embryos (data not shown).

Taken together, these data show that cytoplasmic polyade- tion for binding between the RNAs. Identical experimentswere then performed with a Cl2 RNA containing the CPEnylation regulates the overexpression phenotype induced

by injected activin receptor mRNA. By extension, we infer but lacking the AAUAAA hexanucleotide (C/H0) and a Cl2RNA lacking the CPE but containing the hexanucleotidethat the critical role played by the activin receptor in embry-

onic patterning is controlled at the translational level by (C0H/). Only the Cl2 RNA containing the CPE competedwith the activin receptor RNA for the binding of the Mr 36cytoplasmic polyadenylation.and 45 1 103 proteins. Thus, these two proteins interactspecifically with the activin receptor CPE.

Identification of Activin Receptor Because a number of nuclear RNA-binding proteins haveCPE-Binding Proteins an avidity for polypyrimidine, we wanted to determine

whether the proteins noted above were indeed cytoplasmic.The embryonic-type CPE, oligouridine, of Cl1 and Cl2Accordingly, extracts from enucleated oocytes (cytoplasm)RNAs is bound by Mr 36 and 45 1 103 proteins that areas well as eggs were used for UV crosslinking. Figure 5Bpresent in eggs as well as embryos (Simon and Richter,shows that although egg extracts primed with either Cl2 or1994). To determine whether these same proteins also bindactivin receptor RNA UV crosslinked to the two proteins,the activin receptor CPE, a series of UV crosslinking experi-only the Mr 36 1 103 protein crosslinked to the RNAs inments was performed. Radiolabeled activin receptor 3* UTRthe cytoplasmic extract. We therefore conclude that the Mrcontaining the oligouridine regions described in Fig. 2, as45 1 103 protein is nuclear and that it is the Mr 36 1 103

well as Cl2 3* UTR, were added to egg extracts that wereprotein that is most likely involved in cytoplasmic polyade-irradiated with UV light. This was followed by RNase treat-nylation (see also Simon and Richter, 1994).ment and SDS–polyacrylamide gel electrophoresis and au-

toradiography (Fig. 5A). Two prominent proteins with sizesof Mr 36 and 45 1 103 were photocrosslinked to the RNAs. In Vivo Competition for CPE-Binding ProteinsTo assess whether these proteins bound specifically to theactivin receptor CPE, a series of RNA competitions was Based on preliminary protein purification results, we sus-

pected that the Mr 36 1 103 protein noted above was muchperformed. Radiolabeled activin receptor 3* UTR was mixedwith unlabeled wild-type Cl2 3* UTR (C/H/) in 10- and 100- lower in abundance than CPEB, a protein that interacts with

the UUUUUUAU maturation-type CPE. In that case, therefold molar excess, which was then crosslinked to protein in




FIG. 4. The overexpression phenotype induced by injected wild-type activin receptor mRNA is abolished by deletion of the CPEs.Fertilized eggs were injected with water (a), activin receptor mRNA that lacked the CPEs (b), or activin receptor mRNA that containedthe CPEs (c) and the resulting embryos were examined 2.5 days later. Embryos derived from injected eggs were also examined 5 dayspostinjection (d, water injected; e and f, CPE-containing activin receptor mRNA injected).

is about 1 ng of CPEB per oocyte (Hake and Richter, 1994). the CPE but containing the hexanucleotide (C0H/) had noeffect irrespective of the amount injected. Thus, there ap-We have exploited the relative paucity of the Mr 36 1 103

protein and performed two sets of RNA competition experi- pears to be an in vivo competition for the factor that inter-acts with the CPE, which, considering the results presentedments to assess whether it could be important for the poly-

adenylation and expression of activin receptor mRNA. First, in Fig. 5, is likely to be the Mr 36 1 103 protein.Because injected Cl2 3* UTR is a trans inhibitor of activinradiolabeled activin receptor 3* UTR was mixed with a 100-

