detection and identification of plant viruses belonging to...
TRANSCRIPT
DETECTION AND IDENTIFICATION
OF POTYVIRUSES AND
GEMINIVIRUSES IN VIETNAM
by
Cuong Viet Ha
Tropical Crops and Biocommodities Domain
Institute of Health and Biomedical Innovation
A thesis submitted for the degree of Doctor of Philosophy to the
Queensland University of Technology
2007
ABSTRACT
Prior to the commencement of this project, few plant viruses had been identified
from Vietnam despite virus-like symptoms being commonly observed on many crops
and weeds. In limited surveys in the late 1990’s, preliminary evidence was obtained
indicating that potyviruses and geminiviruses were causing significant diseases. As a
result, this study was aimed at developing generic PCR-based methods for the rapid
detection of viruses belonging to viruses in the families Potyviridae and
Geminiviridae in plant samples collected from Vietnam, and to characterise the
viruses at the molecular level.
Novel degenerate PCR primers were developed for the identification of
begomoviruses. Using these primers, 17 begomoviruses species infecting seven crop
and nine weed species in Vietnam were identified and characterised. Sequence
analyses showed that ten of the viruses (six monopartite and four bipartite) were new
species. Of the seven previously characterized begomoviruses, five were identified in
Vietnam for the first time. Additionally, eight DNA-ß and three nanovirus-like DNA-
1 molecules were also found associated with the monopartite viruses. Five of the
DNA-β molecules were putatively novel.
Two novel bipartite begomoviruses, named Corchorus yellow vein virus (CoYVV)
and Corchorus golden mosaic virus (CoGMV), were isolated from jute plants.
Analysis of these viruses showed that they were more similar to New World
begomoviruses than to viruses from the Old World. This was based on the absence of
an AV2 open reading frame, the presence of an N-terminal PWRLMAGT motif in
ii
the coat protein and phylogenetic analysis of the DNA A and DNA B nucleotide and
deduced amino acid sequences. This is the first known occurrence of Old World
viruses bearing features of New World viruses, and their presence in Vietnam
suggests the presence of a “New World” virus in the Old World prior to Gondwana
separation. Other interesting features relating to begomoviruses identified in Vietnam
were; (i) the detection of several recombination events, particularly between the
newly identified Tomato yellow leaf curl Vietnam virus (TYLCVNV), and the
previously characterised, Tomato leaf curl Vietnam virus (ToLCVV), (ii) the
identification of new natural hosts of Sida leaf curl virus (SiLCV), Papaya leaf curl
China virus (PaLCuCNV) and Alternanthera yellow vein virus (AlYVV), (iii) the
first report of variation in the geminivirus stem-loop nonanucleotide sequence
(CoGMV sequence was TATTATTAC rather than TAATATTAC) and (iv) the first
report of different stem sequences in the stem-loop structure of two genomic
components from a bipartite begomovirus, Kudzu mosaic virus (KuMV). The
sequence and phylogenetic analyses of the begomoviruses and begomovirus-
associated DNAs identified in this study suggested that South East Asia, and
Vietnam in particular, may be a centre of begomovirus diversity.
Two pairs of degenerate primers, designed in the CI gene (CIFor/CIRev) and HC-Pro
gene (HPFo/HPRev), were developed for the detection of viruses in the genus
Potyvirus. Using these primers, three novel potyviruses from Vietnam were detected,
namely Telosma mosaic virus (TelMV) infecting telosma (Telosma cordata), Peace
lily mosaic virus (PeLMV) infecting peace lily (Spathiphyllum patinii) and Wild
tomato mosaic virus (WTMV) infecting wild tomato (Solanum torvum). The
fragments amplified by the two sets of primers enabled additional PCR and complete
iii
genomic sequencing of these three viruses and a Banana bract mosaic virus
(BBrMV) isolate from the Philippines. All four viruses shared genomic features
typical of potyviruses. Sequence comparisons and phylogenetic analyses indicated
that WTMV was most closely related to Chilli veinal mottle virus (ChiVMV) and
Pepper veinal mottle virus (PVMV) while PeLMV, TelMV were related to different
extents with members of the BCMV subgroup.
The incidence of potyviruses infecting plants in Vietnam was investigated using the
potyvirus-specific primers. Fifty two virus isolates from 13 distinct potyvirus species
infecting a broad range of crops were identified in Vietnam by PCR and sequence
analysis of the 3’ region of the genome. The viruses were Bean common mosaic
virus (BCMV), Potato virus Y (PVY), Sugarcane mosaic virus (SCMV), Sorghum
mosaic virus (SrMV), Chilli veinal mottle virus (ChiVMV), Zucchini yellow mosaic
virus (ZYMV), Leek yellow stripe virus (LYMV), Shallot yellow stripe virus
(SYSV), Onion yellow dwarf virus (OYDV), Turnip mosaic virus (TuMV), Dasheen
mosaic virus (DsMV), Sweet potato feathery mottle virus (SPFMV) and a novel
potyvirus infecting chilli, which was tentatively named Chilli ringspot virus
(ChiRSV). With the exception of BCMV and PVY, this is first report of these viruses
in Vietnam. Further, rabbit bell (Crotalaria anagyroides) and typhonia (Typhonium
trilobatum) were identified as new natural hosts of the Peanut stunt virus (PStV)
strain of BCMV and of DsMV, respectively. Sequence and phylogenetic analyses,
based on the nucleotide sequence of the entire CP-coding region of all 52 virus
isolates, revealed considerable variability in BCMV, SCMV, PVY, ZYMV and
DsMV. The phylogenetic analyses also suggested the possible presence of ancestral
groups of BCMV, SCMV and ZYMV in Vietnam.
iv
Keywords: ssDNA viruses, Geminiviridae, begomovirus, ssDNA satellites,
begomovirus-associated DNA β, begomovirus-associated DNA 1, ssRNA viruses,
Potyviridae, potyvirus, degenerate primer, nanovirus, Vietnam.
v
PUBLICATIONS
Publications related to this PhD thesis
1. Ha, C., Coombs, S., Revill, P., Harding, R., Vu, M., and Dale, J. (2006)
Corchorus yellow vein virus, a New World geminivirus from the Old World.
Journal of General Virology 87: 997-1003.
2. C. Ha, S. Coombs, P. Revill, R. Harding, M. Vu and J. Dale. (2007). Molecular
characterization of begomoviruses and DNA satellites from Vietnam – additional
evidence that New World geminiviruses were present in the Old World prior to
continental separation. Accepted for publication in Journal of General Virology.
3. C Ha, S. Coombs, P. Revill, R. Harding, M. Vu and J. Dale. (2007). Design and
application of two novel degenerate primer pairs for the detection and complete
genomic characterization of potyviruses. Accepted for publication in Archives of
Virology.
4. C. Ha, P. Revill, R. Harding, M. Vu and J. Dale. (2007). Identification and
sequence analysis of potyviruses infecting crops in Vietnam. Accepted for
publication in Archives of Virology.
Papers unrelated to this PhD thesis
5. Revill, P.A., Ha, C.V., Porchun, S.C., Vu, M.T., and Dale, J.L. (2003) The
complete nucleotide sequence of two distinct geminiviruses infecting cucurbits in
Vietnam. Archives of Virology 148: 1523-1541.
6. Revill, P.A., Ha, C.V., Lines, R.E., Bell, K.E., Vu, M.T., and Dale, J.L. (2004)
PCR and ELISA-based virus surveys of banana, papaya and cucurbit crops in
Vietnam. Asia Pacific Journal of Molecular Biology and Biotechnology 12: 27 -
32.
7. Bell, K.E., Dale, J.L., Ha, C.V., Vu, M.T., and Revill, P.A. (2002)
Characterisation of Rep-encoding components associated with banana bunchy
top nanovirus in Vietnam. Archives of Virology 147: 695-707.
vi
8. Bateson, M.F., Lines, R.E., Revill, P., Chaleeprom, W., Ha, C.V., Gibbs, A.J.,
and Dale, J.L. (2002) On the evolution and molecular epidemiology of the
potyvirus Papaya ringspot virus. Journal of General Virology 83: 2575-2585.
vii
TABLE OF CONTENTS
ABSTRACT.................................................................................................................ii
PUBLICATIONS…………………………................................................................vi
TABLE OF CONTENTS..........................................................................................viii
LIST OF ABBREVIATIONS....................................................................................xii
STATEMENT OF ORIGINAL AUTHORSHIP.......................................................xiv
ACKNOWLEDGEMENTS.......................................................................................xv
CHAPTER 1: AIMS AND OBJECTIVES………………………………………..1
CHAPTER 2: LITERATURE REVIEW……………………………………… 5
2.1. THE FAMILY GEMINIVIRIDAE ……………………………………..…… 6
2.1.1. INTRODUCTION ...........................................................................................6
2.1.2. TAXONOMY...................................................................................................6
2.1.3. GENOME ORGANIZATION.........................................................................11
2.1.3.1. Genome organization of begomoviruses.......................................................11
2.1.3.2. Genome organization of mastreviruses.........................................................15
2.1.3.3. Genome organization of curtoviruses and topocuviruses..............................16
2.1.4. FUNCTIONS OF GENES................................................................................16
2.1.4.1. Replication-associated protein (Rep).............................................................16
2.1.4.2. Coat protein (CP)...........................................................................................18
2.1.4.3. Genes on DNA-B of bipartite begomovirus..................................................21
2.1.4.4. C4 protein......................................................................................................22
2.1.4.5. Replication enhancer protein (REn)...............................................................23
2.1.4.6. Transcriptional activator protein (TrAP).......................................................23
2.1.4.7. Movement protein (MP) (AV2, V2 protein)..................................................24
2.1.5. REPLICATION................................................................................................25
2.1.6. RECOMBINATION.........................................................................................26
viii
2.1.7. CIRCULAR SSDNA MOLECULES ASSOCIATED WITH
GEMINIVIRUSES...........................................................................................28
2.1.7.1. Tomato leaf curl virus (ToLCV) satellite DNA (ToLCV-sat).......................28
2.1.7.2. Nanovirus-like DNA-1...................................................................................31
2.1.7.3. DNA-β...........................................................................................................32
2.1.8. DIAGNOSIS.....................................................................................................33
2.1.8.1. Serological techniques...................................................................................33
2.1.8.2. Genomic DNA-based techniques...................................................................35
2.1.8.2.1. DNA hybridization......................................................................................35
2.1.8.2.2. Polymerase chain reaction (PCR)...............................................................36
2.2. THE FAMILY POTYVIRIDAE......................................................................... .37
2.2.1. INTRODUCTION ...........................................................................................37
2.2.2. TAXONOMY...................................................................................................41
2.2.3. GENOME ORGANIZATION..........................................................................41
2.2.4. FUNCTIONS OF GENES................................................................................45
2.2.4.1. P1 protein.......................................................................................................45
2.2.4.2. HC-Pro protein....................................................................... .......................46
2.2.4.3. P3 protein.......................................................................................................48
2.2.4.4. CI protein.......................................................................................................48
2.2.4.5. 6K proteins.....................................................................................................49
2.2.4.6. Genome-linked viral protein (VPg)...............................................................49
2.2.4.7. NIa-Pro protein..............................................................................................51
2.2.4.8. NIb protein.....................................................................................................51
2.2.4.9. CP (coat protein)............................................................................................51
2.2.5. DIAGNOSIS.....................................................................................................54
2.2.5.1. Serological techniques...................................................................................54
2.2.5.2. Nucleic acid - based techniques.....................................................................55
2.2.5.2.1. Hybridization techniques............................................................................55
2.2.5.2.2. Reverse transcriptase - polymerase chain reaction (RT-PCR)…………...55
2.3. REFERENCES………………………………………………………………....57
ix
CHAPTER 3: CORCHORUS YELLOW VEIN VIRUS, A NEW WORLD
GEMINIVIRUS FROM THE OLD WORLD……………………………………91
ABSTRACT……………………………………………………………………..….93
INTRODUCTION………………………………...……………………………...…94
METHODS…………………………………………………………………….……96
RESULTS………………………………………………………………….………102
DISCUSSION……………………………………………………………….……..109
REFERENCES……………………………………………………….……………114
CHAPTER 4: MOLECULAR CHARACTERIZATION OF
BEGOMOVIRUSES AND DNA SATELLITES FROM VIETNAM -
ADDITIONAL EVIDENCE THAT NEW WORLD GEMINIVIRUSES WERE
PRESENT IN THE OLD WORLD PRIOR TO CONTINENTAL
SEPARATION………………………………………………………………….119
ABSTRACT…………………………………………………………………… 121
INTRODUCTION…………………………………………………………………122
METHODS………………………………………….……………………………..126
RESULTS.................................................................................................................130
DISCUSSION...........................................................................................................156
REFERENCES.........................................................................................................162
x
CHAPTER 5: DESIGN AND APPLICATION OF TWO NOVEL
DEGENERATE PRIMER PAIRS FOR THE DETECTION AND COMPLETE
GENOMIC CHARACTERISATION OF POTYVIRUSES……………….….169
SUMMARY..............................................................................................................170
INTRODUCTION....................................................................................................171
MATERIALS AND METHODS.............................................................................173
RESULTS.................................................................................................................180
DISCUSSION...........................................................................................................195
REFERENCES.........................................................................................................198
CHAPTER 6: IDENTIFICATION AND SEQUENCE ANALYSIS OF
POTYVIRUSES INFECTING CROPS IN VIETNAM ………………………203
SUMMARY………………………………………………………………………204.
INTRODUCTION...................................................................................................205
MATERIALS AND METHODS............................................................................206
RESULTS................................................................................................................213
DISCUSSION……………………………………………………………………..235
REFERENCES.........................................................................................................239
CHAPTER 7: GENERAL DISCUSSION AND CONCLUSIONS...................245
xi
LIST OF ABBREVIATIONS
µg microgram
µL microlitre
µM micromolar
µm micrometre
ATPase adenosine triphosphatase
CTAB cetyl trimethyl ammonium bromide
DMSO dimethyl sulfoxide
DNA deoxyribonucleic acid
EDTA ethylenediaminetetraacetic acid
ELISA enzyme linked immunosorbent assay
g gram
g gravity
GUS beta-glucuronidase
h hour
IPTG isopropyl-β-D-thiogalactopyranoside
ISEM immunosorbent electron microscopy
kb kilobase
kPa kilopascal
L litre
LB Luria-Bertani broth
M molar
MAb monoclonal antibody
MES 2-(N-morpholino) ethanesulfonic acid monohydrate
mg milligram
xii
mL milliliter
mM millimolar
MS Murashige and Skoog
NTP nucleotide triphosphate
NTPase nucleotide triphosphatase
PAb polyclonal antibody
PCR polymerase chain reaction
pM picomolar
pmol picomole
RNA ribonucleic acid
rpm revolutions per minute
RT room temperature
RT-PCR reverse transcriptase - PCR
s second
SDS sodium dodecyl sulfate
SOB super optimal broth
SSC saline sodium citrate
TAE tris-acetate-EDTA
TAS-ELISA triple antibody sandwich - ELISA
TE tris-EDTA
U unit
UV ultraviolet
V volt
X-Gal 5-bromo-4-chloro-3-indolyl-β-D-galactoside
X-Gluc 5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid,
cyclohexylammonium salt
xiii
STATEMENT OF ORIGINAL AUTHORSHIP
The work contained in this thesis has not been previously submitted to
meet requirements for an award at this or any other higher education
institution. To the best of my knowledge and belief, the thesis contains
no material previously published or written by another person except
where due reference is made.
Signature:
Date:
xiv
ACKNOWLEDGEMENTS
First and foremost, my sincere thank goes to Professor James Dale, my principal
supervisor, for his ongoing support and suggestions through my PhD. Without him,
this PhD project would not have been possible. My sincere thank also goes to my
associate supervisors, Associate Professor Rob Harding, Professor Man Vu for all
their help and encouragement during my PhD and particularly to Dr. Peter Revill
who helped to shape my research skills. As an international student, I was lucky to
study in a great working environment created by the staff, scientists and students of
the Plant Biotechnology Group. They were all very friendly and helpful to me and I
would like to thank all of them; Associate Professor Chris Collet, Dr. Terry Walsh,
Dr. Marion Bateson, Dr. Doug Becker, Dr. Ben Dugdale, Dr. Jason Geijskes, Dr.
Mark Harrison, Dr. Harjeet Khanna, Ms Susan Porchun, Dr. Rosemarie Lines, Brett
Williams, Matthew Webb, Kathryn Bell, Kay Taylor, Nishantha Jayathilake, Srimek
Chowpongpang, Clair Bolton, Aurelie Chanson, Michelle Dowling, Suzanne Facy,
Bulukani Mlalazi, Priver Namanya, Jean-Yves Paul, Steven Pirlo, Theresa Tsao,
Suzelle Waggett, Don Catchpoole, Jennifer Kleidon and Maiko Kato. I would like to
thank Diana O’Rourke who helped me a lot during my 1999, 2000 and 2001 training
courses and PhD time at QUT. I would also like to thank the Queensland University
of Technology where I received the International Postgraduate Research Scholarship
(IPRS), living allowance support and great study conditions.
I would like to thank to all staff of the Plant Pathology Department (Hanoi
Agricultural University, Vietnam) who always supported and encouraged me during
my PhD time in Australia. I would also like to thank the staff of the Post-Import
Plant Quarantine Center I (Vietnam), Sugarcane Research Institute (Vietnam) and
Coffee Research Institute (Vietnam) for their help during my field surveys in
Vietnam in 2004.
Last, but not least, I thank my wife and daughter for their patience and for supporting
me through all these years.
xv
CHAPTER 1
AIMS AND OBJECTIVES
Description of scientific problem investigated
Viruses are considered one of the major constraints to agricultural production in
Vietnam. However, accurate data on the range and impact of plant virus diseases is
not available due to a lack of diagnostic techniques and capacity. To address this
problem, a collaborative project between QUT and Hanoi Agricultural University
(HAU), and funded by the Australian Centre for International Agricultural Research
(ACIAR), commenced in 1999 with a major aim being to improve the diagnostic
capability at HAU and to gain a better understanding of the viruses affecting
important agricultural crops in Vietnam. Preliminary surveys throughout the country
between 1999 and 2002 indicated that several plant viruses, mostly geminiviruses,
nanoviruses and potyviruses, were causing major diseases in banana, papaya and
several cucurbit crops. As a consequence of these preliminary findings, further
research towards the identification and characterization of plant viruses in Vietnam
was undertaken, focusing specifically on viruses in the important families
Geminiviridae and Potyviridae.
Overall objectives of the study
A key component to the control of plant virus diseases is the availability of
diagnostic tools for the rapid and accurate identification of the virus causing the
disease. PCR is gaining increasing popularity as a diagnostic tool for plant viruses
1
and, with the number of plant virus sequences deposited in public databases
increasing exponentially, opportunities are now arising to design degenerate PCR
primers for the detection of viruses at genus, and sometimes family, levels. The
overall objective of this study was to develop generic PCR-based methods to enable
the detection and subsequent characterisation of plant viruses belonging to the
families Potyviridae and Geminiviridae in Vietnam. Such information will be
important in the development of control strategies and for matters of plant
quarantine.
Specific aims of the study
The specific aims of this project were to (i) develop generic PCR-based methods for
the rapid detection of viruses belonging to the families Potyviridae and
Geminiviridae (and their associated satellites), (ii) utilise these generic methods to
identify viruses belonging to the families Potyviridae and the Geminiviridae (and
their associated satellites) in samples collected from selected crops and weeds in
Vietnam and (iii) characterise, at the molecular level, any “new” virus species in the
families Potyviridae and Geminiviridae identified during the study.
Account of scientific progress linking the scientific papers
The first two papers focused on the identification and characterization of
begomoviruses in Vietnam. The first paper (Chapter 3) describes the development of
novel degenerate PCR primers to detect begomoviruses, and the use of these primers
to detect and characterize a novel, bipartite begomovirus (Corchorus yellow vein
virus (CoYVV)) infecting Jute mallow (Corchorus capsularis, Tilliaceae). This
2
paper provided the first example of an indigenous Old World begomovirus that has
all of the distinguishing characteristics of a New World virus. The ramifications of
this finding for current theories on begomovirus evolution were discussed.
The second paper (Chapter 4) describes the identification and characterisation of
geminiviruses and associated DNA molecules infecting crop and weed species in
Vietnam. Sixteen begomoviruses were identified and their genomes cloned,
sequenced and analysed. Nine of the viruses were shown to be new species and five
of them were identified in Vietnam for the first time. Eight DNA-ß (five putatively
novel) and three nanovirus-like DNA-1 molecules were also found associated with
some of the monopartite viruses. A second bipartite begomovirus, Corchorus golden
mosaic virus (CoGMV), with similar genomic features to the previously
characterised, Corchorus yellow vein virus (CoYVV), was also identified which
supported the hypothesis that New World-like viruses are present in the Old World.
The final two papers focussed on the identification and characterision of potyviruses
in Vietnam. Paper three (Chapter 5) describes the development of two alternative sets
of degenerate PCR primers to amplify sequences from the 5’ (HC-Pro) and central
(CI) regions of potyviral genomes. These primers were used to identify 15
potyviruses in Vietnam, of which three were novel, Telosma mosaic virus (TelMV),
Peace lily mosaic virus (PeLMV) and Wild tomato mosaic virus (WTMV). The
complete genomes of these three novel viruses, in addition to a Banana bract mosaic
virus (BBrMV) isolate from the Philippines, were completely sequenced and
analysed.
3
The final paper (Chapter 6) describes the characterisation and analysis of the 3’
region of 52 virus isolates from 13 distinct potyviruses identified in Vietnam, namely
Bean common mosaic virus (BCMV), Potato virus Y (PVY), Sugarcane mosaic
virus (SCMV), Sorghum mosaic virus (SrMV), Chilli veinal mottle virus (ChiVMV),
Zucchini yellow mosaic virus (ZYMV), Leek yellow stripe virus (LYMV), Shallot
yellow stripe virus (SYSV), Onion yellow dwarf virus (OYDV), Turnip mosaic virus
(TuMV), Dasheen mosaic virus (DsMV), Sweet potato feathery mottle virus
(SPFMV) and a novel potyvirus infecting chilli, which was tentatively named Chilli
ringspot virus (ChiRSV). Eleven of these viruses were reported in Vietnam for the
first time. Sequence and phylogenetic analyses of the complete CP-coding region
revealed considerable sequence variability in many of the viruses, and also suggested
the presence of the ancestral groups of BCMV, SCMV and ZYMV in Vietnam.
.
4
CHAPTER 2
LITERATURE REVIEW
5
2.1. THE FAMILY GEMINIVIRIDAE
2.1.1. Introduction
The Geminiviridae is one of the largest families of plant viruses, containing 209
definite and tentative members (Fauquet and Stanley, 2005) (Table 2.1). All
members of the family have circular, single-stranded DNA genomes that are
approximately 2.7 kb in length and encapsidated within twinned (geminate)
icosahedral particles (Figure 2.1). Geminiviruses can be either monopartite, if their
genome contains only one DNA molecule, or bipartite if it consists of two molecules
(Stanley et al., 2005).
Many economically important virus diseases of crops are caused by geminiviruses
(Moffat, 1999). Some of the most important ones are Maize streak virus (MSV)
(Bosque-Perez, 2000) and those that infect cassava (Legg and Fauquet, 2004), cotton
(Briddon, 2003; Briddon and Markham, 2000) and tomato (Moriones and Navas-
Castillo, 2000).
2.1.2. Taxonomy
Based on the genome arrangement and biological properties, geminiviruses are
currently classified into four genera, Mastrevirus, Curtovirus, Topocuvirus and
Begomovirus (Stanley et al., 2005). Of them, the genus Begomovirus is increasingly
important with 185 species (Table 2.1).
6
Table 2.1. Current classification of the family Geminiviridae
Number of species†
Genus Type species Genome* Vector
Definitive Tentative Total
Mastrevirus Maize streak virus (MSV) M Leafhopper 11 6 17
Curtovirus Beet curly top virus (BCTV) M Leafhopper 5 1 6
Topocuvirus Tomato pseudo-curly top virus (TPCTV) M Treehopper 1 0 1
Begomovirus Bean golden yellow mosaic virus (BGMV) M, B Whitefly 132 53 185
149 60 209
* M: Monopartite, B: Bipartite
† The number of species is derived from Fauquet & Stanley (2005).
7
8
9
A B
Figure 2.1. Morphology of geminiviruses. A. Purified geminate particles of
Tomato yellow leaf curl virus (TYLCV), bar = 100 nm (Gafni, 2003). B. A
cryoEM reconstruction of Maize streak virus (MSV) (Zhang et al., 2001).
10
2.1.3. Genome organization
2.1.3.1. Genome organization of begomoviruses
Begomoviruses have either a bipartite genome, with components known as DNA-A
and DNA-B, or a monopartite genome resembling DNA-A. DNA-A typically
harbours six open reading frames (ORF): AV1 (known as AR1; coat protein, CP) and
AV2 (known as AR2; AV2 protein or movement protein, MP) on the virion-sense
strand; AC1 (known as AL1; replication protein, Rep), AC2 (known as AL2;
transcriptional activator, TrAP), AC3 (known as AL3; replication enhancer, REn)
and AC4 (known as AL4; AC4 protein) on the complementary-sense strand. DNA-B
contains two ORFs encoding proteins involved in movement: BV1 (known as BR1;
nuclear shuttle protein, NSP) on the virion-sense strand and BC1 (known as BL1;
movement protein, MPB) on the complementary-sense strand (Seal et al., 2006;
Stanley et al., 2005). The genome organization of begomoviruses is shown in Figure
2.2.
Based on phylogenetic studies and genome arrangement, begomoviruses have been
broadly divided into two groups, the Old World viruses (Eastern Hemisphere,
Europe, Africa, Australasia) and the New World viruses (Western Hemisphere, The
Americas) (Padidam et al., 1999; Paximadis et al., 1999; Rybicki, 1994).
Begomovirus genomes have a number of characteristics that distinguish Old World
and New World viruses. All New World begomoviruses are bipartite, whereas both
bipartite and monopartite begomoviruses are present in the Old World. In addition,
11
12
13
Begomovirus DNA-A
Begomovirus DNA-B
Topocuvirus
Mastrevirus Curtovirus
AV2 (MP) (=V1, AR2)
AV1 (CP) (=AR1)
AC3 (REn) (=AL3) AC2 (TrAP)
(=AL2)
AC1 (Rep) (=AL1)
AC4 (=AL4)
CR
BV1 (NSP) (=BR1)
Rep binding
CR
BC1 (MP) (=BL1)
C1 (Rep A)
LIR V1 (MP)
V2 (CP)
SIR
C2
V3 (MP)
C1:C2 (Rep)
V2
V1 (CP)
C4
C1 (Rep)
C2 C3 (REn) “Primer-like molecule”
V2
V1 (CP)
C4
C2 C3 (REn)
C1 (Rep)
Figure 2.2. Genome organization of the four genera of the family Geminiviridae. The ORFs are denoted according to their orientation as V (virion-sense) or C (complementary-sense). The ORFs of the monopartite begomoviruses should not have the “prefix” A. The dotted borderline of the AV2 ORF of DNA-A of the genus Begomovirus indicates that this ORF is absent in members from the New World. The common region (CR) of the two components of the genus Begomovirus is illustrated in more detail with a solid arrow indicating the nicking position. Two open boxes in the mastrevirus genome indicate introns. LIR; large intergenic region, SIR; small intergenic region, MP; movement protein, CP; coat protein, Rep; replication-associated protein, REn; replication enhancer, TrAP; transcriptional activator protein.
14
DNA-A of bipartite begomoviruses from the New World lacks an AV2 ORF
(Rybicki, 1994; Stanley et al., 2005).
The opposing transcription units on DNA-A and -B are separated by an intergenic
region (IR) that, in most cases, shares a highly conserved region of ~ 200 nts, called
the common region (CR) (Lazarowitz, 1992). The CR contains an origin of
replication (ori) organized modularly including a stem-loop structure containing an
invariant nonanucleotide TAATATTAC sequence, whose T7-A8 site is required for
cleaving and joining of the viral DNA during replication (Laufs et al., 1995a). The
ori posses a virus-specific recognition region located upstream of the stem-loop,
which contains conserved reiterated sequences (iterons) required for specific
recognition and binding by Rep during replication (Fontes et al., 1994a; Fontes et al.,
1994b).
2.1.3.2. Genome organization of mastreviruses
The monopartite mastreviruses (Figure 2.2) have genomes containing a long (or
large) and small intergenic region (LIR and SIR, respectively) located opposite to
each other on the genome. The LIR contains the ori for the virion strand synthesis
similar to that of begomoviruses. The SIR contains the ori for the synthesis of the
complementary strand and a short ssDNA sequence (~70-80 nts). This primer-like
sequence is annealed to the encapsidated genomic ssDNA and is thought to prime the
minus strand synthesis. The genome of mastreviruses encodes four proteins, Rep and
RepA on the complementary-sense strand, MP and CP on the virion-sense strand.
