detailed materials and methods gene targeting and

DETAILED MATERIALS AND METHODS

Gene Targeting and development of knock-out mice. The murine genomic clone, RP23-

449P23, containing the mir142 gene, was obtained from the BACPAC Resource Center

(http://bacpac.chori.org). A replacement vector was constructed which was designed to replace

the miR-142 hairpin precursor (100001-1000064) and upstream 1000 base pairs (99040-

100001) as well as downstream 2640 base pairs(100064-102705) with a PGK-neomycin-

resistance cassette. The retrieval vector was constructed using PCR amplified left/right

homology arms cloned into a vector backbone containing the PGK-neomycin- resistance

cassette. The 5’ arm retrieval primers used were “5’Arm sense”’ and “5’Arm antisense”, which

produce a 3,050 base pairs arm. The 3’ arm retrieval primers used were 3’ arm sense and 3’

arm antisense, which produce 2,541 base pairs 3’ arm. The 5’ arm was cloned into ploxPFlpneo

vector at unique restriction site Swa I by using Takara DNA ligation Kit Long. Next, 3’ arm was

cloned into the targeting vector by using In-Fusion Advantage PCR Cloning Kit (Clontech) with

Infusion Forward and Reverse primers. The Targeting vector was delivered into JM8.F6

(C57BL/6N) stem cell by microinjection. Targeted heterozygotes were monitored by genotyping

using TaqMan real-time quantitative PCR with primers and probes: 5’ Geno Farward, 5’ Geno

Reverse, and 5’ Geno probe; 3’ Geno Farward, 3’ Geno Reverse and 3’ Geno probe (37). The

ES derived from C57BL/6 mouse substrains (JM8.F6 [C57BL/6N] stem cell) and carrying

targeting vector was injected into albino C57BL/6 mice to produce black on white chimeras. ES

cell-mouse chimeras with high coat color contribution from the ES cells (90%) are selected for

germline transmission. Pups that are produced from sperm derived from the C57BL/6 host

embryo will have black coats and those from the albino C57BL/6 host embryo will be white. Tail

biopsies from the pups are screened for the presence of the targeted gene. The absence of

miR-142 gene was further confirmed by qTaqMan-PCR using specific control reference probe

for targeting the telomerase reverse transcriptase (Tert) gene on chromosome 13, cytoband

13qC1, and probes specific for 3’arm and 5’arm designed for miR-142 gene homologous

recombination. PCR primers used for distinguishing mir142-/-, miR142+/- and WT littermates

were 5’ forward, 5’ reverse, 3’ forward and 3’ reverse’ and mice were genotyped from tail biopsy

genomic DNA. The absence of miR-142 expression in miR-142-/- mice was confirmed in bone

marrow tissues isolated from tibia and fibula and T cells isolated from secondary lymphoid

organ (spleen) by qTaqMan PCR using specific probes against miR-142-3p, using Raw264.7

cells as positive control and NIH3T3 cells as negative control (11).

The oligos used were:

Lower case denotes cloning sites & upper case genomic DNA

5’arm forward: 5’- tcgatttaaatGGCCGATTTCTGAGTTCAAGGCC -3’

5’ arm reverse: 5’-ccaatttaaatGCGCAAAGCCCTGGGTTCGGTTCCC-3’

3’ arm forward: 5’-tcgggccggccGACATAGCATGTGTACTGATG-3’

3’ arm reverse: 5’-ccaggccggccggtaccGGCAGATCAAACTCCCTCC-3’

3’ Infusion forward: 5’-gctcgaattgatccccgggtaccGACATAGCATGTGTACTGATGTTTAGACTGC-3’

3’ Infusion reverse: 5’-gacctcgagggggggcccggtaccGGCAGATCAAACTCCCTCCCCATCCGTC-3’

5’ Geno forward: 5’-AAGCTGGGAACCGAACCC-3’

5’ Geno reverse: 5’-GCCCGGCTAATTTTTCCTTTTTTAAT-3’

5’ Geno probe 5’-TTGCGCTTACCATTGAGC-3’

3’ Geno forward 5’-CACAGACATACTATGCATACTCTTCTATACA-3’

3’ Geno reverse 5’-AAGGTAACATTCATTTCTCTAAAGCAGTCT-3’

3’ Geno probe 5’-ATGCTATGTCATGTAACTTT-3’

5’ Forward: 5’-GCCCAAGGCTCAGAGAAGAGC-3’

5’ Reverse: 5’-CGATACCAGTCTCACTGTTTCAGC-3’

3’ Forward 5’-GAAGTTCCTATTCCGAAGTTCC -3’

3’ Reverse 5’-GGAATAGCAGCTAAAGCATAGAG-3’

Mice: C57BL/6 (B6, H2b, CD45.2), C3H.sw (H2b), BALB/c (H2d), B6D2F1 (H2b/d, CD45.2) and

B6 Ly5.2 (H2b, CD45.1) mice were purchased from The Jackson Laboratory and the National

Cancer Institute. The age of mice used for experiments ranged between 8 and 12 weeks. Mice

were housed in sterilized microisolator cages and received filtered water and normal chow. All

animals were cared for under regulations reviewed and approved by the University Committee

on Use and Care of Animals of the University of Michigan, based on University Laboratory

Animal Medicine guidelines.

DC isolation: dendritic cells (DC) were isolated from splenocytes either from WT or miR-142

deficiency mice. Single cell suspensions were prepared by collagenase D (Roche) digestion

according to manufacturer’s instruction then subjected to CD11c microbead (MACS) staining

and positive selection using autoMACSTM Pro Separator (Miltenyi Biotec). The purity of

enriched CD11c+ DC preparation was 85.6~90%. Culture media were collected for

measurements of IL-6 and TNF by ELIS A a

ng/ml) for 6 hours.

BMT, systemic analyses of GVHD: BMTs were performed as described before (38-40). The

donor T cells were isolated from individual or pooled spleen cells suspensions by negative

selection (Pan T cell Isolation Kit II; Miltenyi Biotec). BM cells were harvested from the tibia from

one side of the mice for LSK cell harvest and for TCD of BM cells. TCD (T cell deletion) BM

cells were isolated with negative selection by autoMACS using anti-CD90.2 microbeads

(Miltenyi Biotec, Bergisch Gladbach, Germany). The recipient BALB/c mice received an 800-

cGy total body irradiation on day -1 (split dose) and T cells (1 × 106, isolated from either WT B6

mice or miR-142 deficiency mice) and TCDBM cells (5 × 106, from WT B6 mice) were injected

intravenously into the recipients on day 0. The recipient B6D2F1 mice received a 1100-cGy

total body irradiation on day -1, and T cells (2.5 × 106, isolated from either WT B6 mice or miR-