or 500-molar excess of wild-type Cl2 3* UTR or Cl2 3* UTRs receptor RNA polyadenylation (even stronger than the ac-tivin receptor 3* UTR itself), we wondered whether it couldlacking either a CPE or a polyadenylation hexanucleotide

and injected into fertilized eggs. Nine hours later, RNA was also inhibit endogenous activin receptor RNA polyadenyla-tion and yield, in effect, a null activin receptor phenotype.extracted and the extent of polyadenylation of activin recep-

tor RNA was determined. Figure 6 shows that although Although such a null phenotype has not been produced ge-netically in Xenopus, it might be similar to that whichactivin receptor 3* UTR alone was polyadenylated, when

the RNA was mixed with a 500-fold molar excess of wild- occurs when a dominant negative form of the activin recep-tor is expressed. Those phenotypes include an inhibitiontype Cl2 3* UTR (C/H/) prior to injection, polyadenylation

was dramatically inhibited. Similarly, Cl2 RNA containing of mesoderm formation (Hemmati-Brivanlou and Melton,1992) and aberrant neuralization (Hemmati-Brivanlou andthe CPE but lacking the hexanucleotide (C/H0) also almost

completely abrogated activin receptor RNA polyadenyla- Melton, 1994). We have chosen to examine mesoderm for-mation that is manifested by the expression of the specifiction at a 500-fold molar excess. However, Cl2 RNA lacking




TABLE 1Production of Phenotypes Following Activin Receptor mRNA Injection

Morphological defects ofsurvivors

RNA concentrationInjection (ng/ml) Total injected Total surviving Number Percentage

None — 104 97 0 0Water — 25 22 0 0RNA 0 CPE 50 30 17 0 0RNA / CPE 50 30 25 3 12RNA / CPE (45-aa protein) 50 30 23 0 0RNA 0 CPE 100 132 97 6 6RNA / CPE 100 121 94 77 82RNA / CPE (45-aa protein) 100 40 31 0 0RNA 0 CPE 200 40 38 4 11RNA / CPE 200 40 39 39 100RNA / CPE (45-aa protein) 200 40 35 0 0

molecular markers muscle actin (Gurdon et al., 1985; Hem- UTR (C/H/), the same amount necessary to observe a sub-stantial decrease in injected activin receptor RNA polyade-mati-Brivanlou and Melton, 1992) and brachyury (xbra)

(Smith et al., 1991). nylation, produced no diminution of EF-1a RNA, but sig-nificantly lowered xbra and muscle actin RNA levels (Fig.Wild-type and mutant Cl2 3* UTRs were injected into fer-

tilized eggs that were allowed to develop until their nonin- 7). Similarly, the injection of Cl2 3* UTR containing onlythe CPE (C/H0) had no effect on EF-1a RNA but decreasedjected siblings reached the gastrula stage (stage 13); at such

time the two RNAs noted above should be synthesized (Gur- xbra and muscle actin RNA levels. Finally, a Cl2 3* UTRlacking the CPE (C0H/) had no effect on any of the test RNAsdon et al., 1985; Hemmati-Brivanlou and Melton, 1992). To-

tal RNA was then extracted, treated with DNase I, reverse compared to when no Cl2 RNA was injected. As a negativecontrol, the RT step, when eliminated, produced no detect-transcribed with oligo(dT) as the primer, and annealed with

specific oligonucleotides to detect muscle actin, xbra, or as able amplification product (data not shown).A summary of three separate experiments identical toa positive control, EF-1a, by PCR (Hemmati-Brivanlou and

Melton, 1994). The injection of 125 ng of wild-type Cl2 3* that described above is presented in Table 2. For conve-

FIG. 5. Competition for CPE binding proteins in vitro. (A) Egg extracts were primed with radiolabeled Cl2 or activin receptor (ActR)RNAs, some of which also contained a 10- or 100-fold molar excess of unlabeled Cl2 RNAs that contained both the CPE and hexanucleotide(C/H/), the CPE only (C/H0), or the hexanucleotide only (C0H/). This was followed by UV irradiation, RNase digestion, and SDS–polyacrylamide gel electrophoresis and autoradiography. The relevant proteins of Mr 36 and 45 1 103 are denoted. (B) Egg and enucleatedoocyte (i.e., cytoplasmic) extracts were primed with radiolabeled Cl2 or activin receptor RNAs and then UV crosslinked and analyzed asin A.




