de novo assembly of rna steve kelly slides are available at: example data
TRANSCRIPT
![Page 1: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/1.jpg)
De novo assembly of RNA
Steve Kelly
www.stevekelly.eu
Slides are available at:
http://bioinformatics.plants.ox.ac.uk/EBI_2014/EBI_2014.ppt
Example data is available at:
http://bioinformatics.plants.ox.ac.uk/EBI_2014/reads.zip
![Page 2: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/2.jpg)
What is a de novo transcriptome?
Set of nucleotide sequences obtained by sequencing reverse transcribed RNA
- Poly A selected
- Ribsomal RNA depleted
- Random hexamer primed
- Long reads/short reads
- Strand specific
Sequencing technology: Read size: Throughput per run:
Illumina ~120bp ~800Gbp
454 ~1000bp ~700Mbp
PacBio ~2700bp ~100Mbp
GridION ~100kbp ~100Gbp/day
Select for mRNA
![Page 3: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/3.jpg)
Why do de novo transcriptomes
Good way of generating new data from non-model species
- It can tell you about gene presence
- It can tell you about gene expression
- It can tell you about evolution
Cheaper than you might think!
2Gb of paired end sequence data is sufficient to get 90% of expressed genes!
A de novo plant transcriptome from Illumina sequence: ~£300
Typical computing resources (standard PC desktop)
Linux desktop: cost £800-1000.
at least 1 quad core processor
at least 16gb of ram
at least 3 TB of disk space
![Page 4: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/4.jpg)
Why do de novo transcriptomes
Example data for this talk is available at:http://bioinformatics.plants.ox.ac.uk/EBI_2014/reads.zip
Paired end Illumina sequence data from Sorghum bicolor leaves R1.fq is a file containing the first end reads.R2.fq is contains the second end reads.The first read in R2.fq is the pair of the first read in R1.fq so the order of the reads is very important in paired-end read files!
All software used is available for Linux- Web addresses for current versions are given- Software takes many hours to run of large datasets
All software is command line only- Command line examples for every step are given
![Page 5: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/5.jpg)
Example: Using fastx toolkit
http://hannonlab.cshl.edu/fastx_toolkit/
Command line:~/fastx_quality_stats –i R1.fq –o R1_output.txt~/fastx_nucleotide_distribution_graph.sh –i R1_output.txt –o R1_nuc.png
Command line examples
The name of the software being used
Where you can get it for free
How to use software to generate the data shown on the slide
Shorthand for the full path to the directory where the program is located
![Page 6: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/6.jpg)
De novo assembly protocol outline
1) Pre-assembly read processing
Remove poor quality data before assembly
2) Assembly
Using different parameters and merging
3) Post-assembly processing
Identifying protein sequences and orthologous protein groups
4) Quantification
Mapping raw reads back onto assembly to determine expression level
![Page 7: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/7.jpg)
What do sequence files look like?
@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/1GAGTTTTTGTCATCGTTGATGCCAAGGAACAGTATACATGAAG…+Fefefggggggfggggggggfgggegggggggaggggggggdg…
Each read has a name that starts with an @ symbol
![Page 8: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/8.jpg)
What do sequence files look like?
@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/1GAGTTTTTGTCATCGTTGATGCCAAGGAACAGTATACATGAAG…+Fefefggggggfggggggggfgggegggggggaggggggggdg…
@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/2GTTCAACTTGATGAATCATCTAAGGAGTGATCCAACAAAACAAA…+gggggegggggggggggggggfgggcfbgfgggeccd[Q^d^]]…
Each read has a name that starts with an @ symbol
If the reads are paired, then the first in pair will end with a /1 and the
second with a /2
![Page 9: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/9.jpg)
What do sequence files look like?
@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/1GAGTTTTTGTCATCGTTGATGCCAAGGAACAGTATACATGAAG…+Fefefggggggfggggggggfgggegggggggaggggggggdg…
@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/2GTTCAACTTGATGAATCATCTAAGGAGTGATCCAACAAAACAAA…+gggggegggggggggggggggfgggcfbgfgggeccd[Q^d^]]…
Each read has a name that starts with an @ symbol
If the reads are paired, then the first in pair will end with a /1 and the
second with a /2
The read sequence is on the line after the read name
![Page 10: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/10.jpg)
What do sequence files look like?