142 deficiency nice) and TCDBM cells (5 × 106, from WT B6 mice) were injected intravenously

into the recipients on day 0. The recipient C3H.SW mice received a 1050-cGy total body

irradiation on day -1, and T cells (1.5 × 106, isolated from either WT B6 mice or miR-142

deficiency nice) and TCDBM cells (5 × 106, from WT B6 mice) were injected intravenously into

the recipients on day 0. The syngeneic B6 control mice received a 1000-cGy total body

irradiation on day -1, and T cells (1-2.5 × 106, isolated from either WT B6 mice) and TCDBM

cells (5 × 106, from WT B6 mice) were injected intravenously into the recipients on day 0. For in

vivo knockdown of miR-142-3p using LNA-anti-miR-142-3p, recipient B6D2F1 and B6 mice

were administered on day 1, 3 and 7 with saline-formulated LNA-anti-miR-142-3p, or LNA

mismatch control by the injection volume of 200 uL with an IP (Intraperitoneal injection) dose of

10 mg/kg respectively (9). For in vivo CRISPRi targeted silencing of atypical E2Fs using B6 into

BALB/c GVHD model as described above, purified miR-142 KO T cells were infected with

lentiviral particles carrying double guide RNAs targeting E2F7 and E2F8 or CRISPRi-control,

and purified WT T cells were infected with lentiviral particles carrying CRISPRi-control, along

with dCas9 lentiviral particles for 3 days. The recipient BALB/c mice received an 800-cGy TBI

on day -1 (split dose) and miR-142 KO T cells (1 × 106, infected with lentiviral particles carrying

CRISPRi-E2F7/8 or control along with dCas9 lentiviral particles) or WT T cells 1 × 106 and TCD

BM cells (5 × 106, from WT B6 mice) were injected i.v. into the recipients on day 0. Mice were

housed in sterilized microisolator cages and received normal chow and autoclaved

hyperchlorinated drinking water for the first 3 week after BMT. Survival was monitored daily.

The degree of systemic GVHD was assessed by a standard scoring system by summation of

five criteria scores: percentage of weight change, posture, activity, fur texture, and skin integrity.

At the time of analysis, coded cages were evaluated and graded from 0 to 2 for each criterion

(maximum index =10) (40). Acute GVHD was also assessed by histopathologic analysis of the

ileum and the ascending colon, liver and ear skin. Specimens were harvested from animals on

day +14 or +21 after BMT, then processed and stained with hematoxylin and eosin. Coded

slides were examined systematically in a blinded manner by using a semiquantitative scoring

system to assess the following abnormalities known to be associated with GVHD, small

intestine: villous blunting, cryptregener ation, loss of enterocyte brush border, luminal sloughing

of cellular debri, crypt cell apoptosis, outright crypt destruction, and lamina propria lymphocytic

infiltrate; colon: crypt regeneration, surface co loncytes, colonocyte vacuolization, surface

colonocyte attenuation, crypt cell apoptosis, outright crypt destruction, and lamina propria

lymphocytic infiltrate; liver: portal tract expansion, neutrophil infiltrate, mononuclear cell infiltrate,

nuclear pleomorphism, intraluminal epithelial cells, endotheliatitis, hepatocellular damage,

acidophilic bodies, mitotic figures, neutrophil accumulations, macrophage aggregates,

macrocytosis; skin: apoptoses in epidermal basal layer or lower malphigian layer or outer root

sheath of hair follicle or acrosyringium, lichenoid inflammation, vacuolar change, lymphocytic

satellitosis. The scoring system denoted 0 as normal, 0.5 as focal and rare, 1.0 as focal and

mild, 2.0 as diffuse and mild, 3.0 as diffuse and moderate, and 4.0 as diffuse and severe.

Scores were added to provide a total score for each specimen (40).

T cell transfer and proliferation experiments: To examine the proliferation capability of miR-

142 KO T cells following allogeneic BMT, first, 1 x 106 purified T cells either WT or miR-142

deficient mice were injected intravenously into the BALB/c recipients on day 0 after irradiation

along with WT TCDBM cells (5 × 106). After 7 days, donor T cells in spleen and mLN were

analyzed using FACS staining gated for H2b+ CD90.2+. To assess intrinsic deficiency of miR-

142 KO T cells, purified T cells either from WT mice and miR-142 deficient mice were co-

transferred intravenously into the BALB/c recipients on day 0 after irradiation along with WT

TCDBM cells (5 × 106). After 7 days, donor T cells in spleen and mLN were analyzed using

FACS staining gated for H2b+ CD90.2+ CD45.1+ for WT donor T cells and H2b+ CD90.2+

CD45.2+ for miR-142 deficient donor T cells. For BrdU incorporation experiments, WT B6 T

cells and miR-142 KO T cells purified by negative selection were injected intravenously into the

BALB/c recipients on day 0 after irradiation. After 7 days of BMT, mice were injected with

50mg/kg BrdU (5mg/ml in 0.9% saline, IP) 3 hours prior to tissue collection. Splenocytes were

prepared for FACS staining with antibodies H2b, CD3 and BrdU. For studies pertaining to the in

vivo evaluation of miR-142 KO T cells after targeted silencing of atypical E2Fs using CRISPRi

system, B6 into BALB/c BMT model was used and procedures for silencing of atypical E2Fs

were described as above. The syngeneic recipients are B6 Ly5.2/CD45.1. After 7 days of BMT,

donor T cells in spleen and mLN were stained and analyzed for H2b and CD3 in BALB/c

allogeneic recipients, CD3 and congenic marker CD45.2 in B6 ly5.2 syngeneic recipients.

Cytospin slide preparation and immunocytochemistry Spleen T cells purified by negative

selection either from WT or miR-142 deficiency mice were suspended in PBS containing 0.5%

BSA and adjusted to the concentration of 5 x 106/ml. 5 x 105 (100ul) T cells were spread onto a

poly-lysine precoated slide by cytocentrifugation at 1000 rpm for 5 minutes, fixed in 10% neutral

buffered formalin for 15 minutes and in 70% ethanol for 30 minutes. HistoMouse-MAX Kit (Life

Technologies) and antibodies against E2F7 and E2F8 (abcam) were chosen for

immunocytochemistry and the staining protocol suggested by manufacturer was followed.

Stained slides were observed and analyzed with microscopy (Olympus BX-51) equipped with an

Olympus DP70 digital camera.

