deep sequencing technologies - biochemie.uni...

Deep Sequencing technologies

Gabriela Salinas

30 October 2017

Transcriptome and Genome Analysis Laboratory

Microarray and Deep-Sequencing Core Facility

University Medical Center Göttingen (UMG)

NGS-Course Molecular biology/Master

http://www.uni-bc.gwdg.de/index.php?id=709

Outline

➢ Deep Sequencing Technologies and Applications

➢ Second Generation Sequencing: Illumina platform

➢ Workflow: Library preparation

➢ TruSeq RNA-Standard library preparation (mRNA-Seq, non directional)

➢ Nextera™ technology (RNA-Seq, single cell)

➢ Strand-specific library preparation (directional)

➢ Workflow: Clonal amplification

➢ Workflow: Sequencing by Synthesis (SBS)

➢ Data Analysis and QC

➢ Single-Molecule, Real Time (SMRT) Sequencing

➢ Single-Molecule, Oxford Nanopore Technologies

Deep Sequencing Platforms and Applications

Long Reads

No required amplification

Simple sample prep

Single molecule raw accuracy

Errors tend to be random

Less coveragerequired

Short Reads

Amplification errors and bias

Several enzymatic steps

Multi molecule raw accuracy

Errors tend to be systematic

More coveragerequired

Second vs third generation sequencing approach

Second Generation SequencingIllumina Platform and Applications

Deep Sequencing Instruments_HiSeq 4000/HiSeq 2500

MiSeq

HiSeq 2000/HiSeq 2500 and HiSeq 4000

Instrument Output Fragment length Run time Human Genome per run-30x coverage

MiSeq 4.5 Gb -12 Gb 2x50; 2x150; 2x250, 2x300

4 hs – 48 hs No- only small genomes or gene panels

HiSeq2500 HTM 600 Gb SR up to 1x 100PE up to 2x 100

2 – 11 days 5

HiSeq2500 rapid mode 150 Gb PE up to 2x 250 4 hs – 48 hs 1

HiSeq4000 1500 Gb SR up to 1x 150PE up to 2x 150

4 hs – 48 hs 12

Illumina Sequencing Systems_HiSeq 4000/HiSeq 2500/MiSeq

1

2

3

4

Library Preparation

Cluster Generation

Sequencingby Synthesis

Data Analysis

Stranded total RNASeq● Depletion rRNA; mtRNA● RNA Fragmentation● ssDNA and dsDNA synthesis

● Hybridize to flow cell● Perform bridge amplification

● SR 50 bp; 6GB; ca. 50 Mio Reads/sample● Base Calling

● Images/Intensities QC● Clonal density QC● Pass Filter Reads QC● FastQ QC

RNA-Sequencing: Workflow_HiSeq 4000/2500

● End Repair● Ligate Adapters● Library validation QC

Data pre processing

cBot

Perform sequencing

DNA/RNA extraction

Experimentator

Dataprocessing

Bioinformatic

Applications for Deep Sequencing Technologies

Our sequencing applications include:

➢ Re-sequencing or de-novo sequencing of entire genomes

➢ Methylation analysis by bisulfite sequencing or by immunoprecipitated DNA (MeDIP)

➢ Chromatin modifications or

➢ Immunoprecipitated DNA to study DNA-protein interactions (ChIP seq)

➢ Transcriptome sequencing (RNA seq)

➢ Exome enrichment Analysis (DNA seq)

➢ Genome sequencing to discover SNPs and chromosomal rearrangements (DNA seq)

➢ small RNA Analysis

miRNAmRNA/ncRNAsChIP

DNA RNA

GenomeSeq

Met-Seq

Exom-Seq

Exon

Library Preparation

Project Information –

➢ Number of Samples

➢ Standard Operational Procedures (SOPs) to isolate RNA and DNA

➢ Amount of start material / FFPE

➢ Type of Library Preparation

➢ Strategies to improve the dynamic range

➢ Quality controls to be included / Validation of libraries

➢ Multiplexing Plans

➢ Number of Flow Cell Lanes

➢ Number of Sequencing Cycles

➢ Data Analysis Plans

Meta-Data required for deep Sequencing

RNA-Seq Methods

Standardnon-directional mRNA-Seq

strand-specificTotal RNA-Seq

Nextera RNA-Seq

Single cell RNA-SeqFFPE RNA-Seq

RNA-Seq Methods

Amount of Total RNA 1000-100 ng 50 ng 10 ng 1 ng

Nextera √ √ ? ?

mRNA √ x x x

Stranded total RNA √ x x x

End Repairand

phosphorylate

dA addition

A

Ligation

Purify Ligation (2x)

Final library

TruSeq Standard library preparation

➢Standard (mRNA)ds cDNA from fragmented RNA

P

A

AA

P

P+PT

P

P

P

RNA (Total)

mRNA

scDNA Synthesis

dcDNA Synthesis

Fragmentationpriming

PCR

Purify PCR

Library validation

QC_Bioanalyzer+NanoDrop

2 x purification (beads)

purification (beads)

QC_Bioanalyzer+NanoDropPicogreen or QuantiFluor

Purification (Beads)

Nextera™ technology: transposase mediated RNA-seq libraries (Tn-RNA-seq)