@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/1GAGTTTTTGTCATCGTTGATGCCAAGGAACAGTATACATGAAG…+Fefefggggggfggggggggfgggegggggggaggggggggdg…
@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/2GTTCAACTTGATGAATCATCTAAGGAGTGATCCAACAAAACAAA…+gggggegggggggggggggggfgggcfbgfgggeccd[Q^d^]]…
Each read has a name that starts with an @ symbol
If the reads are paired, then the first in pair will end with a /1 and the
second with a /2
The read sequence is on the line after the read name
The sequence read is followed by a +
symbol on a new line
![Page 11: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/11.jpg)
What do sequence files look like?
@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/1GAGTTTTTGTCATCGTTGATGCCAAGGAACAGTATACATGAAG…+Fefefggggggfggggggggfgggegggggggaggggggggdg…
@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/2GTTCAACTTGATGAATCATCTAAGGAGTGATCCAACAAAACAAA…+gggggegggggggggggggggfgggcfbgfgggeccd[Q^d^]]…
Each read has a name that starts with an @ symbol
If the reads are paired, then the first in pair will end with a /1 and the
second with a /2
The read sequence is on the line after the read name
The base-by-base qualities are on line #4
The sequence read is followed by a +
symbol on a new line
![Page 12: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/12.jpg)
Understanding read quality scores
Quality scores are the probability that the base is called incorrectly
Q = -10 Log10(p)
where p is the probability that base is incorrect
Quality score Probability of sequencing error Accuracy
10 1 in 10 90%
20 1 in 100 99%
30 1 in 1000 99.9%
Read quality is more important for assembly than for read mapping!
![Page 13: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/13.jpg)
Example of read quality scores
Reads in Illumina 1.5+ encoding (Quality 2 - 40)
What does quality score of B mean?
ASCII value for B = 66 (http://www.asciitable.com/)
Illumina 1.5+ offset = 64
B = 66 – 64 = 2
2 = -10 Log10(p)
p = 10^(-2/10)
p = 0.63
i.e. 63% chance that the base call is wrong
![Page 14: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/14.jpg)
Visualising read quality data
Important to visualise/summarise the raw data before using it!
Most common errors can be spotted in general summary statistics!
Use FASTQC for nice visual output:
http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
Use FASTX or Trimmomatic for simple processing tasks:
http://hannonlab.cshl.edu/fastx_toolkit/
http://www.usadellab.org/cms/?page=trimmomatic
![Page 15: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/15.jpg)
Pre-assembly read processing
Example: Using fastx toolkit
http://hannonlab.cshl.edu/fastx_toolkit/
Command line:~/fastx_quality_stats –i R1.fq –o R1_output.txt~/fastx_nucleotide_distribution_graph.sh –i R1_output.txt –o R1_nuc.png
![Page 16: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/16.jpg)
Pre-assembly read processing
Example: Using fastx toolkit
http://hannonlab.cshl.edu/fastx_toolkit/
Command line:~/fastx_quality_stats –i R1.fq –o R1_output.txt~/fastx_nucleotide_distribution_graph.sh –i R1_output.txt –o R1_nuc.png
Normal 5’ composition bias caused by non-random hexamer used during cDNA synthesis
![Page 17: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/17.jpg)
Pre-assembly read processing
Example: Using fastx toolkit
http://hannonlab.cshl.edu/fastx_toolkit/
Command line:~/fastx_trimmer –f 6 –i R1.fq –o trim_R1.fq
If there is unusual composition bias at either end it is likely to cause problems. It’s best to remove these bases!
![Page 18: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/18.jpg)
Pre-assembly read processing
Example: Using fastx toolkit
http://hannonlab.cshl.edu/fastx_toolkit/
Command line:~/fastx_clipper –a GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG –i R1.fq –o filt_R1.fqjava -jar trimmomatic-0.30.jar PE -threads 4 -phred64 R1.fq R2.fq trimmed_R1.fq unpaired_R1.fq trimmed_R2.fq unpaired_R2.fq ILLUMINACLIP:all_adaptors.fasta:2:30:10 LEADING:10 TRAILING:10 SLIDINGWINDOW:5:15 MINLEN:50
Non-uniform composition in the reads due to sequencing adaptor sequences.