Affymetrix microarrays and analyses: The tcRNA was extracted from purified WT B6 T cells

and miR-142 KO T cells with RNeasy Mini Kit (Qiagen). After the quality of the total RNA was

verified by an Agilent 2100 Bioanalyzer, the samples were processed using the WT-Ovation™

Pico System (Affymetrix), and a single round of amplification for samples with even stricter

concentration restraints. This system incorporates oligo(dT) and random primers for

amplification at the 3’ end and throughout the whole transcriptome. Affymetrix mouse genome

430 2.0 Arrays (Affymetrix, Santa Clara, CA), which contain 45,000 transcripts for annotated

genes and expressed sequence tags, were used. The stained arrays were scanned on an

Agilent Gene Array Scanner (Affymetrix) with a 560-nm filter. The data were published and

analyzed using the R statistical environment (http://cran.r-project.org/) provided by Bioconductor

(http://www.bioconductor.org/) and were examined for the quality control by showing the same

distribution of the PM probes for each chip and no degradation. The expression values were

then calculated for each gene using a robust multi-array average (41, 42). This modeling

strategy converts the PM probe values into an expression value (log2-transformed) for each

gene. 4,057 Affy IDs differentially expressed were converted to Human Entrez gene ID

(ConceptGen only uses each gene once) yielding 2392 genes and analyzed for gene function

concept (conceptgen.ncibi.org) based on multiple database including GO and MeSH database.

The probe sets with a fold change of 2 or greater were selected (the probe sets were subjected

to the additional constraint that one of the two samples had an enrichment value of 26 or greater

to prevent the selection of genes with large fold changes based on two small numbers. The

gene set that is involved in specific function concept was analyzed for enrichment by GSEA

(http://www.broadinstitute.org/gsea/index.jsp), and the top enriched genes were further

analyzed for function network by GeneMANIA (http://www.genemania.org/). The microarray

data were deposited in the Gene Expression Omnibus (GEO) database (GSE57543).

Cell-cycle measurement by DNA content Analysis of nuclear DNA content of T cells isolated

from WT or miR-142 deficiency mice treated with or without CD3-CD28 antibodies (0.1ng/ml) for

up to 4 days as indicated or infected with lentiviral particles for overexpression or targeted

silencing of atypical E2Fs. T cells was processed using CycleTEST PLUS DNA reagent kit (BD

Biosciences), following the vendor’s recommendations. After gating on live cells, single cells

were gated using width and area parameters from Propidium iodide. The area parameter

histogram was used to determine the percentage of cells in G1, S, G2/M and >4C phases.

http://www.bioconductor.org/

CRISPR interference system, sgRNA design, cloning, lentiviral package and T cells

infection: The CRISPRi system, derived from the Streptococcus pyogenes CRISPR (clustered

regularly interspaced palindromic repeats) pathway, requiring only the coexpression of a

catalytically inactive Cas9 protein and a single guide RNA (sgRNA), was chosen to knockdown

E2F7 and E2F8 (31, 32). pHR-SFFV-dCas9-BFP-KRAB (Addgene, 46911) was utilized to

express dCas9, which lacks endonucleolytic activity because of carrying 2 point mutations in

both its RuvC-like (D10A) and HNH nuclease (H840A) domains, but it can efficiently silence a

target gene with up to 99.9% repression in Escherichia coli when coexpressed with an sgRNA

designed with a 20-bp complementary region to any gene of interest (43). For sgRNA design,

first we selected exon 2 or exon1 in E2F7 or E2F8 genome loci which contain the PAM sites for

dCas9 binding as the targets (see details below), then designed oligos to obtain chimeric

sgRNA which contain the sequences encoding dCas9 handle and transcription terminator

derived from S. pyogenes.

To avoid off-target effects, we searched the genome for the 14-nt specificity region consisting of

the 12-nt ‘seed’ region of the sgRNA and 2 of the 3-nt (NGG) PAM in the genome, in order to

rule out additional potential binding sites. To achieve the crucial interaction between dCas9 and

the dCas9 handle hairpin for target binding, the prediction of secondary structure folding of the

dCas9 handle hairpin has been processed for each sgRNA construct using online Quikfold

algorithm (http://mfold.rna.albany.edu/?q=DINAMelt/Quickfold).

Expression plasmids were cloned by inserting PCR products into the lentiviral U6-based

expression vector (Addgene, 44248) digested by BstXI and XhoI. To obtain multiplexed

targeting sgRNA plasmids, we inserted compatible restriction enzyme sites (BglII and BamHI) to

flank individual sgRNA expression cassettes as BioBrick parts (44) to concatenate multiple

sgRNA expression cassettes into a single expression vector. The target sequences of the 73

sgRNAs are shown below: the PAMs are in bold and the target sequences are underlined. The

http://mfold.rna.albany.edu/?q=DINAMelt/Quickfold

sgRNAs were designed by searching for 5’-CCN-N (19-24) C3’ in nontemplate DNA strand

between 5’UTR and exon1 or exon 2 of the coding sequence of E2F7 and E2F8. CCN is the

PAM for the S. pyogenes Cas9 recognition. The N (19-24) sequence was used as the base

pairing region of the sgRNA (underlined and italicized). The distance between adjacent sgRNAs

was kept at 130 to 180 bp. The correct cloning for the first sgRNA and cloning of multiple

sgRNA expression cassettes into the same U6 vector with BioBrick strategy were confirmed by

sequencing step by step.

E2F7 Exon2: aaaatatatttgtcgaccgatcaaggatgaccccaaagacaccgatgaagaacgagcc gatcgaCCTgtcaaagcaaagaatcttcaccccagacagaaaccccattactccagta aagccggtcgacaggcagccgcaggtggagccctggacacccacagccaacctgaag atgctcatcagcgccgccagcccagacataagagaccgggagaagaaaaaggagctg ttcagaCCCattgagaataaggaggatgcgttcgtgaactccctgcag

E2F8 Exon1: 5’-agtgcttgcgccgggcgggacgcgggctactgctggggactgtacctgggaccgggagcg cagcgtacggtgcgctttggcatcgcggtgatttcggcacctagggaatccttccctcgc CCCagtacttcgtgtattgaaagaagcctgaaaaagggggtcaagatcccaaagcccttt gtaaatgcccggtcgtgcgcttagagcgcagaggctgaattggagggttgttctcaggcc acttcacaagtccttccttctgagcctgtgcacgtgtgtgtcaggcgagaaacttcagca tctcccccgatgcaggctcggtgcgtgctCCAtcggaacccgggctcgtgcgctccgtcc gcagcccggatcagtgcacaggatagtaaa.

Please see Table 1 for the sgRNA sequence for the E2F7/8 and controls.

Concentrated Lentiviral particles carrying double guide RNAs targeting E2F7 and E2F8, Cas9

or negative control construct were prepared by Vector Core of Biomedical Research Core

Facilities in University of Michigan. miR-142 KO or WT T cells were purified by negative

selection and infected with lentiviral particles carrying double guide RNAs targeting E2F7 and

E2F8, or negative control along with Cas9 lentiviral particles for 3 days with complete medium

supplemented with Polybrene (Sigma-Aldrich) at a final concentration of 5 μg/ml. Infection

efficiency was controlled under microscopy by fluorescence for BFP or mCherry infused in

lentiviral constructs for dCas9 or sgRNA.