While RepA is produced from unspliced transcripts containing the C1 ORF, Rep is
15
expressed from spliced transcripts with fused C1 and C2 ORFs. The excised
sequence contains signals typical of plant introns (Boulton, 2002; Gutierrez, 2002;
Gutierrez et al., 2004; Hanley-Bowdoin et al., 2000; Palmer and Rybicki, 1998).
2.1.3.3. Genome organization of curtoviruses and topocuviruses
The genome organization of curtoviruses and topocuviruses (Figure 2.2) is similar to
that of monopartite begomoviruses, except that the genome of curtoviruses encodes
one extra protein (V2 protein) on the virion-sense strand that is involved in
regulation of the levels of ss and dsDNA (Stanley et al., 2005).
2.1.4. Functions of genes
2.1.4.1. Replication-associated protein (Rep)
The Rep protein of geminiviruses is a multifunctional protein with a number of
important functions including:
DNA binding. For initiating of replication, Rep is required to bind to the dsDNA
template. Rep recognizes its cognate DNA ori in a sequence- and site-specific
manner, and this process involves iteron sequences upstream of the stem-loop
structure (Fontes et al., 1994b). Although the natural substrate for Rep binding in
vivo is dsDNA, Rep binds to ssDNA in vitro (Fontes et al., 1994a). Jupin et al.
(1995) demonstrated that the 116 N-terminal amino acids of TYLCV Rep are
responsible for binding.
Cleavage and joining activities. Rep initiates the virion-strand replication by
introducing a nick between nucleotides 7 and 8 (TAATATT7OH-PA8C) of the
nonanucleotide sequence in the stem-loop (Laufs et al., 1995b). The Rep domain
responsible for cleavage activity was mapped to the first 211 amino acids of TYLCV
16
Rep (Heyraud-Nitschke et al., 1995) and the first 120 amino acids in Tomato golden
mosaic virus (TGMV) (Orozco et al., 1997). This N-terminal domain contains three
motifs conserved among the Reps of all geminiviruses (Laufs et al., 1995a). Motif I
(FLTY) has an unknown function, motif II (HLH) is a putative metal ion binding
site, and motif III contains a highly conserved Y residue that is essential for both
cleavage and joining activities (Laufs et al., 1995a; Orozco et al., 1997). The linear
ssDNAs generated from RCR replication (see section 2.1.5) are recircularized into
circular ssDNAs by the joining activity of Rep by transferring the 5’ terminal
phosphate of the linear ssDNA to the 3’OH end (Laufs et al., 1995b). These ssDNAs
can either be encapsidated or go back into the replication cycle.
Oligomerization. Formation of protein complexes is an essential property for origin
recognition and replication in many organisms that replicate by RCR. Settlage et al.
(1996) showed that the Rep of Tomato golden mosaic virus (TGMV) and BGMV
formed oligomers. The authors demonstrated that this oligomerization occurred in a
virus non-specific manner as Reps of the two viruses complexed with each other and
the addition of heterologous Rep had no effect on the efficiency of replication. The
Rep domain responsible for the oligomerization was mapped to between amino acids
120 and 181 in TGMV. This domain contained two characteristic α-helices that were
essential for the oligomerization (Orozco et al., 1997; 2000).
Interaction with host factors associated with replication machinery. Replication of
geminiviruses can occur in plant tissue that is not actively dividing (Horns and Jeske,
1991). In addition, geminiviruses do not encode a nucleic acid polymerase.
Therefore, after establishing an infection, geminiviruses need to induce the
replication machinery of the host cells. There is some evidence demonstrating the
interaction between Rep and replication factors of the host. For example, Ach et al.
17
(1997) found that Rep of TGMV can bind to the RRB1, a maize retinoblastoma-
related protein that is a negative regulator responsible for the G1 to S phase transition
of the cell cycle. Recently, Rep of Tomato yellow leaf curl Sardinia virus (TYLCSV)
was found to interact with PCNA (proliferating cell nuclear antigen) in Arabidopsis.
PCNA is a ring-like protein that functions as a mobile platform or “sliding clamp”
for docking of enzymes necessary for the replication of DNA (Castillo et al., 2003).
For mastreviruses, RepA is responsible for interaction with host factors. The
interaction of RepA with RRB is performed through an LXCXE motif that is located
close to the splicing site (Boulton, 2002).
ATPase activity. The Rep C-terminal region contains a conserved motif similar to the
P-loop motif of other NTP hydrolysing proteins. Desbiez et al. (1995) showed that
Rep of TYLCV exhibited an ATPase activity in vitro and demonstrated that the
ability of Rep to bind and hydrolyse ATP was essential for replication. However, the
nature of this activity in the replication process remains unclear because it was
shown that cleavage and ligation activities do not require the participation of ATPase
activity (Heyraud-Nitschke et al., 1995).
2.1.4.2. Coat protein (CP)
The CP of geminiviruses is a multifunctional protein required for a range of
functions associated with encapsidation, accumulation of viral ssDNA, insect
transmission and both intra- and inter-cellular movement (Boulton, 2002). However,
these functions vary according to genus.
Encapsidation. The most important function of CP is to form the shell in which
genomic ssDNA is encapsidated. Initial studies on geminivirus capsid structure were
done on Chloris striate mosaic virus (Hatta and Francki, 1979). A study based on
18
MSV, using cryo-electron microscopy and three dimensional image reconstruction
(Zhang et al., 2001), revealed that geminate particles are assembled from 110 protein
subunits, organized as 22 pentameric capsomers forming 2 abutting incomplete T=1
icosahedra joined together (Figure 2.1.B). Assembly and stability of the geminivirus
particles relies on interactions between CP molecules. It was suggested that the N-
terminal region of one CP molecule binds to the C-terminal amino acids of another
(Hallan and Gafni, 2001).
Transmission by vectors. The CP plays a key role in vector transmission and in
determination of vector specificity. One important experiment to prove this role was
conducted with two members of different genera, in which the CP gene of African
cassava mosaic virus (ACMV), a begomovirus, was replaced with that from BCTV,
a curtovirus (Briddon et al., 1990). This chimeric genome produced symptoms
typical of ACMV infection. The CP gene of BCTV was also expressed in plants and
was shown to encapsidate the hybrid ACMV genomic ssDNA. Interestingly,
Circulifera tenellus, the vector of BCTV, transmitted hybrid ACMV virus to N.
benthamiana seedlings, but not the original ACMV. This indicated that the CP
influences the vector specificity (Briddon et al., 1990). Similarly, a whitefly non-
transmissible strain of Abutilon mosaic virus (AbMV), with the CP replaced with that
from Sida golden mosaic virus (SiGMV), was acquired and transmitted by whitefly
to various host plants, indicating a crucial role of CP in the transmission process
(Hofer et al., 1997). The region associated with vector transmission was identified
within positions 124-174. The mutation in this region altered virus transmission by
the vector by either preventing particle assembly, or inhibiting passage of the virus
from gut to haemocoel or from the haemocoel to the salivary gland of vectors
(Harrison et al., 2002).
19
Intra-cellular targeting. During infection, many virus-associated products (genomic
DNA, replication intermediates, and proteins) need to move to particular sites in the
cells. It has been suggested that this transport is conducted with the participation of
viral proteins, host cytoskeletal elements and possibly host nuclear shuttle proteins
(Gafni and Epel, 2002).
Because geminiviruses replicate in the nucleus of infected host cells, following their
inoculation into the cytoplasm by vectors, the virus needs to be transported into the
nucleus for replication. Although it is still not clear if geminiviruses enter the nucleus
in the form of intact virions or as nucleoprotein complexes, the presence of only the
viral CP in the nucleus following initial cellular entry suggests it may be involved in
the nuclear import of viral DNA. The trafficking of the viral DNA-protein complex
between the nucleoplasm and protoplasm occurs through a complex structure called
the nuclear pore complex (NPC) and is mediated by host transport receptors known
as karyopherins that link to virus-associated proteins and then become associated
with the NPC. To be recognized by host receptors, these virus-associated proteins
must contain nuclear localizing signals (NLS) (Gafni and Epel, 2002). Such signals
have been determined for both monopartite and bipartite geminiviruses and are
mainly located in the N-terminal region of the CP; 63 amino acids for TYLCV
(Kunik et al., 1998), 5-22 amino acids for MSV (Liu et al., 1999) and 54 amino acids
for ACMV (Unseld et al., 2001). For ACMV, two other domains containing NLS
signals, which are located in the central (100-127 amino acids) and C-terminal (201-
258 amino acids) regions, were also determined (Unseld et al., 2001).
The CP of geminiviruses also participates in exporting the viral genome from the
nucleus to the cytoplasm. In this case, a nuclear export signal (NES) is required for
recognition by a host receptor. A NES signal located in the C-terminal half of the
20
TYLCV CP has been identified (Rhee et al., 2000). For bipartite begomoviruses,
although nuclear export is the responsibility of the BV1 gene product, one NES was
identified in the central region of the ACMV CP (Unseld et al., 2001). In brief, CP,
in terms of intra-cellular targeting function, serves as a nuclear shuttle protein for
monopartite geminiviruses and as a nuclear import protein for bipartite
begomoviruses.
2.1.4.3. Genes on DNA-B of bipartite begomoviruses.
DNA-B of bipartite begomoviruses encodes two proteins, BV1 (NSP) and BC1
(MP), both involved in viral movement.
BV1 is a nuclear shuttle protein. BV1 functions as a nuclear shuttle protein that is
responsible for transporting viral ssDNA into and out of the nucleus. However, it is
not involved in the nuclear import of viral ssDNA during initial infection, which is
facilitated by the CP (Gafni and Epel, 2002). The NLS of Squash leaf curl virus
(SqLCV) BV1 was mapped to the N-terminal 113 residues (Pascal et al., 1994) and
contained a sequence of 22 amino acids containing the motif SLEKDLLIDLH,
resembling the NES of other nuclear shuttling proteins (Ward and Lazarowitz, 1999).
BV1 interacts with BC1 for cell-to-cell movement. BV1 enters the nucleus to form a
complex with viral ssDNA that moves to the cytoplasm and is trapped by BC1. The
complex BV1:BC1:ssDNA then moves to the plasmodesmata and is transferred to
the adjacent cell (Gafni and Epel, 2002). The C-terminal region of the SqLCV BV1
was shown to be essential for interaction with BC1 (Sanderfoot et al., 1996).
BC1 is a movement protein. The function of BC1 as a MP was demonstrated in two
cases: (1) Bean dwarf mosaic virus (BDMV) BC1 increased the size exclusion limit
(SEL) of plasmodesmata (Noueiry et al., 1994; Rojas et al., 1998), and (2) SqLCV
21
BC1 induced formation of a tubular structure derived from the endoplasmic
reticulum that facilitated viral translocation between cells (Ward et al., 1997). As
mentioned above, it has been proposed that BC1 interacts with BV1 through the
BV1:BC1:ssDNA complex for cell-to-cell movement (Gafni and Epel, 2002).
BC1 is involved in pathogenicity. The association of BC1 with pathogenicity has
been proven in transgenic experiments. Tobacco and tomato plants transformed with
the BC1 gene of Tomato mottle virus (ToMoV) and BDMV, respectively, expressed
characteristic visible symptoms of viral infection. The BC1 genomic region
responsible for induction of pathogenicity was mapped to the C-terminus since
transgenic lines containing a deletion of this region (eg. 119 amino acids for BC1 of
TMoV), were all symptomless (Duan et al., 1997; Hou et al., 2000).
2.1.4.4. C4 protein
C4 protein is involved in movement of monopartite begomoviruses. Through
mutation analysis, Jupin et al. (1994) found that the protein encoded by the TYLCV
C4 ORF was necessary for viral systemic movement. Using microinjection and
transient expression assays, Rojas et al. (2001) suggested that the TYLCV C4 protein
that contains an N-terminal putative myristoylation domain could deliver viral DNA
to the plasmodesmata and mediate cell-to-cell transport.
C4 protein is involved in symptom expression of monopartite begomoviruses.
Rigden et al. (1994) showed that plants agro-inoculated with constructs containing
Tomato leaf curl virus (ToLCV) C4 ORF initiation codon mutants showed
significantly less symptoms than controls. For bipartite begomoviruses, the ACMV
AC4 protein has been shown to bind miRNA (Chellappan et al., 2005) and suppress
PTGS (Vanitharani et al., 2004).
22
2.1.4.5. Replication enhancer protein (REn)
REn enhances replication. Sunter et al. (1990) observed that mutation of the AL3
ORF of TGMV created a large reduction in the levels of ss- and dsDNA. They
proposed that the association between the AL3 ORF and replication depends on the
interaction between Rep and the AL3 protein. Such an interaction has been found in
TGMV and BGMV (Settlage et al., 1996).
REn interacts with cell cycle regulator proteins. The interaction of the AL3 protein
of TGMV, a bipartite begomovirus, with a maize retinoblastoma homolog (pRBR1)
was demonstrated by Settlage et al. (2001). Using a yeast two-hybrid system,
Castillo et al. (2003) found that REn of TYLCSV, a monopartite begomovirus, also
interacted with PCNA of Arabidopsis thaliana and tomato.
2.1.4.6. Transcriptional activator protein (TrAP)
TrAP is a transcriptional activator protein. The AL2 protein is required for efficient
transcription of virion sense viral genes such as CP and the BR1 protein (Sunter and
Bisaro, 1992). Using transgenes consisting of complete and truncated versions of the
CP promoter of TGMV fused to the GUS reporter gene, Sunter and Bisaro (1997)
found that TrAP activated the CP promoter in mesophyll cells but repressed it in
phloem tissue. The biochemical properties of TrAP were also elucidated showing
that it (1) had ability to bind to ssDNA in a sequence non-specific manner and to zinc
ions, (2) was phosphorylated and (3) contained a minimal transcriptional activation
domain comprising 15 C-terminal amino acids (Hartitz et al., 1999).
TrAP is a potential silencing suppressor. The ability of TrAP to act as a suppressor
of post-transcriptional gene silencing was first shown with ACMV (Voinnet et al.,
1999). Sunter et al. (2001) demonstrated that transgenic tobacco plants expressing
23
the AL2 ORF of TGMV showed enhanced susceptibility to infection of TGMV,
BCTV and Tobacco mosaic virus (TMV), an unrelated RNA virus. This function
seemed to be independent of the transcriptional activity because the activation
domain located in the C-terminal region was truncated in the AL2 transgene.
2.1.4.7. Mastrevirus movement protein (MP)
The movement protein (MP) of mastreviruses (also known as pre-coat protein) was
shown to be a movement protein with a similar function to the BC1 protein of
bipartite begomoviruses (Boulton, 2002; Gafni and Epel, 2002). The MP of MSV
associated with secondary plasmodesmata of infected maize cells (Dickinson et al.,
1996). It was also suggested that, like the BC1 protein, the MP of mastreviruses
interacts with the CP:ssDNA complex to function in cell-to-cell movement (Liu et
al., 2001).
For begomoviruses, the AV2 ORF is present only in viruses from the Old World
(Stanley et al., 2005). The plants (tomato, tobacco and N. benthamiana) inoculated
with infectious DNA of Tomato leaf curl New Delhi virus (a bipartite virus) which
contained deletions in AV2 developed very mild symptoms and accumulated only
low levels of both ss- and ds viral DNA, whereas inoculated protoplasts accumulated
both ss- and dsDNA to wild-type levels, showing that AV2 is required for efficient
viral movement (Padidam et al., 1996). In TYLCV, a monopartite virus, mutations in
the AV2 ORF affected ssDNA accumulation and prevented systemic infection of
tomato plants (Wartig et al., 1997). It has been proposed that the AV1 product may
enhance the export of the viral DNA of TYLCV from the nuclear periphery to the
cell periphery (Rojas et al., 2001).
24
2.1.5. Replication
Geminivirus DNA replication follows a rolling-circle mechanism. The rolling circle
replication (RCR) of geminiviruses can be divided into two phases (Gutierrez, 2000):
1. Conversion of viral ssDNA into dsDNA forms on entering the nucleus of the
initially infected cells. This step of synthesis of viral minus strand is carried out
by cellular enzymes and is still poorly understood.
2. Rolling circle phase to replicate viral ssDNA on dsDNA templates. This step
requires the participation of Rep. Rep is the only viral protein absolutely required
for RCR, as it is responsible for initiating DNA replication. Laufs et al. (1995a)
described in detail the role of Rep in initiation and termination of RCR of
geminiviruses.
Recently, an additional model of replication of geminiviruses and their satellites has
been proposed (Alberter et al., 2005; Jeske et al., 2001; Preiss and Jeske, 2003). This
model, recombination-dependent replication (RDR), was based on analyses of
replication intermediates of AbMV, TYLCV, BCTV, TGMV, ACMV, ToLCV and
one satellite molecule, DNA-β, using two-dimensional gel electrophoresis and
electron microscopy. Apart from the previously identified RCR intermediates
(Saunders et al., 1991), a range of intermediates suggested an additional RDR
pathway. This is analogous to the pathway of T4 bacteriophage (Kreuzer, 2000) that
has also been named the “join-copy” pathway (Mosig, 1998), “break-induced
replication” (George and Kreuzer, 1996) and “bubble-migration synthesis” (Formosa
and Alberts, 1986). The RDR model has three steps (Kreuzer, 2000; Mosig et al.,
2001):
25
1. Processing of the broken double-stranded DNA to produce the 3’ end single-
stranded DNA required for DNA strand invasion.
2. Invasion of a homologous duplex by 3’ end single-stranded DNA to form a
structure known as the `displacement loop' (D-loop or bubble loop). DNA strand
invasion by the 3' end of ssDNA allows it to serve as a potential primer for DNA
replication.
3. DNA heteroduplex extension (branch migration). At this step, the protein-
directed branch migration occurs at the rear of the loop as DNA polymerase
extends the leading-strand product at the front of the loop. Because both reactions
occur at a similar rate, the size of the loop is roughly unchanged.
This type of RDR does not need a topoisomerase, even when the circular DNA
templates are supercoiled, and the two parent strands do not need to separate from
each other (Kreuzer, 2000).
RDR of geminiviruses apparently does not require participation of Rep in terms of its
cognate virus recognition and nicking of ssDNA at the nonanucleotide sequence for
initiation of replication. This possibility is also supported by a recent study (Lin et
al., 2003) in which mutants of ToLCV and its sat-DNA molecule, that were impaired
in their ability to bind Rep in vitro, were still infectious to tomato.
2.1.6. Recombination
One of the earliest pieces of evidence for recombination amongst geminiviruses was
obtained from studies of a severe mosaic disease of cassava in Uganda (Zhou et al.,
1997). Sequence analysis revealed that a virus responsible for the disease, East
26
African cassava mosaic virus – Uganda (EACMV-UG) had probably arisen by
interspecific recombination between East African cassava mosaic virus (EACMV)
and ACMV.
Using a program to detect gene conversion, (GENECONV), Padidam et al. (1999)
searched for recombination events among geminiviruses from sequences
representing 64 distinct species. In total, the analysis identified 420 statistically
significant recombinant fragments distributed across the viral genomes. The
fragments (391) detected between viruses from different continents and between
begomoviruses and curtoviruses were located in the N-terminal region of Rep,
suggesting that they are old events that presumably occurred before the geographical
isolation. This important analysis suggested that interspecific recombination has
resulted in remarkable diversity among geminiviruses and could be a major cause of
the emergence of new geminivirus diseases.
At present, the number of new geminiviruses arising as a consequence of
recombination is increasing (Fauquet et al., 2005; Garcia-Andres et al., 2006; Girish
and Usha, 2005; Idris and Brown, 2005; Kon et al., 2006; Rojas et al., 2005;
Rothenstein et al., 2006; Were et al., 2005). In some cases, the recombinants
exhibited a new pathogenic phenotype which is often more virulent than the parents.
For example, a natural recombinant between TYLCSV and TYLCV has been
detected which has a wider host range than for the individual viruses and which is
becoming prevalent in geminivirus populations infecting tomato in Spain (Monci et
al., 2002).
27
One question relating to the recombination of geminiviruses concerns the mechanism
by which a virus acquires a DNA fragment from its counterpart. RCR alone does not
seem to explain recombination. The second replication pathway, RDR, which may be
widespread among geminiviruses (Jeske et al., 2001; Preiss and Jeske, 2003) may
explain the recombination phenomena among geminiviruses.
2.1.7. Circular ssDNA molecules associated with geminiviruses
2.1.7.1. Tomato leaf curl virus (ToLCV) satellite DNA (ToLCV-sat)
The first circular DNA molecule associated with a geminivirus was ToLCV satellite
DNA isolated from ToLCV-infected tomato in Australia (Dry et al., 1997). This
satellite DNA (Fig. 2.3) comprised 682 nts and contained two stem-loop structures (I
and II). Stem-loop I had a nonanucleotide sequence, TAATATTAC, identical to that
of other geminiviruses while stem-loop II contained, within the loop, a Rep-binding
motif (iteron), GGTGTCT, identical to that of ToLCV. Another iteron
(AGACACC) is found upstream of the stem-loop II but in a reverse complement
orientation. This satellite did not contain any significant ORF, shared no sequence
similarity with the genome of its cognate virus, ToLCV, completely depended on the
cognate virus for replication, systemic movement and encapsidation, and was not
essential for ToLCV replication. Additionally, trans-replication of ToLCV-sat was
also supported by other non-cognate geminiviruses such as TYLCV, ACMV and
BCTV (Dry et al., 1997).
28
DNA-β Nanovirus-like DNA-1
ToLCV-satellite
βC1
Rep A-rich
SCR A-rich
SCR Stem-loop I
Stem-loop II A-rich
Figure 2.3. Genome organization of the begomovirus satellites. Rep; replication-associated
protein, SCR; satellite conserved region.
29
30
2.1.7.2. Nanovirus-like DNA-1
The first nanovirus-like DNA molecule associated with geminiviruses was isolated
from cotton infected with Cotton leaf curl Multan virus (CLCuV) in Pakistan
(Mansoor et al., 1999). Subsequently, similar molecules were found in many other
plants infected with monopartite begomoviruses from the Old World (Briddon et al.,
2004). These DNA molecules, named nanovirus-like DNA-1 (Fig. 2.3), comprised
1375 nt and had a common genome organization including (1) a predicted stem-loop
structure containing, within the loop, a conserved TAGTAATAT nonanucleotide
sequence typical to that of nanoviruses, (2) a single large ORF in the positive sense
encoding a homologue of the nanovirus replication-associated protein (Rep)
(typically 315 amino acids) and (3) an adenine rich (A-rich) region immediately
downstream of the coding region (typically 100-200 nts) – the only feature different
from nanovirus Rep components (Briddon et al., 2004). The Rep sequences of
nanovirus-like DNA-1 are highly conserved (greater than 86 % amino acid sequence
similarity) (Briddon et al., 2004). Nanovirus-like DNA-1 molecules can replicate
autonomously, but similar to ToLCV-sat, they depend on helper viruses for systemic
movement, encapsidation and play no role in symptom induction (Briddon et al.,
2004; Mansoor et al., 2003).
It has been suggested that the nanovirus like-DNA molecules were possibly
“captured” by geminiviruses during mixed infection by trans-encapsidation. This
allowed them to be transmitted by geminivirus vectors and, therefore, increased their
host range (Mansoor et al., 1999; Saunders et al., 2002).
31
2.1.7.3. DNA-β
Recently, another group of novel circular ssDNA molecules, named DNA-β (Fig.
2.3), have been found associated with many monopartite begomoviruses infecting a
diverse range of plants including cotton, okra, hibiscus, hollyhock and three-lobe
false mallow (Malvaceae), honeysuckle (Caprifoliaceae), tomato, tobacco and chilli
(Solanaceae), squash (Cucurbitaceae), zinnia and ageratum (Asteraceae) (Briddon et
al., 2003; Zhou et al., 2003). The DNA-β molecules have keenly attracted the
attention of virologists since Saunders et al. (2000) and Briddon et al. (2001) showed
that typical symptoms of ageratum yellow vein and cotton leaf curl diseases occurred
only when Ageratum yellow vein virus (AYVV) and CuLCV, respectively, were co-
inoculated with their respective DNA-β components. These molecules have a
genome of approximately 1350 nucleotides for the full-length forms or
approximately 700 nucleotides for the deleted forms, and contain three characteristic
regions (Briddon et al., 2003).
Satellite conserved region (SCR). The satellite conserved region (SCR), a region of
200 nts, contains (i) a putative stem-loop structure containing a nonanucleotide
TAG/ATATTAC sequence typical of the nanoviruses and geminiviruses and (ii) a
very highly conserved region of over 100 nts located on the 5’ side of the stem-loop
(Briddon et al., 2003). This conserved region has a very high GC content (~ 70 %)
(Zhou et al., 2003).
Adenine rich region (A rich region). The DNA-β molecules contain an A-rich
region (typically 160-180 nts and about 60% A (Briddon et al., 2003)) located
between nucleotide ± 700 and ±1000 (Zhou et al., 2003). It was suggested that this
32
region may be present to increase the size of these molecules to become a fraction
(either half or quarter) of the typical genome size of geminiviruses (Mansoor et al.,
2003). In doing so, the molecules could be tolerated during systemic movement
which operates through a stringent size-selection mechanism (Etessami et al., 1989;
Rojas et al., 1998)
Potential coding region. The DNA-β molecules contain an ORF (βC1) on the
complementary strand on 3’ side of the stem-loop. This ORF encodes a protein of
approximately 118 amino acids. Through mutation analysis, Zhou et al. (2003)
demonstrated that the βC1 gene product is associated with symptom induction. The
βC1 protein of DNA-β satellite (Y10β), associated with Tomato yellow leaf curl
China virus Y10 isolate (TYLCCNV-Y10), is nucleophilic and is able to suppress
RNA silencing activity (Cui et al., 2005).
2.1.8. Diagnosis
Several methods, particularly those based on protein or nucleic acid detection, have
been developed to identify geminiviruses.
2.1.8.1. Serological techniques
Serological detection techniques, such as ELISA or its variants, are based on the
antigenic properties of the viral coat protein. Traditionally, the techniques have been
a primary means of virus detection and diagnosis. For mastreviruses, polyclonal and
monoclonal antibodies has been used to detect and differentiate the isolates of SMV
(Bosque-Perez, 2000; Peterschmitt et al., 1991; Pinner and Markham, 1990), three
distinct viruses, namely Chloris striate mosaic virus (CSMV), Paspalum striate
mosaic virus (PaSMV) and Digitaria striate mosaic virus (DDSMV) infecting
graminaceous plants from Australia (Pinner et al., 1992) and a Syrian chickpea
33
isolate of Chickpea chlorotic dwarf virus (CpCDV), a dicot mastrevirus (Kumari et
al., 2006).
For begomoviruses, however, serological-based diagnostics have met with limited
success because the particles are only moderately immunogenic, are purified with
difficulty from plant materials, and occur in only low to moderate concentration in
plants tissue. Consequently, serological techniques using polyclonal antibodies
(pAbs) lack both the specificity and sensitivity required for accurate diagnosis
(Harrison and Robinson, 1999; Harrison et al., 2002; Pico et al., 1996). These
problems have been resolved, to a certain degree, by several methods including
techniques such as ISEM and ELISA using a range of polyclonal and monoclonal
antibodies (mAb) (Harrison et al., 2002; Pico et al., 1999). Finally, recombinant
pAbs against BGMV, Cabbage leaf curl virus (CaLCuV), Tomato mottle virus
(ToMoV) and TYLCV have been generated using the CP expressed in Escherichia
coli as immunogenic sources. These antibodies are inexpensive and have high
sensitivity for detection of begomoviruses (Abouzid et al., 2002).
The cross-reactions with heterologous pAbs antibodies have been exploited to detect
unrelated viruses. For example, antisera against CaLCuV and TYLCV were used to
detect BGMV antigens while the CaLCuV antiserum reacted well with ToMoV
antigens and weakly with TYLCV antigens (Abouzid et al., 2002). Harrison et al.
(2002) identified more than 50 distinct begomoviruses originating from over 30
countries of six continents using selected mAbs.
34
2.1.8.2. Genomic DNA-based techniques
2.1.8.2.1. DNA hybridisation
Hybridisation techniques have been widely used in the diagnosis of plant viruses.
These techniques are based on the base pairing between viral nucleic acid sequences
(target) and labelled probes whose sequence is complementary to that of the targets.