TABLE 2Analysis of the Relative Levels of EF-1a, Muscle Actin, and xbraRNAs in Embryos

cis element content ofinjected Cl2 3* UTR

No injection C/H/ C/H0 C0H/

Expt. 1EF-1a 100 100 103 99Muscle actin 100 3 4 105xbra 100 1 5 99

Expt. 2EF-1a 100 98 100 101Muscle actin 100 2 6 98xbra 100 7 24 95

Expt. 3FIG. 6. Polyadenylation competition in vivo. Radiolabeled activin EF-1a 100 100 100 99receptor RNA, sometimes mixed with a 100- or 500-fold molar Muscle actin 100 11 28 96excess of unlabeled Cl2 RNA containing both cis regulatory ele- xbra 100 8 16 100ments (C/H/), the CPE only (C/H0), or the hexanucleotide only(C0H/), was injected into fertilized eggs. After an incubation of 0 Note. Values are relative to the amount of RNA present in nonin-or 9 hr, the RNA was extracted and analyzed for polyadenylation jected embryos, which is arbitrarily set at 100.by urea/polyacrylamide gel electrophoresis and autoradiography.

was injected. However, cardiac actin and xbra RNAs werealways substantially depressed when a Cl2 3* UTR con-nience, the relative amount of the specific RNA present intaining the CPE was injected (C/H/ or C/H0), but not whenuninjected embryos is arbitrarily set at 100. In all cases, EF-it was absent (C0H/). We thus conclude that the Cl2 CPE1a RNA levels were constant irrespective of the RNA thatinhibits mesoderm formation, probably by competing withactivin receptor mRNA for the Mr 36 1 103 CPE-bindingprotein that controls polyadenylation and translation.

DISCUSSION

In this report, we have investigated the importance ofcytoplasmic polyadenylation in pattern formation in Xeno-pus embryogenesis by focusing on activin receptor mRNA.This message, which contains a CPE and hexanucleotide,must be correctly expressed in embryos if mesoderm is toform (Hemmati-Brivanlou and Melton, 1992, 1994; Ma-thews et al., 1992). Activin receptor mRNA not only under-goes cytoplasmic polyadenylation in embryos, but the 3*UTR, when appended to a reporter RNA, also drives transla-tion following injection into fertilized eggs. Moreover, aphenotype produced by injected activin receptor mRNA,the truncation of posterior structures, can be eliminated bydeleting the CPEs of this RNA. A Mr 36 1 103 protein binds

FIG. 7. Mesoderm formation is inhibited by a CPE-containing the activin receptor CPE in vitro, which is the same oneRNA. Approximately 10 nl of solution containing 125 ng of wild- that interacts with the CPE of Cl1 and Cl2 RNAs (Simontype Cl2 3* UTR RNA (C/H/), a Cl2 3* UTR containing only the and Richter, 1994). The competition for this protein in vivoCPE (C/H0), or a Cl2 3* UTR containing only the hexanucleotide between injected Cl2 and activin receptor mRNA probably(C0H/) was injected into fertilized eggs that were allowed to de-

inhibits the latter from being polyadenylated. Finally, com-velop to a time when their noninjected siblings had reached thepetition for the binding of this protein between injectedgastrula stage. Total RNA was then extracted and used for RT–Cl2 RNA and endogenous activin receptor mRNA disruptsPCR in the presence of [32P]dATP to detect EF-1a, muscle actin,mesoderm formation as assessed by the inhibition of muscleand brachyury (xbra) RNA sequences. The products were resolved

by polyacrylamide gel electrophoresis and autoradiography. actin and xbra mRNA synthesis. Taken together, these data




point to the importance of cytoplasmic polyadenylation in vitro. Thus, this CPE-binding protein is the factor that mostlikely is rate-limiting for polyadenylation in embryos. Wedifferentiation and pattern formation.