Remove the appropriate adapter sequence using fastx_clipper
![Page 19: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/19.jpg)
Example: Using fastx toolkit
http://hannonlab.cshl.edu/fastx_toolkit/
Command line:~/fastq_quality_boxplot_graph.sh –i R1_output.txt –o R1_box_plot.png
Pre-assembly read processing
![Page 20: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/20.jpg)
Example: Using fastx toolkit
http://hannonlab.cshl.edu/fastx_toolkit/
Normal 3’ degradation of read quality scores.
Sequence at 3’end has higher proportion of errors
Before assembly good idea to remove poor quality sequences!Command line:~/fastq_quality_boxplot_graph.sh –i R1_output.txt –o R1_box_plot.png
![Page 21: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/21.jpg)
Understanding read quality scores
Quality scores are the probability that the base is called incorrectly
Q = -10 Log10(p)
where p is the probability that base is incorrect
Quality score Probability of sequencing error Accuracy
10 1 in 10 90%
20 1 in 100 99%
30 1 in 1000 99.9%
Read quality is more important for assembly than for read mapping!
Quantification
SNP calling or assembly
![Page 22: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/22.jpg)
Pre-assembly read processing
Three ways to deal with poor quality reads:
1) Discard reads based on quality threshold
Most stringent
Lose lots of data
2) Remove poor quality sections from reads
Middle stringency
Keep most of the read data, just loosing the unreliable bits
1) Try to find and fix the errors in poor quality reads
Least stringent
Error correction may introduce errors
Keep all the data
![Page 23: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/23.jpg)
Example: Using fastx toolkit
http://hannonlab.cshl.edu/fastx_toolkit/
Command line:~/fastq_quality_filter –q 30 –p 50 –i R1.fq –o filt_R1.fq~/fastx_quality_stats –i filt_R1.fq –o filt_R1_output.txt~/fastq_quality_boxplot_graph.sh –i filt_R1_output.txt –o filt_R1_box_plot.png
Removed reads which have quality < 30 for more than 50% of the read length
22.5 million -> 14.3 million (64%)
Pre-assembly read processing
![Page 24: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/24.jpg)
Example: Using fastx toolkit
http://hannonlab.cshl.edu/fastx_toolkit/
Pre-assembly read processing
Command line:~/fastq_quality_trimmer –t 30 –l 30 –i R1.fq –o trim_R1.fq~/fastx_quality_stats –i trim_R1.fq –o trim_R1_output.txt~/fastq_quality_boxplot_graph.sh –i trim_R1_output.txt –o trim_R1_box_plot.png
Clip reads from both ends which have quality until quality > 30. Discard if read length < 30
22.5 million -> 22.2 million reads (99%)
![Page 25: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/25.jpg)
Pre-assembly read processing
Command line:~/sortmerna --I interleaved_trimmed_reads.fq -n 4 --db “the full paths to the four included ribosomal RNA libraries” --paired-in --accept ribosomal_RNA_reads --other non_ribosomal_reads --log rRNA_filter_log -a 4
Example: Using SortMeRNA
http://bioinfo.lifl.fr/RNA/sortmerna/
Even after polyA selection or ribosomal RNA depletion you will have 1-30% ribosomal RNA contamination in your RNAseq. Best to remove it before assembly!
You will need to interleave your read files to run SortMeRNA.
@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/1GAGTTTTTGTCATCGTTGATGCCAAGGAACAGTATACATGAA+Fefefggggggfggggggggfgggegggggggaggggggggd@FCC00CKABXX:2:1101:1248:2120#CAGATCAT/2GTTCAACTTGATGAATCATCTAAGGAGTGATCCAACAAAACA+gggggegggggggggggggggfgggcfbgfgggeccd[Q^d^
One file containing all read pairs interleaved consecutively.
![Page 26: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/26.jpg)
Example: Using ALLPATHS-LG
http://www.broadinstitute.org/software/allpaths-lg/blog/
Pre-assembly read processing
- Splits all reads into all possible sub-sequences of length k
- Makes stacks of near identical sub-sequences
- Bigger the value of k the more conservative
- Small value of k can introduce more errors than it fixes!