Hull (1993) summarised in detail the factors affecting hybridisation including
temperature, nucleic acid composition, sequence length and base mismatch, salt
concentration, pH and organic solvents. There are three major formats for DNA
hybridisation techniques;
In the dot blot technique, the DNA extracts are dotted onto a nylon membrane for
hybridisation (Gilbertson et al., 1991; Harper and Creamer, 1995; Kheyr-Pour et al.,
2000; Polston et al., 1989; Polston et al., 1999; Potter et al., 2003; Stonor et al.,
2003). The dot blot can also be used to estimate relative differences in viral nucleic
acid titres in infected tissues (Gilbertson et al., 1991). In the tissue print (or squash
plot) technique, the infected tissue is squashed directly onto a nylon membrane for
hybridisation. This method provides a specific, rapid, and simple means to detect
virus without DNA extractions. The technique has been use to detect geminiviruses
in field samples (Czosnek and Laterrot, 1997; Gilbertson et al., 1991; Pico et al.,
1996) and in assessing virus resistance (Martins Santana et al., 2001; Maruthi et al.,
2003; Rubio et al., 2003). In the Southern blot technique, the DNA extracts are
electrophoresed through an agarose gel followed by transfer onto nylon membrane
for hybridisation. This technique enables the detection of the characteristic
replicative forms of viral DNA present in plants, including open circular dsDNA,
supercoiled dsDNA and circular ssDNA. The technique has been widely used to
35
characterise new viruses (Bigarre et al., 2001; Lotrakul et al., 1998), investigate the
presence of viruses in whitefly vectors (Ghanim et al., 1998), study gene functions
(Briddon et al., 1990; Noris et al., 1998; Orozco and Hanley-Bowdoin, 1996;
Padidam et al., 1996; Petty et al., 2000; Wartig et al., 1997), study the interaction
between host factors and virus (Pooma et al., 1996), to discover the replication
intermediates of viruses (Jeske et al., 2001) and to confirm the presence and role of
satellite molecules in disease induction (Briddon et al., 2004; Briddon et al., 2001;
Bull et al., 2004; Mansoor et al., 1999).
2.1.8.2.2. Polymerase chain reaction (PCR)
First described in the 1980s by Mullis et al. (1986), PCR has become a powerful
technique that has had a great impact on molecular biotechnology. Briefly, PCR
allows amplification of specific nucleic acid sequences using two short
oligonucleotide primers that flank the target sequence (Henson and French, 1993).
PCR has been widely used in detection and diagnosis of plant viruses because of its
rapidity, sensitivity, specificity and reliability (Henson and French, 1993; Hull, 2002;
Martin et al., 2000). PCR, using degenerate (or universal) primers designed from
highly conserved regions of virus genomes, has become a rapid and reliable way to
screen mixed infections or to detect new geminiviruses in plants or vectors (Deng et
al., 1994; Guo and Zhou, 2005; Harrison et al., 1997; Lyttle and Guy, 2004;
Rampersad and Umaharan, 2003; Rojas et al., 1993; Roye et al., 1999; Wyatt and
Brown, 1996) and their satellites (Briddon et al., 2002; Bull et al., 2003; Zhou et al.,
2003).
36
2.2. THE FAMILY POTYVIRIDAE
2.2.1. Introduction
The Potyviridae (named after Potato virus Y) is the largest family of plant viruses
currently recognized containing 218 definite and tentative species (Berger et al.,
2005) (Table 2.2). All members of the family have a genome of positive single
stranded RNA and comprise flexuous filamentous particles between 11-15 nm in
diameter. The lengths of the viruses range from 650-950 nm for those with
monopartite genomes (Fig. 2.4.A) and 200-300 and 500-600 nm for those with
bipartite genomes. Each virion comprises 1700-2000 coat protein subunits arranged
in a helical manner around a single molecule of viral RNA (Shukla et al., 1998).
Cytopathologically, all the members of the family characteristically induce the
formation of three-dimensional crystalline cytoplasmic inclusions (CI) within
infected cells (Fig. 2.4.C). These are seen as “pinwheels” in transverse section or as
“bundles” in longitudinal section. Some members of the potyvirus genus induce the
formation of crystalline nuclear inclusions (NI) (Fig. 2.4.D) that consist of two
proteins, NIa and NIb (Shukla et al., 1998).
Many members of the family are important pathogens on plants. Papaya ringspot
virus (PRSV) has been considered the most damaging virus infecting papaya
worldwide (Gonsalves, 1998). Turnip mosaic virus (TuMV) is ranked the second
most important virus infecting field-grown vegetables (Tomlinson, 1987). Similarly,
Plum pox virus (PPV) is by far the most important virus that infects stone fruits
(Kegler et al., 1998).
37
Table 2.2. Current classification of the family Potyviridae
Number of species‡
Genus Type species Genome* Vector† Definitive Tentative Total
Potyvirus Potato virus Y (PVY) M Aphids (np) 111 86 197
Ipomovirus Sweet potato mild mottle virus (SPMMV) M Whitefly (np) 3 1 4
Macluravirus Maclura mosaic virus (MacMV) M Aphids (np) 3 1 4
Rymovirus Ryegrass mosaic virus (RGMV) M Mites (pc) 3 0 3
Tritimovirus Wheat streak mosaic virus (WSMV) M Mites (pc) 3 1 4
Bymovirus Barley yellow mosaic virus (BaYMV) B Fungus (z) 6 0 6
129 89 218
* M : Monopartite, B : Bipartite
† np: non-persistent, pc: persistent-circulative, z: zoospore
‡ The number of species is derived from Berger et al. (2005)
38
A B
C D
Figure 2.4. Virion and inclusion morphology of potyviruses. A. Flexuous filamentous particles of
PVY, bar = 100 nm (http://www.dpvweb.net/notes/showem.php?genus=Potyvirus). B. Schematic
drawing showing the linear sequence of the CP subunit, the subunit folding pattern, the surface
location of the N- and C-termini and the assembly of PVY particle (Shukla et al., 1998). C.
drical inclusions (CI) of PVY formed in the cytoplasm of an infected tobacco leaf cell; V,
ole; Mb, microbody; bar = 200 nm; b in parentheses is Figure 3b in Arbatova et al. (1998). D.
Nuclear inclusions (arrowed) of Tobacco etch virus (TEV) in Nicotiana benthaminana leaf cell; N,
cleus; CW, cell wall; Ch, chloroplast; CI, cytoplasmic inclusions; M, mitochondria; bar = 1.4
µm; B at top left corner is Figure 5B in Hajimorad et al. (1996).
Cylin
vacu
Nu
39
40
2.2.2. Taxonomy
Initially, the family Potyviridae was divided into four genera, Potyvirus, Rymovirus,
Bymovirus and Ipomovirus, on the basis of vector transmission (aphid, mite, fungus
and whitefly, respectively) (Barnett, 1992). Currently, six genera of the family are
recognized (Berger et al., 2005) including the four former and two new genera,
Macluravirus and Tritimovirus. These genera are distinguished on the bases of their
genome organization, vector transmission and genome sequence (Table 2.2).
2.2.3. Genome organization
Members of the family Potyviridae have a genome of single-stranded, positive-sense
RNA. The viruses of five genera (Potyvirus, Macluravirus, Ipomovirus, Rymovirus
and Tritimovirus) have a monopartite genome that contains only one RNA molecule.
Viruses of the genus Bymovirus have a bipartite genome which contains two RNA
molecules, RNA-1 and RNA-2 (Shukla et al., 1998).
The genome organization of the monopartite genera is quite similar to one another
(Fig. 2.5). They have a genome ~10 kb in length, characterised by an 5’ untranslated
region (5’ UTR), a major single ORF and a 3’ UTR region terminated by a poly-A
tail. The major ORF encodes a large polyprotein that is co-translationally processed
into ten functional proteins (Adams et al., 2005a). In descending order (5’-3’), these
proteins are the first protein (P1), helper component protein (HC-Pro), third protein
(P3), 6K1, cylindrical inclusion protein (CI), 6K2, VPg (viral protein genome-
41
42
AI CI NIa NIb
Figure 2.5. Genome organization of the monopartite genera of the family
Potyviridae. AI, amorphous inclusion; CI, cytoplasmic inclusion; NI, nuclear
inclusion; P1, P1 protein; HC-Pro, helper component protein; P3, third protein;
VPg, viral protein genome–linked; NIa-Pro, major protease of small nuclear
inclusion protein –NIa; CP, coat protein; UTR, untranslated region. The functions
of the genes are also indicated. The crucial motifs of the genes are in parenthesis.
HC-Pro P3 P1 CI CP NIa-Pro NIb Poly-A VPg
N - terminus Core region C- terminus
1. Replication (IGN) 2. Systemic movement (CC/CS) 3. Gene silencing suppressor
1. Cell-to-cell movement 2. Replication: Helicase,
ATPase, RNA binding
1. Genome amplification 2. Host specific determinant 3. Systemic movement
N – terminus Core region C- terminus
1. Aphid transmission: HC-Pro binding (DAG) 2. Systemic movement 3. Immunodominant: (Virus specific)
Systemic movement
1. Virus assembly 2. Cell-to-cell movement
1. Proteinase 2. Cell-to-cell movement
Aphid transmission: Vector binding (KTIC)
(FY)/S G/G
1.2. nteract RNA 3. Host defence
suppressor
Proteinase I
Pathogenicity
Replication: anchors replication apparatus
RdRp (GDD)
5’UT 3’UTR R
Major protease
VPg
6K1 6K2
43
44
linked), NIa-Pro (major protease of small nuclear inclusion protein -NIa), NIb (large
nuclear inclusion protein) and CP (coat protein) (Shukla et al., 1998) (Fig. 2.5).
The RNA-1 of the genus Bymovirus resembles the C-terminal two-thirds of the
monopartite genomes and encodes proteins analogous to P3, 6K1, CI, 6K2, NIa, NIb
and CP, whereas the RNA-2 encodes a polyprotein which is processed into two
proteins, P1 and P2. P1 is similar to HC-Pro of monopartite viruses while P2 is
similar to the capsid readthrough protein of furoviruses and is required for virus
transmission by fungi. Both RNA-1 and RNA-2 of bymoviruses have a VPg linked
to the 5’ terminal nucleotide, a 5’ UTR, a 3’ UTR and a poly-A tail as for
monopartite viruses (Shukla et al., 1998).
Sequence analysis revealed that rymoviruses shared strongly sequence identity with
the potyviruses and therefore should be included in the genus Potyvirus (Adams et
al., 2005b; Shukla et al., 1998).
2.2.4. Functions of genes
2.2.4.1. P1 protein
P1 is a proteinase. P1 is the most variable region of the genome, with the exception
of the C-terminal region (Adams et al., 2005b; Urcuqui-Inchima et al., 2001). P1 is a
serine proteinase that self-cleaves P1/HC-Pro junction at a conserved YS or FS motif
(Adams et al., 2005a; Verchot et al., 1992; Yang et al., 1998). The region
responsible for this activity was identified at the C-terminus of P1 with a catalytic
45
triad H-(X7-11)-D-(X30-36)-S. The D residue of this triad was replaced by E for
potyviruses of the BCMV subgroup (Adams et al., 2005a).
P1 interacts with RNA. P1 binds non-specifically to the RNA and it has been
suggested that P1 may be involved in viral movement (Brantley and Hunt, 1993).
This was supported by the finding that P1 was localized in association with CI in
cytoplasm (Arbatova et al., 1998).
P1 participates in suppression of host defence. The fusion of P1 and HC-Pro
enhances viral pathogenicity through suppression of posttranscriptional gene
silencing (PTGS) in the host (Kasschau and Carrington, 1998). Maki-Valkama et al.
(2000) showed that the mechanism and strain specificity of the resistance in plants
transformed with the PVY P1 gene was based on PTGS.
2.2.4.2. Helper component protein (HC-Pro)
HC-Pro is a multifunctional protein required for viral acquisition by the vector,
systemic and cell-to-cell movement and suppression of PTGS.
HC-Pro is required for transmission through interaction with virions and vectors.
When testing the virus transmission efficiency of four aphid species, Wang et al.
(1998) found that different aphid species transmitted virus more efficiently than
others. They showed that the food canal of aphids differed in its ability to interact
with HC-Pro, which, therefore, affected the ability of aphids to retain virions in the
stylets. Through mutation analysis, Blanc et al. (1998) determined that the N-
terminal region of HC-Pro, which contains a highly conserved K(I/L)(T/S)C motif
(known as KITC motif), was required for interaction of HC-Pro with the aphid
mouthpart. Similarly, a PTK motif in the core region of HC-Pro was identified as
important for virion-binding (Peng et al., 1998). PTK mutants reduced or abolished
46
the ability of HC-Pro to bind to the virions. These results confirmed the “bridge
hypothesis” of potyvirus transmission proposed by Pirone and Blanc (1996),
whereby HC-Pro acts as a bi-functional molecule, with one domain located at the
core region binding to CP and other located at the N-terminal region interacting with
the aphid mouthpart.
HC-Pro is involved in systemic movement. Cronin et al. (1995) showed that a
mutant in the highly conserved CC/CS motif in the core region of the Tobacco etch
virus (TEV) HC-Pro was not capable of systemic movement. Systemic movement
was restored, however, in transgenic plants provided with the intact HC-Pro.
HC-Pro is involved in cell-to-cell movement. HC-Pro was shown to pass from cell-
to-cell, to increase the size exclusion limit (SEL) of plasmodesmata and therefore to
facilitate passage of viral RNA between cells. The region responsible for this activity
was located in the C-terminal part of HC-Pro (Rojas et al., 1997).
HC-Pro is involved in viral replication. Kasschau et al. (1997) used mutation
analysis to show that the central region of the TEV HC-Pro, that contains an IGN
motif, was important for viral amplification. This hypothesis has been supported by
the results of Urcuqui-Inchima et al. (2000) who showed that two independent
domains, designated A and B, which confer the binding of HC-Pro to RNA, were
located in the central region of HC-Pro.
HC-Pro is involved in suppression of gene silencing. It has been proposed that in
the absence of the functional HC-Pro, viral RNA or a replication intermediate is
targeted by the natural silencing response of the host cells (Kasschau and Carrington,
1998). Mallory et al. (2001) demonstrated that expression of HC-Pro in transgenic
plants suppressed PTGS at a step before accumulation of small RNAs.
47
HC-Pro has proteinase activity. The C-terminal region of HC-Pro has cysteine
proteinase-like activity required for auto-cleavage between HC-Pro and P3 at its C-
terminus. Carrington and Herndon (1992) determined the cleavage site between HC-
Pro and P3 in TEV was G763-G764 and four amino acids surrounding this cleavage
site were important for auto-recognition by HC-Pro. The cleave site (G-G) was
conserved in all the members of the family, except for bymoviruses (Adams et al.,
2005b).
2.2.4.3. P 3 protein
P3, together with P1, are the two most variable proteins in the family Potyviridae
(Adams et al., 2005b). P3 is also the least well characterised potyvirus protein
(Urcuqui-Inchima et al., 2001). However, P3 has been shown to have a role in
pathogenicity through interaction with other viral proteins; for instance, the C-
terminal region of the P3-6K1 complex carries a pathogenicity determinant in PPV
(Saenz et al., 2000). Similarly, Suehiro et al., (2004) showed that TuMV contained
an important determinant in the P3 C-terminal region, which conferred the ability of
virus to infect different hosts.
2.2.4.4. Cylindrical inclusion protein (CI)
CI is a major component of the replication complex. The CI protein belongs to
“super family 2” of helicase proteins that are characterised by seven conserved
segments, I, Ia, II, III, IV, V and VI (Kadare and Haenni, 1997). These fragments
occupy the N-terminal half of the protein and have NTP binding, NTPase, RNA
binding and RNA helicase activities (Fernandez and Garcia, 1996; Fernandez et al.,
1997; Fernandez et al., 1995). Because replication of potyviruses requires a
polymerase, a primer and a helicase to separate dsRNA templates, CI was considered
48
to be a major component of a multicomponent, membrane-associated replication
complex of CI, VPg/NIa and NIb (Shukla et al., 1998). In this case, CI can unwind
RNA duplexes with 3’ overhangs in the 3’ to 5’ direction (Fernandez et al.,
1995;1997).
CI is involved in cell-to-cell movement. Although the CI is not a true movement
protein like CP or HC-Pro (Rojas et al., 1997), the presence of ATPase activity in
plasmodesmata of Maize dwarf mosaic virus (MDMV)-infected cells (Chen et al.,
1994) suggested that cell-to-cell movement requires energy released from ATP
hydrolysis. Therefore, since CI is the only virus-encoded protein that has ATPase
activity, it may participate in this process. On the other hand, an analysis using
alanine scanning mutagenesis based on the CI/TEV system supported a model in
which CI interacts directly with plasmodesmata and CP-containing ribonucleoprotein
complex to facilitate cell-to-cell movement (Carrington et al., 1998).
2.2.4.5. 6K proteins
While 6K1, in conjunction with P3, carries a determinant for the pathogenicity as
mentioned in Section 2.2.4.3, it was proposed that 6K2 is required for genome
replication because it anchors the replication apparatus to the endoplasmic reticulum
(Schaad et al., 1997a).
2.2.4.6. Genome-linked viral protein (VPg)
The VPg is the N-terminal part of NIa and, apart from CP, the only viral protein
present in virions and covalently linked to the 5’ end of viral RNA via a tyrosine (Y)
residue (Murphy et al., 1991).
49
VPg is involved in genome replication. The role of VPg in genome replication was
shown indirectly in Tobacco vein mottling virus (TVMV) using mutations to the
tyrosine residue (Tyr1860) that links the VPg to the viral RNA. The mutant virus did
not accumulate to detectable levels in infected plants and was not infectious in
protoplasts (Murphy et al., 1996). In a recent study, Anindya et al. (2005) showed
that the VPg tyrosine 66 of Pepper vein banding virus (PVBV) was uridylylated by
NIb, and the uridylylated VPg might function as a primer for viral RNA synthesis.
VPg is involved in systemic movement. A study based on chimeric TEV genomes
(Schaad et al., 1997b) suggested that VPg interacts either directly or indirectly with
host components to facilitate long-distance movement. Dunoyer et al. (2004)
identified a cellular factor, namely Potyvirus VPg-interacting protein (PVIP), that
interacts with the VPg N-terminal region of a diverse range of potyviruses. The
interaction affected systemic symptoms involving both cell-to-cell and systemic
movement in infected plants.
VPg interacts with plant translational initiation factors. VPg was reported to
interact with plant translational initiation factors like eIF4E and eIF(iso)4E (Leonard
et al., 2000, 2004; Wittmann et al., 1997). However, the direct role of this interaction
in potyviral translation remains unknown because the VPg was not required for
efficient cap-independent translation of TuMV (Basso et al., 1994; Niepel and
Gallie, 1999).
VPg is an avirulent determinant. Several recessive resistance genes to potyviruses
have been identified in plants including pvr1 (pepper), mo1 (lettuce), sbm1 (pea) and
rym4/5 (barley). These genes (with different alleles) encode the translational
initiation factor, eIF4E. This property of VPg was identified based on observations
50
that the resistance genes, at homozygous state, containing point mutants which
interrupted the interaction of eIF4E and VPg, created resistance phenotypes at
different levels (viral accumulation, cell-to-cell and long movements) (Kang et al.,
2005)
2.2.4.7. Small nuclear inclusion protein ( NIa)
The N-terminal region of NIa harbours the VPg, whereas the C-terminal region is a
major trypsin-like protease (NIa-Pro) that cleaves the junctions of P3/6K1, 6K1/CI,
CI/6K2, 6K2/VPg, VPg/NIa-Pro, NIa-Pro/NIb and NIb/CP. The cleavage motifs for
this protease were V-xx-Q(E)-(ASGE or V) (Adams et al., 2005a; Shukla et al.,
1998).
2.2.4.8. Large nuclear inclusion protein (NIb)
NIb is a RNA dependent RNA polymerase (RdRp). This function was demonstrated
in TVMV in which the TVMV NIb had poly(U) polymerase activity and was able to
utilize full-length TVMV RNA as a template for RNA synthesis. In addition, the
mutation of the highly conserved GDD motif, which is present in many other viral
RdRps, significantly reduced the polymerase activity of the TVMV NIb (Hong and
Hunt, 1996). As discussed in Section 2.2.4.6, the uryldylation activity of NIb has also
been demonstrated recently in PVMV (Anindya et al., 2005).
2.2.4.9. Coat protein (CP)
The CP is a well-characterised potyviral protein, and is roughly divided into three
domains: The N domain is highly variable and contains the major virus-specific
epitopes; the core and C domains are more conserved. The variation in the core
51
region is similar to that of the whole genome and, therefore, is a reliable index for
genetic relatedness (Shukla et al., 1998).
CP is involved in aphid transmission. The CP N-terminal region that is exposed on
the virion surface contains a highly conserved DAG motif located near the N-
terminus. Site-directed mutagenesis analyses showed that the motif is essential for
aphid transmission (Atreya et al., 1995). However, the context in which the DAG or
equivalent motif is found is also important for efficient transmission (Lopez-Moya et
al., 1999). A specific interaction between CP and HC-Pro with the involvement of
the DAG and KITC motifs in each component, respectively, was essential for aphid
transmission (Blanc et al., 1997; Flasinski and Cassidy, 1998). This interaction
supports the “bridge hypothesis” mentioned previously.
CP is involved in cell-to cell and systemic movement. Dolja et al. (1994, 1995) used
mutation analyses to show that the N- and C-terminal regions of TEV CP were
indispensable for systemic viral movement, while the core region was essential for
cell-to-cell movement. In contrast, Arazi et al. (2001) showed that deletion or
substitution with foreign peptides encoding up to 33 amino acids of the N-terminal
region of the CP did not alter systemic infectivity of ZYMV. This finding was later
supported by Kimalov et al. (2004) who showed that maintenance of the CP N-
terminal neutralized net charge, but not primary sequence, was essential for ZYMV
systemic infectivity. It was elucidated that CP (and HC-Pro as well) are two
movement proteins that are able to increase the size exclusion limit (SEL) of
plasmodesmata and, therefore, facilitate cell-to-cell virus movement (Rojas et al.,
1997). Apparently, CP and HC-Pro co-ordinate viral accumulation and movement
(Andrejeva et al., 1999)
52
CP is a structural protein for encapsidation. The mechanism of assembly of
flexuous viruses, such as potyviruses, is still poorly understood. PVY CP subunits, in
the absence of the viral RNA and under suitable conditions, self-assemble to form 16
S disk- or ring-like intermediates made up of 7-8 subunits, which then form non-
helical virus-like particles (McDonald et al., 1976) (Fig. 1.4.A). The role of the CP
N- and C-terminal regions in particle assembly is undefined. Two lines of evidence
suggested that these two regions are not necessary for assembly. Firstly, the N- and
C-terminal regions were known to be surface-exposed and could be removed by
trypsin treatment without affecting reassembly of the CP subunits (Shukla et al.,
1991). Secondly, mutation analyses showed that the core region of CP is
indispensable for this function, but not the N- and C-termini (Dolja et al., 1995;
Dolja et al., 1994; Voloudakis et al., 2004). However, recent studies showed both
regions were required for assembly (Anindya and Savithri, 2003; Kang et al., 2006).
CP is involved in regulation of viral RNA synthesis. The interaction between the
CP and the NIb through the GDD motif of NIb (Hong et al., 1995) suggested that the
CP may be involved in regulation of RNA synthesis. Based on mutation analyses,
Mahajan et al. (1996) identified that the CP-coding sequence appeared to stimulate
genome amplification through two distinct mechanisms: (1) translation continues
until codons 138 and 189 of the TEV CP-coding sequence (but neither the CP-coding
sequence up to codon 189 nor the product encoded by this sequence is required for
amplification) and (2) one or more signals (at RNA level) located between codons
211-246 of the TEV CP might control viral RNA replication in a cis-acting manner.
These signals appeared to be involved in series of stem-loop structures in this region
as confirmed later by Haldeman-Cahill et al. (1998).
53
2.2.5. Diagnosis
2.2.5.1. Serological techniques
Serological relationships among distinct potyviruses using polyclonal antibodies are
complex for several reasons; (1) most definitive members are serologically related to
at least one of other member in the group and in many cases to several others; (2) the
specificity of antisera of the same virus prepared under different conditions
(laboratories, dissociated CP vs. intact virions, immunization procedures) may be
very inconsistent; and (3) strains of one species may differ considerably in their
serological affinities (Shukla et al., 1992; Shukla and Ward, 1989; Shukla et al.,
1998).
The molecular basis of potyvirus serology is well established. As mentioned in
Section 1.3.4.7, the N- and C-termini of the CP are surface-located. The N-terminus
is the most variable and immunodominant region in the CP gene. The epitopes
contained in this region, therefore, generate virus-specific antibodies. The N- and C-
termini of CP are easily degraded during purification and storage. The conservation
of the CP core region in different potyviruses enables production of antibodies which
can be used to detect a broad range of potyviruses (Shukla et al., 1992, 1998; Shukla
and Ward, 1989) PAbs and MAbs are currently available at both the laboratory and
commercial levels against most economically important potyviruses. In general,
serological methods, particularly used with MAbs, are widely used in the diagnosis
of potyviruses (van der Vlugt et al., 1999; Koch and Salomon, 1994: Desbiez et al.,
2002: Kantrong and Sako, 1993; Mink and Silbernagel, 1992; Mink et al., 1999;
Vetten et al., 1992; Crosslin et al., 2005; Ellis et al., 1996; Llave et al., 1999;
54
Ounouna et al., 2002 ; Balamuralikrishnan et al., 2002; Oertel et al., 1999; Villamor
et al., 2003; Hammond et al., 1992; Karyeija et al., 2000).
2.2.5.2. Nucleic acid - based techniques
2.2.5.2.1. Hybridisation techniques
The most widely used hybridisation techniques are dot blot and tissue print (see
Section 1.2.8.2). In the traditional procedures, the viral RNA is immobilised onto a
nylon membrane followed by hybridisation with labelled cDNA probes synthesized
using RT-PCR (Ali et al., 1998; Frenkel et al., 1992; Tracy et al., 1992). Recently,
Hsu et al. (2005) developed a modified hybridisation technique, named reverse dot
blot hybridisation, for rapid detection and identification of six potyviruses. In this
technique, the cDNA probes synthesized by RT-PCR with species-specific primers
were immobilized onto nylon membrane, and then hybridised with DIG-labeled RT-
PCR products amplified by potyvirus degenerate primers. This technique is similar to
a microarray-based method developed by Boonham et al. (2003) for diagnosis of
potato RNA viruses.
2.2.5.2.2. Reverse transcriptase - polymerase chain reaction (RT-PCR)
Besides using specific primers designed from known sequences, the PCR-based
methods for the detection and identification of potyviruses rely on degenerate
primers designed to conserved sequences of the genome. Since most published
potyvirus sequences are from the 3’ region of the genome, universal primers to
identify potyviruses have mostly been designed based on the conserved sequences
such as WCIEN box or QMKAA motif in the CP gene (Bateson and Dale, 1995;
Colinet and Kummert, 1993; Langeveld et al., 1991; Pappu et al., 1993; Zerbini et
55
al., 1995). Recently, the consensus motif (GNNSGQPSTVVDN) in the NIb gene has
been shown to be highly conserved among members of the family Potyviridae
(Gibbs et al., 2003). The forward degenerate primers corresponding to the
GNNSGQP sequence of this motif are specific for numerous members of the family
(Chen and Adams, 2001; Gibbs and Mackenzie, 1997; Mackenzie et al., 1998).
SUMMARY
Geminiviruses and potyviruses are two of the most economically important and
diverse groups of plant viruses identified to date. Although a small number of viral
species have been identified in Vietnam, it is important to characterise the viruses
present in the region to enable the development of appropriate diagnostic and control
measures. This will be achieved by cloning, sequencing and characterisation of the
genome sequence of geminiviruses and potyviruses infecting a wide range of crop
and putative reservoir species throughout Vietnam.
56
2.3. REFERENCES
Abouzid, A. M., Freitas-Astua, J., Purcifull, D. E., Polston, J. E., Beckham, K. A.,
Crawford, W. E., Petersen, M. A., Peyser, B., Patte, C., and Hiebert, E.
(2002). Serological studies using polyclonal antisera prepared against the
viral coat protein of four begomoviruses expressed in Escherichia coli. Plant
Disease 86, 1109-1114.
Ach, R. A., Durfee, T., Miller, A. B., Taranto, P., Hanley-Browdoin, L., Zambryski,
P. C., and Gruissem, W. (1997). RRB1 and RRB2 encode maize
retinoblastoma-related proteins that interact with a Plant D-type cyclin and
geminivirus replication protein. Molecular and Cellular Biology 17, 5077-
5086.
Adams, M. J., Antoniw, J. F., and Beaudoin, F. (2005). Overview and analysis of the
polyprotein cleavage sites in the family Potyviridae. Molecular Plant
Pathology 6, 471-487.
Adams, M. J., Antoniw, J. F., and Fauquet, C. M. (2005). Molecular criteria for
genus and species discrimination within the family Potyviridae. Archives of
Virology 150, 459-479.
Alberter, B., Ali Rezaian, M., and Jeske, H. (2005). Replicative intermediates of
Tomato leaf curl virus and its satellite DNAs. Virology 331, 441-448.
Ali, A., Randles, J. W., and Hodgson, R. A. J. (1998). Sensitive detection of pea seed
borne mosaic potyvirus by dot blot and tissue print hybridisation assays.
Australian Journal of Agricultural Research 49, 191-197.