Lentiviral infection: For overexpression experiments, lentiviral transduction particles

containing inserts specific for E2F7 (NM_178609) or E2F8 (NM_001013368.5) or control vector

were obtained from Applied Biological Materials Inc. B6 WT splenocytes were cultured in

complete medium for 24 hours. The medium was then replaced with complete medium

supplemented with Polybrene (Sigma-Aldrich) at a final concentration of 5 μg/ml, and the cells

were infected with lentiviral particles carrying E2F7 or E2F8, or control vector for 3 days. T cells

were isolated by negative selection (Pan T cell Isolation Kit II; Miltenyi Biotec), and their RNA

was isolated. The transduction and expression efficiency was examined by SYBR Green qPCR

using specific primers for E2F7, E2F8, PCAF (negative control) and GAPDH (input control). The

purified T cells were processed for cell cycle analyses and cell proliferation experiments. For

CRISPR interference system for targeted silencing in WT or miR-142 KO T cells, cells were

infected with lentiviral particles, processed for examining silencing efficiency and cell cycle

analyses and cell proliferation experiments same as above.

PCR: miRNA and mRNA quantitative real-time PCR assays (qPCR) were performed as

previously described (9,11, 15). For the miR qPCR, miR-enriched RNA was isolated using the

miRNeasy Mini Kit (Qiagen) from bone marrow cells (WT, heterozygous and miR-142

deficiency mice), T cells (from spleens) and control cells (Raw264.7, NIH3T3 cells). Reverse

transcription was performed by incubating a mixture of 10 ng RNA, 0.15 μl of 100 mM dNTPs,

1.00 μl MultiScribe Reverse Transcriptase (50 U/μl), 1.50 μl 10X RT Buffer, 0.188 μl RNase

Inhibitor (20 U/μl), 4.192 μl nuclease-free water, and 3 μl 5X specific RT primers for miR142-3p

and snoRNA135 (as an internal control; Applied Biosystems, Foster City, CA) at 16°C for 30

minutes, 42°C for 30 min and 85°C for 5 min. The qPCR was performed on an Eppendorf

realplex2 system (Eppendorf, Westbury, NY), which was set to the following program: 95°C for

10 min, followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. Each PCR

reaction mix contained 10 μl of TaqMan 2X Universal PCR Master Mix (no AmpErase UNG),

7.67 μl nuclease-free water, 1.33 μl RT product and 1 μl 20X specific PCR primers for miR142-

3p and snoRNA135 (Applied Biosystems, Foster City, CA). All of the samples were tested in

triplicate. snoRNA-135 was used to normalize the expression levels of the target miRs by

correcting the differences in the amount of RNA that was loaded into the qPCR reactions. The

threshold levels for each experiment were set during the exponential phase of the reaction. For

the mRNA qPCR, the total RNA was isolated from T cells purified from splenocytes of WT or

miR-142 deficiency mice treated with or without CD3-CD28 antibodies for 0, 6, 12, 24 and 48

hours, respectively, or infected with overexpression or targeted silencing of atypical E2Fs, using

RNeasy Mini Kit (Qiagen). Briefly, 2 μg of total RNA was reverse-transcribed into cDNA using

High capacity cDNA Reverse Transcription Kit (Applied Biosystems ) in the presence of random

hexamers. All of the reactions were performed in triplicate with SYBR Green Master Mix

(Applied Biosystems) and 25 ng of both the forward and reverse primers according to the

manufacturer’s recommended thermocycling conditions and were then subjected to melt curve

analysis. The threshold levels for each experiment were set during the exponential phase of the

reaction. The DNA in each sample was quantified by interpolation of its threshold cycle (Ct)

value from a standard curve of Ct values. The calculated quantity of the target gene for each

sample was divided by the average sample quantity of the housekeeping gene glyceraldehyde-

3-phosphate dehydrogenase (GAPDH) to obtain the relative gene expression. All of the

oligonucleotide primers were synthesized by Integrated DNA Technologies (Coralville, IA, USA).

The primers used were:

E2F1 forward 5'-agggtccctatggaagagga-3', reverse 5'-caggtccccaaagtcacagt-3';

E2F2 forward 5'-gatggagtcctggacctgaa-3', reverse 5'-gggagcaactctgaatgagc-3';

E2F3 forward 5'-gctgtaccctggacctcaaa-3', reverse 5'-gggtctgtgtgtttccgtct-3';

E2F4 forward 5'-caagcctgccttagctcaac-3', reverse 5'-atccagcagtgcagaggact-3';

E2F5 forward 5'- tgtggctacagcaaagcatc-3', reverse 5'-aggccctgagtgactcttca-3';

E2F6 forward 5'- ctgggggcattcttgactta-3', reverse 5'- gagttctgcctgcagcttct-3';

E2F7 forward 5'-gcgctgtggatgagtatgag-3', E2F7-2 reverse 5'-cgagactgacggcgacct-3'

E2F8 forward 5'- ttgcaagatgcagttggaag-3', reverse 5'-caggcactgcagatgacaat-3'.

PCAF Forward 5’-caaggccaatgaaacctgcaag-3’, reverse 5’-ggtagaaatagacttgtttggtg-3’

GAPDH forward 5’-ccacagtccatgccatcactgc-3’, reverse 5’-gcccaagatgcccttcagtggg-3’.

Mixed lymphocyte cultures (MLR), CFSE and Annexin v staining. For MLR, T cells were

isolated from spleen cells suspensions from WT or miR-142 deficiency B6 mice untreated or

treated for atypical E2Fs overexpression or targeted silencing by negative selection (Pan T cell

Isolation Kit II; Miltenyi Biotec). The splenocytes from BALB/c or WT B6 mice were processed

for T cell deletion after removal of red blood cells by negative selection via autoMACS using

anti-CD90.2 microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and followed by

radiation (3000 cGY). Then T cells were cultured with radiated and T cell-deleted splenocytes

with ratio of 4:1 (T cells versus splenocytes, 3 x 105 : 7.5 x 104) for 48, 72 or 96 hours using 96-

well round-bottomed plates (Falcon Labware, Lincoln Park, NJ). Supernatants were collected

for measurements of cytokine concentrations by ELISA. Proliferation was determined by

incubation of cells with 3H-TdR (1 Ci/well [0.037 MBq]) for final 16 hours and proliferation was

determined on a 1205 Betaplate reader (Wallac, Turku, Finland). For CSFE tracing, purified T

cells were labeled with CFSE at final concentration of 5 µmol/L according to manufacturer’s

instruction (Molecular Probes). CFSE-labeled T cells were cultured similarly to above MLR for 4,

5 and 6 days, then collected cells were gated for APC-CD90.2 positive and CFSE dilution and

determined for apoptosis in divided cells by PE-Annexin V staining. For CD3-CD28 antibodies

activation, T cells isolated from WT or miR-142 deficiency untreated or treated same as above

were stimulated with CD3-CD28 antibodies (0.1ng/ml) for 48 or 72 hours. Supernatants were

collected for measurements of cytokine concentrations by ELISA. Proliferation was determined

by incubation of cells with 3H-TdR (1 Ci/well [0.037 MBq]) for final 6 hours and proliferation was

determined on a 1205 Betaplate reader (Wallac, Turku, Finland). CFSE-labeled T cells were

treated with CD3-CD28 antibodies for 2~6 days, and collected cells were gated for APC-

CD90.2 positive and CFSE dilution and determined for apoptosis in divided cells by PE-Annexin

V staining.