![Page 27: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/27.jpg)
Example: Using ALLPATHS-LG
http://www.broadinstitute.org/software/allpaths-lg/blog/
Pre-assembly read processing
- Splits all reads into all possible sub-sequences of length k
- Makes stacks of near identical sub-sequences
- Bigger the value of k the more conservative
- Small value of k can introduce more errors than it fixes!
![Page 28: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/28.jpg)
Example: Using ALLPATHS-LG
http://www.broadinstitute.org/software/allpaths-lg/blog/
Pre-assembly read processing
- Splits all reads into all possible >25bp sub-sequences (p < 1e-6)
- Makes stacks of near identical sub-sequences (no gaps)
Command line:~/ErrorCorrectReads.pl PHRED_ENCODING=64 READS_OUT=corrected_reads PAIRED_READS_A_IN=R1.fq PAIRED_READS_B_IN=R2.fq FILL_FRAGMENTS=True
![Page 29: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/29.jpg)
Example: Using ALLPATHS-LG
http://www.broadinstitute.org/software/allpaths-lg/blog/
Pre-assembly read processing
- Splits all reads into all possible >25bp sub-sequences (p < 1e-6)
- Makes stacks of near identical sub-sequences (no gaps)
- Correct singletons and low frequency bases
Keep all 22.5 million reads (100%)
Command line:~/ErrorCorrectReads.pl PHRED_ENCODING=64 READS_OUT=corrected_reads PAIRED_READS_A_IN=R1.fq PAIRED_READS_B_IN=R2.fq FILL_FRAGMENTS=True
![Page 30: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/30.jpg)
Example: Using ALLPATHS-LG
http://www.broadinstitute.org/software/allpaths-lg/blog/
Pre-assembly read processing
Join paired end reads into long reads prior to assembly.
Command line:~/ErrorCorrectReads.pl PHRED_ENCODING=64 READS_OUT=corrected_reads PAIRED_READS_A_IN=R1.fq PAIRED_READS_B_IN=R2.fq FILL_FRAGMENTS=True
Assembly contains up to 50% less reads
Assembly program doesn’t incorrectly guess insert size!
Prevents some common assembly artefacts
![Page 31: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/31.jpg)
Pre-assembly read processing
Example “good practice” pre-assembly processing
- Visually inspect nucleotide composition and quality scores
- Clip off 5’ or 3’ ends containing unexpected/unusual nucleotide bias
- Filter out any reads containing adaptor sequences
- Trim back reads from both ends based on quality score
- Filter out ribosomal RNA reads
- Error correct and join overlapping remaining reads using k >= 25bp
- (Optional step here would be to normalise reads to even out coverage depth for example see program called “khmer”)
- Assemble!
![Page 32: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/32.jpg)
Assembly packages:
All use the same underlying idea of assembling using de Bruijn graphs
1) Velvet/Oases - Good all round and very fast
2) Trinity - Good at getting full length transcripts
3) TransAbyss - Good at getting lots of splice variants
4) SOAPdenovo-Trans - Very fast with low memory footprint
Results of all assembly programs are quite similar.
As each of them comes up with a new idea they tend to be built into the others quickly too so that they don’t get left behind!
I recommend you start with velvet/oases as its easy to install and use!
Which assembler to use?