57
Andrejeva, J., Puurand, U., Merits, A., Rabenstein, F., Jarvekulg, L., and Valkonen,
J. P. (1999). Potyvirus helper component-proteinase and coat protein (CP)
have coordinated functions in virus-host interactions and the same CP motif
affects virus transmission and accumulation. Journal of General Virology 80,
1133-9.
Anindya, R., Chittori, S., and Savithri, H. S. (2005). Tyrosine 66 of Pepper vein
banding virus genome-linked protein is uridylylated by RNA-dependent RNA
polymerase. Virology 336, 154-62.
Anindya, R., and Savithri, H. S. (2003). Surface-exposed amino- and carboxy-
terminal residues are crucial for the initiation of assembly in Pepper vein
banding virus: a flexuous rod-shaped virus. Virology 316, 325-36.
Arazi, T., Shiboleth, Y. M., and Gal-On, A. (2001). A nonviral peptide can replace
the entire N terminus of zucchini yellow mosaic potyvirus coat protein and
permits viral systemic infection. Journal of Virology 75, 6329-36.
Arbatova, J., Lehto, K., Pehu, E., and Pehu, T. (1998). Localization of the P1 protein
of potato Y potyvirus in association with cytoplasmic inclusion bodies and in
the cytoplasm of infected cells. Journal of General Virology 79, 2319-23.
Atreya, P. L., Lopez-Moya, J. J., Chu, M., Atreya, C. D., and Pirone, T. P. (1995).
Mutational analysis of the coat protein N-terminal amino acids involved in
potyvirus transmission by aphids. Journal of General Virology 76, 265-70.
Balamuralikrishnan, M., Doraisamy, S., Ganapathy, T., and Viswanathan, R. (2002).
Serological specificity and titre of Sugarcane mosaic virus polyclonal antisera
raised under varying immunization procedures and bleeding time. Journal of
Plant Diseases and Protection 109, 646-654.
58
Barnett, O. W. (1992). A summary of potyvirus taxonomy and definitions. Archives
of Virology (Suppl.) 5, 435-44.
Basso, J., Dallaire, P., Charest, P. J., Devantier, Y., and Laliberte, J. F. (1994).
Evidence for an internal ribosome entry site within the 5' non-translated
region of turnip mosaic potyvirus RNA. Journal of General Virology 75,
3157-65.
Bateson, M. F., and Dale, J. L. (1995). Banana bract mosaic virus: characterisation
using potyvirus specific degenerate PCR primers. Archives of Virology 140,
515-27.
Berger, P. H., Adams, M. J., Barnett, O. W., Brunt, A. A., Hammond, J., Hill, J. H.,
Jordan, R. L., Kashiwazaki, S., Rybicki, E., Spence, N., Stenger, D. C., Ohki,
S. T., Uyeda, I., van Jaayen, A., Valkonen, J., and Vetten, H. J. (2005).
Potyviridae. In "Virus Taxonomy. VIIIth Report of the International
Committee on Taxonomy of Viruses" (C. M. Fauquet, M. A. Mayo, J.
Maniloff, U. Desselberger, and L. A. Ball, Eds.). Elsevier/Academic Press,
London.
Bigarre, L., Chazly, M., Salah, M., Ibrahim, M., Padidam, M., Nicole, M.,
Peterschmitt, M., Fauquet, C., and Thouvenel, J. C. (2001). Characterization
of a new begomovirus from Egypt infecting hollyhock (Althea rosea).
European Journal of Plant Pathology 107, 701-711.
Blanc, S., Ammar, E. D., Garcia-Lampasona, S., Dolja, V. V., Llave, C., Baker, J.,
and Pirone, T. P. (1998). Mutations in the potyvirus helper component
protein: effects on interactions with virions and aphid stylets. Journal of
General Virology 79, 3119-22.
59
Blanc, S., Lopez-Moya, J. J., Wang, R., Garcia-Lampasona, S., Thornbury, D. W.,
and Pirone, T. P. (1997). A specific interaction between coat protein and
helper component correlates with aphid transmission of a potyvirus. Virology
231, 141-7.
Boonham, N., Walsh, K., Smith, P., Madagan, K., Graham, I., and Barker, I. (2003).
Detection of potato viruses using microarray technology: towards a generic
method for plant viral disease diagnosis. Journal of Virological Methods 108,
181-187.
Bosque-Perez, N. A. (2000). Eight decades of maize streak virus research. Virus
Research 71, 107-21.
Boulton, M. I. (2002). Functions and interactions of mastrevirus gene products.
Physiological and Molecular Plant Pathology 60, 243-255.
Brantley, J. D., and Hunt, A. G. (1993). The N-terminal protein of the polyprotein
encoded by the potyvirus tobacco vein mottling virus is an RNA-binding
protein. Journal of General Virology 74, 1157-62.
Briddon, R. W. (2003). Cotton leaf curl disease, a multicomponent begomovirus
complex. Molecular Plant Pathology 4, 427-434.
Briddon, R. W., Bull, S. E., Amin, I., Idris, A. M., Mansoor, S., Bedford, I. D.,
Dhawan, P., Rishi, N., Siwatch, S. S., and Abdel-Salam, A. M. (2003).
Diversity of DNA β, a satellite molecule associated with some monopartite
begomoviruses. Virology 312, 106-121.
60
Briddon, R. W., Bull, S. E., Amin, I., Mansoor, S., Bedford, I. D., Rishi, N., Siwatch,
S. S., Zafar, Y., Abdel-Salam, A. M., and Markham, P. G. (2004). Diversity
of DNA 1: a satellite-like molecule associated with monopartite
begomovirus-DNA β complexes. Virology 324, 462-474.
Briddon, R. W., Bull, S. E., Mansoor, S., Amin, I., and Markham, P. G. (2002).
Universal primers for the PCR-mediated amplification of DNA β - a molecule
associated with some monopartite begomoviruses. Molecular Biotechnology
20, 315-318.
Briddon, R. W., Mansoor, S., Bedford, I. D., Pinner, M. S., Saunders, K., Stanley, J.,
Zafar, Y., Malik, K. A., and Markham, P. G. (2001). Identification of DNA
components required for induction of cotton leaf curl disease. Virology 285,
234-243.
Briddon, R. W., and Markham, P. G. (2000). Cotton leaf curl virus disease. Virus
Research 71, 151-159.
Briddon, R. W., Pinner, M. S., Stanley, J., and Markham, P. G. (1990). Geminivirus
coat protein gene replacement alters insect specificity. Virology 177, 85-94.
Bull, S. E., Briddon, R. W., and Markham, P. G. (2003). Universal primers for the
PCR-mediated amplification of DNA 1: A satellite-like molecule associated
with begomovirus-DNA beta complexes. Molecular Biotechnology 23, 83-86.
Bull, S. E., Tsai, W. S., Briddon, R. W., Markham, P. G., Stanley, J., and Green, S.
K. (2004). Diversity of begomovirus DNA beta satellites of non-malvaceous
plants in east and south east Asia - Brief report. Archives of Virology 149,
1193-1200.
61
Carrington, J. C., and Herndon, K. L. (1992). Characterization of the potyviral HC-
pro autoproteolytic cleavage site. Virology 187, 308-15.
Carrington, J. C., Jensen, P. E., and Schaad, M. C. (1998). Genetic evidence for an
essential role for potyvirus CI protein in cell-to-cell movement. Plant Journal
14, 393-400.
Castillo, A. G., Collinet, D., Deret, S., Kashoggi, A., and Bejarano, E. R. (2003).
Dual interaction of plant PCNA with geminivirus replication accessory
protein (REn) and viral replication protein (Rep). Virology 312, 381-94.
Challappan, P., Vanitharani, R. and Fauquet, C.M. (2005). MicroRNA-binding viral
protein interferes with Arabidopsis development. PNAS 102, 10381-10386.
Chen, J., and Adams, M. J. (2001). A universal PCR primer to detect members of the
Potyviridae and its use to examine the taxonomic status of several members
of the family. Archives of Virology 146, 757-766.
Chen, S., Das, P., and Hari, V. (1994). In situ localization of ATPase activity in cells
of plants infected by Maize dwarf mosaic potyvirus. Archives of Virology
134, 433-9.
Colinet, D., and Kummert, J. (1993). Identification of a sweet potato feathery mottle
virus isolate from China (SPFMV-Ch) by the polymerase chain-reaction with
degenerate primers. Journal of Virological Methods 45, 149-159.
Cronin, S., Verchot, J., Haldeman-Cahill, R., Schaad, M. C., and Carrington, J. C.
(1995). Long-distance movement factor: a transport function of the potyvirus
helper component proteinase. Plant Cell 7, 549-59.
62
Crosslin, J. M., Hamm, P. B., Shiel, P. J., Hane, D. C., Brown, C. R., and Berger, P.
H. (2005). Serological and molecular detection of tobacco veinal necrosis
isolates of Potato virus Y (PVYN) from potatoes grown in the western United
States. American Journal of Potato Research 82, 263-269.
Cui, X. F., Li, G. X., Wang, D. W., Hu, D. W., and Zhou, X. P. (2005). A
begomovirus DNA β-encoded protein binds DNA, functions as a suppressor
of RNA silencing and targets the cell nucleus. Journal of Virology 79, 10764-
10775.
Czosnek, H., and Laterrot, H. (1997). A worldwide survey of tomato yellow leaf curl
viruses. Archives of Virology 142, 1391-406.
Deng, D., McGrath, P. F., Robinson, D. J., and Harrison, B. D. (1994). Detection and
differentiation of whitefly-transmitted geminiviruses in plants and vector
insects by the polymerase chain-reaction with degenerate primers. Annals of
Applied Biology 125, 327-336.
Desbiez, C., David, C., Mettouchi, A., Laufs, J., and Gronenborn, B. (1995). Rep
protein of tomato yellow leaf curl geminivirus has an ATPase activity
required for viral DNA replication. Proceedings of the National Academy of
Sciences of the United States of America 92, 5640-4.
Desbiez, C., Wipf-Scheibel, C., and Lecoq, H. (2002). Biological and serological
variability, evolution and molecular epidemiology of Zucchini yellow mosaic
virus (ZYMV, Potyvirus) with special reference to Caribbean islands. Virus
Research 85, 5-16.
63
Dickinson, V. J., Halder, J., and Woolston, C. J. (1996). The product of maize streak
virus ORF V1 is associated with secondary plasmodesmata and is first
detected with the onset of viral lesions. Virology 220, 51-9.
Dolja, V. V., Haldeman-Cahill, R., Montgomery, A. E., Vandenbosch, K. A., and
Carrington, J. C. (1995). Capsid protein determinants involved in cell-to-cell
and long distance movement of tobacco etch potyvirus. Virology 206, 1007-
16.
Dolja, V. V., Haldeman, R., Robertson, N. L., Dougherty, W. G., and Carrington, J.
C. (1994). Distinct functions of capsid protein in assembly and movement of
tobacco etch potyvirus in plants. EMBO Journal 13, 1482-91.
Dry, I. B., Krake, L. R., Rigden, J. E., and Rezaian, M. A. (1997). A novel subviral
agent associated with a geminivirus: The first report of a DNA satellite.
Proceedings of the National Academy of Sciences of the United States of
America 94, 7088-7093.
Duan, Y. P., Powell, C. A., Purcifull, D. E., Broglio, P., and Hiebert, E. (1997).
Phenotypic variation in transgenic tobacco expressing mutated geminivirus
movement/pathogenicity (BC1) proteins. Molecular Plant-Microbe
Interactions 10, 1065-74.
Dunoyer, P., Thomas, C., Harrison, S., Revers, F., and Maule, A. (2004). A cysteine-
rich plant protein potentiates potyvirus movement through an interaction with
the virus genome-linked protein VPg. Journal of Virology 78, 2301-9.
Ellis, P., StaceSmith, R., Bowler, G., and Mackenzie, D. J. (1996). Production of
monoclonal antibodies for detection and identification of strains of potato
virus Y. Canadian Journal of Plant Pathology 18, 64-70.
64
Etessami, P., Watts, J., and Stanley, J. (1989). Size reversion of African cassava
mosaic virus coat protein gene deletion mutants during infection of Nicotiana
benthamiana. Journal of General Virology 70, 277-289.
Fauquet, C. M., Sawyer, S., Idris, A. M., and Brown, J. K. (2005). Sequence analysis
and classification of apparent recombinant begomoviruses infecting tomato in
the nile and Mediterranean basins. Phytopathology 95, 549-555.
Fauquet, C. M., and Stanley, J. (2005). Revising the way we conceive and name
viruses below the species level: A review of geminivirus taxonomy calls for
new standardized isolate descriptors. Archives of Virology 150, 2151-2179.
Fernandez, A., and Garcia, J. A. (1996). The RNA helicase CI from plum pox
potyvirus has two regions involved in binding to RNA. FEBS Letters 388,
206-10.
Fernandez, A., Guo, H. S., Saenz, P., Simon-Buela, L., Gomez de Cedron, M., and
Garcia, J. A. (1997). The motif V of plum pox potyvirus CI RNA helicase is
involved in NTP hydrolysis and is essential for virus RNA replication.
Nucleic Acids Research 25, 4474-80.
Fernandez, A., Lain, S., and Garcia, J. A. (1995). RNA helicase activity of the plum
pox potyvirus CI protein expressed in Escherichia coli. Mapping of an RNA
binding domain. Nucleic Acids Research 23, 1327-32.
Flasinski, S., and Cassidy, B. G. (1998). Potyvirus aphid transmission requires helper
component and homologous coat protein for maximal efficiency. Archives of
Virology 143, 2159-72.
65
Fontes, E., Eagle, P., Sipe, P., Luckow, V., and Hanley-Bowdoin, L. (1994a).
Interaction between a geminivirus replication protein and origin DNA is
essential for viral replication. Journal of Biological Chemistry 269, 8459-
8465.
Fontes, E. P., Gladfelter, H. J., Schaffer, R. L., Petty, I. T., and Hanley-Bowdoin, L.
(1994b). Geminivirus replication origins have a modular organization. Plant
Cell 6, 405-16.
Formosa, T., and Alberts, B. M. (1986). DNA synthesis dependent on genetic
recombination: characterization of a reaction catalyzed by purified
bacteriophage T4 proteins. Cell 47, 793-806.
Frenkel, M. J., Jilka, J. M., Shukla, D. D., and Ward, C. W. (1992). Differentiation of
potyviruses and their strains by hybridization with the 3' noncoding region of
the viral genome. Journal of Virological Methods 36, 51-62.
Gafni, Y. (2003). Tomato yellow leaf curl virus. Molecular Plant Pathology 4, 9-15.
Gafni, Y., and Epel, B. L. (2002). The role of host and viral proteins in intra- and
inter-cellular trafficking of geminiviruses. Physiological and Molecular Plant
Pathology 60, 231-241.
Garcia-Andres, S., Monci, F., Navas-Castillo, J., and Moriones, E. (2006).
Begomovirus genetic diversity in the native plant reservoir Solanum nigrum:
Evidence for the presence of a new virus species of recombinant nature.
Virology 350, 433-442.
George, J. W., and Kreuzer, K. N. (1996). Repair of double-strand breaks in
bacteriophage T4 by a mechanism that involves extensive DNA replication.
Genetics 143, 1507-20.
66
Ghanim, M., Morin, S., Zeidan, M., and Czosnek, H. (1998). Evidence for
transovarial transmission of tomato yellow leaf curl virus by its vector, the
whitefly Bemisia tabaci. Virology 240, 295-303.
Gibbs, A., and Mackenzie, A. (1997). A primer pair for amplifying part of the
genome of all potyvirids by RT-PCR. Journal of Virological Methods 63, 9-
16.
Gibbs, A. J., Mackenzie, A. M., and Gibbs, M. J. (2003). The 'potyvirid primers' will
probably provide phylogenetically informative DNA fragments from all
species of Potyviridae. Journal of Virological Methods 112, 41-44.
Gilbertson, R. L., Hidayat, S. H., Martinez, R. T., Leong, S. A., Faria, J. C., Morales,
F., and Maxwell, D. P. (1991). Differentiation of bean-infecting
geminiviruses by nucleic-acid hybridization probes and aspects of bean
golden mosaic in Brazil. Plant Disease 75, 336-342.
Girish, K. R., and Usha, R. (2005). Molecular characterization of two soybean-
infecting begomoviruses from India and evidence for recombination among
legume-infecting begomoviruses from South-East Asia. Virus Research 108,
167-176.
Gonsalves, D. (1998). Control of papaya ringspot virus in papaya: A case study.
Annual Review of Phytopathology 36, 415-437.
Guo, X., and Zhou, X. (2005). Molecular characterization of Alternanthera yellow
vein virus: a new Begomovirus species infecting Alternanthera philoxeroides.
Journal of Phytopathology 153, 694-696.
Gutierrez, C. (2000). DNA replication and cell cycle in plants: learning from
geminiviruses. EMBO Journal 19, 792-799.
67
Gutierrez, C. (2002). Strategies for geminivirus DNA replication and cell cycle
interference. Physiological and Molecular Plant Pathology 60(5), 219-230.
Gutierrez, C., Ramirez-Parra, E., Castellano, M. M., Sanz-Burgos, A. P., Luque, A.,
and Missich, R. (2004). Geminivirus DNA replication and cell cycle
interactions. Veterinary Microbiology 98, 111-119.
Haldeman-Cahill, R., Daros, J. A., and Carrington, J. C. (1998). Secondary structures
in the capsid protein coding sequence and 3' nontranslated region involved in
amplification of the tobacco etch virus genome. Journal of Virology 72,
4072-9.
Hallan, V., and Gafni, Y. (2001). Tomato yellow leaf curl virus (TYLCV) capsid
protein (CP) subunit interactions: implications for viral assembly. Archives of
Virology 146, 1765-73.
Hammond, J., Jordan, R. L., Larsen, R. C., and Moyer, J. W. (1992). Use of
polyclonal antisera and monoclonal-antibodies to examine serological
relationships among 3 filamentous viruses of sweet-potato. Phytopathology
82, 713-717.
Hanley-Bowdoin, L., Settlage, S. B., Orozco, B. M., Nagar, S., and Robertson, D.
(2000). Geminiviruses: models for plant DNA replication, transcription, and
cell cycle regulation. Critical Reviews in Biochemistry and Molecular
Biology 35, 105-40.
Harper, K., and Creamer, R. (1995). Hybridization detection of insect-transmitted
plant-viruses with digoxigenin-labeled probes. Plant Disease 79, 563-567.
68
Harrison, B., and Robinson, D. (1999). Natural genomic and antigenic variation in
whitefly-transmitted geminiviruses (begomoviruses). Annual Review of
Phytopathology 37, 369-398.
Harrison, B. D., Liu, Y. L., Khalid, S., Hameed, S., OtimNape, G. W., and Robinson,
D. J. (1997). Detection and relationships of cotton leaf curl virus and allied
whitefly-transmitted geminiviruses occurring in Pakistan. Annals of Applied
Biology 130, 61-75.
Harrison, B. D., Swanson, M. M., and Fargette, D. (2002). Begomovirus coat
protein: serology, variation and functions*1. Physiological and Molecular
Plant Pathology 60, 257-271.
Hartitz, M. D., Sunter, G., and Bisaro, D. M. (1999). The tomato golden mosaic virus
transactivator (TrAP) is a single-stranded DNA and zinc-binding
phosphoprotein with an acidic activation domain. Virology 263, 1-14.
Hatta, T., and Francki, R.I.B. (1979). The fine structure of chloris striate mosaic
virus. Virology 92, 428-435.
Henson, J. M., and French, R. (1993). The polymerase chain-reaction and plant-
disease diagnosis. Annual Review of Phytopathology 31, 81-109.
Heyraud-Nitschke, F., Schumacher, S., Laufs, J., Schaefer, S., Schell, J., and
Gronenborn, B. (1995). Determination of the origin cleavage and joining
domain of geminivirus Rep proteins. Nucleic Acids Research 23, 910-6.
Hofer, P., Bedford, I. D., Markham, P. G., Jeske, H., and Frischmuth, T. (1997). Coat
protein gene replacement results in whitefly transmission of an insect
nontransmissible geminivirus isolate. Virology 236, 288-95.
69
Hong, Y., and Hunt, A. G. (1996). RNA polymerase activity catalyzed by a
potyvirus-encoded RNA-dependent RNA polymerase. Virology 226, 146-51.
Hong, Y., Levay, K., Murphy, J. F., Klein, P. G., Shaw, J. G., and Hunt, A. G.
(1995). A potyvirus polymerase interacts with the viral coat protein and VPg
in yeast cells. Virology 214, 159-66.
Horns, T., and Jeske, H. (1991). Localization of abutilon mosaic virus (AbMV) DNA
within leaf tissue by in situ hybridization. Virology 181, 580-8.
Hou, Y. M., Sanders, R., Ursin, V. M., and Gilbertson, R. L. (2000). Transgenic
plants expressing geminivirus movement proteins: abnormal phenotypes and
delayed infection by Tomato mottle virus in transgenic tomatoes expressing
the Bean dwarf mosaic virus BV1 or BC1 proteins. Molecular Plant-Microbe
Interactions 13, 297-308.
Hsu, Y. C., Yeh, T. J., and Chang, Y. C. (2005). A new combination of RT-PCR and
reverse dot blot hybridization for rapid detection and identification of
potyviruses. Journal of Virological Methods 128, 54-60.
Hull, R. (1993). Nucleic acid hybridization procedures. In "Diagnosis of Plant Virus
Diseases" (R. E. F. Matthews, Ed.). CRC Press.
Hull, R. (2002). "Matthews's Plant Virology." Fourth ed. Academic Press.
Idris, A. M., and Brown, J. K. (2005). Evidence for interspecific-recombination for
three monopartite begomoviral genomes associated with the tomato leaf curl
disease from central Sudan. Archives of Virology 150, 1003-1012.
70
Jeske, H., Lutgemeier, M., and Preiss, W. (2001). DNA forms indicate rolling circle
and recombination-dependent replication of Abutilon mosaic virus. EMBO
Journal 20, 6158-67.
Jupin, I., De Kouchkovsky, F., Jouanneau, F., and Gronenborn, B. (1994). Movement
of tomato yellow leaf curl geminivirus (TYLCV): involvement of the protein
encoded by ORF C4. Virology 204, 82-90.
Jupin, I., Hericourt, F., Benz, B., and Gronenborn, B. (1995). DNA replication
specificity of TYLCV geminivirus is mediated by the amino-terminal 116
amino acids of the Rep protein. FEBS Letters 362, 116-20.
Kadare, G., and Haenni, A. L. (1997). Virus-encoded RNA helicases. Journal of
Virology 71, 2583-2590.
Kang, B. C., Yeam, I., and Jahn, M. M. (2005). Genetics of plant virus resistance.
Annual Review of Phytopathology 43, 581-621.
Kang, S. H., Lim, W. S., Hwang, S. H., Park, J. W., Choi, H. S., and Kim, K. H.
(2006). Importance of the C-terminal domain of soybean mosaic virus coat
protein for subunit interactions. Journal of General Virology 87, 225-9.
Kantrong, S., and Sako, N. (1993). Characterization of epitopes recognized by
monoclonal antibodies to aphid transmissible and non-transmissible strains of
turnip mosaic virus. Archives of Virology 133, 11-20.
Karyeija, R. F., Kreuze, J. F., Gibson, R. W., and Valkonen, J. P. T. (2000). Two
serotypes of Sweetpotato feathery mottle virus in Uganda and their
interaction with resistant sweetpotato cultivars. Phytopathology 90, 1250-
1255.
71
Kasschau, K. D., and Carrington, J. C. (1998). A counterdefensive strategy of plant
viruses: suppression of posttranscriptional gene silencing. Cell 95, 461-70.
Kasschau, K. D., Cronin, S., and Carrington, J. C. (1997). Genome amplification and
long-distance movement functions associated with the central domain of
tobacco etch potyvirus helper component-proteinase. Virology 228, 251-62.
Kegler, H., Fuchs, E., Gruntzig, M., and Schwarz, S. (1998). Some results of 50
years of research on the resistance to plum pox virus. Acta Virol 42, 200-15.
Kheyr-Pour, A., Bananej, K., Dafalla, G. A., Caciagli, P., Noris, E., Ahoonmanesh,
A., Lecoq, H., and Gronenborn, B. (2000). Watermelon chlorotic stunt virus
from the Sudan and Iran: sequence comparisons and identification of a
whitefly-transmission determinant. Phytopathology 90, 629-635.
Kimalov, B., Gal-On, A., Stav, R., Belausov, E., and Arazi, T. (2004). Maintenance
of coat protein N-terminal net charge and not primary sequence is essential
for zucchini yellow mosaic virus systemic infectivity. Journal of General
Virology 85, 3421-3430.
Koch, M., and Salomon, R. (1994). Serological detection of onion yellow dwarf
virus in garlic. Plant Disease 78, 785-788.
Kon, T., Hidayat, S. H., Hase, S., Takahashi, H., and Ikegami, M. (2006). The
natural occurrence of two distinct begomoviruses associated with DNA β and
a recombinant DNA in a tomato plant from Indonesia. Phytopathology 96,
517-525.
Kreuzer, K. N. (2000). Recombination-dependent DNA replication in phage T4.
Trends in Biochemical Sciences 25, 165-73.
72
Kumari, S. G., Makkouk, K. M., and Attar, N. (2006). An improved antiserum for
sensitive serologic detection of Chickpea chlorotic dwarf virus. Journal of
Phytopathology 154, 129-133.
Kunik, T., Palanichelvam, K., Czosnek, H., Citovsky, V., and Gafni, Y. (1998).
Nuclear import of the capsid protein of tomato yellow leaf curl virus
(TYLCV) in plant and insect cells. Plant Journal 13, 393-9.
Langeveld, S. A., Dore, J. M., Memelink, J., Derks, A., Vandervlugt, C. I. M., Asjes,
C. J., and Bol, J. F. (1991). Identification of potyviruses using the polymerase
chain-reaction with degenerate primers. Journal of General Virology 72,
1531-1541.
Laufs, J., Jupin, I., David, C., Schumacher, S., Heyraud-Nitschke, F., and
Gronenborn, B. (1995a). Geminivirus replication: genetic and biochemical
characterization of Rep protein function, a review. Biochimie 77, 765-773.
Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S. G., Schell, J., and
Gronenborn, B. (1995b). In vitro cleavage and joining at the viral origin of
replication by the replication initiator protein of tomato yellow leaf curl virus.
Proceedings of the National Academy of Sciences of the United States of
America 92, 3879-83.
Lazarowitz, S. G. (1992). Geminiviruses - genome structure and gene function.
Critical Reviews in Plant Sciences 11, 327-349.
Legg, J. P., and Fauquet, C. M. (2004). Cassava mosaic geminiviruses in Africa.
Plant Molecular Biology 56, 585-599.
73
Leonard, S., Plante, D., Wittmann, S., Daigneault, N., Fortin, M. G., and Laliberte, J.
F. (2000). Complex formation between potyvirus VPg and translation
eukaryotic initiation factor 4E correlates with virus infectivity. Journal of
Virology 74, 7730-7737.
Leonard, S., Viel, C., Beauchemin, C., Daigneault, N., Fortin, M. G., and Laliberte,
J. F. (2004). Interaction of VPg-Pro of turnip mosaic virus with the
translation initiation factor 4E and the poly(A)-binding protein in planta.
Journal of General Virology 85, 1055-63.
Lin, B., Akbar Behjatnia, S. A., Dry, I. B., Randles, J. W., and Rezaian, M. A.
(2003). High-affinity Rep-binding is not required for the replication of a
geminivirus DNA and its satellite. Virology 305, 353-363.
Liu, H., Boulton, M. I., Oparka, K. J., and Davies, J. W. (2001). Interaction of the
movement and coat proteins of Maize streak virus: implications for the
transport of viral DNA. Journal of General Virology 82, 35-44.
Liu, H., Boulton, M. I., Thomas, C. L., Prior, D. A., Oparka, K. J., and Davies, J. W.
(1999). Maize streak virus coat protein is karyophyllic and facilitates nuclear
transport of viral DNA. Molecular Plant-Microbe Interactions 12, 894-900.
Llave, C., Martinez, B., Diaz-Ruiz, J. R., and Lopez-Abella, D. (1999). Serological
analysis and coat protein sequence determination of potato virus Y (PVY)
pepper pathotypes and differentiation from other PVY strains. European
Journal of Plant Pathology 105, 847-857.
Lopez-Moya, J. J., Wang, R. Y., and Pirone, T. P. (1999). Context of the coat protein
DAG motif affects potyvirus transmissibility by aphids. Journal of General
Virology 80, 3281-8.
74
Lotrakul, P., Valverde, R. A., Clark, C. A., Sim, J., and Torre, R. d. l. (1998).
Detection of a geminivirus infecting sweet potato in the United States. Plant
Disease 82, 1253-1257.
Lyttle, D. J., and Guy, P. L. (2004). First record of Geminiviruses in New Zealand:
Abutilon mosaic virus and Honeysuckle yellow vein virus. Australasian
Plant Pathology 33, 321-322.