The Xenopus activin receptor RNA we chose to study have taken advantage of the paucity of this factor and haveproduced, in essence, an activin receptor null mutation byhere, XAR-7 (Kondo et al., 1991), contains the typical oli-

gouridine CPE that drives cytoplasmic polyadenylation and injecting a saturating amount of CPE-containing Cl2 3*UTR. The manifestation of this injection is an inability oftranslation in embryos (Simon et al., 1992; Simon and Rich-

ter, 1994). Another activin receptor RNA, XAR1, might also the embryos to synthesize significant amounts of muscleactin or brachyury RNA or to form mesoderm. Such em-be polyadenylated during embryogenesis because its 3* UTR

contains the sequence U3AU10CU12 (Hemmati-Brivanlou et bryos generally are amorphous in appearance (data notshown). It should also be borne in mind, however, that sev-al., 1992). This is likely because dodecauridine can support

polyadenylation of Cl2 RNA (Simon et al., 1992). In addi- eral other RNAs that normally are under polyadenylationcontrol would not be polyadenylated or translated when ation, a number of other RNAs that contain CPE-like se-

quences in their 3* UTRs, such as fibronectin, xotch, and large amount of Cl2 3* UTR is injected. Thus, the phenotypewe observed may be more severe than a single knockout ofpossibly xwnt 11 (summarized in Simon and Richter, 1994)

may also be regulated by cytoplasmic polyadenylation. the activin receptor mRNA.In addition to Xenopus, cytoplasmic polyadenylation alsoHowever, this process is clearly only one of several different

translational control mechanisms that operate in embryos controls pattern formation in Drosophila. For example, bi-coid mRNA, which is localized to the anterior pole of the(reviewed in Curtis et al., 1995; Osborne and Richter, 1996).

For example, activin mRNA contains an inhibitory se- oocyte, encodes a protein that has an essential role in theformation of structures of that region of the embryo (i.e.,quence in its 3* UTR that prevents precocious translation

(Klein and Melton, 1995), which also appears to be the case head and thorax). An abnormal bicoid phenotype can berescued if embryos are injected with bicoid mRNA thatwith FGF mRNA (Robbie et al., 1995). Indeed, this theme

of negative regulation (i.e., inhibitory cis elements) also is contains its normal 3* UTR, which includes the polyadenyl-ation-inducing cis signals. In the absence of the 3* UTR,important for the timed expression of Cl1 and Cl2 RNAs.

They contain, in addition to the CPE and polyadenylation neither polyadenylation nor rescue occurs (Salles et al.,1994). Another Drosophila protein that affects embryonichexanucleotide, polyadenylation inhibitory elements that

prevent inappropriate mRNA expression during oocyte mat- patterning may be a part of the polyadenylation complex.Flies that are mutant for orb produce abnormal egg cham-uration (Simon et al., 1992; Simon and Richter, 1994). Be-

cause these inhibitory elements are relatively large, they bers and aberrant anterior–posterior and dorsal–ventralaxes (Christersen and McKearin, 1993; Lantz et al., 1992).may form a secondary structure that is necessary for biologi-

cal activity. Activin receptor mRNA might have a similar Orb is an RNA binding protein with homology to CPEB, aCPE-binding protein that controls cytoplasmic polyadenyla-inhibitory element because it is not polyadenylated during

oocyte maturation (unpublished observation). tion in maturing Xenopus oocytes (Hake and Richter, 1994).In flies, orb could have a function similar to CPEB, whichOur experiments show that the truncation of posterior