Immunoblot analyses: Cell lysates were prepared from WT and miR-142 KO T cells, and

CD3/28 T cells. A 50-μg quantity of each protein extract was boiled in sample buffer, separated

by SDS-PAGE, and transferred onto a PVDF membrane (GE Healthcare). The membrane was

incubated for 30 min with 5% nonfat dry milk and then incubated overnight at 4°C with the

following Abs: anti-E2F7 rabbit polyclonal Ab (1:1,000 in 5% nonfat milk; ab56022, Abcam),

anti-E2F8 rabbit polyclonal Ab (1:1,000 in 5% nonfat milk; ab109569, Abcam), anti-AxnA1 rabbit

polyclonal Ab (1:1, 000 in 5% nonfat milk; Cat. 3299 Cell Signaling) and anti-actin mouse mAb

(1:1,000; Abcam). After washing with TBS-T, the blot was incubated with an HRP secondary Ab.

The signals were visualized by enhanced chemiluminescence (Thermo Scientific).

ELISAs: Concentrations of TNF-α, IL-6, IL-2, IFN-γ and IL-17A were measured by ELISA with

specific anti-mouse mAbs for capture and detection, and the appropriate standards were

purchased from BD Biosciences — Pharmingen (IFN-γ and TNF-α) and R&D Systems (IL-6 and

IL-2). Assays were performed according to the manufacturer’s protocol and read at 450 nm by

using a microplate reader (Bio-Rad).

FACS and intracellular staining analysis: Single cell suspensions of spleens, thymuses and

bone marrows from tibia and fibula were prepared as previously described (38, 39, 40). Briefly,

to analyze cell surface phenotype, splenocytes, thymocytes, bone marrow cells from WT B6,

miR-142 deficiency mice, or transplanted animals were washed with FACS wash buffer (2%

bovine serum albumin [BSA] in phosphate-buffered saline [PBS]) and pre-incubated with the rat

anti-mouse FcR mAb 2.4G2 for 15 minutes at 4 ℃ to block nonspecific FcR binding of labeled

antibodies. resuspended in FACS wash buffer and stained with conjugated monoclonal

antibodies purchased from BD Biosciences (San Jose, CA): Fluorescein isothiocyanate (FITC) -

conjugated monoclonal antibodies (MoAbs) to CD4, CD8, CD90.2, CD3, c-Kit, IgM, CD44,

CD45.2, CD45.1, H2b, IL-7Rα and CD62L; phycoerythrin (PE)-conjugated MoAbs to CD45.1,

CD8, Lin, and allophycocyanin (APC)-conjugated MoAbs to CD90.2, CD3, CD4 were

purchased from eBioscience (SanDiego, CA). Next, cells were fixed with 1x BD FACSTM Lysing

Solution (BD Biosciences, San Jose, CA), and analyzed using a FACS Vantage SE (Becton

Dickinson, San Jose, CA). For intracellular staining (IL-17A, IFNγ and IL-2), cells were treated

with 1x cell stimulation cocktail (plus protein transport inhibitors 1:500, eBioscience, Cat. No. 00-

4975) for 6 hours, then stained for APC conjugated CD90.2. or CD3 antibodies. Next, the cells

were treated with fixation Buffer (Biolegend, Cat. No.420801) in the dark for 20 minutes at room

temperature, followed by 1X Permeabilization Wash Buffer (Biolegend Cat. No. 421002) for 20

minutes. Resuspend fixed/permeabilized cells in residual Permeabilization Wash Buffer were

incubated with predetermined optimum concentration of PE-conjugated antibody of interest

(against IFN-γ, IL-17A or IL-2) or an appropriate negative control for 20 minutes in the dark at

room temperature. Intracellular labeled cells were resuspended in 0.5 ml cell staining buffer and

analyzed with appropriate controls.

Statistical analyses: Data were analyzed using Prism GraphPad (Version 5 or 6). The relevant

statistics were clarified by biostatistician (T.B.). Briefly, comparisons between 2 groups were

calculated using t test, while comparisons between 2 groups at multiple time points were

calculated utilizing Holm-Sidak method. Log-rank (Mantel-Cox) test was utilized to analyze all

survival data. Mann-Whitney test was used for the statistical analysis of clinical scores (38, 39,

45, 46, 47). All of the gene expression and relative quantification data were analyzed on the log

(base 2) scale. The comparisons of the gene expression values across the sample classes were

performed using the paired two-sample Student’s t-test. Affymetrix microarray data were further

analyzed for function concept by GO, MeSH databases and gene sets for specific gene

concepts were ranked by P-Value or/and Q-Value. Gene enrichment was analyzed with GSEA

and genes in function network were determined by GeneMANIA database. P value less than

0.05 was considered statistically significant.

Study approval. All animals were cared for under regulations reviewed and approved by the

University Committee on Use and Care of Animals of the University of Michigan, based on

University Laboratory Animal Medicine guidelines.

Supplementary Figure legends

Supplementary Figure 1 Validation of null expression of miR-142 in miR-142-/- mice. A. The

loss of miR-142 expression at RNA level in BM cells isolated from tibia and fibula was confirmed

by qTaqMan PCR using specific probes against miR-142-3p, using Raw264.7 cells as positive

control, NIH3T3 cells as negative control and snoRNA-135 as loading control. Data are

representative of three similar experiments. B. The loss of miR-142 expression at RNA level in

purified T cells isolated either from WT or miR-142 KO mice was confirmed by qTaqMan PCR

using specific probes against miR-142-3p using snoRNA-135 as loading control. Data are

representative of three independent experiments. The calculated summary data were shown in

Figure 1 D.

Supplementary Figure 2. Confirmation of previously reported targets of miR-142-3p in miR-

142 KO mice. A. Validation of greater production of IL-6 in DCs isolated from miR-142 KO mice

upon stimulation of LPS. Splenic DCs were isolated from WT or miR-142 KO mice as described

in Methods and Materials. DCs were treated with or without LPS (500ng/ml) for 6 h, the

supernatants were collected for measurements of IL-6 protein by Elisa. Data were combined

from two independent experiments (mean± SEM). B. Null expression of miR-142 did not

change TNFα expression in DCs isolated from miR-142 KO mice upon stimulation of LPS. The

same supernatants as in A were detected for TNFα protein level. Data were combined from two

independent experiments (mean± SEM). C and D. Significantly higher expression of IL-6 and

AC9 (adenylyl cyclase 9) in miR-142 KO T cells. Data were extracted from Affymetrix

expression values (Log2) from 3 biological triplicates in T cells either from WT or miR142 KO

mice (mean± SEM). P values were obtained using unpaired t test.