Mackenzie, A. M., Nolan, M., Wei, K.-J., Clements, M. A., Gowanlock, D., Wallace,
B. J., and Gibbs, A. J. (1998). Ceratobium mosaic potyvirus: another virus
from orchids. Archives of Virology 143, 903-914.
Mahajan, S., Dolja, V. V., and Carrington, J. C. (1996). Roles of the sequence
encoding tobacco etch virus capsid protein in genome amplification:
requirements for the translation process and a cis-active element. Journal of
Virology 70, 4370-9.
Maki-Valkama, T., Valkonen, J. P., Kreuze, J. F., and Pehu, E. (2000). Transgenic
resistance to PVY(O) associated with post-transcriptional silencing of P1
transgene is overcome by PVY(N) strains that carry highly homologous P1
sequences and recover transgene expression at infection. Molecular Plant-
Microbe Interactions 13, 366-73.
Mallory, A. C., Ely, L., Smith, T. H., Marathe, R., Anandalakshmi, R., Fagard, M.,
Vaucheret, H., Pruss, G., Bowman, L., and Vance, V. B. (2001). HC-Pro
suppression of transgene silencing eliminates the small RNAs but not
transgene methylation or the mobile signal. Plant Cell 13, 571-83.
Mansoor, S., Briddon, R. W., Zafar, Y., and Stanley, J. (2003). Geminivirus disease
complexes: an emerging threat. Trends in Plant Science 8, 128-134.
75
Mansoor, S., Khan, S. H., Bashir, A., Saeed, M., Zafar, Y., Malik, K. A., Briddon,
R., Stanley, J., and Markham, P. G. (1999). Identification of a novel circular
single-stranded DNA associated with cotton leaf curl disease in Pakistan.
Virology 259, 190-199.
Martin, R. R., James, D., and Levesque, C. A. (2000). Impacts of molecular
diagnostic technologies on plant disease management. Annual Review of
Phytopathology 38, 207-239.
Martins Santana, F., Ribeiro, S. D., Moita, A. W., Moreira, D. J., and Giordano, L.
D. (2001). Sources of resistance in Lycopersicon spp. to a bipartite whitefly-
transmitted geminivirus from Brazil. Euphytica 122, 45-51.
Maruthi, M. N., Czosnek, H., Vidavski, F., Tarba, S. Y., Milo, J., Leviatov, S.,
Venkatesh, H. M., Padmaja, A. S., Kulkarni, R. S., and Muniyappa, V.
(2003). Comparison of resistance to Tomato leaf curl virus (India) and
Tomato yellow leaf curl virus (Israel) among Lycopersicon wild species,
breeding lines and hybrids. European Journal of Plant Pathology 109, 1-11.
McDonald, J. G., Beveridge, T. J., and Bancroft, J. B. (1976). Self-assembly of
protein from a flexuous virus. Virology 69, 327-31.
Mink, G. I., and Silbernagel, M. J. (1992). Serological and biological relationships
among viruses in the bean common mosaic-virus subgroup. Archives of
Virology Suppl 5, 397-406.
Mink, G. I., Vetten, H. J., Wyatt, S. D., Berger, P. H., and Silbernagel, M. J. (1999).
Three epitopes located on the coat protein amino terminus of viruses in the
bean common mosaic potyvirus subgroup. Archives of Virology 144, 1173-
1189.
76
Moffat, A. S. (1999). Geminiviruses emerge as a serious crop threat. Science 286,
1835.
Monci, F., Sanchez-Campos, S., Navas-Castillo, J., and Moriones, E. (2002). A
natural recombinant between the geminiviruses Tomato yellow leaf curl
Sardinia virus and Tomato yellow leaf curl virus exhibits a novel pathogenic
phenotype and is becoming prevalent in Spanish populations. Virology 303,
317-326.
Moriones, E., and Navas-Castillo, J. (2000). Tomato yellow leaf curl virus, an
emerging virus complex causing epidemics worldwide. Virus Research 71,
123-134.
Mosig, G. (1998). Recombination and recombination-dependent DNA replication in
bacteriophage T4. Annual Review of Genetics 32, 379-413.
Mosig, G., Gewin, J., Luder, A., Colowick, N., and Vo, D. (2001). Two
recombination-dependent DNA replication pathways of bacteriophage T4,
and their roles in mutagenesis and horizontal gene transfer. Proceedings of
the National Academy of Sciences of the United States of America 98, 8306-
8311.
Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., and Erlich, H. (1986).
Specific enzymatic amplification of DNA in vitro: the polymerase chain
reaction. Cold Spring Harbor Symposia on Quantitative Biology 51, 263-73.
Murphy, J. F., Klein, P. G., Hunt, A. G., and Shaw, J. G. (1996). Replacement of the
tyrosine residue that links a potyviral VPg to the viral RNA is lethal. Virology
220, 535-8.
77
Murphy, J. F., Rychlik, W., Rhoads, R. E., Hunt, A. G., and Shaw, J. G. (1991). A
tyrosine residue in the small nuclear inclusion protein of tobacco vein
mottling virus links the VPg to the viral RNA. Journal of Virology 65, 511-3.
Niepel, M., and Gallie, D. R. (1999). Identification and characterization of the
functional elements within the tobacco etch virus 5' leader required for cap-
independent translation. Journal of Virology 73, 9080-8.
Noris, E., Vaira, A. M., Caciagli, P., Masenga, V., Gronenborn, B., and Accotto, G.
P. (1998). Amino acids in the capsid protein of tomato yellow leaf curl virus
that are crucial for systemic infection, particle formation, and insect
transmission. Journal of Virology 72, 10050-7.
Noueiry, A.O., Lucas, W.J. and Gilbertson, R.L. (1994).Two proteins of a plant
DNA virus coordinate nuclear and plasmodesmal transport. Cell 76, 925-932.
Oertel, U., Fuchs, E., and Hohmann, F. (1999). Differentiation of isolates of
Sugarcane mosaic potyvirus (SCMV) on the basis of molecular, serological
and biological investigations. Journal of Plant Diseases and Protection 106,
304-313.
Orozco, B., and Hanley-Bowdoin, L. (1996). A DNA structure is required for
geminivirus replication origin function. Journal of Virology 70, 148-158.
Orozco, B. M., Kong, L.-J., Batts, L. A., Elledge, S., and Hanley-Bowdoin, L.
(2000). The multifunctional character of a geminivirus replication protein is
reflected by its complex oligomerization properties. Journal of Biological
Chemistry 275, 6114-6122.
78
Orozco, B. M., Miller, A. B., Settlage, S. B., and Hanley-Bowdoin, L. (1997).
Functional domains of a geminivirus replication protein. Journal of
Biological Chemistry 272, 9840-9846.
Ounouna, H., Kerlan, C., Lafaye, P., Loukili, M. J., and ElGaaied, A. (2002).
Production of monoclonal antibodies against synthetic peptides of the N-
terminal region of Potato virus Y coat protein and their use in PVY strain
differentiation. Plant Pathology 51, 487-494.
Padidam, M., Beachy, R. N., and Fauquet, C. M. (1996). The role of AV2 ("precoat")
and coat protein in viral replication and movement in tomato leaf curl
geminivirus. Virology 224, 390-404.
Padidam, M., Sawyer, S., and Fauquet, C. M. (1999). Possible emergence of new
geminiviruses by frequent recombination. Virology 265, 218-225.
Palmer, K. E., and Rybicki, E. P. (1998). The molecular biology of mastreviruses.
Advances in Virus Research 50, 183-234.
Pappu, S. S., Brand, R., Pappu, H. R., Rybicki, E. P., Gough, K. H., Frenkel, M. J.,
and Niblett, C. L. (1993). A polymerase chain reaction method adapted for
selective amplification and cloning of 3' sequences of potyviral genomes -
application to Dasheen mosaic virus. Journal of Virological Methods 41, 9-
20.
Pascal, E., Sanderfoot, A. A., Ward, B. M., Medville, R., Turgeon, R., and
Lazarowitz, S. G. (1994). The geminivirus BR1 movement protein binds
single-stranded DNA and localizes to the cell nucleus. Plant Cell 6, 995-
1006.
79
Paximadis, M., Idris, A. M., Torres-Jerez, I., Villarreal, A., Rey, M. E. C., and
Brown, J. K. (1999). Characterization of tobacco geminiviruses in the Old
and New World. Archives of Virology 144, 703-717.
Peng, Y. H., Kadoury, D., Gal-On, A., Huet, H., Wang, Y., and Raccah, B. (1998).
Mutations in the HC-Pro gene of zucchini yellow mosaic potyvirus: effects
on aphid transmission and binding to purified virions. Journal of General
Virology 79, 897-904.
Peterschmitt, M., Reynaud, B., Sommermeyer, G., and Baudin, P. (1991).
Characterization of maize streak virus isolates using monoclonal and
polyclonal antibodies and by transmission to a few hosts. Plant Disease 75,
27-32.
Petty, I. T. D., Carter, S. C., Morra, M. R., Jeffrey, J. L., and Olivey, H. E. (2000).
Bipartite geminivirus host adaptation determined cooperatively by coding and
noncoding sequences of the genome. Virology 277, 429-438.
Pico, B., Diez, M. J., and Nuez, F. (1996). Viral diseases causing the greatest
economic losses to the tomato crop. II. The Tomato yellow leaf curl virus - a
review. Scientia Horticulturae 67, 151-196.
Pico, B., Diez, M. J., and Nuez, F. (1999). Improved diagnostic techniques for
tomato yellow leaf curl virus in tomato breeding programs. Plant Disease 83,
1006-1012.
80
Pinner, M. S., and Markham, P. G. (1990). Serotyping and strain identification of
maize streak virus isolates. Journal of General Virology 71, 1635-40.
Pinner, M. S., Markham, P. G., Rybicki, E. P., and Greber, R. S. (1992). Serological
relationships of geminivirus isolates from Gramineae in Australia. Plant
Pathology 41, 618-625.
Pirone, T. P., and Blanc, S. (1996). Helper-dependent vector transmission of plant
viruses. Annual Review of Phytopathology 34, 227-247.
Polston, J. E., Dodds, J. A., and Perring, T. M. (1989). Nucleic-acid probes for
detection and strain discrimination of cucurbit geminiviruses. Phytopathology
79, 1123-1127.
Polston, J. E., McGovern, R. J., and Brown, L. G. (1999). Introduction of tomato
yellow leaf curl virus in Florida and implications for the spread of this and
other geminiviruses of tomato. Plant Disease 83, 984-988.
Pooma, W., Gillette, W. K., Jeffrey, J. L., and Petty, I. T. D. (1996). Host and viral
factors determine the dispensability of coat protein for bipartite geminivirus
systemic movement. Virology 218, 264-268.
Pooma, W., and Petty, I. T. (1996). Tomato golden mosaic virus open reading frame
AL4 is genetically distinct from its C4 analogue in monopartite
geminiviruses. Journal of General Virology 77, 1947-51.
Potter, J. L., Nakha, M. K., Mejia, L., and Maxwell, D. P. (2003). PCR and DNA
hybridization methods for specific detection of bean-infecting begomoviruses
in the Americas and Caribbean. Plant Disease 87, 1205-1212.
81
Preiss, W., and Jeske, H. (2003). Multitasking in replication is common among
geminiviruses. Journal of Virology 77, 2972-80.
Rampersad, S. N., and Umaharan, P. (2003). Detection of begomoviruses in clarified
plant extracts: A comparison of standard, direct-binding, and immunocapture
polymerase chain reaction techniques. Phytopathology 93, 1153-1157.
Rhee, Y., Gurel, F., Gafni, Y., Dingwall, C., and Citovsky, V. (2000). A genetic
system for detection of protein nuclear import and export. Nature
Biotechnology 18, 433-7.
Rigden, J. E., Krake, L. R., Rezaian, M. A., and Dry, I. B. (1994). ORF C4 of tomato
leaf curl geminivirus is a determinant of symptom severity. Virology 204,
847-50.
Rojas, A., Kvarnheden, A., Marcenaro, D., and Valkonen, J. P. T. (2005). Sequence
characterization of Tomato leaf curl Sinaloa virus and Tomato severe leaf
curl virus: phylogeny of New World begomoviruses and detection of
recombination. Archives of Virology 150, 1281-1299.
Rojas, M. R., Gilbertson, R. J., Russell, D. R., and Maxwell, D. P. (1993). Use of
degenerate primers in the polymerase chain-reaction to detect whitefly-
transmitted geminiviruses. Plant Disease 77, 340-347.
Rojas, M. R., Jiang, H., Salati, R., Xoconostle-Cazares, B., Sudarshana, M. R.,
Lucas, W. J., and Gilbertson, R. L. (2001). Functional analysis of proteins
involved in movement of the monopartite begomovirus, tomato yellow leaf
curl virus. Virology 291, 110-125.
82
Rojas, M. R., Noueiry, A. O., Lucas, W. J., and Gilbertson, R. L. (1998). Bean dwarf
mosaic geminivirus movement proteins recognize DNA in a form- and size-
specific manner. Cell 95, 105-13.
Rojas, M. R., Zerbini, F. M., Allison, R. F., Gilbertson, R. L., and Lucas, W. J.
(1997). Capsid protein and helper component-proteinase function as
potyvirus cell-to-cell movement proteins. Virology 237, 283-95.
Rothenstein, D., Haible, D., Dasgupta, I., Dutt, N., Patil, B. L., and Jeske, H. (2006).
Biodiversity and recombination of cassava-infecting begomoviruses from
southern India. Archives of Virology 151, 55-69.
Roye, Wernecke, McLaughlin, Nakhla, and Maxwell (1999). Tomato dwarf leaf curl
virus, a new bipartite geminivirus associated with tomatoes and peppers in
Jamaica and mixed infection with tomato yellow leaf curl virus. Plant
Pathology 48, 370-378.
Rubio, L., Herrero, J. R., Sarrio, J., Moreno, P., and Guerri, J. (2003). A new
approach to evaluate relative resistance and tolerance of tomato cultivars to
begomoviruses causing the tomato yellow leaf curl disease in Spain. Plant
Pathology 52, 763-769.
Rybicki, E. P. (1994). A phylogenetic and evolutionary justification for 3 genera of
geminiviridae. Archives of Virology 139, 49-77.
Saenz, P., Cervera, M. T., Dallot, S., Quiot, L., Quiot, J. B., Riechmann, J. L., and
Garcia, J. A. (2000). Identification of a pathogenicity determinant of Plum
pox virus in the sequence encoding the C-terminal region of protein
P3+6K(1). Journal of General Virology 81, 557-566.
83
Sanderfoot, A. A., Ingham, D. J., and Lazarowitz, S. G. (1996). A viral movement
protein as a nuclear shuttle. The geminivirus BR1 movement protein contains
domains essential for interaction with BL1 and nuclear localization. Plant
Physiology 110, 23-33.
Saunders, K., Bedford, I. D., Briddon, R. W., Markham, P. G., Wong, S. M., and
Stanley, J. (2000). A unique virus complex causes Ageratum yellow vein
disease. Proceedings of the National Academy of Sciences of the United
States of America 97, 6890-6895.
Saunders, K., Bedford, I. D., and Stanley, J. (2002). Adaptation from whitefly to
leafhopper transmission of an autonomously replicating nanovirus-like DNA
component associated with ageratum yellow vein disease. Journal of General
Virology 83, 907-913.
Saunders, K., Lucy, A., and Stanley, J. (1991). DNA forms of the geminivirus
African cassava mosaic virus consistent with a rolling circle mechanism of
replication. Nucleic Acids Research 19, 2325-30.
Schaad, M. C., Jensen, P. E., and Carrington, J. C. (1997). Formation of plant RNA
virus replication complexes on membranes: role of an endoplasmic reticulum-
targeted viral protein. EMBO Journal 16, 4049-59.
Schaad, M. C., Lellis, A. D., and Carrington, J. C. (1997). VPg of tobacco etch
potyvirus is a host genotype-specific determinant for long-distance
movement. Journal of Virology 71, 8624-31.
Seal, S. E., vandenBosch, F., and Jeger, M. J. (2006). Factors influencing
begomovirus evolution and their increasing global significance: Implications
for sustainable control. Critical Reviews in Plant Sciences 25, 23-46.
84
Settlage, S. B., Miller, A. B., Gruissem, W., and Hanley-Bowdoin, L. (2001). Dual
interaction of a geminivirus replication accessory factor with a viral
replication protein and a plant cell cycle regulator. Virology 279, 570-6.
Settlage, S. B., Miller, A. B., and Hanley-Bowdoin, L. (1996). Interactions between
geminivirus replication proteins. Journal of Virology 70, 6790-5.
Shukla, D. D., Frenkel, M. J., and Ward, C. W. (1991). Structure and function of the
potyvirus genome with special reference to the coat protein coding region.
Canadian Journal of Plant Pathology 13, 178-191.
Shukla, D. D., Lauricella, R., and Ward, C. W. (1992). Serology of potyviruses:
current problems and some solutions. Archives of Virology (Suppl.) 5, 57-69.
Shukla, D. D., and Ward, C. W. (1989). Identification and classification of
potyviruses on the basis of coat protein sequence data and serology. Brief
review. Archives of Virology 106, 171-200.
Shukla, D. D., Ward, C. W., Brunt, A. A., and Berger, P. H. (1998). Potyviridae
family. In "Description of Plant Viruses, No. 366". Association of Applied
Biologists (AAB).
Stanley, J., Bisaro, D. M., Briddon, R. W., Brown, J. K., Fauquet, C. M., Harrison,
B. D., Rybicki, E. P., and Stenger, D. C. (2005). Geminiviridae. In "Virus
Taxonomy. VIIIth Report of the International Committee on Taxonomy of
Viruses" (C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger, and L.
A. Ball, Eds.), pp. 301 - 326. Elsevier/Academic Press, London.
Stonor, J., Hart, P., Gunther, M., DeBarro, P., and Rezaian, M. A. (2003). Tomato
leaf curl geminivirus in Australia: occurrence, detection, sequence diversity
and host range. Plant Pathology 52, 379-388.
85
Suehiro, N., Natsuaki, T., Watanabe, T., and Okuda, S. (2004). An important
determinant of the ability of Turnip mosaic virus to infect Brassica spp.
and/or Raphanus sativus is in its P3 protein. Journal of General Virology 85,
2087-98.
Sunter, G., and Bisaro, D. M. (1992). Transactivation of geminivirus AR1 and BR1
gene expression by the viral AL2 gene product occurs at the level of
transcription. Plant Cell 4, 1321-31.
Sunter, G., and Bisaro, D. M. (1997). Regulation of a geminivirus coat protein
promoter by AL2 protein (TrAP): evidence for activation and derepression
mechanisms. Virology 232, 269-80.
Sunter, G., Hartitz, M. D., Hormuzdi, S. G., Brough, C. L., and Bisaro, D. M. (1990).
Genetic analysis of tomato golden mosaic virus: ORF AL2 is required for
coat protein accumulation while ORF AL3 is necessary for efficient DNA
replication. Virology 179, 69-77.
Sunter, G., Sunter, J. L., and Bisaro, D. M. (2001). Plants expressing tomato golden
mosaic virus AL2 or beet curly top virus L2 transgenes show enhanced
susceptibility to infection by DNA and RNA viruses. Virology 285, 59-70.
Tomlinson, J. A. (1987). Epidemiology and control of virus diseases of vegetables.
Annals of Applied Biology 110, 661-681.
Tracy, S. L., Frenkel, M. J., Gough, K. H., Hanna, P. J., and Shukla, D. D. (1992).
Bean yellow mosaic, clover yellow vein, and pea mosaic are distinct
potyviruses - evidence from coat protein gene-sequences and molecular
hybridization involving the 3' noncoding regions. Archives of Virology 122,
249-261.
86
Unseld, S., Hohnle, M., Ringel, M., and Frischmuth, T. (2001). Subcellular targeting
of the coat protein of African cassava mosaic geminivirus. Virology 286, 373-
83.
Urcuqui-Inchima, S., Haenni, A. L., and Bernardi, F. (2001). Potyvirus proteins: a
wealth of functions. Virus Research 74, 157-175.
Urcuqui-Inchima, S., Maia, I. G., Arruda, P., Haenni, A. L., and Bernardi, F. (2000).
Deletion mapping of the potyviral helper component-proteinase reveals two
regions involved in RNA binding. Virology 268, 104-11.
Vanitharani, R., Challappan, P., Pita, J.S. and Fauquet, C.M. (2004). Differential
roles of AC2 and AC4 of cassava geminiviruses in mediating synergism and
suppression of post-transcriptional gene silencing. Journal of Virology 78,
9487-9498.
van der Vlugt, R. A. A., Steffens, P., Cuperus, C., Barg, E., Lesemann, D. E., Bos,
L., and Vetten, H. J. (1999). Further evidence that shallot yellow stripe virus
(SYSV) is a distinct potyvirus and reidentification of Welsh onion yellow
stripe virus as a SYSV strain. Phytopathology 89, 148-155.
Verchot, J., Herndon, K. L., and Carrington, J. C. (1992). Mutational analysis of the
tobacco etch potyviral 35-kDa proteinase: identification of essential residues
and requirements for autoproteolysis. Virology 190, 298-306.
Vetten, H. J., Lesemann, D. E., and Maiss, E. (1992). Serotype-a and serotype-B
strains of bean common mosaic virus are 2 distinct potyviruses. Archives of
Virology Suppl 5, 415-431.
87
Villamor, D. E. V., Bajet, N. B., and Lockhart, B. E. (2003). Purification and
production of antiserum against abaca mosaic potyvirus. Philippine
Agricultural Scientist 86, 368-376.
Voinnet, O., Pinto, Y. M., and Baulcombe, D. C. (1999). Suppression of gene
silencing: a general strategy used by diverse DNA and RNA viruses of plants.
Proceedings of the National Academy of Sciences of the United States of
America 96, 14147-52.
Voloudakis, A. E., Malpica, C. A., Aleman-Verdaguer, M. E., Stark, D. M., Fauquet,
C. M., and Beachy, R. N. (2004). Structural characterization of Tobacco etch
virus coat protein mutants. Archives of Virology 149, 699-712.
Wang, R. Y., Powell, G., Hardie, J., and Pirone, T. P. (1998). Role of the helper
component in vector-specific transmission of potyviruses. Journal of General
Virology 79, 1519-24.
Ward, B. M., and Lazarowitz, S. G. (1999). Nuclear export in plants. Use of
geminivirus movement proteins for a cell-based export assay. Plant Cell 11,
1267-76.
Ward, B. M., Medville, R., Lazarowitz, S. G., and Turgeon, R. (1997). The
geminivirus BL1 movement protein is associated with endoplasmic
reticulum-derived tubules in developing phloem cells. Journal of Virology 71,
3726-33.
Wartig, L., Kheyr-Pour, A., Noris, E., De Kouchkovsky, F., Jouanneau, F.,
Gronenborn, B., and Jupin, I. (1997). Genetic analysis of the monopartite
tomato yellow leaf curl geminivirus: roles of V1, V2, and C2 ORFs in viral
pathogenesis. Virology 228, 132-140.
88
Were, H. K., Takeshita, M., Furuya, N., and Takanami, Y. (2005). Molecular
characterization of a new begomovirus infecting tobacco in Kagoshima,
Japan: an evidence for interspecific recombination. Journal of the Faculty of
Agriculture Kyushu University 50, 83-91.
Wittmann, S., Chatel, H., Fortin, M. G., and Laliberte, J. F. (1997). Interaction of the
viral protein genome linked of turnip mosaic potyvirus with the translational
eukaryotic initiation factor (iso) 4E of Arabidopsis thaliana using the yeast
two-hybrid system. Virology 234, 84-92.
Wyatt, S. D., and Brown, J. K. (1996). Detection of subgroup III geminivirus isolates
in leaf extracts by degenerate primers and polymerase chain reaction.
Phytopathology 86, 1288-1293.
Yang, L. J., Hidaka, M., Masaki, H., and Uozumi, T. (1998). Detection of potato
virus Y P1 protein in infected cells and analysis of its cleavage site.
Bioscience, Biotechnology, and Biochemistry 62, 380-2.
Zerbini, F. M., Koike, S. T., and Gilbertson, R. L. (1995). Biological and molecular
characterization of lettuce mosaic potyvirus isolates from the Salinas Valley
of California. Phytopathology 85, 746-752.
Zhang, W., Olson, N. H., Baker, T. S., Faulkner, L., Agbandje-McKenna, M.,
Boulton, M. I., Davies, J. W., and McKenna, R. (2001). Structure of the
maize streak virus geminate particle. Virology 279, 471-477.
Zhou, X., Liu, Y., Calvert, L., Munoz, C., Otim-Nape, G. W., Robinson, D. J., and
Harrison, B. D. (1997). Evidence that DNA-A of a geminivirus associated
with severe cassava mosaic disease in Uganda has arisen by interspecific
recombination. Journal of General Virology 78, 2101-11.
89
Zhou, X. P., Xie, Y., Tao, X. R., Zhang, Z. K., Li, Z. H., and Fauquet, C. M. (2003).
Characterization of DNA beta associated with begomoviruses in China and
evidence for co-evolution with their cognate viral DNA-A. Journal of
General Virology 84, 237-247.
90
CHAPTER 3
Corchorus yellow vein virus, a New World
geminivirus from the Old World
Cuong Ha1, Steven Coombs2, Peter Revill1,†, Rob Harding1, Man Vu3 and James Dale1
1Tropical Crops and Biocommodities Domain, Institute of Health and Biomedical
Innovation, Queensland University of Technology, GPO Box 2434, Brisbane, QLD
4001, Australia
2Centre for Information Technology Innovation, Faculty of Information Technology,
Queensland University of Technology, Brisbane, QLD 4001, Australia
3Department of Plant Pathology, Hanoi Agriculture University, Gia Lam, Hanoi,
Vietnam
† Present address: Victorian Infectious Diseases Reference Laboratory, 10 Wreckyn
Street, North Melbourne, VIC 3051, Australia.
Journal of General Virology (2006), 87: 997–1003
91
Statement of joint authorship
Cuong Ha:
Executed the work (collected plant samples, designed and conducted all laboratory
experiments, analysed and interpreted data) and wrote initial manuscript.
Steven Coombs:
Provided initial alignments of geminivirus sequences for design of degenerate
primers.
Peter Revill:
Conceived project idea, collected plant samples, supervised execution of the work,
critically interpreted data and significantly contributed to final manuscript.
Rob Harding:
Conceived project idea, collected plant samples, supervised execution of the work,
critically interpreted data and contributed to final manuscript.
Man Vu:
Conceived project idea and collected samples.
James Dale:
Conceived project idea, collected plant samples, supervised execution of the work,
critically interpreted data, contributed to final manuscript.
92
SUMMARY
A bipartite begomovirus infecting Jute mallow (Corchorus capsularis, Tilliaceae) in
Vietnam was identified using novel degenerate PCR primers. Analysis of this virus,
which was named Corchorus yellow vein virus (CoYVV), showed that it was more
similar to New World begomoviruses than to viruses from the Old World. This was
based on the absence of an AV2 open reading frame, the presence of an N-terminal
PWRLMAGT motif in the coat protein and phylogenetic analysis of the DNA A and
DNA B nucleotide and deduced amino acid sequences. Evidence is provided that
CoYVV is probably indigenous to the region and may be the remnant of a previous
population of New World begomoviruses in the Old World.
The GenBank/EMBL/DDBJ accession numbers for the sequences reported in this
paper are AY727903 and AY27904.
93
INTRODUCTION
The Geminiviridae are a family of plant viruses with circular single-stranded DNA
(ssDNA) genomes encapsidated in twinned particles. Based on their genome
arrangement and biological properties, geminiviruses are classified into one of four
genera, Mastrevirus, Curtovirus, Topocuvirus and Begomovirus (Stanley et al.,
2005). Members of the genus Begomovirus are transmitted by whiteflies to a wide
range of dicotyledonous plants and many have bipartite genomes, known as DNA A
and DNA B. DNA A has either one or two open reading frames (ORFs) in the virion
sense (AV1, AV2) and up to four major ORFs in the complementary sense (AC1,
AC2, AC3, AC4). The DNA B component has one major ORF in each of the virion
(BV1) and complementary (BC1) orientations. The DNA A and DNA B components
share little sequence similarity, except for ~170 nt of sequence in the intergenic
region (IR), termed the common region (CR) (reviewed by Hanley-Bowdoin et al.,
1999). Although the CR sequence is usually almost identical in both components,
there are examples where the CRs differ substantially between DNA A and DNA B.
For example, the CRs of Tomato leaf curl Gujarat virus (ToLCGV) and Cotton leaf
crumple virus (CLCrV) differed by 40 and 37%, respectively (Chakraborty et al.,
2003; Idris & Brown, 2004). Despite these differences, sequences critical for
replication are identical between components of each individual virus. These
comprise iterative sequences (iterons) that are recognized and bound by Rep protein
(Fontes et al., 1994; Orozco et al., 1998) and a conserved inverted repeat sequence
with the potential to form a stem–loop where rolling circle replication initiates (Laufs
et al., 1995; Stanley, 1995). Microprojectile bombardment of seedlings with
infectious clones of the respective CLCrV and ToLCGV DNA A and DNA B
94
molecules resulted in typical disease symptoms and confirmed that both components
are from the same infectious unit (Chakraborty et al., 2003; Idris & Brown, 2004).