![Page 33: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/33.jpg)
Simplified overview of assembly process
![Page 34: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/34.jpg)
Simplified overview of assembly process
![Page 35: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/35.jpg)
Command line example:~/oases_pipeline.py –m 31 –M 61 –s 10 –g 41 –o merged –d “ –fastq –shortPaired –separate R1.fq R2.fq“ –d –ins_length 170 –cov_cutoff 6 –min_pair_count 4 –min_trans_lgth 200
Assembling the transcriptome
Example: Using Velvet/Oases
http://www.ebi.ac.uk/~zerbino/velvet/ & http://www.ebi.ac.uk/~zerbino/oases/ Assembly only needs two parameters
- Need to specify the insert size
- Need to specify the k-mer size for constructing the de Bruijn graph
- Larger k more specific
- Smaller k more sensitive
- Best to use a range of k-mer sizes and merge the results
- For example k = 31, 41, 51 and 61
- Set a minimum transcript length
- Set a minimum coverage cut off
![Page 36: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/36.jpg)
Assessing the transcriptome
Effect of kmer size of transcript length part 1
![Page 37: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/37.jpg)
Assessing the transcriptome
Effect of kmer size of transcript length part 2
![Page 38: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/38.jpg)
Assessing the transcriptome
Effect of kmer size on number of transcripts
![Page 39: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/39.jpg)
Command line example:~/rsem-prepare-reference --bowtie-path “path-to-bowtie” transcripts.fa~/rsem-calculate-expression --bowtie-path “path-to-bowtie” --paired-end R1.fq R2.fq transcripts.fa
Quantifying your transcriptome
Example: Using RSEM & bowtie
http://deweylab.biostat.wisc.edu/rsem/ & http://bowtie-bio.sourceforge.net/index.shtml
Use processed reads for quantification
- Cant use programs such as cufflinks to estimate abundance from transcripts
- Current best method is RSEM
gene_id transcript_id(s) length effective_length expected_count TPM FPKM
transcript_1 transcript_1 2021 1936.59 519.77 5190.23 6378.74
transcript_100 transcript_100 887 802.59 96 2313.29 2843.01
transcript_101 transcript_101 880 795.59 1856.65 45132.93 55467.89
transcript_102 transcript_102 876 791.59 370 9039.72 11109.72
transcript_103 transcript_103 876 791.59 173.95 4249.96 5223.15
transcript_104 transcript_104 875 790.59 53 1296.52 1593.4
Use expected count for DE testing
![Page 40: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/40.jpg)
Summary
- A de novo plant transcriptome from Illumina sequence: ~£300
- Important to check the raw data before assembly
- Correcting and removing errors before assembly improves quality
- Most assembly methods have similar performance
- Try it!
![Page 41: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/41.jpg)
Assemble your own mini-transcriptome
http://bioinformatics.plants.ox.ac.uk/EBI_2014/reads.zip
Download and extract some pre-trimmed read data from:
Command line:wget http://bioinformatics.plants.ox.ac.uk/EBI_2014/reads.zip ./
unzip reads.zip
Command line:ErrorCorrectReads.pl PHRED_ENCODING=64 READS_OUT=corrected_reads PAIRED_READS_A_IN=R1.fq PAIRED_READS_B_IN=R2.fq FILL_FRAGMENTS=True
Error correct and join overlapping paired end reads:
These reads come from 5 genes detected in a sorghum RNAseq experimentSb09g020820, Sb02g034570, Sb07g000980, Sb07g023920, Sb06g016090
![Page 42: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/42.jpg)
Command line:velveth kmer_31 31 -fastq -shortPaired -separate R1.fq R2.fq
velvetg kmer_31 -read_trkg yes -scaffolding yes -ins_length 170
oases kmer_31 -ins_length 170 -scaffolding yes
Assemble uncorrected (trimmed) reads
Assemble your own mini-transcriptome
Command line:velveth kmer_31ec 31 -fastq -shortPaired -separate corrected_reads.paired.A.fastq corrected_reads.paired.B.fastq
velvetg kmer_31ec -read_trkg yes -scaffolding yes -ins_length 170
oases kmer_31ec -ins_length 170 -scaffolding yes
Assemble corrected reads
![Page 43: De novo assembly of RNA Steve Kelly Slides are available at: Example data](https://reader036.vdocuments.net/reader036/viewer/2022062515/56649c785503460f9492d5d4/html5/thumbnails/43.jpg)
Command line:velveth kmer_31ecj 31 -fastq -short corrected_reads.filled.fastq
velvetg kmer_31ecj -read_trkg yes
oases kmer_31ecj
Assemble corrected “joined” reads (*MUCH* better for larger read datasets)
Assemble your own mini-transcriptome
Look in the “transcripts.fa” output files to see what transcripts you have assembled
BLAST transcripts online at NCBI BLAST
Are each of the 5 expected genes assembled?Sb09g020820, Sb02g034570, Sb07g000980, Sb07g023920 & Sb06g016090
If you assemble at k = 21 do you generate any chimeric transcripts?
Try the oases pipeline script on slide 35.