Supplementary Figure 3. miR-142 KO mice showed no apparent developmental anomalies. A.

Flow cytometric analyses of BM cells isolated from tibia and fibula showed the similar numbers

of Lin-Scal+ c-Kit+ HSCs in miR-142-/- mice compared with WT littermates. Data were

summarized from three independent experiments (mean± SEM). B. Thymic analyses

demonstrated no significant differences in DP (double positive), DN (double negative), single

positive CD4 and CD8 T cells, and total thymocytes between WT and KO animals. Data were

summarized from three independent experiments (mean± SEM). C. Spleens demonstrated

similar numbers of total T cells (CD3+) and naïve T cells (CD44lowCD62L+), effector

(CD4+CD44highCD62L-, or CD8+CD44highCD62L-) and central memory T cells

(CD4+CD44highCD62L+, CD8+CD44highCD62L+) between the WT and KO animals. Data were

summarized from three independent experiments (mean± SEM). P values were obtained using

unpaired t test.

Supplementary Figure 4. miR-142 deficiency in T cells induced S and G2/M arrests. A. Plot

looks at the cell cycle data, and uses placed markers to estimate percentages. Cell cycle was

measured by analyses of nuclear DNA content of T cells isolated from WT or miR-142 KO mice.

After gating on live cells, single cells were gated using width and area parameters from

Propidium iodide staining. The area parameter histogram was used to determine the percentage

of cells in subG1, G1, S, G2/M and >4C phases. B. miR-142 deficiency in T cells induced S

and G2/M arrests on days 0, 1, 2, 3 and 4 and reduction in apoptosis on day 4 upon untreated

or CD3-CD28 Abs stimulation compared to WT T cells. Data are representative of three

independent experiments. C. Loss of miR-142 in T cells induced significant arrests in S and

G2/M phases. T cells were purified from WT or miR-142 KO mice and treated with CD3-CD28

Abs as in B. Flow cytometric analyses of DNA content of propidium iodide (PI)-stained cells

were measured as area parameter histogram to determine the percentage of cells in subG1,

G1, S, G2/M and >4C phases. P values were obtained using multiple t test. Combined results

were from three independent similar experiments (mean± SEM).

Supplementary Figure 5.Visual image for ranking enrichment scores along with heat map from

GSEA (http://www.broadinstitute.org/gsea/) shows the upregulated gene set in miR-142 KO T

cells that is involved in cell cycle function concept. The most predominant genes in miR-142 KO

T cells that significantly involved in cell cycle regulation were identified. Data were obtained from

three biological triplicates for each group. The significant ranking of top relevant genes sorted by

ES was listed in Supplementary table 2.

Supplementary Figure 6. Gene Set Network Prediction for top 35 genes by GeneMANIA

(http://genemania.org/). 35 genes which received ES value higher than 0.5 (from GSEA) among

upregulated genes which are involved in cell cycle function in miR-142 KO T cells were further

analyzed by GeneMANIA. Functional networks predicted by GeneMANIA were ranked by false

discovery rate (FDR) values. DNA replication network is ranked at top 1. Data were obtained

from three biological triplicates for each group.

Supplementary Figure 7. Top 7 upregulated genes which involved in cell cycle function in miR-

142 KO T cells were identified by Affymetrix expression microarray as shown by perfect match

probes. Data are collected expression values (Log2) from biological triplicates in T cells either

from WT or miR-142 KO mice (mean± SEM). P values were obtained using unpaired t test.

**P<0.01. The complete expression values were list in Supplementary table 1.

Supplementary Figure 8. Atypical E2Fs were significantly upregulated in miR-142 KO T cells

compared to WT T cells. A. Confirming the upregulated E2F7 and E2F8 in miR-142 KO T cells

using qPCR. Results shown were three independent experiments (mean± SEM), and

summarized and analyzed shown in Figure 6 A. B. Confirming the upregulated Anxa1 in miR-

142 KO T cells using western blot. AnxA1 was upregulated in miR-142 KO T cells, particularly

higher in CD4 T cells. Data are representative of three independent experiments.

Supplementary Figure 9. Kinetic expression5 of typical E2F family members in T cell cycling

when activated with CD3 and CD28 Abs. Similar dynamic expressions of E2F1, 2, 3, 4, 5 and 6

between miR-142 KO T cells and WT T cells upon stimulation with CD3-CD28 Abs from 0 to 48

h. Combined results were from three independent experiments (mean± SEM). P values were

obtained using multiple t test.

Supplementary Figure 10. . Overexpression of atypical E2F induced significantly increased

arrests in S and G2/M phases but less apoptosis. WT T cells infected with lentiviral particles

expressing E2F7 and E2F8 or scramble control for three days were processed for cell cycle

analyses as in Supplementary Figure 4. A. The transfection efficiency was examined by SYBR

Green qPCR using specific primers for E2F7, E2F8, PCAF and GAPDH. Data were combined

from three independent experiments (mean± SEM). P value was obtained using unpaired t test.

B. Overexpression of E2F7 and 8 in WT T cells significantly induced S and G2/M phase arrests,

but less apoptosis (SubG1 phase) in T cells untreated or treated with CD3-CD28 Abs. Data are

representative of three independent experiments. C. T cell phenotypes after infection with

lentiviral particles. After WT T cells were infected with lentiviral particles expressing E2F7 and

E2F8 or scramble control for three days, T cells were stained with Abs CD4-APC, CD8-PE or

APC, CD44-PE, CD62L-PE, CD25-PE, CD-PD1-PE, CTLA4-PE. For FACS analyses, CD4-APC

versus CD8-PE was used for CD4 and CD8 T cells proportion. Then CD4-APC or CD8-APC

was gated for analyzing T cell subpopulations or exhaustion. Data were from 3 sets of results

(mean± SEM).