Phylogenetic studies show that begomoviruses can be broadly divided into two
groups, the Old World viruses (eastern hemisphere, Europe, Africa, Asia) and the
New World viruses (western hemisphere, the Americas) (Padidam et al., 1999;
Paximadis et al., 1999; Rybicki, 1994). Begomovirus genomes have a number of
characteristics that distinguish Old World and New World viruses. All New World
begomoviruses are bipartite, whereas both bipartite and monopartite begomoviruses
are present in the Old World. In addition, all Old World begomoviruses have an extra
AV2 ORF in DNA A that is not present in New World begomoviruses (Rybicki,
1994; Stanley et al., 2005). New World begomoviruses also have an N-terminal
PWRsMaGT motif in the coat protein (CP) encoded by AV1, which is absent from
Old World begomoviruses (Harrison et al., 2002). In most Old World
begomoviruses, there are two iterons upstream of the AC1 TATA box, with a
complementary iteron downstream. This downstream iteron is lacking in most New
World begomoviruses (Arguello-Astorga et al., 1994). Rybicki (1994) proposed that
most New World viruses arose more recently than Old World viruses and suggested
that they may have evolved after the continental separation of the Americas from
Gondwana approximately 130 million years ago. Rybicki (1994) speculated that
whiteflies moving from Asia to the Americas may have transmitted viruses that were
the ancestors of New World viruses that we observe today. These viruses
subsequently evolved separately from Old World viruses and this evolution would
also have been accompanied by the early loss of the AV2 gene (originally named
AV1), which would explain its absence from all New World viruses characterized to
95
date. In more recent times, there is evidence of New World begomoviruses in the Old
World and vice versa, due to the increased range of the B biotype of the Bemisia
tabaci whitefly vector and/or the distribution of infected propagating material. For
example, strains of Tomato yellow leaf curl virus (TYLCV) have been identified in
the New World (Caribbean Islands and Florida) (reviewed by Czosnek & Laterrot,
1997; Polston et al., 1999) and the New World virus Abutilon mosaic virus (AbMV)
has been identified in ornamental Abutilon spp. in the UK (Brown et al., 2001) and
New Zealand (Lyttle & Guy, 2004). However, these are apparently recent
introductions and there are no known examples of indigenous viruses from the Old
World with genome organization and/or phylogenetic similarity to New World
viruses and vice versa. In this paper, we describe the first example of an indigenous
Old World begomovirus that has all of the distinguishing characteristics of a New
World virus and discuss the ramifications of this finding for current theories on
begomovirus evolution.
METHODS
Degenerate primers and PCR
Although degenerate PCR primers have been used to amplify DNA A from a number
of begomoviruses, most primer pairs only amplify small fragments of approximately
500 nt in the AV1 gene (Revill et al., 2003; Wyatt & Brown, 1996). To design
degenerate primers that would amplify a larger region of DNA A, we aligned
begomovirus DNA A sequences from the GenBank database using the CLUSTAL X
program (Thompson et al., 1997) and identified two conserved regions, one at the 5’
end of the AV1 gene (CP) and the other at the 3’ end of the AC1 gene (Rep),
approximately 1200 nt apart. Degenerate primers, BegoAFor1 (5’-
96
TGYGARGGiCCiTGYAARGTYCARTC-3’) (i=inosine) and BegoARev1 (5’-
ATHCCMDCHATCKTBCTiTGCAATCC-3’), were designed in each region and
used in PCRs comprising a 1 μl aliquot of template DNA, 15 mM MgCl2 buffer
(Roche), 10 pmol dNTPs, 40 pmol of each primer and 2.5 U Taq polymerase
(Roche). The reactions were denatured at 94 OC for 5 min and then subjected to 40
cycles at 94 OC (30 s), 50 OC (30 s) and 72 OC (90 s), terminating with 10 min at 72
OC.
The primers were initially tested on total DNA extracted (DNeasy; Qiagen) from
several known begomovirus-infected samples from Vietnam, namely Squash leaf
curl virus-China (SLCCNV), Luffa yellow mosaic virus (LYMV) and TYLCV and
in each case a fragment of the expected size (~1.2 kbp) was amplified. Sequence
analysis of the cloned amplicon from the SLCCNV-infected sample confirmed the
presence of SLCCNV. DNA was subsequently extracted from various samples that
had been collected during a virus survey of Vietnam during 2000. These samples
included weeds that were exhibiting typical geminivirus symptoms (stunting, bright
yellow mosaics and vein yellowing) and Jute (Corchorus capsularis), a leaf
vegetable and medicinal herb, collected from Hoa Binh province in northern
Vietnam, which was showing vein yellowing.
The DNA A-specific primers BegoAFor1 and BegoARev1 amplified a 1.2 kbp
product from several of the samples tested, including the Jute sample, which was
chosen for further analysis. To amplify DNA B from the Jute sample, the degenerate
primer PBL1v2040 (Rojas et al., 1993) was used in combination with an antisense
97
primer (201CRRev 59-CAGAGACTTTGGTGTGTACC-39) located in the DNA A
IR to amplify a product of ~700 bp. This primer pair was used in a PCR as described
above, but at an annealing temperature of 46 OC.
Amplification and cloning of DNA A and DNA B
To amplify the remaining sequence of DNA A and DNA B from the virus infecting
Jute, outwardly extending specific primers (DNA A: 201For 5’-
TCCTCTTCGAAGAACTCCT-3’, 201Rev 5’-TGTATGAGCAATATCGTGAC-3’;
DNA B: 201BFor 5’-GAAGGTATGATGTCTTCCTG-3’, 201BRev 5’-
AATCACAATTAGCTCAAGC-3’) were used in PCRs comprising a 1 μl aliquot of
template DNA, 15 mM MgCl2 buffer, 10 pmol dNTPs, 40 pmol of each primer and
2.5 U Taq polymerase. The reactions were denatured at 94 OC for 5 min, followed by
40 cycles at 94 OC (30 s), 52 OC (30 s) and 72 OC (90 s), terminating with 10 min at
72 OC. For DNA B, the annealing temperature was reduced to 46 OC. The complete
DNA A sequence was also amplified using Expand polymerase (Roche) with
adjacent outwardly extending primers (201For and 201Rev1 5’-
AAAGAACAAAGCAATCAATGAC-3’) at an annealing temperature of 50 OC.
PCR products were gel-purified, ligated into plasmid vector pGEM-T Easy
(Promega), introduced into Escherichia coli and sequenced. Consensus sequences
were determined using the SeqMan program (DNASTAR) and nucleotide and
deduced amino acid sequences from three clones for each molecule were analysed
using EditSeq (DNASTAR) and Vector NTI. Sequences were compared with the
GenBank database using the BLAST programs available at the National Centre for
98
Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/blast). The
complete DNA A and DNA B nucleotide sequences and the nucleotide and deduced
amino acid sequences of the AC1, AV1, BC1 and BV1 genes were aligned using
CLUSTAL X (Thompson et al., 1997) with analogous sequences from 29 Old World
and 11 New World begomoviruses (Table 1). Neighbor-joining trees were generated
using TREEVIEW (Page, 1996). Nucleotide identities were calculated with the
MegAlign program (DNASTAR) using the CLUSTALW algorithm.
Replication studies
To confirm that the DNA A and DNA B molecules identified in this study were from
the same bipartite begomovirus, replication studies were performed on cloned
components. To the best of our knowledge, Corchorus yellow vein virus (CoYVV) is
not present in Australia and therefore Australian quarantine regulations did not
permit co-inoculation experiments with DNA A and DNA B infectious clones. To
determine whether the DNA A Rep sequence could initiate replication of DNA B,
Nicotiana tabacum (NT1) cells were co-bombarded with a plasmid expressing the
DNA A Rep/TraP/REn sequences encoded by AC1, AC2 and AC3, respectively, and
a plasmid containing a 1.5-mer copy of the DNA B molecule.
Constructs
DNA B 1.5-mer replicon
The complete DNA B sequence was amplified by PCR using the Expand Long
Template PCR system (Roche Diagnostics) using a pair of adjacent outwardly
99
Table 1. GenBank accession numbers for the begomoviruses used in the phylogenetic analysis
Accession no. Acronym Species
DNA A DNA B
New World AbMV Abutilon mosaic virus X15983 X15984 BDMV Bean dwarf mosaic virus M88179 M88180 SLCV Squash leaf curl virus M38183 M38182 DiYMoV Dicliptera yellow mottle virus AF139168 AF170101 MaMPRV Macroptilium mosaic Puerto Rico virus AF449192 AF449193 RhGMV Rhynchosia golden mosaic virus AF239671 - SiGMCRV Sida golden mosaic Costa Rica virus X99550 X99551 SiGMV Sida golden mosaic virus AF049336 AJ250731 SiMoV Sida mottle virus AY090555 - SMLCV Squash mild leaf curl virus AF421552 AF421553 CabLCuV Cabbage leaf curl virus U65529 U65530 ToGMoV Tomato golden mottle virus AF132852 - ToMoTV Tomato mottle Taino Virus AF012300 AF012301
Old World
ACMV African cassava mosaic virus AF126802 AF126803 AEV Ageratum enation virus AJ437618 - AYVV Ageratum yellow vein virus X74516 - CLCuRV Cotton leaf curl Rajasthan virus AF363011 - EACMV East African cassava mosaic virus AF126806 AF126807 EpYVV Eupatorium yellow vein virus AJ438936 - ICMV Indian cassava mosaic virus AJ314739 AJ314740 MYMIV Mungbean yellow mosaic India virus AF126406 AF142440 LYMV Luffa yellow mosaic virus AF509739 AF509740 MYMV Mungbean yellow mosaic virus D14703 D14704 PaLCuCNV Papaya leaf curl China virus AJ558124 - PepLCBV Pepper leaf curl Bangladesh virus AF314531 - SACMV South African cassava mosaic virus AF155806 AF155807 SbCLV Soybean crinkle leaf virus AB050781 - SLCCNV Squash leaf curl virus-China AF509743 AF509742 StaLCV Stachytarpheta leaf curl virus AJ495814 - TbLCYNV Tobacco leaf curl Yunnan virus AJ566744 - ToLCLV Tomato leaf curl Laos virus AF195782 - ToLCVV Tomato leaf curl Vietnam virus AF264063 - ToLCV Tomato leaf curl virus S53251 - TYLCTHV Tomato yellow leaf curl virus- Thailand AY514630 AY514633
100
extending primers, CorBSacFor (5’-GAGCTCCTCTCTCTGTACGACGACCA-3’,
nt 448–473) and CorBSacRev (5’-GAGCTCCATGTCTATACCGCATAGTATAC-
3’, nt 453–425). PCRs were set up as described above using an annealing
temperature of 55 OC and the amplicon was gel purified (Qiax II; Qiagen) and ligated
into the pGEM-T Easy vector to produce pCoY/B-1.0. The fragment containing the
potential stem–loop sequence in the DNA B CR was excised from pCoY/B-1.0 and
ligated into the pGEM-T Easy vector to form pCoY/B-0.5. The complete DNA B
sequence was excised from pCoY/B-1.0 and ligated to pCoY/A-0.5 to form pCoY/B-
1.5, which contained the complete DNA B sequence flanked by two DNA B stem–
loop sequences.
Rep/TraP/REn gene expression
The complete DNA A sequence was amplified using adjacent outwardly extending
primers, CorAPstFor (5’-CTGCAGTTCGTGCATCTGTACTTCTTC-3’, nt 2314–
2340) and CorAPstRev (5’-CTGCAGATTGTTCGATCTATCCAATCC-3’, nt
2319–2293), as described above. The amplicon was ligated into the pGEM-T Easy
vector to produce pCoY/A-1.0. The sequence encompassing the complete AC1 ORF
through to the end of the REn gene was amplified using the Expand Long Template
PCR system from the pCoY/A-1.0 template, with primers 201RepFor (5’-
AGGCACCATGGGAAGTCGTTTTG-3’) and 201REnRev (5’-
CTGCACGTGAGATACGGATCTAC-3’). The amplicon was ligated into the
pTEST expression vector (a gift from Dr B. Dugdale, Queensland University of
Technology) containing a 35S promoter and a Nos terminator in a pGEM-T Easy
backbone, to form p35SRep/REn.
101
Microprojectile bombardment and Southern hybridization
NT1 cells were co-bombarded with either pCoY/B-1.5 alone (1 μg) or pCoY/B-1.5
and p35SRep/REn (0.5 μg) together, as described by Dugdale et al. (1998) and
harvested three days post-inoculation. DNA was extracted using the CTAB method
of Stewart & Via (1993) and 40 μg DNA was loaded onto each lane of a 1% agarose
gel. Southern hybridization was performed using the DIG (Roche) protocol, with a
1157 nt DNA B probe amplified from the pCoY/B-0.5 plasmid using primers
CorBEcoFor (5’-GAATTCAACTGTAGAACAATCTCTGTTAG-3’, nt 2021–2043)
and CorBSacRev.
RESULTS
CoYVV sequence
Complete nucleotide sequences of DNA A and DNA B were obtained and we named
the virus Corchorus yellow vein virus (CoYVV). The DNA A molecule was 2724 nt
in length, whereas the DNA B molecule comprised 2691 nt. DNA A encoded one
major ORF in the sense orientation (AV1) and four in the complementary sense
(AC1, AC2, AC3 and AC4). DNA A did not encode an AV2 ORF. DNA B encoded
two major ORFs, BV1 on the virion strand and BC1 on the complementary strand.
The CRs of DNA A and DNA B comprised 228 and 254 nt, respectively, with 70.2%
identity. This low identity was due, in part, to a 21 base insertion in the DNA B CR
between the TATA box and the stem–loop sequence; the remainder of the CR
sequences were 84% identical. Each CR contained two identical iterons, both
upstream of the AC1 TATA box, as well as identical stem–loop sequences that
included the conserved TAATATTAC nonanucleotide sequence present in the CRs
102
103
of all characterized geminiviruses (Fig. 1). A PWRLMAGT motif was identified at
the N terminus of the deduced CoYVV CP sequence encoded by AV1 (Table 2).
Replication analysis
Southern hybridization experiments using a DIG-labelled DNA B-specific probe
showed that microprojectile bombardment of NT1 cells with a construct expressing
the DNA A Rep/TraP/REn sequences initiated replication of DNA B, released from a
plasmid harbouring a 1.5-mer copy of DNA B. No DNA B replication was observed
in the absence of the Rep/TraP/REn gene product (Fig. 2).
Phylogenetic analysis
BLAST searches and nucleotide sequence alignments showed that CoYVV DNA A
was more closely related to New World begomoviruses than to those from the Old
World, and with closest overall nucleotide identity (60.2%) to Macroptilium mosaic
Puerto Rico virus (data not shown). Sequence alignments showed that CoYVV DNA
B was also more closely related to New World begomoviruses with closest overall
nucleotide identity to Tomato mottle Taino virus (ToMoTV; 45.9%). Higher
similarity was observed for the deduced amino acid sequence of the BC1 gene,
which was 75% similar to the analogous sequence of Bean dwarf mosaic virus
(BDMV) from Columbia (data not shown). In addition, the CoYVV DNA A lacked
the AV2 ORF that is present in Old World begomoviruses, but absent from all New
104
**************************************************************************************** DNA A CTTGCGTTTTATATCGGTACACACCAAAGTCTCTGTGTACCGATATATCGGTACACAATATATACTAGTGGCCTCTATAATGCTACTA- DNA B CTTGCGTTTTATATCGGTACACACCAAAGTCTCTGTGTACCGATATATCGGTACACAATATATACTAGTGGCCTCTATAATGCTACTAA
********* ** ** * * ** ******* * *** *** * * * ** ** * DNA A GGCGTGCAGCGCCTTGATATTCCGGACGCGAGGGGTATTCATGGTCATTT-GCCACTCAGTT---------------------TAGCGC DNA B GGCGTGCAGTTCCACC-TAGGCGTGGGAAGAAGGGTATTTAGTGTCTTTTCACTATTTGTTTGTAAAGGGTTTGATATCCGCATAAGGG
***** ** * ** **************** *********************** **************** DNA A TATTTTTGGG---TTCCGATCCGCTGCTGCACGCCTATAATATTACCGTGCAGCAGCCCC-GCTTTTGCCGTACGCT DNA B TATTTGTGTAACTTACCACACCGCTGCTGCACGCCTTTAATATTACCGTGCAGCAGCCCCCGCTTTTGCCGTACGCT
Fig. 1. Comparison of the CR sequences of CoYVV DNA A and DNA B. The putative iteron sequences are underlined, the
TATA motif is boxed and stem–loop forming sequences are underlined and in bold. Asterisks indicate identical nucleotides.
A comparison of the N-terminal amino acid sequences of the CP of CoYVV and several representative New World and Old
World begomoviruses is given in Table 2.
Table 2. Comparison of the N-terminal amino acid sequences of the CP of
CoYVV and several representative New World (the Americas) and Old World
(Asia, Africa) begomoviruses (Harrison et al., 2002).
The conserved motif PWRsMaGT is highlighted in bold. The initial methionine
residue (M) is the first amino acid of the CP. GenBank accession numbers for
these sequences and the virus names are provided in Table 1.
Virus N terminus of the CP Origin
MAMPRV MPKRDAPWRSSAGTSKVSRN America
SiGMV MPKRELPWRSMAGTSKVSRN America
ToGMoV MPKRDAPWRLMGGTSKVSRS America
RhGMV MPKRDAPWRLSAGTSKVSRS America
BDMV MPKRDAPWRSMAGTTKVSRN America
CoYVV MPKRDAPWRLMAGTSKVSRS This study
LYMV MSKRPADIIISTPASKVRRR Asia
SLCCNV MSKRPADIIISTPASKVRRR Asia
ToLCVV MSKRPADIVISTPASKVRRR Asia
ICMV MSKRPADIIISTPASKVRRR Asia
TYLCTHV MSKRPADILISTPVSKVRRR Asia
TLCLV MSKRPGDIIISTPVSKVRRR Asia
ACMV MSKRPGDIIISTPGSKVRRR Africa
EACMV MSKRPGDIIISAPVSKVRRR Africa
105
106
107
Fig. 2. Southern blot analysis of DNA extracted from NT1 cells bombarded
with a 1.5-mer copy of the CoYVV DNA B sequence (pCoY/B-1.5) alone
(lanes 1–3), pCoY/B-1.5 co-bombarded with a plasmid expressing the
CoYVV Rep/TraP/REn genes (p35SRep/REn) (lanes 4–6), unshot and
p35SRep/REn controls (lanes 7 and 8, respectively) and 270 pg pCoY/B-1.5
DNA (lane 9). The blots were hybridized with a DNA B-specific probe.
Open circular and supercoiled DNA are indicated by the top and bottom
arrows, respectively.
1 2 3 4 5 6 7 8 9
108
109
World begomoviruses. Other similarities to many begomoviruses from the New
World included the presence of a PWRLMAGT motif at the CoYVV CP N terminus
and the absence of a complementary iteron downstream of the AC1 TATA box.
Phylogenetic analysis using the complete DNA A and DNA B nucleotide sequences
showed that CoYVV grouped more closely with New World begomoviruses, but was
the most distant of the New World begomoviruses (100% bootstrap support) (Fig. 3).
A similar tree topology was obtained using the AV1 nucleotide and deduced amino
acid sequences and the AC1, BC1 and BV1 nucleotide sequences (data not shown).
DISCUSSION
We have identified a bipartite virus from the Old World that is more similar to New
World geminiviruses than to other indigenous Old World viruses. This conclusion is
based on the absence of an AV2 ORF, the presence of an N-terminal PWRLMAGT
motif in the CP, the absence of a complementary iteron downstream of the stem–loop
sequence and phylogenetic analysis of the DNA A and DNA B nucleotide and
deduced amino acid sequences. Although the nucleotide sequences of the CoYVV
DNA A and DNA B CRs were only 70.2 % identical, due in part to a 21 nt insertion
in the DNA B CR, they shared identical iterons and stem–loop sequences, suggesting
that they represented two components of the one virus. This was supported by
microprojectile bombardment of NT1 cells, which showed that a construct
harbouring the DNA A Rep/TraP/REn sequence initiated episomal replication of
DNA B released from a plasmid harbouring a 1.5-mer copy of the DNA B molecule.
Our results confirmed that the CoYVV DNA A and DNA B molecules represented a
biologically functional unit from the same begomovirus.
TYLCTHV
110
New World
(a) (b)
0.1
ICMV
LYMV
SLCCNV
1000
1000
985
ACMV
MYMIV
MYMV 1000
958
EACMV
SACMV
1000
1000 1000
SMLCV
SLCV
1000
DiYMoV
MaMPRV CaLCuV
646 675
AbMV ToMoTV
1000 BDMV
SiGMCRV
SiGMV 1000
1000 1000
1000
CoYVV
New World
SLCV
SMLCV
MaMPRV
0.1
ACMV
EACMV
SACMV
1000
1000
MYMIV
MYMV
1000
DiYMoV
ToGMoV
SiMoV BDMV
SiGMCRV
995
ToMoTV SiGMV
AbMV 1000 1000
960
CaLCuV
1000 1000
958
RhGMV
1000
879 1000
644 ToLCV
EpYVV
TYLCTHV
ToLCVV
PaLCuCNV
1000
891
819
TbLCYNV AYVV
SbCLV
1000 712
ToLCLV StaLCV
821
883
1000
724
CLCuRV
AEV PepLCBV
1000
LYMV
SLCCNV-[VN] 1000
863
970
ICMV
1000
870
560 728
551
CoYVV
Fig. 3. Phylogenetic analysis of the complete CoYVV DNA A (a) and DNA B (b) nucleotide sequences. CoYVV
is circled and underlined. Bootstrap values are indicated (1000 replicates). The full name and GenBank accession
numbers for the sequences used in the analysis are presented in Table 1.
CoYVV is not the only Old World geminivirus to bear some relationship to New
World geminiviruses. Phylogenetic analysis of the CP, BC1, BC2 and IRA/IRB
sequences of the Old World Mungbean yellow mosaic virus (MYMV) showed that
they were closely related to viruses from the New World (Rybicki, 1994). Our
phylogenetic analysis of the complete DNA A sequence from a large number of Old
and New World geminiviruses showed that, whereas MYMV was distal to other Old
World viruses, it was still more closely related to Old World geminiviruses than to
New World viruses. The complete MYMV DNA B sequence was even more closely
related to Old World viruses, whereas the CoYVV DNA A and DNA B sequences
were both more closely related to New World viruses. It should also be noted that
MYMV encodes an AV2 ORF, although the sequence in GenBank (e.g. accession
no. D14703) appears to contain a frameshift error in AV2 that results in two AV2
genes.
The distal position of CoYVV on phylogenetic trees relative to the New World
begomoviruses with which it shares closest similarity suggests that CoYVV is not a
New World virus that has been recently introduced into Vietnam. Rather, it is more
likely that it has been in Vietnam for a considerable period. Jute is a native of
southern China (http://www.hear.org/gcw/html/autogend/species/5199.htm) and is
propagated as a vegetable and fibre crop by seed, not cuttings. There are no reports
of seed transmission of begomoviruses, which suggests that CoYVV has either been
transmitted to Jute in Vietnam or CoYVV-infected plants entered Vietnam from
nearby southern China. Although some Old World and New World begomoviruses
have been detected in the New and Old Worlds, respectively, these are probably
recent introductions either as a result of spread of the B biotype of the B. tabaci
111
whitefly vector (reviewed by Czosnek & Laterrot, 1997; Polston et al., 1999) or the
direct importation of infected plants (Brown et al., 2001; Lyttle & Guy, 2004).
Therefore, CoYVV appears to be the first indigenous begomovirus identified from
the Old World with closer similarity to New World begomoviruses. Rybicki (1994)
suggested that New World viruses may have evolved from Old World viruses after
continental separation from Gondwana, possibly as a result of whitefly transmission
of ancestral Old World viruses to the New World. Rybicki (1994) also suggested that
the absence of the AV2 ORF from all New World bipartite geminiviruses could be
explained by its early loss after arrival in the New World and the subsequent
evolution of AV2-deficient New World viruses. The occurrence of CoYVV in
Vietnam strongly suggests that New World and Old World viruses have been present
together in this region for some considerable time. It also suggests that the common
ancestor of New World viruses originated in the Old World and that both the New
World and Old World begomoviruses had evolved prior to continental separation. It
is possible that CoYVV may be a remnant from the population of New World
begomoviruses that previously existed in the Old World. Alternatively, the
begomoviruses may have evolved in the Old World, and a progenitor of the current
New World begomoviruses moved to the New World by unknown means. Although
it is possible that whiteflies transmitted a CoYVV-like virus to the Americas, it is
tempting to speculate that Asian ancestors of American Indians (for discussion see
http://www.hrw.com/science/si-science/biology/evolution/origin/origin.html) or very
early Chinese traders may have moved the virus(es) to the New World.
Vietnam appears to be a major centre for plant virus diversity. In previous studies,
we have shown that sequence variability of one genome component of the ssDNA
112
Banana bunchy top virus (BBTV) in Vietnam was almost double that observed
elsewhere in the world (Bell et al., 2002). High levels of sequence variability were
also observed in the ssRNA potyvirus, Papaya ringspot virus (PRSV; Bateson et al.,
2002). We have also previously identified two begomoviruses infecting Vietnamese
cucurbits with CP genes that appear to have a recombinant origin (SLCCNV and
LYMV; Revill et al., 2003). The discovery of CoYVV further emphasizes the degree
of virus diversity present in Vietnam. We are currently characterizing geminiviruses
and associated ssDNA molecules infecting a large range of crops and weeds in
Vietnam, to determine whether additional viruses similar to CoYVV are present and
provide us with further insights into begomovirus evolution.
ACKNOWLEDGEMENTS
This work was funded by the Australian Centre for International Agricultural
Research (ACIAR) and the Australian Research Council. The authors thank Brett
Williams for assistance with the construction of plasmids for the in vitro replication
studies and Jennifer Kleidon for maintenance of the NT1 cell lines.
113
REFERENCES
Arguello-Astorga, G. R., Guevara-Gonzalez, R. G., Herrera-Estrella, L. R. &
Rivera-Bustamante, R. F. (1994). Geminivirus replication origins have a group-
specific organization of iterative elements: a model for replication. Virology 203, 90-
100.
Bateson, M. F., Lines, R. E., Revill, P., Chaleeprom, W., Ha, C. V., Gibbs, A. J.
& Dale, J. L. (2002). On the evolution and molecular epidemiology of the potyvirus
Papaya ringspot virus. J Gen Virol 83, 2575-2585.
Bell, K. E., Dale, J. L., Ha, C. V., Vu, M. T. & Revill, P. A. (2002).
Characterisation of Rep-encoding components associated with banana bunchy top
nanovirus in Vietnam. Arch Virol 147, 695-707.
Brown, J. K., Idris, A. M., Torres-Jerez, I., Banks, G. K. & Wyatt, S. D. (2001).
The core region of the coat protein gene is highly useful for establishing the
provisional identification and classification of begomoviruses. Arch Virol 146, 1581-
1598.
Chakraborty, S., Pandey, P. K., Banerjee, M. K., Kalloo, G. & Fauquet, C. M.
(2003). Tomato leaf curl Gujarat virus, a new Begomovirus species causing a severe
leaf curl disease of tomato in Varanasi, India. Phytopathology 93, 1485-1495.
114
Czosnek, H. & Laterrot, H. (1997). A worldwide survey of tomato yellow leaf curl
viruses. Arch Virol 142, 1391-1406.
Dugdale, B., Beetham, P. R., Becker, D. K., Harding, R. M. & Dale, J. L. (1998).
Promoter activity associated with the intergenic regions of banana bunchy top virus
DNA-1 to –6 in transgenic tobacco and banana cells. J Gen Virol 79, 2301-2311.
Fontes, E. P., Gladfelter, H. J., Schaffer, R. L., Petty, I. T. & Hanley-Bowdoin,
L. (1994). Geminivirus replication origins have a modular organization. Plant Cell 6,
405-416.
Hanley-Bowdoin, L., Settlage, S. B., Orozco, B. M., Nagar, S. & Robertson, D.
(1999). Geminiviruses: models for plant DNA replication, transcription, and cell
cycle regulation. Crit Rev Pl Sci 18, 71-106.
Harrison, B. D., Swanson, M. M. & Fargette, D. (2002). Begomovirus coat
protein: serology, variation and functions. Physiol Mol Pl Path 60, 257-271.
Idris, A. M. & Brown, J. K. (2004). Cotton leaf crumple virus is a distinct Western
Hemisphere begomovirus species with complex evolutionary relationships indicative
of recombination and reassortment. Phytopathology 94, 1068-1074.