structures produced in Xenopus embryos following activin is to recognize the regulatory cis element in mRNAs andpromote polyadenylation and translation.receptor mRNA injection is controlled by the cytoplasmic

polyadenylation of this message. Importantly, the injection These and other studies have provided some details con-cerning the molecular biology of cytoplasmic polyadenyla-of a polyadenylation-competent activin receptor mRNA en-

coding only a 45-amino-acid protein, which is probably too tion, which is apt to be a major regulator of maternal mRNAtranslation in all metazoans (reviewed by Richter, 1995).small to act as a dominant negative inhibitor, produces no

aberrant phenotype. Thus, in this case where only a small Although differences exist among the animal groups, theessentials of the phenomenon are these. A number ofamount of message is injected (2 ng or less), synthesis of

functional protein, but not polyadenylation per se, is re- mRNAs that are translationally dormant in oocytes containrelatively short tracts of 3* poly(A), usually fewer than 20–sponsible for the abnormal pattern formation we observed

(also, see below). 50 nucleotides. During oocyte maturation or early em-bryogenesis, specific mRNAs that contain a CPE and AAU-The injection of a large amount (125 ng) of Cl2 3* UTR

into eggs together with a trace amount of activin receptor AAA hexanucleotide undergo poly(A) extension up to 60–150 nucleotides or more and, as a result, are translationally3* UTR produces an obvious competition for components

of the polyadenylation apparatus as evidenced by decreased activated (McGrew et al., 1989; Vassalli et al., 1989; Parisand Richter, 1990; Huarte et al., 1992; Simon et al., 1992;polyadenylation. Because this competition occurs only

when Cl2 RNA contains an intact CPE, the rate-limiting Gebauer et al., 1994; Sheets et al., 1994; Stebbins-Boaz andRichter, 1994). Although the oligouridine CPE controlsfactor is likely to be a CPE-binding protein (we should note

that all injected Cl2 3* UTRs, irrespective of their precise polyadenylation in embryos (Simon et al., 1992; Simon andRichter, 1994; this study), the sequence UUUUUUAU (orsequence, have about the same stability, Simon et al., 1992).

This is underscored by the fact that this competition for a close variant) is important for polyadenylation during oo-cyte maturation (McGrew et al., 1989; Fox et al., 1989;polyadenylation in vivo closely parallels the competition

among RNAs for the Mr 36 1 103 CPE-binding protein in Huarte et al., 1992; Salles et al., 1992; Gebauer et al., 1994).




polyadenylation factors recognize cytoplasmic polyadenylationAside from poly(A) polymerase (Gebauer and Richter, 1994;elements. Genes Dev. 8, 1106–1116.Ballantyne et al., 1995), several factors that regulate polyad-

Christersen, L. B., and McKearin, D. M. (1994). orb is required forenylation have been identified (Paris et al., 1991; Simon etanterioposterior and dorsoventral patterning during Drosophilaal., 1992; Simon and Richter, 1994; Bilger et al., 1994; thisoogenesis. Genes Dev. 8, 614–628.study), but so far only CPEB has been cloned and character-

Curtis, D., Lehman, R., and Zamore, P. D. (1995). Translationalized (Hake and Richter, 1994; Stebbins-Boaz et al., 1996).regulation in development. Cell 81, 171–178.