Supplementary Figure 11. Improvement of proliferation and reduction of cell cycle arrests in S

and G2/M phases in miR-142 KO T cells after targeted silencing of E2F7 and E2F8 by CRISPRi

system. miR-142 KO T cells infected with lentiviral particles carrying double guide RNAs

targeting E2F7 and E2F8 along or control lentiviral particles along with dCas9 lentiviral particles

for 3 days were processed for cell cycle analyses as in Supplementary Figure 4. A. The

knockdown efficiency was examined by SYBR Green qPCR using specific primers for E2F7,

E2F8, PCAF and GAPDH. Data were combined from three independent experiments (mean±

SEM). P values were obtained using unpaired t test. B. T cell phenotypes after infection with

lentiviral particles. After miR-142 T cells were infected with lentiviral particles expressing

CRISPRi-E2F7- E2F8 or scramble control along with dCAS9 particles for three days, T cells

were stained with Abs CD4-APC, CD8-PE or APC, CD44-PE, CD62L-PE, CD25-PE, CD-PD1-

PE, CTLA4-PE. For FACS analyses, CD4-APC versus CD8-PE was used for CD4 and CD8 T

cells proportion. Then CD4-APC or CD8-APC was gated for analyzing T cell subpopulations or

exhaustion. Data were from 3 sets of results (mean± SEM). C. After treated with CD3-CD28 Abs

for 0-3 days, T cells were processed for cell cycle analysis. Knockdown of E2F7 and E2F8

significantly induced less arrest in S and G2/M phases but more apoptosis (subG1 phase). Data

were representative of three independent experiments. The summarized data were shown in

Figure 7 C.

Supplementary Figure 12. T cell phenotypes after infection with lentiviral particles. After WT T

cells were infected with lentiviral particles expressing CRIPSi-E2F7- E2F8 or scramble control

along with dCAS9 paticles for 3 days, T cells were stained with Abs CD4-APC, CD8-PE or APC,

CD44-PE, CD62L-PE, CD25-PE, CD-PD1-PE, CTLA4-PE. For FACS analyses, CD4-APC

versus CD8-PE was used for CD4 and CD8 T cells proportion. Then CD4-APC or CD8-APC

was gated for analyzing T cell subpopulations or exhaustion. Data were from 3 sets of results

(mean± SEM).

Supplementary Table 1 (Excel file). Analysis data of Affymetrix expression microarray from

biological triplicates of miR-142 KO and WT T cells. Upregulated genes in miR-142 KO T cells

identified by Affymetrix microarrays were analyzed using gene function concept

(conceptgen.ncibi.org)

Supplementary Table 2. (Excel file). Analysis data of genes involved in cell cycle functional

concept by GSEA ranked with Enrichment Scores. The upregulated gene set in miR-142 KO T

cells that is involved in cell cycle function concept was analyzed by GSEA. The most

predominant genes in miR-142 KO T cells that significantly involved in cell cycle regulation were

identified as listed by ES ranking.

miR-142-3p expression in BM using mature miR-142-3p TaqMan probes

Supplementary Figure 1

A

B

Fluo

resc

ence

Sig

nal

Fluo

resc

ence

Sig

nal

Fluo

resc

ence

Sig

nal

Fluo

resc

ence

Sig

nal

miR-142-3p expression in miR-142 KO T cells using mature miR-142-3p TaqMan probes

W T - D C W T - D C K O - D C K O - D C0

5 0

1 0 0

1 5 0

2 0 0P<0.01

W T - D C W T - D C K O - D C K O - D C0

5 0

1 0 0

1 5 0

LPS - + - + (500 ng/ml)

LPS - + - + (500ng/ml)

IL-6

(pg/

ml)

TN

Fα p

g/m

l IL-6

Exp

ress

ion

val

ue

(Log

2, A

ffy

)


A

B

C

D AC9

NS

P<0.05

W T T c e lls 1 4 2 K O T c e lls0

2

4

6

8

1 0 P<0.01

Exp

ress

ion

val

ue

(log2

, Aff

y)

W T T c e l l s 1 4 2 K O c e l l s0

2

4

6

8


BM Lin-S+K+ A B

W T 1 4 2 K O0

2 .0×1 0 6

4 .0×1 0 6

6 .0×1 0 6

W T 1 4 2 K O0

1 .0×1 0 6

2 .0×1 0 6

3 .0×1 0 6

4 .0×1 0 6

W T 1 4 2 K O0

2 .0×1 0 7

4 .0×1 0 7

6 .0×1 0 7

8 .0×1 0 7

W T 1 4 2 K O0

1 .0×1 0 6

2 .0×1 0 6

3 .0×1 0 6

4 .0×1 0 6

5 .0×1 0 6

W T 1 4 2 K O0

5 .0×1 0 5

1 .0×1 0 6

1 .5×1 0 6

2 .0×1 0 6

2 .5×1 0 6

W T m iR 1 4 2 K O0

2 .0×1 0 7

4 .0×1 0 7

6 .0×1 0 7

8 .0×1 0 7

1 .0×1 0 8

CD4-CD8- (DN)

CD4+ (SP)

CD4+CD8+ (DP)

CD8+ (SP)

Total Thymocytes

C

CD4+CD44highCD62L+

CD8+CD44highCD62L-

CD44lowCD62L+ Total T cells CD3+

W T 1 4 2 K O0

1 .0×1 0 7

2 .0×1 0 7

3 .0×1 0 7

W T 1 4 2 K O0

1 .0×1 0 7

2 .0×1 0 7

3 .0×1 0 7

4 .0×1 0 7

W T 1 4 2 K O0

1 .0×1 0 6

2 .0×1 0 6

3 .0×1 0 6

W T 1 4 2 K O0

1 .0×1 0 6

2 .0×1 0 6

3 .0×1 0 6

W T 1 4 2 K O0

1 .0×1 0 6

2 .0×1 0 6

3 .0×1 0 6

W T 1 4 2 K O0

2 .0×1 0 5

4 .0×1 0 5

6 .0×1 0 5

CD8+CD44highCD62L+

CD4+CD44highCD62L-

NS

NS

NS

NS

NS

NS

NS

NS

NS

NS

NS

NS

Cel

l Num

ber

Cel

l Num

ber

Cel

l Num

ber

Cel

l Num

ber

Cel

l Num

ber

Cel

l Num

ber

Cel

l Num

ber

Cel

l Num

ber

Cel

l Num

ber

Cel

l Num

ber

Cel

l Num

ber

Cel

l Num

ber


Day 1 Day 2 Day 3 Day 4 Day 0

WT T cells

142KO T cells

>4C SubG1

G2/M S G1

A

B

SubG1 Phase

gate

d si

ngle

cel

ls (%

)

G1 Phase

0 1 2 3 40

5

1 0

1 5

2 0

W T

1 4 2 K O

D a y

S Phase

0 1 2 3 40

5

1 0

1 5

W T1 4 2 K O

D a y

G2/M Phase

0 1 2 3 40

1

2

3

4

W T1 4 2 K O

D a y

>4C

**

C

**

**

** **

** ** **

** ** ** **

** ** * ** **

** **

Supplementary Table 1 Affy analysis Excel file Upregulated genes in miR-142 KO T cells identified by Affymetrix microarrays were analyzed using gene function concept (conceptgen.ncibi.org)

Supplementary Table 2 GSEA excel file The upregulated gene set in miR-142 KO T cells that is involved in cell cycle function concept was analyzed by GSEA. The most predominant genes in miR-142 KO T cells that significantly involved in cell cycle regulation were identified as listed by ES ranking.