115
Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S.G., Schell, J. &
Gronenborn, B. (1995). In vitro cleavage and joining at the viral origin of
replication by the replication initiator protein of tomato yellow leaf curl virus. Proc
Natl Acad Sci U S A 92, 3879-3883.
Lyttle, D. J. & Guy, P. L. (2004). First record of geminiviruses in New Zealand:
Abutilon mosaic virus and Honeysuckle yellow vein virus. Aust Plant Pathol 33, 321-
322.
Orozco, B. M., Gladfelter, H. J., Settlage, S. B., Eagle, P. A., Gentry, R. N. &
Hanley-Bowdoin, L. (1998). Multiple cis elements contribute to geminivirus origin
function. Virology 242, 346-356.
Padidam, M., Sawyer, S. & Fauquet, C. M. (1999). Possible emergence of new
geminiviruses by frequent recombination. Virology 265, 218-224.
Page, R. D. (1996). TREEVIEW: an application to display phylogenetic trees on
personal computers. Comput Appl Biosci 12, 357-358.
Paximadis, M., Idris, A. M., Torres-Jerez, I., Villarreal, A., Rey, M. E. &
Brown, J. K. (1999). Characterization of tobacco geminiviruses in the Old and New
World. Arch Virol 144, 703-717.
116
Polston, J. E., McGovern, R. J. & Brown, L. G. (1999). Introduction of tomato
yellow leaf curl virus in Florida and implications for the spread of this and other
geminiviruses of tomato. Plant Disease 83, 984-988.
Revill, P. A., Ha, C. V., Porchun, S. C., Vu, M. T. & Dale, J. L. (2003). The
complete nucleotide sequence of two distinct geminiviruses infecting cucurbits in
Vietnam. Arch Virol 148, 1523-1541.
Rojas, M. R., Gilbertson, R. L., Russell, D. R. & Maxwell, D. P. (1993). Use of
degenerate primers in the polymerase chain reaction to detect whitefly-transmitted
geminiviruses. Plant Disease 77, 340-347.
Rybicki, E. P. (1994). A phylogenetic and evolutionary justification for three genera
of Geminiviridae. Arch Virol 139, 49-77.
Stanley, J. (1995). Analysis of African cassava mosaic virus recombinants suggests
strand nicking occurs within the conserved nonanucleotide motif during the initiation
of rolling circle DNA replication. Virology 206, 707-712.
Stanley, J., Bisaro, D. M., Briddon, R. W., Brown, J. K., Fauquet, C. M.,
Harrison, B. D., Rybicki, E. P. & Stenger, D. C. (2005). Geminiviridae. In: Virus
Taxonomy. VIIIth Report of the International Committee on Taxonomy of Viruses.
(C. M. Fauquet, M. A Mayo, J. Maniloff, U. Desselberger and L. A. Ball, eds) 301-
326, Elsevier/Academic Press, London.
117
Stewart, C. N. & Via, L. E. (1993). A rapid CTAB DNA isolation technique useful
for RAPD fingerprinting and other PCR applications. BioTechniques 14, 748-751.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G.
(1997). The CLUSTAL_X windows interface: flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 4876-
4882.
Wyatt, S. D. & Brown, J. K. (1996). Detection of subgroup III geminivirus isolates
in leaf extracts by degenerate primers and polymerase chain reaction.
Phytopathology 86, 1288-1293.
118
CHAPTER 4
Molecular characterization of begomoviruses and
DNA satellites from Vietnam - additional evidence
that the New World geminiviruses were present in
the Old World prior to continental separation
Cuong Ha1,2, Steven Coombs1, Peter Revill1,*, Rob Harding1, Man Vu2
and James Dale1
1Tropical Crops and Biocommodities Domain, Institute of Health and Biomedical
Innovation, Queensland University of Technology, Brisbane, 4001, Australia.
2Department of Plant Pathology, Hanoi Agriculture University, Gialam, Hanoi,
Vietnam.
*Current address: Victorian Infectious Diseases Reference Laboratory, 10 Wreckyn
St, Nth Melbourne, Victoria, 3051, Australia.
This paper has been accepted for publication in Journal of General Virology.
The formatting and presentation style within this chapter are consistent with Journal
of General Virology
119
STATEMENT OF JOINT AUTHORSHIP
Cuong Ha:
Executed the work (collected plant samples, designed and conducted all laboratory
experiments, analysed and interpreted data) and wrote initial manuscript.
Steven Coombs:
Provided initial alignments of geminivirus sequences for design of degenerate
primers.
Peter Revill:
Conceived project idea, collected plant samples, supervised the work, critically
interpreted data and significantly contributed to final manuscript.
Rob Harding:
Conceived project idea, collected plant samples, supervised the work, critically
interpreted data and contributed to final manuscript.
Man Vu:
Conceived project idea and collected samples.
James Dale:
Conceived project idea, collected plant samples, supervised the work, critically
interpreted data, contributed to final manuscript.
120
CHAPTER 5
Design and application of two novel degenerate primer
pairs for the detection and complete genomic
characterization of potyviruses
C. Ha1,2, S. Coombs1, P.A. Revill1,*, R.M. Harding1, M. Vu2 and J.L
Dale1
1Tropical Crops and Biocommodities Domain, Institute of Health and Biomedical
Innovation, Queensland University of Technology, Brisbane, 4001, Australia.
2Department of Plant Pathology, Hanoi Agriculture University, Gialam, Hanoi,
Vietnam.
*Current address: Victorian Infectious Diseases Reference Laboratory, 10 Wreckyn
St, Nth Melbourne, Victoria, 3051, Australia.
This paper has been accepted for publication in Archives of Virology
The formatting and presentation style within this chapter are consistent with Archives
of Virology
169
Summary. Two pairs of degenerate primers were designed from sequences within
the potyviral CI (CIFor/CIRev) and HC-Pro-coding regions (HPFo/HPRev) and these
were shown to be highly specific to members of the genus Potyvirus. Using the
CIFor and CIRev primers, three novel potyviruses infecting crop and weed species
from Vietnam were detected, namely Telosma mosaic virus (TelMV) infecting
telosma (Telosma cordata, Asclepiadaceae), Peace lily mosaic virus (PeLMV)
infecting peace lily (Spathiphyllum patinii, Araceae) and Wild tomato mosaic virus
(WTMV) infecting wild tomato (Solanum torvum, Solanaceae). The fragments
amplified by the two sets of primers enabled additional PCR and complete genomic
sequencing of these viruses and a Banana bract mosaic virus (BBrMV) isolate from
the Philippines. All four viruses shared genomic features typical of potyviruses.
Sequence comparisons and phylogenetic analyses indicated that WTMV was most
closely related to Chilli veinal mottle virus (ChiVMV) and Pepper veinal mottle
virus (PVMV) while PeLMV, TelMV and BBrMV were related to different extents
with members of the Bean common mosaic virus (BCMV) subgroup.
The GenBank accession numbers of the sequences reported in this manuscript are:
DQ851493 (TelMV), DQ851494 (PeLMV), DQ851495 (WTMV) and DQ851496
(BBrMV)
170
Introduction
The Potyviridae is the largest family of positive-sense, single-stranded RNA
(ssRNA) plant viruses currently recognized. Based on their transmission vectors and
genomic characteristics, the members of the family are classified into six genera,
Potyvirus, Ipomovirus, Macluravirus, Tritimovirus, Bymovirus and Rymovirus, the
largest of which is the genus Potyvirus [5].
Members of the Potyvirus genus have particles at least 700 nm in length which
encapsidate a monopartite ssRNA genome ~ 10 kb in length. The genome is
characterized by a 5’untranslated region (5’ UTR) which is linked to a terminal,
genome-linked protein (VPg), a single major open reading frame (ORF) and a 3’
UTR region terminating in a polyadenylated (polyA) tail. The ORF encodes a single
large polyprotein that is co-translationally processed into ten functional proteins [1];
namely, the first protein (P1), helper component protease (HC-Pro), third protein
(P3), 6K1, cylindrical inclusion protein (CI), 6K2, small nuclear inclusion protein
(NIa; including the VPg and protease (NIa-Pro) domains), large nuclear inclusion
protein (NIb; replicase) and coat protein (CP) [26]. Members of the Potyvirus genus
are transmitted by aphids in a non-persistent manner and infect a wide range of both
monocotyledonous and dicotyledonous plants [26].
PCR-based methods for the detection and identification of potyviruses are
primarily based on the use of degenerate primers to conserved sequences in the viral
genomes. The vast majority of these primers have been designed to sequences at the
3’ end of the genome, such as the CP and NIb-coding regions [3, 4, 7, 8, 11, 12, 14,
171
18, 22, 34]. In particular, primers corresponding to the GNNS motif in the NIb-
coding region are specific for members of the entire family Potyviridae [7, 11, 12].
The use of degenerate primers has not only facilitated the rapid detection of many
potyviruses, but has also enabled partial genomic sequencing for taxonomic
purposes. Recently however, the accuracy of taxonomic classifications based on the
analysis of the 3’ sequences, particularly those derived from the CP, has been
questioned [2]. Adams et al. [2] suggested that the most accurate molecular criterion
for genus and species discrimination within the family Potyviridae was the
phylogenetic analysis of the nucleotide sequences of the entire ORF. Further,
comparisons using the CI-coding region most accurately reflected those for the
complete ORF and this region was deemed to be the most suitable for diagnostic and
taxonomy purposes if the complete sequence could not be obtained.
Complete potyvirus genome sequences have typically been obtained by
constructing viral cDNA libraries [13, 23] or, more recently, by primer walking in
which regions of the genome are amplified in overlapping fragments using
degenerate primers designed on conserved genomic regions [29, 33]. However, due
to the large size of the potyviral genome and the absence of highly conserved
sequences in many coding regions, the number of fully sequenced potyviruses (45 by
2005, http://www.ncbi.nlm.nih.gov) is small in comparison to the number of
recognized species (197 in 2005, [5]). In this paper, we describe the development of
two alternative sets of degenerate PCR primers to amplify sequences from the 5’
(HC-Pro) and central (CI) regions of potyviral genomes that can be used as
diagnostic tools. Further, we demonstrate the utility of these primers to facilitate
additional amplification and sequencing of the complete genomes of three previously
172
uncharacterized potyviruses from Vietnam and Banana bract mosaic virus (BBrMV)
from the Philippines.
Materials and methods
Virus isolates
Leaf samples showing characteristic symptoms of virus infection including
puckering, mottling, mosaic and stunting were collected from a range of crops and
weeds during field surveys across Vietnam in 2000/1 and 2004. Samples were dried
under silica gel and stored at room temperature until use. In addition, samples known
to be infected with the potyviruses, Johnsongrass mosaic virus (JGMV), Lily mottle
virus (LMoV) and Potato virus Y (PVY) from Australia and BBrMV from the
Philippines were stored at –80oC and used as positive controls to test the specificity
of the degenerate primers.
Design of primers
All primers used in this study are shown in Table 1. The CI-specific primers, CIFor
and CIRev, were designed based on the alignment of 56 complete sequences
(available in 2003) from isolates representing 22 potyviruses, one bymovirus, one
rymovirus and one tritimovirus. The HC-Pro-specific primers, HPFor and HPRev,
and NIb gene-specific primer, NIbFor1, were designed based on the alignment of
149 complete sequences of 38 potyviruses (available in 2005).
RT-PCR
Total RNA was extracted from dried (~20 mg) or frozen (~100 mg) leaf tissue using
an RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions. For
173
174
Table 1. Primers used for the detection and cloning of potyvirus genomes
Primer Sequence* (5’ – 3’) Conserved motif† or position
Use
Potyvirus-specific CIFor GGIVVIGTIGGIWSIGGIAARTCIAC GxVGSGKST Potyvirus CI gene specific primer
CIRev‡ ACICCRTTYTCDATDATRTTIGTIGC ATNIIENGV Potyvirus CI gene specific primer
HPFor TGYGAYAAYCARYTIGAYIIIAAYG CDNQLDxN Potyvirus HC-Pro gene specific primer
HPRev GAICCRWAIGARTCIAIIACRTG HVxDSY/FGS Potyvirus HC-Pro gene specific primer
NIbFor1 GGICARCCITCIACIGTIGT GQPSTVV Potyvirus NIb gene specific primer
PV2IT7§ TAATACGACTCACTATAGGGIAAYAAYAGYGGICARCC GNNSGQP Potyvirus NIb gene specific primer
5' end
Anchor25dT GTACTGAACCTGCGTGACAGTCGTC(T)25V 5’RACE second-strand primer
Anchor17T2A|| GTACTGAACCTGCGTGACAGTCGTC(T)17AA 5’RACE second-strand primer
Anchor GTACTGAACCTGCGTGACAGTCGTCT 5’RACE PCR primer, general
Anchor2 GTACTGAACCTGCGTGACAGTCGTC 5’RACE PCR primer, general
3' end
N1T GACCACGCGTATCGATGTCGAC(T)17V General 3’end first-strand primer
N1 GACCACGCGTATCGATGTCGAC General 3’end PCR primer
TelMV-specific
TelMVHPFor GAGGCACCTGGTAGTTGGTGCATCAG 2072 - 2097 TelMV major gap 1 PCR primer,
TelMVHPRev CTGATGCACCAACTACCAGGTGCCTC 2072 - 2097 TelMV 5’RACE PCR primer
TelMVCIFor CACAGCACCCAGTCAAACTCAAGGTAG 4351 - 4377 TelMV major gap 2 PCR primer
TelMVCIRev CTACCTTGAGTTTGACTGGGTGCTGTG 4351 - 4377 TelMV major gap 1 PCR primer
TelMVNIbRev GCACAAATAGCCTCTGTCCTGTGCATG 8348 - 8374 TelMV major gap 2 PCR primer
PelMV-specific
PelMVHPFor CTTCGTGTATCCATGTTGTTGCGTGAC 1961 - 1987 PelMV major gap 1 PCR primer
PelMVHPRev GTCACGCAACAACATGGATACACGAAG 1961 - 1987 PelMV 5’RACE-PCR primer
PelMVCIFor CAGCAACTCCACCTGGAAAAGAGTGTG 4270 - 4296 PelMV major gap 2 PCR primer
PelMVCIRev CACACTCTTTTCCAGGTGGAGTTGCTG 4270 - 4296 PelMV major gap 1 PCR primer
PelMVNIbRev TCCTGGTATTCAATCCCTCTGTGTGAC 8213 - 8239 PelMV major gap 2 PCR primer
WTMV- specific
WTMVHPFor GACGATGGTACTCCTTTGCTCTCAGAG 1919 - 1945 WTMV major gap 1 PCR primer
WTMVHPRev CTCTGAGAGCAAAGGAGTACCATCGTC 1919 - 1945 WTMV 5’RACE-PCR primer
WTMVCIFor GAACTATGAAATCAGGAGCAACCGAGA 4446 - 4472 WTMV major gap 2 PCR primer
WTMVCIRev TCTCGGTTGCTCCTGATTTCATAGTTC 4446 - 4472 WTMV major gap 1 PCR primer
WTMVNIbRev CCATGTGTTGTGTGGTTTGACAGCTAC 8057 - 8083 WTMV major gap 2 PCR primer
BBrMV-specific
BBrMVHPFor CACAGTATCGAAGCCCATCTGCAAGAC 2026 - 2052 BBrMV major gap1 PCR primer
BBrMVHPRev GTCTTGCAGATGGGCTTCGATACTGTG 2026 - 2052 BBrMV 5’RACE first-strand primer
BBrMVHPRev1 TGGTGAGAGGTTCCCTCTGTATCG 1921 - 1944 BBrMV 5’RACE-PCR primer
BBrMVCIFor GCTTCAGCAATGGCGTTCTATTGTCTAC 4224 - 4251 BBrMV major gap 2 PCR primer
BBrMVCIRev GTAGACAATAGAACGCCATTGCTGAAGC 4224 - 4251 BBrMV major gap 1 PCR primer
BBrMVNIbRev TTCCTGCAGTTTGTCAAGTGTACAAGC 8130 - 8156 BBrMV major gap 2 PCR primer
* In the primer sequences, I = inosine, Y = C/T, R = G/A, W = A/T, V = A/C/G, S = C/G and D = A/G/T † x in the conserved motifs = any amino acid ‡ CIRev was also used as 5’RACE first-strand primer § PV2IT7 is from Mackenzie et al. [19] || Anchor17T2A contains two 3’ terminal adenosine residues exploiting the fact that the 5’ end of potyviral genomes contains several A residues
175
176
use as a general potyvirus diagnostic test, RNA (1µL) was used directly for RT-PCR
using a Titan One Tube RT-PCR System (Roche) in a final reaction volume of 25 µL
containing 0.2 mM each dNTP, 20 pmoles of each degenerate primer, 5 mM DTT, 5
U RNase Inhibitor and 0.5 µL of Titan Enzyme mix. The reactions were incubated at
42 ○C for 30 min, 94 ○C for 3 min, followed by 40 cycles of 94 ○C for 30 s, 40 ○C for
30 s and 68 ○C for 1 min, and a final incubation for 5 min at 68 ○C. Initially, the
degenerate primers were used to amplify the partial HC-Pro, CI and 3’ end
fragments. Virus-specific primers (Table 1) were subsequently designed from the
cloned sequences to amplify the intervening sequences and 5’ end fragments.
Amplification of 3’ ends
RNA extract (10 µL) was used to synthesize first-strand cDNA using primer N1T
and SuperScript™ III Reverse Transcriptase (Invitrogen) as recommended by the
manufacturer. The cDNAs were used as templates to amplify the 3’ end fragments
(of TeLMV, PeLMV and WTMV) in a 25 µL reaction containing 0.4 mM each
dNTP, 20 pmoles of primer NIbFor1, 10 pmoles of primer N1 and 0.5 µL of Taq
(Roche). The reactions were incubated at 94 ○C for 4 min, followed by 35 cycles of
94 ○C for 30 s, 50 ○C for 30 s and 72 ○C for 90 s, terminating with 10 min at 72 ○C.
In the case of BBrMV, the 3’ end fragment was amplified directly from the RNA
extract (1µL) using a Titan One Tube RT-PCR System (Roche) in a final reaction
volume of 25 µL containing 0.4 mM each dNTP, 20 pmoles of each primer PV2IT7
and N1T, 5 mM DTT, 5 U RNase Inhibitor, 2.5 mM MgCl2 and 0.5 µL of Titan
Enzyme mix. The reactions were incubated at 45 ○C for 30 min, 94 ○C for 3 min,
followed by 35 cycles of 94 ○C for 30 s, 54 ○C for 40 s and 68 ○C for 2 min,
terminating with 5 min at 68 ○C.
177
Amplification of intervening sequences
The intervening sequences between the HC-Pro and CI fragments (~2.5 kb) and
between the CI and 3’ end fragments (~3.5 kb) of each genome were amplified using
specific primers designed from the HC-Pro, CI and 3’ end fragments (Table 1). The
reactions were done using either the Titan One Tube RT-PCR System with RNA
extracts as template or using the Expand Long Template PCR System (Roche) and
N1T-primed cDNA as template.
Amplification of 5’ ends
The 5’ end (~ 2 kb) fragments were amplified using 5’ Rapid Amplification of cDNA
Ends (5’ RACE) [10]. RNA extract (23 µL) was used to synthesize the first-strand
cDNA using SuperScript™ III Reverse Transcriptase (Invitrogen) as recommended
by the manufacturer. The first-strand primers were CIRev (for TeLMV, PeLMV and
WTMV) and BBrMVHPRev (for BBrMV). The cDNAs were treated with RNase A
and H (Invitrogen) as recommended by the manufacturer and purified directly using
a High Pure PCR Product Purification Kit (Roche). The purified cDNAs were dA-
tailed at 37 ○C for 25 min in a 10 µL reaction containing 7 µL cDNA, 1 µL Taq 10x
PCR buffer (Roche), 2 pmoles dATP and 100 U terminal transferase (Roche). The
dA-tailed cDNAs were used as template for the single tube, two-step 5’RACE
reactions. In step 1 (second-strand synthesis), the 25 µL reaction mixtures,
containing 2 µL of dA-tailed cDNA, 0.35-0.5 mM each dNTP, 10 pmoles primer
Anchor25dT or 5 pmoles primer Anchor17T2A and 0.5 µL of Enzyme mix (Expand
Long Template PCR System), were incubated at 94 ○C for 2-3 min, 45-50 ○C for 5-
10 min and 68 ○C for 5 min. For step 2 (amplification), 10 pmoles of each virus-
specific 5’RACE-PCR primer and Anchor or Anchor2 primer were added to the tube
and incubated under the following conditions: 94 ○C for 3 min, followed by 40
178
cycles of 94 ○C for 30 s, 54 ○C for 45 s and 68 ○C for 90 s, terminating with 7 min at
68 ○C.
Cloning and sequencing
Amplicons were purified from agarose gels using a High Pure PCR Product
Purification Kit (Roche), ligated into the plasmid vector pGEM-T Easy (Promega)
and transformed into E. coli XL1-Blue competent cells (Stratagene) as recommended
by the manufacturers. Putative recombinant plasmids were purified with a Wizard
Miniprep Kit (Promega) and inserts were verified by restriction enzyme digestion.
Two independent clones of each amplicon were sequenced in both directions using
the ABI Prism® BigDyeTM Terminator Kit (PE Applied Biosystem) and sent to the
Australia Genomic Research Facility (University of Queensland) for analysis.
Sequence analyses
The sequences were initially compared to known viral sequences using the BLAST
program available at the National Centre for Biotechnology Information (NCBI)
(http://www.ncbi.nlm.nih.gov/BLAST/). ORFs were identified using Vector NTI
Suite7 program and sequences were aligned using ClustalX [30]. Overlapping
sequences were assembled using SeqMan (DNASTAR, Madison, WI). Sequence
identities were calculated from “Sequence Identity Matrix” option in BioEdit
program version 7.05 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html).
Phylogenetic trees were constructed from the ClustalX-aligned sequences using
MEGA version 3.1 [17] using a Neighbor-Joining method and a Kimura 2-Parameter
model for estimating the distances and conducting the bootstrap analysis (1000
replicates).
179
Results
Specificity of potyvirus degenerate primers
CI-coding region primers
Based on the alignment of 56 complete nucleotide sequences from viruses within the
family Potyviridae, two degenerate primers, designated CIFor and CIRev, were
designed to conserved sequences within the CI-coding region to amplify a ~700 bp
product (Fig. 1). To evaluate their specificity, the primers were initially tested on
RNA extracted from leaves of several known potyvirus-infected samples, namely
JGMV, PVY and LMoV from Australia, PRSV from Vietnam and BBrMV from the
Philippines. In each case, a major product of the expected size (~700 bp) was
amplified. Sequence analysis confirmed that all the amplicons were virus-specific
and were ~680 nucleotides, with the exception of JGMV, which contained 42
additional nucleotides located immediately upstream of the CIRev primer sequence.
RNA was subsequently extracted from various samples that had been collected
during virus surveys in Vietnam and which were showing virus-like symptoms. The
CIFor and CIRev primers amplified a band of ~700 bp from numerous plant samples
including Chinese radish, leek, sweet potato, bean, sugarcane, taro, chilli pepper,
pumpkin and shallot. Sequence analysis of the amplicons derived from these samples
showed high identity to sequences of Turnip mosaic virus (TuMV), Leek yellow
stripe virus (LYSV), Sweet potato feathery mottle virus (SPFMV), Bean common
mosaic virus (BCMV), Sugarcane mosaic virus (SCMV), Sorghum mosaic virus
(SrMV), Dasheen mosaic virus (DsMV), Chilli veinal mottle virus (ChiVMV),
180
5’ UTR An
PV2IT7 NIbFor1
HC-Pro VPg 6K1P1 P3 CI NIb NIa-Pro CP 6K2
5’end (~ 2 kb)
Intervening sequence 1 (~ 2.5 kb)
Intervening sequence 2 (~ 3.5 kb)
3’end (~ 1.7 kb)
CI (~ 0.7 kb)
HC-Pro (~ 0.7 kb)
Virus major gap 1 PCR primers
3’ UTR
N1T N1
CIFor CIRev HPFor HPRev
Virus 5’RACE PCR primers
Anchor25dT Ancho17T2A Anchor Anchor2
Virus major gap 1 PCR primers
Virus major gap 2 PCR primers
Virus major gap 2 PCR primers
Fig. 1. Relative position of the primers and the strategy to amplify and sequence the complete potyvirus genome.
181
182
Zucchini yellow mosaic virus (ZYMV) and Shallot yellow stripe virus (SYSV),
respectively.
Samples were also collected from Telosma cordata, a fragrant climber whose
edible flowers are used as a vegetable and for medicinal purposes, Peace lily
(Spathiphylum patinii), a popular ornamental, and wild tomato (Solanum torvum), all
of which were showing mosaic symptoms. A band of ~700 bp was also amplified
from these samples, however, sequence analysis indicated that these plants were
infected by three different, as yet uncharacterized, potyviruses.
HC-Pro-coding region primers
Based on the alignment of 149 complete nucleotide sequences from viruses within
the genus Potyvirus, degenerate primers HPFor and HPRev were designed to amplify
a ~700 bp fragment within the HC-Pro-coding region (Fig. 1). Using the same RNA
extracts as above, products of the expected size were amplified from the known
potyvirus-infected samples as well as from the samples which previously tested
positive using the CIFor and CIRev primers. Sequence analysis again confirmed that
these products were virus-specific. Consistent with previous results, a ~700 bp
product was also amplified from the peace lily, telosma and wild tomato samples
with sequence analysis confirming the presence of three, as yet uncharacterized,
potyviruses.
183
184
Molecular characterization of the three novel potyviruses and BBrMV
Amplification and sequencing of the complete genomes
A PCR-based strategy, utilising the new degenerate primer pairs, was devised to
amplify the entire genome of potyviruses. This strategy involved the initial
amplification of the 5’ and central regions of the potyvirus genome using the
HPFor/HPRev and CIFor/CIRev primers, and subsequent PCR using virus-specific
primers to amplify the intervening sequences and 3’ end of the genome. 5’ RACE
was used to amplify the 5’ terminal sequence (Fig. 1). This strategy was used to
obtain the entire genomic sequences of a partially characterized BBrMV isolate from
the Philippines and the three uncharacterized potyviruses infecting telosma (Hanoi
isolate), peace lily (Haiphong isolate) and wild tomato (Laichau isolate) from
Vietnam. The three potyviruses from Vietnam were named Telosma mosaic virus
(TelMV), Peace lily mosaic virus (PeLMV) and Wild tomato mosaic virus (WTMV),
based on their natural host and symptoms.
Genome organization and analysis of conserved motifs
Based on genome size and organization, and the presence of conserved sequence
motifs, all four viruses were typical potyviruses (Fig. 2). The genomes comprised
9689 nt (TelMV), 9882 nt (PeLMV), 9659 nt (WTMV) and 9711 nt (BBrMV),
excluding polyA tails but including the 5’ and 3’UTRs which comprised 188/255
(TelMV), 179/466 (PeLMV), 136/298 (WTMV) and 128/208 nt (BBrMV),
respectively. The 5’UTRs of all four viruses were A/T rich, ranging from 60.2%
(BBrMV) to 70.6% (WTMV), and typical of other potyviruses, terminated in several
TelMV PeLMV WTMV BBrMV Complete genome Length (nt) 9689 9882 9659 9711
3’UTR Length (nt) 255 466 298 208
5’UTR Length (nt) 188 179 136 128 % A+T 67.0 66.5 70.6 60.2 Potybox a (11) AACTCGAAAAGACAATTA (11) AACTCAATACAACATATG (11) AACTACAAAACACATACA (10) ATCTCAGCAAGACATTCA
Potybox b (54) TTCTCAAGCAAAC (35) CGATCAAGCAATC (55)TTCTCGAGCATTC (42) ACCTTACGCAACT
“Context” of the initiation code AGCATGGCA GAAATGGCA GCAATGGCA CAAATGGCG
Polyprotein Length (aa) 3082 3079 3075 3125
P1 Length (aa) 317 309 298 329
Catalytic triad H-X8-E-X29-GDSG H-X8-E-X30-GWSG H-X8-D-X31-GDSG H-X8-E-X30-GWSG
HC-Pro Length (aa) 457 456 457 457
Catalytic sites GYCY-X71-H GYCY-X71-H GYCY-X71-H GYCY-X71-H
Aphid transmission KLSC KLTC RITC RISC Aphid transmission PTK PTK PTK PSA RNA amplification IKS IGN IGN IGR Systemic movement CCC CCC CC CCC
P3 Length (aa) 347 344 347 347
6K1 Length (aa) 52 52 54 52
CI Length (aa) 634 634 644 634 Motif I LVRGAVGSGKSTGLP LVRGAVGSGKSTGLP LIRGAVGSGKSTGLP LIRGAVGSGKSTGLP Motif II YIIIDECH YIIIDECH FIMFDECH FIILDECH Motif V FIVATNIIENGVTLDVDCVVD FVVATNIIENGVTLDIDVVVD FIVATNIIENGVTIDIDAVVD FVVATNIIENGVTLDIDVVVD Motif VI SYGERIQRLGRVGR NYGERLQRLGRVGR NYGERIQRLGRVGR GFGERVQRLGRVGR
6K2 Length (aa) 53 52 53 53
VPg Length (aa) 190 190 191 190
Viral RNA attachment HMYG HMYG NMYG NMYG
NIa Length (aa) 243 246 242 243
Catalytic sites H-X34-D-X67-GFCG-X14-H H-X34-D-X67-GDCG-X14-H H-X34-D-X67-GHCG-X14-H H-X34-D-X67-GDCG-X14-H
NIb Length (aa) 517 516 519 520 RdRP GDD GDD GDD GDD
CP Length (aa) 272 280 270 300 Aphid transmission and movement DAG DAG DAG DAG
Encapsidation LRQ-X41-FDF FRQ-X41-FDF FRQ-X41-FDF FRQ-X41-FDF
Fig. 2. Sizes and the important functional motifs of TelMV, PeLMV, WTMV and BBrMV. The “potybox a and -b”-like sequences are underlined. The initiation codon ATG is in bold. See Adams et al. [1], Urcuqui-Inchima et al. [32] and Kadare & Haenni [15] for the functional motifs and their essential residues (boxed) in the genes.