Although the precise mechanism by which polyadenylationFox, C. A., Sheets, M. D., and Wickens, M. (1989). Poly(A) addition

induces translation is unclear, it may do so by promoting during oocyte maturation of frog oocytes: Distinct nuclear and5* cap ribose methylation, which could offer a competitive cytoplasmic activities and regulation by the sequence UUU-translational advantage for the mRNAs modified in such a UUAU. Genes Dev. 4, 2287–2298.manner (Kuge and Richter, 1995). Gebauer, F., Xu, W., Cooper, G. M., and Richter, J. D. (1994). Trans-

It is this latter observation that could help explain why lational control by cytoplasmic polyadenylation of c-mos mRNAactivin receptor mRNA, which acquires only an additional is necessary for oocyte maturation in the mouse. EMBO J. 13,

5712–5720.30 adenosine residues or so, is translationally activated. CapGebauer, F., and Richter, J. D. (1994). Cloning and characterizationribose methylation, which so far has been examined exclu-

of a Xenopus poly(A) polymerase. Mol. Cell. Biol. 15, 1422–1430.sively in injected Xenopus oocytes, occurs only whenGreen, J. B. A., New, H. V., and Smith, J. C. (1992). Responses ofmRNAs are undergoing active poly(A) addition during mat-

embryonic Xenopus cells to activin and FGF are separated byuration. It may be that for activin receptor RNA, like Cl2multiple dose thresholds and correspond to distinct axes of theRNA (Simon et al., 1992), the process of polyadenylation,mesoderm. Cell 71, 731–739.and not the final length of the poly(A) tail, is important for

Gurdon, J. B., Fairman, S., Mohun, T. J., and Brennan, S. (1985).translational activation. This is presently under investiga-Activation of muscle-specific-actin genes in Xenopus develop-

tion. ment by an induction between animal and vegetal cells. Cell 41,While the relative paucity of the Mr 361 103 CPE-binding 913–922.

protein described in this study has made in vivo competi- Hake, L. E., and Richter, J. D. (1994). CPEB is a specificity factortion analysis possible, it also makes its isolation and cloning that mediates cytoplasmic polyadenylation during Xenopus oo-a significant challenge. Nonetheless, our hope is that pro- cyte maturation. Cell 79, 617–627.tein purification by RNA affinity chromatography, which Hemmati-Brivanlou, A., and Melton, D. A. (1992). A truncated ac-has proven to be successful in the past (Hake and Richter, tivin receptor dominantly inhibits mesoderm induction and for-

mation of axial structures in Xenopus embryos. Nature 359, 609–1994), will also be useful in this case as we attempt to clone614.and characterize this protein.

Hemmati-Brivanlou, A., and Melton, D. A. (1994). Inhibition ofactivin receptor signaling promotes neuralization in Xenopus.Cell 77, 273–281.ACKNOWLEDGMENTS

Hemmati-Brivanlou, A., Wright, D. A., and Melton, D. A. (1992).Embryonic expression and functional analysis of a Xenopus ac-

We thank K. Shiokawa for the activin receptor cDNA clone, tivin receptor. Dev. Dyn. 194, 1–11.D. Kilpatrick for the luciferase cDNA clone, E. Rappaport and P. Huarte, J. A., Stutz, A., O’Connell, M. L., Gubler, P., Belin, D.,Zamecnik for use of their luminometer, G. Sluder for the use of Darrow, A. L., and Strickland, S. (1992). Transient translationalhis microscope and camera, and L. Lorenz and members of our silencing by reversible mRNA deadenylation. Cell 69, 1021–laboratory for comments on the manuscript. L.W. was supported 1030.in part by an institutional NIH postdoctoral training grant Kessler, D. S., and Melton, D. A. (1994). Vertebrate embryonic in-(HD07312) and an individual National Research Service Award duction: Mesodermal and neural patterning. Science 266, 596–(GM17932). This work was funded by grants from the NIH 604.(GM46779 and CA40189) and the March of Dimes Birth Defects Kimelman, D., Christian, J. L., and Moon, R. T. (1992). SynergisticFoundation (to J.D.R.). principles of development: Overlapping patterning systems in

Xenopus mesoderm induction. Development 116, 1–9.Kimelman, D., Abraham, J. A., Haaparanta, T., Palisi, T. M., and

REFERENCES Kirschner, M. (1988). The presence of FGF in the frog egg: Itsrole as a natural inducer of mesoderm. Science 242, 1053–1056.