In vitro transposition withappended transposon ends

➢ Low input of start material (dsDNA: 50 ng)

➢ No mechanical fragmentation (sonication) is required

➢ 1 day library preparation (Tagmentation)

➢ Applicable to all organisms

➢ Optimized PCR: Improved formulations with fewer cycles deliver reduced GC bias and lower error rates

Advantages of the Nextera™ technology protocol

RNA (Total)

rRNA Depletion

scDNA Synthesis

dcDNA Synthesis

Fragmentation





Adenylate 3' Ends

Ligate Adapters

Validation

Pool

PCRPurify PCR



RNA (Total)

scDNA Synthesis

dcDNA Synthesis

Fragmentation

Adenylate 3' Ends

Ligate Adapters

Validation

Pool

PCRPurify PCR

RNA (Total)

scDNA Synthesis

dcDNA Synthesis



Tagmentation

Validation

Pool

Limited PCRPurify PCR

total RNA mRNANextera

RNA_Seq: Nextera, Stranded total RNA and Standard libraries

mRNA


➢ Maintaining strand orientation allows identification of antisense expression (important mediator for gene regulation)

➢ Identification of mRNA; ncRNA (lincRNAs; snRNAs; snoRNAs and others)

➢ Increase alignment efficiency

➢ Currently available for human, mouse and rat (Ribo-Zero)

➢ Compatible with low quality samples (FFPE)

Advantages of the TruSeq Stranded total RNA library preparation

COVARIS (NGS)/Sonication

Blue Pippin/Fragment size

Fragment Analyzer/DNARNA Quality and Quantity

Sample Preparation Workflow: additional equipment

Library quality control: Fragment Analyzer

Clonal Amplification

A. B. C. D.

Clustering by Clonal Amplification-cBot

Image from http://www.illumina.com

http://www.illumina.com/

Sequencing by Synthesis (SBS)

A. B. C. D.

Clustering by Clonal Amplification-cBot



Sequencing by Synthesis_SBS


● Sequencing by synthesis (SBS)

● The sequencing chemistry uses 4reversible terminator-bound, fluorescently labeled nucleotides

● A single nucleotide is incorporated into each DNA fragment and the fluorescence from each cluster isvisualized and measured by taking an image of theflow cell after laser excitation

● After incorporation and imaging, the fluorescent dye is enzymatically cleaved to allow incorporation of next nucleotide during the next flow cycle




The reads are filtered based on a CHASTITY score allocated to each base (CHASTITY score for cycle)

QC_Sequencing and Cluster density

Data Analysis and QC

Gene Expression: Microarray/RNA-SeqStatistics; Hierarchical & K-means clusters; Scatter plots; list of candidates; RNA counting; Mapping to a reference

sequencing; pathways; gene ontologies; links to NCBI

Initial ConsultationUser & TAL

Experimental DesignTimeline and Cost

Project initiationUser

Sample preparation Sample collecting

TAL NGSSample quality controlSample library constructionClonal AmplificationSequencing_Instrument Run

Data AnalysisTAL

Pipelines; Data preprocessing;Txt files; cel Files; FastaQ Files

Epigenetics: Methylation; Chip-SeqMapping; peak calling; UCSC Browser; Literature searches

Small RNA: Microarray/small RNA-SeqMapping; known miRNA; unknown miRNA; Expression and counts;

links to miRBASE; known gene interactions

ResequencingMapping; SNP calling; small insertion/deletion;

large insertion/deletion; Copy Number Variation; inversions

Deep Sequencing Data Analysis Services_TAL

FastQC_Sequencing ReportInput formatAny fastq file, for example:@HWI-EAS91_1_30788AAXX:7:21:1542:1758GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA+HWI-EAS91_1_30788AAXX:7:21:1542:1758hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR

Single-Molecule, Real Time (SMRTTM) Sequencing:Technology Update and Recent Applications

Single-Molecule, Real Time DNA Sequencing (SMRT) is:

Highquality, intact DNA samples are crucial to the success of PacBio SMART sequencing experiments.

DNA input requirement will vary by template inert size and project design: for instance 500 bp/600 ng; 10 Kb/12 µg.

Sample fragmentation: COVARIS

Fragment Size: Pippin Blue

PCR-free Sample Preparation Workflow

HLA FullLength Gene Sequencing

Reads Now Cover Entire Genes (With Introns)

Detection of DNA Base Modifications by SMRT Sequencing

De Novo Characterization of Genome & Epigenome

Characterization of Splice Variants

Recent Applications

https://www.youtube.com/watch?v=NHCJ8PtYCFc

Single-Molecule, Oxford Nanopore Technologies

Highquality, intact DNA samples are crucial to the success of PacBio or Nanopore sequencing experiments.

DNA input requirement and insert size selection is variable and depend on the application

Sample fragmentation: COVARIS „G tube“ or Pippin Blue

For Nanopore a library conditioning step which attaches the motor protein is required

PCR-free Sample Preparation Workflow

STATS

Price: Less than $1,000

DNA Read Length: 70,000 base pairs

1) Drop the DNA sample on a chip

2) Unzip the DNA

3) Block the ion current

4) Determine the sequence

5) Check for errors

MinIon Device

https://www.youtube.com/watch?v=3UHw22hBpAk

deep sequencing technologies - biochemie.uni...

Documents