Supplementary Table 3: T cell precursors in bone marrow

Mouse Absolute Number of T cell precursor (L-S+K+ IL-7Ra+)

P value

WT 3.64 x 103 ± 4.2 x 103 NS miR-142 KO 6.11 x 104 ± 5.8 x 104

Bone marrow cells were isolated from 2 femurs and tibias from WT and miR-142 KO mice (n=4 for each group) aged at 12-16 weeks. Bone marrow cells were stained with antibodies against Lineage marker, Sca1, cKit and IL-7Ra. T cell precursors were identified as Lineage markers- Sca1+ cKit+ and IL-7Ra+. Absolute numbers of T cell precursors were calculated for each mouse as Mean ± SEM.

D N A r ep lica t io

n

c e ll c y c le p

h a se tra n s it i

o n

G2 /M

tra n s it i

o n of m

itot ic

c e ll c y c le

p o s it iv e r e g u la

t ion o

f ce ll

d ivis io

n

c e ll c y c le c h e ck p o in

t

ma in

ten a n c e o

f lo c a t io

n in c e ll

r e g u lat io

n of D

N A r ep lica t io

n

o r g a n e lle a

s s emb ly

r e g u lat io

n of m

ic r o tub u le -b

a sed pr o c e s s

0 .0 0 0 0

0 .0 0 0 5

0 .0 0 1 0

0 .0 0 1 5

0 .0 0 2 0 F D R

Gene Set Network Prediction for Top 35 genes by GeneMANIA


Func

tiona

l net

wor

k ra

nk

by fa

lse

disc

over

y ra

te v

alue

s

E2F8 E2F7 AnxA1 Evi5 Anln Ccne2

Expression values of Top 7 upregulated genes in miR-142 KO T cells (Affy. Expression values )


Esco2

W T T c e l l s 1 4 2 K O T c e l l s0

5

1 0

1 5 **


2

4

6

8

1 0**


5

1 0

1 5 **


5

1 0

1 5 **

Exp

ress

ion

Valu

es

(Aff

y. L

og2)


5

1 0

1 5 **


5

1 0

1 5 **


5

1 0

1 5**

WT KO WT KO WT KO T cells CD8 CD4 1 6.8 1.3 9.4 1 3

B-actin AnxA1


WT

1

WT

2

WT

3

1 4 2KO

1

1 4 2KO

2

1 4 2KO

30

5

1 0

1 5

2 0 E2F7

WT

1

WT

2

WT

3

1 4 2KO

1

1 4 2KO

2

1 4 2KO

305

1 01 52 02 5 E2F8

Rel

ativ

e E

xpre

ssio

n o

f mR

NA

A Q-PCR R

elat

ive

Exp

ress

ion

of m

RN

A

B Western Blot

0 h 6 h 1 2 h 2 4 h 4 8 h0

1

2

3

4

5

W T1 4 2 K O E2F1 E2F3

0 h 6 h 1 2 h 2 4 h 4 8 h0

1

2

3

4

5

W T1 4 2 K O E2F4

0 h 6 h 1 2 h 2 4 h 4 8 h0

5

1 0

1 5

W T1 4 2 K O E2F5

0 h 6 h 1 2 h 2 4 h 4 8 h0

5

1 0

1 5

2 0

W T1 4 2 K O

0 h 6 h 1 2 h 2 4 h 4 8 h0

2

4

6

8

W T1 4 2 K O

0 h 6 h 1 2 h 2 4 h 4 8 h0

5

1 0

1 5

W T1 4 2 K O E2F6

E2F2


Kinetic Expression of E2F Family in Response to CD3-CD28 antibody Stimulation

Rel

ated

mR

NA

Exp

ress

ion

(F

old

chan

ges)

R

elat

ed m

RN

A E

xpre

ssio

n

(Fol

d ch

ange

s) *

*

**

*

** **

** *

*

* *

* ** **


P C A F E 2 F 7 P C A F E 2 F 70

5

1 0

1 5

S c r a m b le E 2 F 7 O v e r e x p r e s s io nP C A F E 2 F 8 P C A F E 2 F 8

0

1

2

3

4

S c r a m b le E 2 F 8 O v e r e x p r e s s io n

A

Overexpression of E2F7 and E2F8

Day 0 Day 1 Day 2 Day 3 Day 4

E2F

7+E

2F8

Scra

mbl

e co

ntro

l

B

P<0.001 P<0.001

Rel

ated

mR

NA

Exp

ress

ion

(F

old

chan

ges)

C D 4+ C

D 4 4+

C D+ C D 6 2 L

+

C D 4+ C

D 2 5+

C D 4+ P

D 1+

C D 4+ C

T L A 4+

C D 8+ C D 4 4

+

C D 8+ C D 6 2 L

+

C D 8+ P D 1

+

C D 8+ C T L A 4

+0

5

1 0

4 0

5 0

6 0

7 5

9 0C o n tro lE 2 F 7 -8 o ve re xp re ss io n

C D 4 + C D 8 +0

2 0

4 0

6 0C o n tro l

E 2 F 7 -8 o v e re x p re s s io n

% %

C

Supplementary Figure 11 Targeted silencing of E2F7 and E2F8 by CRISPRi in miR-142 KO T cells

P C A F E 2 F 8 P C A F E 2 F 80 .0

0 .5

1 .0

1 .5

sg-Control sg-8AB

P<0.001

P C A F E 2 F 7 P C A F E 2 F 70 .0

0 .5

1 .0

1 .5 P<0.001

sg-Control sg-7AB

Day 0 Day 1 Day 2 Day 3

CR

ISPR

i C

TL

C

A R

elat

ed m

RN

A E

xpre

ssio

n

(Fol

d ch

ange

s)

B

C D 4+ C D 4 4

+

C D+ C D 6 2 L

+

C D 4+ C D 2 5

+

C D 4+ P D 1

+

C D 4+ C T L A 4

+

C D 8+ C D 4 4

+

C D 8+ C D 6 2 L

+

C D 8+ P D 1

+

C D 8+ C T L A 4

+0

1 0

2 0

4 0

5 06 0

8 0

1 0 0 C o n tro lE 2 F 7 -8 C R IS P i

C D 4 + C D 8 +0

2 0

4 0

6 0 C o n tro lE 2 F 7 -8 C R IS P i

% %


CD

4+ C

D4 4

+

CD+ C

D6 2 L

+

CD

4+ C

D2 5

+

CD

4+ P D

1+

CD

4+ C

T L A4+

CD

8+ C

D4 4

+

CD

8+ C

D6 2 L

+

CD

8+ P D

1+

CD

8+ C

T L A4+

01 02 03 0

4 05 06 0

7 08 09 0

1 0 0C o n tro lE 2 F 7 -8 C R IS P i

C D 4 + C D 8 +0

2 0

4 0

6 0

8 0 C o n tro l

E 2 F 7 -8 C R IS P i

% %

detailed materials and methods gene targeting and

Documents