Kimelman, D., and Kirschner, M. (1988). Synergistic induction ofAsashima, M., Nakano, H., Uchiyama, H., Sugina, H., Nakamura,mesoderm by FGF and TGF-b and the identification of an mRNAT., Eto, Y., Ejia, D., Nishimatsu, S. I., Ueno, N., and Kinoshita,coding for FGF in the early Xenopus embryo. Cell 51, 869–877.K. (1991). Presence of activin (erythroid differentiation factor) in

Klein, P. S., and Melton, D. A. (1995). Translational control ofunfertilized eggs and blastulae of Xenopus laevis. Proc. Natl.activin in Xenopus laevis embryos. Dev. Genet. 17, 55–64.Acad. Sci. USA 88, 6511–6514.

Kondo, M., Tashiro, K., Fujii, G., Asano, M., Miyoshi, R., Yamada,Ballantyne, S., Bilger, A., Anstrom, J., Virtanen, A., and Wickens,R., Muramatsu, M., and Shiokawa, K. (1991). Activin receptorM. (1995). Poly(A) polymerase in the nucleus and cytoplasm ofmRNA is expressed early in Xenopus embryogenesis and thefrog oocytes: Dynamic changes during oocyte maturation andlevel of the expression affects body axis formation. Biochem.early development. RNA 1, 64–78.

Bilger, A., Fox, C. A., Wahle, E., and Wickens, M. (1994). Nuclear Biophys. Res. Commun. 181, 684–690.




Ku, M., and Melton, D. A. (1994). Xwnt-11: A maternally expressed and Dawid, I. B. (1988). Mesoderm induction in amphibians: Therole of TGF-b2-like factors. Science 239, 783–785.Xenopus wnt gene. Development 119, 1161–1173.

Salles, F. J., Darrow, A. L., O’Connell, M. L., and Strickland, S.Kuge, H., and Richter, J. D. (1995). Cytoplasmic 3* poly(A) addition(1992). Isolation of novel murine maternal mRNAs regulated byinduces 5* cap ribose methylation: Implications for translationalcytoplasmic polyadenylation. Genes Dev. 6, 1202–1212.control of maternal mRNA. EMBO J. 14, 6301–6310.

Salles, F. J., Lieberfarb, M. E., Wreden, J. P., and Strickland, S. (1994).Lantz, V., Chang, J. S., Horabin, J. I., Bopp, D., and Schedl, P. (1994).Regulated polyadenylation of maternal mRNAs allows coordi-The Drosophila orb RNA binding protein is required for the for-nate initiation of Drosophila development. Science 266, 1996–mation of the egg chamber and the establishment of polarity.1998.Genes Dev. 8, 598–613.

Simon, R., and Richter, J. D. (1994). Further analysis of cytoplasmicMathews, L. S., Vale, W. W., and Kintner, C. R. (1992). Cloning ofpolyadenylation in Xenopus embryos and identification of em-a second type of activin receptor and functional characterizationbryonic CPE-binding proteins. Mol. Cell. Biol. 14, 7867–7875.in Xenopus embryos. Science 255, 1702–1705.

Simon, R., Tassan, J.-P., and Richter, J. D. (1992). TranslationalMcGrew, L. L., Dworkin-Rastl, E., Dworkin, M. B., and Richter, J.control by poly(A) elongation during Xenopus development: Dif-D. (1989). Poly(A) elongation during Xenopus oocyte maturationferential repression and enhancement by a novel cytoplasmicis required for translational recruitment and is mediated by apolyadenylation element. Genes Dev. 6, 2580–2591.short sequence element. Genes Dev. 3, 803–815.

Slack, J. M. W. (1993). Embryonic induction. Mech. Dev. 41, 93–Nieuwkoop, P. D. (1969). The formation of mesoderm in Urodelean107.amphibians. I. induction by the endoderm. Wilhelm Roux’ Arch.

Slack, J. M. W., Darlington, B. G., Heath, J. K., and Godsave, S. F.Entwickslungmech. Org. 162, 341–373.(1987). Mesoderm induction in early Xenopus embryos by hepa-Osborne, H. B., and Richter, J. D. (1996). Translational control byrin-binding growth factors. Nature 326, 197–200.polyadenylation in early development. In ‘‘Cytoplasmic Fate of

Slack, J. M. W., and Isaacs, H. (1989). Presence of basic fibroblastEukaryotic mRNA’’ (P. Jeanteur, Ed.). Springer-Verlag, Heidel-growth factor in the early Xenopus embryo. Development 105,berg.147–153.Palatnik, C. M., Storti, R. V., and Jacobson, A. (1979). Fractionation

Smith, J. C. (1989). Mesoderm induction and mesoderm-inducingand functional analysis of newly synthesized and decaying mes-factors in early amphibian development. Development 105, 665–senger RNAs from vegetative cells of Dictyostelium discoideum.677.J. Mol. Biol. 128, 371–395.

Smith, J. C., Price, B. M. J., Green, J. B. A., Weigel, D., and Hermann,Palatnik, C. M., Wilkins, C., and Jacobson, A. (1984). TranslationalB. G. (1991). Expression of a Xenopus homolog of Brachyury (T)control during early Dictyostelium development: Possibleis an immediate-early response to mesoderm induction. Cell 67,involvement of poly(A) sequences. Cell 36, 1017–1025.79–87.Paris, J., and Richter, J. D. (1990). Maturation-specific polyadenyla-

Stebbins-Boaz, B., Hake, L. E., and Richter, J. D. (1996). CPEB con-tion and translational control: Diversity of cytoplasmic polyade-trols the cytoplasmic polyadenylation of cyclin, cdk2, and c-mosnylation elements, influence of poly(A) tail size, and formationmRNAs and is necessary for oocyte maturation in Xenopus.of stable polyadenylation complexes. Mol. Cell. Biol. 10, 5634–EMBO J. 15, 2582–2592.5645.

Thomsen, G. H., and Melton, D. A. (1990). Processed Vg1 proteinParis, J., Swenson, K., Piwnica-Worms, H., and Richter, J. D. (1991).as an axial mesodermal inducer in Xenopus. Cell 73, 433–441.Maturation-specific polyadenylation: In vitro activation by

Thomsen, G., Woolf, T., Whitman, M., Sokol, S., Vaughn, J., Vale,p34cdc2 and phosphorylation of a 58-kD CPE-binding protein.W., and Melton, D. A. (1993). Activins are expressed in earlyGenes Dev. 5, 1697–1708.Xenopus embryogenesis and can induce axial mesoderm and an-Richter, J. D. (1995). Dynamics of poly(A) addition and removalterior structures. Cell 63, 485–493.during development. In ‘‘Translational Control’’ (M. Mathews,

Weeks, D. L., and Melton, D. A. (1987). A maternal mRNA local-N. Sonenberg, and J. Hershey, Eds.). Cold Spring Harbor Labora-ized to the vegetal hemisphere in Xenopus eggs codes for a growthtory Press, Cold Spring Harbor, NY.factor related to TGFb. Cell 51, 861–867.Robbie, E. P., Peterson, M., Amaya, E., and Musci, T. J. (1995).

Whitman, M., and Melton, D. A. (1989). Growth factors in earlyTemporal regulation of the Xenopus FGF receptor in develop-embryogenesis. Annu. Rev. Cell Biol. 5, 93–117.ment: A translation inhibitory element in the 3* untranslated

region. Development 121, 1775–1785. Received for publication March 29, 1996Accepted July 31, 1996Rosa, F., Roberts, A. B., Danielpour, D., Dart, L. L., Sporn, M. B.,



cytoplasmic polyadenylation of activin receptor mrna and the control of pattern formation...

Documents