185
186
A residues. The 5’UTRs also contained two potybox–like blocks which, in PeLMV,
were identical to those previously reported (ACAACAT and TCAAGCA) [20, 29].
The genomes of TelMV, PeLMV, WTMV and BBrMV each encoded putative
polyproteins of 3082, 3079, 3075 and 3125 amino acids, respectively. The first in-
frame ATG codons of the four genomes were AGCATGG, GAAATGG,
GCAATGG and CAAATGG, respectively. The cleavage sites of the putative
polyproteins (Fig. 3), predicted following the guidelines of Adams et al. [1], were
similar to those reported for other potyviruses except that the D residue at the CI-
6K2 junction of PeLMV has not been reported in the same position for any other
potyvirus.
Analysis of the putative amino acid sequences of all four viruses revealed the
presence of many well characterized functional motifs (Fig. 2). Most of these motifs
were highly conserved in comparison with other reported potyviruses with the
exception that the T and K residues of the PTK motif in the HC-Pro-coding region of
BBrMV were replaced by S and A, respectively. These replacements were
unexpected because this motif is identical in all potyviruses with fully sequenced
genomes. The sequence was verified, however, by PCR using specific primers to
amplify across this region.
Sequence comparisons
The nucleotide sequences of the entire genome and ORF of all four potyviruses were
compared to other viral sequences using the BLAST program. These comparisons
187
188
HC-Pro VPg 6K1P1 P3 CI NIb NIa CP 6K2
TelMV PeLMV WTMV BBrMV
YS318
YS310
FS299
YS330
GG775GG766GG756GG787
QG1122
QS1110
QA1103
QS1134
QS1174
QS1162
QS1157
QN1186
QS1808
QD1796
QS1801
QN1820
QG1861
QG1848
QA1854
EG1873
ES2051
EG2038
EA2045
EG2063
QS2294
QS2284
QS2287
QH2306
QS2811
QS2800
QS2806
QS2826
5’UTR 3’UTR An
Fig. 3. The genome map of TelMV, PeLMV, WTMV and BBrMV. The position and dipeptide motif of the cleavage sites are indicated.
189
190
revealed that TeLMV, PeLMV, WTMV and BBrMV showed most similarity to
Soybean mosaic virus-G7 (SMV-G7)(66.2% genome, 67.4% ORF), Beet mosaic
virus (BtMV) (61%, 63.3%), Chilli veinal mottle virus (ChiVMV) (65.7%, 66.5%)
and BtMV (51%, 51.9%), respectively. However, when comparisons were made
using all nucleotide sequence available on databases, TeLMV, PeLMV, WTMV and
BBrMV showed most similarity to Trycirtis virus (a putative potyvirus)(74.3% in the
CP-coding region), BtMV, Pepper veinal mottle virus (PVMV)(77.2% in the CP) and
BBrMV-P3 isolate (98.7% in the CP), respectively.
Phylogenetic analyses
To determine the relationship of the four viruses with other potyviruses, phylogenetic
trees were constructed based on the nucleotide sequences of the entire genomes, ORF
and CP-coding region. With the exception of BBrMV, the trees all had a similar
topology. In analyses using either the entire nucleotide sequence (Fig. 4A) or that of
the ORF (data not shown), WTMV always grouped with ChiVMV while PeLMV
grouped tightly with BtMV, which was shown to be related to the members of the
BCMV subgroup. TelMV also branched within the BCMV subgroup while BBrMV
formed a distinct branch that was distally, but basally, related to the BCMV subgroup
and the cluster of PeLMV, BtMV and Peanut mottle virus (PeMoV).
In analyses based on the CP genes (Fig. 4B), the phylogenetic relationships of
TelMV, PeLMV and WTMV were similar to those described above. TelMV still
grouped within the BCMV subgroup, PeLMV paired tightly with BtMV to form a
branch that was related (but not well supported) to the BCMV subgroup while
191
192
BBrMV- AP1
PVMV-AJ780968 PVMV-AJ780967 PVMV-AJ780966
PVMV-AJ780970 PVMV-AJ780969 WTMV
ChiVMV JYMV
PPV LMV
TuMV ScMV
LYSV TVMV
PVA TEV SPFMV
TFMV PVY
PepMoV WPMV PTV PVV JGMV
PLDMV PRSV
PSbMV OYDV
SYSV BYMV
ClYVV BBrMV
BBrMV-P3
SCMV PenMV
MDMV SrMV
LMoV CSV
YMV PeMoV
BtMV PeLMV
DsMV ZYMV
CABMV EAPV Trycirtis potyvirus
BCMNV TelMV
BCMV WVMV
WMV SMV-G7 SMV-N
99 99
76
99
7099
77 99
99 99
69 99
89 99
99
99
98 99
99
99
98
60
95
72
60
61
0.05
BCMV subgroup
SCMV subgroup
PVYsubgroup
(B)
Fig. 4. Neighbor–joining trees based on the nucleotide sequences of the complete genomes (A) and CP genes (B) of the four potyviruses from this study (dotted, underlined and in bold) and 43 fully sequenced species of the Potyvirus genus (with the CP sequences of Trycirtis potyvirus (AY864850), BBrMV (-[P3], AF071586 and –[AP1], AY953427) and Pepper veinal mottle virus (PVMV, AJ780966 – 70) added in B). The previously assigned subgroups are indicated (see Berger et al. [6], Shukla et al. [25] and Melgarejo et al. [20] for the BCMV, SCMV and PVY subgroups, respectively). The bootstrap values greater 50% (1000 replicates) are denoted. The full names and Acc. Numbers are: Bean common mosaic virus (BCMV, AJ312437); Bean common mosaic necrosis virus (BCMNV, U19287); Bean yellow mosaic virus (BYMV, D83749); Beet mosaic virus (BtMV, AY206394); Chili veinal mottle virus (ChiVMV, AJ237843); Clover yellow vein virus (ClYVV, AB011819); Cocksfoot streak virus (CSV, AF499738); Cowpea aphid-borne mosaic virus (CABMV, AF348210); Dasheen mosaic virus (DsMV, AJ298033); East Asian Passiflora virus (EAPV, AB246773); Johnsongrass mosaic virus (JGMV, Z26920); Leek yellow stripe virus (LYSV, AJ307057); Lettuce mosaic virus (LMV, X97705); Lily mottle virus (LMoV, AJ564636); Maize dwarf mosaic virus (MDMV, AJ001691); Onion yellow dwarf virus (OYDV, AJ510223) Papaya ringspot virus (PRSV, X67673); Pea seed-borne mosaic virus (PSbMV, D10930); Peanut mottle virus (PeMoV, AF023848); Pennisetum mosaic virus (PenMV, AY642590); Pepper mottle virus (PepMoV, M96425); Peru tomato mosaic virus (PTV, AJ437280); Plum pox virus (PPV, D13751); Potato virus A (PVA, AJ296311); Potato virus Y (PVY, X12456); Potato virus V (PVV, AJ243766); Scallion mosaic virus (ScMV, AJ316084); Shallot yellow stripe virus (SYSV, AJ865076); Sorghum mosaic virus (SrMV, AJ310197); Soybean mosaic virus (SMV-N, D00507; -G7, AY216010); Sugarcane mosaic virus (SCMV, AJ297628); Sweet potato feathery mottle virus (SPFMV, D86371); Thunberg fritillary virus (TFMV, AJ851866); Tobacco etch virus (TEV, M11458); Tobacco vein mottling virus (TVMV, X04083); Turnip mosaic virus (TuMV, AF169561); Watermelon mosaic virus (WMV, AY437609); Wild potato mosaic virus (WPMV, AJ437279); Wisteria vein mosaic virus (WVMV, AY656816); Yam mosaic virus (YMV, U42596); Zucchini yellow mosaic virus (ZYMV, AF127929); Japanese yam mosaic virus (JYMV, AB027007) and Papaya leaf distortion mosaic virus (PLDMV, BD171712).
TuMV ScMV
JYMV LMV
PPV LMoV
PRSV TFMV ClYVV BYMV
TVMV LYSV
TEV YMV SPFMV
PVA PLDMV
WTMV ChiVMV
PVY PepMoV
PTV WPMV PVV
PSbMV BBrMV
PeLMV BtMV
PeMoV DsMV ZYMV
CABMV BCMV BCMNV
TelMV EAPV
WVMV WMV SMV-N SMV-G7
CSV JGMV
PenMV SCMV MDMV SrMV
SYSV OYDV
95 100
100 99
100
100
100 100
100 95
61 100
85 100
69
100
100
100
99 100
100 100
98 100
100
96
93
85
82
68
64
53
62
82
54
100
0.05
PVYsubgroup
BCMV subgroup
SCMVsubgroup
(A)
193
194
WTMV formed a group with ChiVMV and PVMV that received strong bootsrap
support. Unlike the trees based on the nucleotide sequence of the entire genome and
ORF, however, BBrMV was found to group with the SCMV subgroup. A similar
result was also obtained in analyses based on the amino acid sequence of the CP-
coding region (data not shown).
Discussion
In this study, we have designed two pairs of degenerate primers to detect potyviruses
and used them in a PCR-based strategy to characterize the entire genomes of three
novel potyviruses. The primers were shown to be highly specific for detection of
viruses within the genus Potyvirus. The CIFor and CIRev primer sequences were
based on the potyvirus motifs I and V, respectively [15]. Although these are highly
conserved among all fully sequenced members of the genus Potyvirus, they are less
conserved in members of the Rymovirus, Bymovirus, Ipomovirus and Tritimovirus
genera. However, since four amino acids in motifs I and V (corresponding to 12
nucleotides at the 3’ end of each primer) were identical with those of the potyviruses,
it is possible that these primers could also be used to detect rymoviruses,
ipomoviruses and tritimoviruses. In contrast, the conserved motifs on which the
HPFor and HPRev primers were designed were absent from the published genome
sequences of rymoviruses, ipomoviruses, bymoviruses and tritimoviruses.
The major advantage of these primers lies in their ability to amplify the central
(CI) and 5’ regions (HC-Pro) of the potyviral genome. As such, they can be easily
used in combination with genome-specific primers to facilitate the characterization
195
of complete potyviral genomes. Additionally, Adams et al. [2] concluded that, in the
absence of complete genomic sequence, overall sequence identities between
potyviruses are most accurately reflected in the CI gene. The amplicon sequences
derived using the CIFor/CIRev primer pair may enable the differentiation of
potyviruses at the genus and species level. In pairwise analysis using 149 complete
genomes representing 38 distinct potyviruses, identities based on the CIFor/CIRev-
derived sequences were comparable with those using the entire CI-coding region
(data not shown). Indeed, the three new viruses identified in this study were initially
predicted from the sequences of their CIFor/CIRev-derived amplicons.
Using the degenerate primers in combination with genome-specific primers, we
characterized the complete genome of three potyviruses from Vietnam, tentatively
named TelMV, PeLMV and WTMV, and BBrMV, a potyvirus infecting banana in
the southeast Asian region for which only partial 3’ sequences were available [24].
Based on sequence comparisons, and according to the molecular criteria for
discrimination of members within the family Potyviridae [2], TelMV, PeLMV and
WTMV are new species within the genus Potyvirus. TelMV, PeLMV, WTMV and
BBrMV all contained the genomic features typical of potyviruses. The first in-frame
ATG codons of TeLMV, PeLMV and WTMV were embedded in the plant optimal
initiation contexts with a purine residue (A/G) at the -3 position and a G residue at
the +4 position with respect to the A residue of the ATG codon (+1) [9, 27]. In the
case of BBrMV, a pyrimidine residue (C) was present at the -3 position rather than a
purine. However, the fact that the first few amino acids translated from this putative
BBrMV start codon were highly conserved when compared with those from many
other potyviruses, suggests that the first in-frame ATG triplet in this viral genome is
196
the correct initiation codon. One unusual feature of the genome of PeLMV was the
occurrence of a D residue at the P1’ position at the CI-6K2 junction of PeLMV.
Although a Q/D cleavage motif has not been reported for any other potyviruses at
this position, the cutting motif, DTVQYQ/DKK (corresponding to the modelled
common pattern P6P5P4P3P2P1/P1’P2’P3’), is conserved among potyviruses,
particularly for the residues V (P4), Q (P1) and K (P2’) [1]. It has also been shown
that many amino acids (including D) can be tolerated at the P’ position [16]. Indeed,
a D residue at this position is present at the P3-6K1 junction of Peru tomato virus
[28] and Wild potato mosaic virus [29].
The sequence comparisons and phylogenetic analyses showed TeLMV, PeLMV
were related to members of the BCMV subgroup that includes several different
viruses infecting both monocots and dicots, legume and non-legume plants [6]. This
relatedness was also supported by the presence of an E residue, rather than a D
residue, in the P1 catalytic triad (H-E-S) of all three viruses [1]. In contrast, BBrMV
was not related to other viruses; a reflection of the low identities of the BBrMV CP-
coding region, at both the nucleotide and amino acid levels. This finding is consistent
with the results of Adams et al. [2] who reported that, using phylogenetic analyses
based on the CP-coding region of 89 viruses in the genus Potyvirus, only 20 species
received bootstrap values greater than 75%. Further, the use of the entire ORF
sequences for analyses provided stronger bootstrap support and much clearer
relationships [2].
Using the degenerate primers described in this study, we have detected numerous
novel and previously characterized potyviruses infecting plants in Vietnam. In
197
addition to the three newly described viruses, ten viruses, namely TuMV, LYSV,
SPFMV, SCMV, SrMV, DsMV, ChiVMV, ZYMV, SYSV and PVY, were identified
in Vietnam for the first time. The use of these primers should expedite the molecular
characterization of this important group of viruses.
Acknowledgements
The authors thank the Australian Centre for International Agricultural Research
(ACIAR) for funding this research. HC was supported by a QUT International
Postgraduate Research Scholarship.
References
1. Adams MJ, Antoniw JF, Beaudoin F (2005) Overview and analysis of the
polyprotein cleavage sites in the family Potyviridae. Mol Plant Pathol 6: 471-487
2. Adams MJ, Antoniw JF, Fauquet CM (2005) Molecular criteria for genus and
species discrimination within the family Potyviridae. Arch Virol 150: 459-479
3. Bateson MF, Dale JL (1995) Banana bract mosaic virus - characterization using
potyvirus specific degenerate PCR primers. Arch Virol 140: 515-527
4. Bateson MF, Lines RE, Revill P, Chaleeprom W, Ha CV, Gibbs AJ, Dale JL
(2002) On the evolution and molecular epidemiology of the potyvirus Papaya
ringspot virus. J Gen Virol 83: 2575-2585
198
5. Berger PH, Adams MJ, Barnett OW, Brunt AA, Hammond J, Hill JH, Jordan RL,
Kashiwazaki S, Rybicki E, Spence N, Stenger DC, Ohki ST, Uyeda I, van Jaayen
A, Valkonen J, Vetten HJ (2005) Potyviridae. In: Fauquet CM, Mayo MA,
Maniloff J, Desselberger U and Ball LA (eds) Virus Taxonomy. VIIIth Report of
the International Committee on Taxonomy of Viruses. Elsevier/Academic Press,
London
6. Berger PH, Wyatt SD, Shiel PJ, Silbernagel MJ, Druffel K, Mink GI (1997)
Phylogenetic analysis of the Potyviridae with emphasis on legume-infecting
potyviruses. Arch Virol 142: 1979-1999
7. Chen J, Adams MJ (2001) A universal PCR primer to detect members of the
Potyviridae and its use to examine the taxonomic status of several members of
the family. Arch Virol 146: 757-766
8. Colinet D, Kummert J (1993) Identification of a Sweet potato feathery mottle
virus isolate from China (SPFMV-Ch) by the polymerase chain reaction with
degenerate primers. J Virol Methods 45: 149-159
9. Dreher TW, Miller WA (2006) Translational control in positive strand RNA
plant viruses. Virology 344: 185-197
10. Frohman MA, Dush MK, Martin GR (1988) Rapid production of full-length
cDNAs from rare transcripts - Amplification using a single gene-specific
oligonucleotide primer. Proc Natl Acad Sci USA 85: 8998-9002
11. Gibbs A, Mackenzie A (1997) A primer pair for amplifying part of the genome of
all potyvirids by RT-PCR. J Virol Methods 63: 9-16
199
12. Gibbs AJ, Mackenzie AM, Gibbs MJ (2003) The 'potyvirid primers' will
probably provide phylogenetically informative DNA fragments from all species
of Potyviridae. J Virol Methods 112: 41-44
13. Guyatt KJ, Proll DF, Menssen A, Davidson AD (1996) The complete nucleotide
sequence of bean yellow mosaic potyvirus RNA. Arch Virol 141: 1231-1246
14. Hsu YC, Yeh TJ, Chang YC (2005) A new combination of RT-PCR and reverse
dot blot hybridization for rapid detection and identification of potyviruses. J
Virol Methods 128: 54-60
15. Kadare G, Haenni AL (1997) Virus-encoded RNA helicases. J Virol 71: 2583-
2590
16. Kapust RB, Tozser J, Copeland TD, Waugh DS (2002) The P1' specificity of
tobacco etch virus protease. Biochem Biophys Res Commun 294: 949-955
17. Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for molecular
evolutionary genetics analysis and sequence alignment. Brief Bioinformatics 5:
150-163
18. Langeveld SA, Dore JM, Memelink J, Derks A, Vandervlugt CIM, Asjes CJ, Bol
JF (1991) Identification of potyviruses using the polymerase chain reaction with
degenerate primers. J Gen Virol 72: 1531-1541
19. Mackenzie AM, Nolan M, Wei K-J, Clements MA, Gowanlock D, Wallace BJ,
Gibbs AJ (1998) Ceratobium mosaic potyvirus: another virus from orchids. Arch
Virol 143: 903-914
200
20. Melgarejo TA, Alminaite A, Fribourg C, Spetz C, Valkonen JPT (2004) Strains
of Peru tomato virus infecting cocona (Solanum sessiliflorum), tomato and
pepper in Peru with reference to genome evolution in genus Potyvirus. Arch
Virol 149: 2025-2034
21. Nicolas O, Laliberte JF (1992) The complete nucleotide sequence of Turnip
mosaic potyvirus RNA. J Gen Virol 73: 2785-2793
22. Pappu SS, Brand R, Pappu HR, Rybicki EP, Gough KH, Frenkel MJ, Niblett CL
(1993) A polymerase chain reaction method adapted for selective amplification
and cloning of 3' sequences of potyviral genomes - application to Dasheen
mosaic virus. J Virol Methods 41: 9-20
23. Revers F, Yang SJ, Walter J, Souche S, Lot H, Le Gall O, Candresse T, Dunez J
(1997) Comparison of the complete nucleotide sequences of two isolates of
Lettuce mosaic virus differing in their biological properties. Virus Res 47: 167-77
24. Rodoni BC, Dale JL, Harding RM (1999) Characterization and expression of the
coat protein-coding region of Banana bract mosaic potyvirus, development of
diagnostic assays and detection of the virus in banana plants from five countries
in Southeast Asia. Arch Virol 144: 1725-1737
25. Shukla DD, Frenkel MJ, McKern NM, Ward CW, Jilka J, Tosic M, Ford RE
(1992) Present status of the sugarcane mosaic subgroup of potyviruses. Arch
Virol Suppl 5: 363-373
26. Shukla DD, Ward CW, Brunt AA, Berger PH (1998) Potyviridae family.
CMI/AAB Descriptions of Plant Viruses No 366
201
27. Simon-Buela L, Guo HS, Garcia JA (1997) Cap-independent leaky scanning as
the mechanism of translation initiation of a plant viral genomic RNA. J Gen
Virol 78: 2691-2699
28. Spetz C, Taboada AM, Darwich S, Ramsell J, Salazar LF, Valkonen JPT (2003)
Molecular resolution of a complex of potyviruses infecting solanaceous crops at
the centre of origin in Peru. J Gen Virol 84: 2565-2578
29. Spetz C, Valkonen JPT (2003) Genomic sequence of Wild potato mosaic virus as
compared to the genomes of other potyviruses. Arch Virol 148: 373-380
30. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The
CLUSTAL_X windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882
31. Turpen T (1989) Molecular cloning of a potato virus Y genome: nucleotide
sequence homology in non-coding regions of potyviruses. J Gen Virol 70: 1951-
1960
32. Urcuqui-Inchima S, Haenni AL, Bernardi F (2001) Potyvirus proteins: a wealth
of functions. Virus Res 74: 157-175
33. Wei CB, Chen J, Zhang QY, Shi YH, Lin L, Zheng HY, Adams MJ, Chen JP
(2005) A new potyvirus from Thunberg fritillary (Fritillaria thunbergii Miq.) in
Zhejiang, China. Arch Virol 150: 1271-1280
34. Zerbini FM, Koike ST, Gilbertson RL (1995) Biological and molecular
characterization of Lettuce Mosaic Potyvirus isolates from the Salinas Valley of
California. Phytopathology 85: 746-752
202
CHAPTER 6
Identification and sequence analysis of potyviruses infecting crops in Vietnam
C. Ha1†, P. Revill1*, R.M. Harding1, M. Vu2 and J.L. Dale1
1Tropical Crops and Biocommodities Domain, Institute of Health and Biomedical
Innovation, Queensland University of Technology, Brisbane, 4001, Australia.
2Department of Plant Pathology, Hanoi Agriculture University, Gialam, Hanoi, Vietnam.
† Current address: Department of Plant Pathology, Hanoi Agriculture University,
Gialam, Hanoi, Vietnam.
* Current address: Victorian Infectious Diseases Reference Laboratory, 10 Wreckyn St,
Nth Melbourne, Victoria, 3051, Australia.
This paper has been accepted for publication in Archives of Virology
The formatting and presentation style within this chapter are consistent with Archives of
Virology
203
Summary. Fifty two virus isolates from 13 distinct potyvirus species infecting crops
in Vietnam were identified and the 3’ region of each genome was sequenced. The
viruses were Bean common mosaic virus (BCMV), Potato virus Y (PVY), Sugarcane
mosaic virus (SCMV), Sorghum mosaic virus (SrMV), Chilli veinal mottle virus
(ChiVMV), Zucchini yellow mosaic virus (ZYMV), Leek yellow stripe virus (LYMV),
Shallot yellow stripe virus (SYSV), Onion yellow dwarf virus (OYDV), Turnip mosaic
virus (TuMV), Dasheen mosaic virus (DsMV), Sweet potato feathery mottle virus
(SPFMV) and a novel potyvirus infecting chilli, tentatively named Chilli ringspot virus
(ChiRSV). With the exception of BCMV and PVY, this is first report of these viruses in
Vietnam. Further, rabbit bell (Crotalaria anagyroides) and typhonia (Typhonium
trilobatum) were identified as new natural hosts of the Peanut stunt virus (PStV) strain
of BCMV and of DsMV, respectively. Sequence and phylogenetic analyses of the entire
CP-coding region revealed considerable variability in BCMV, SCMV, PVY, ZYMV and
DsMV.
204
Introduction
The genus Potyvirus is the largest genus of the family Potyviridae with nearly 200
definite and tentative species [6]. Virions of potyviruses range in length from ~700-900
nm and encapsidate a monopartite, single-stranded RNA genome (~ 10 kb) characterized
by a 5’ untranslated region (5’ UTR), a single open reading frame (ORF) and a 3’ UTR
which has a polyadenylated (polyA) tail. The ORF encodes a single, large polyprotein
that is subsequently processed into ten functional proteins [1]. Potyviruses are mainly
transmitted by aphids in a non-persistent manner and infect a wide range of crops in
which they cause significant losses. Although worldwide in their distribution, they are
most prevalent in tropical and subtropical countries [27].
In limited surveys of papaya, banana and various cucurbits in Vietnam between 1998
and 2002, viruses appeared to be a major factor limiting production [24]. The extent of
diseases caused specifically by potyviruses, however, was not thoroughly investigated
although typical potyvirus symptoms were observed on many plants. To date, only three
potyviruses have been definitively identified in Vietnam based on sequence analysis,
namely Banana bract mosaic virus (BBrMV), Papaya ringspot virus (PRSV) and the
Blackeye cowpea mosaic virus strain of Bean common mosaic virus (BCMV-BICM).
BBrMV was detected in a Cavendish banana from North Vietnam in 1999, with
identification based on sequence analysis of the CP-coding region and 3’UTR [25].
PRSV has been shown to be a major limiting factor in papaya production in Vietnam
[24]. Phylogenetic analyses, based on the CP sequences from 52 PRSV isolates from
205
Vietnam, showed a high level of divergence of this virus within the country [4]. The
third potyvirus reported from Vietnam, BCMV-BICM, was detected in both catjang and
yard-long beans (Vigna unguiculata spp.) by IC-PCR; 687 nucleotides of the CP-coding
region has been sequenced [17].
We have previously identified a high degree of virus diversity in Vietnam in a range
of virus groups including babuviruses [5], geminiviruses [16] and PRSV [4]. The high
degree of geminivirus diversity and sequence variability suggested that Vietnam may be
a centre of origin for this important group of viruses. Although only three potyviruses
had been identified in Vietnam prior to the current study, we were interested to
determine whether this important group of viruses was similarly diverse. The major aim
of this study was to conduct a more thorough investigation into the incidence of
potyviruses infecting plants in Vietnam. In this paper, we report the identification of 13
distinct potyviruses in Vietnam using PCR-based diagnostic tests. We also report the
sequence variability in the 3’ region of the viral genomes and discuss the possible
evolutionary implications of these findings.
Materials and methods
Plant samples
Plant samples showing characteristic symptoms of viral infection were collected from a
range of crops during field surveys throughout Vietnam in 2000/2001 and 2004. The
samples were dried under silica gel and stored at room temperature until use.
206
PCR detection of potyviruses
Total RNAs were extracted from the samples using an RNeasy Plant Mini Kit (Qiagen)
following the manufacturer’s instructions. In all cases, RT-PCRs were directly
performed from RNA extracts using a Titan One Tube RT-PCR System (Roche).
Potyviruses were initially detected using two degenerate primers, CIFor and CIRev
(Table 1), which amplified a product of ~0.7 kbp from the CI-coding region. PCRs were
done in a reaction volume of 25 µl containing 1 µl template RNA, 0.5 µl dNTPs (10 mM
each), 1 µl of each primer (20 µM), 1.25 µl DTT (100 mM), 5 U RNase Inhibitor and
0.5 µl enzyme mix. The Tgo proofreading polymerase in this enzyme mix had a three-
fold higher fidelity than Taq DNA polymerase, thereby minimizing PCR induced
sequence errors. The reactions were done at 42○C for 30 min, 94○C for 3 min, and then
subjected to 40 cycles of 94○C (30 s), 40○C (30 s) and 68○C (1 min), terminating with 5
min at 68○C. The 3’ end of each genome, spanning a region from the highly conserved
motif, GNNSGQPSTVVDN, in the NIb-coding region [15] to the 3’ end of the viral
genome, was amplified using different protocols as described below.
1. PVY and TuMV: The 25 µl reaction volume contained 1.5 µl template RNA, 1 µl
dNTPs (10 mM each), 1 µl of NIbFor2 primer (20 µM) (Table 1), 0.5 µl of 3’ end-
specific primers (20 µM each) (Table 1), 1.25 µl DTT (100 mM), 1.5 µl MgCl2 (25
mM), 5 U RNase Inhibitor and 0.5 µl enzyme mix. The reactions were done at 50○C
for 40 min, 94○C for 4 min, and then subjected to 35 cycles of 94○C (30 s), 54○C (30
s) and 68○C (2 min), terminating with 5 min at 68○C.
207
208
Table 1. Primer sequences used in this study
Primer Sequence (5’ – 3’)
CIFor GGiVViGTiGGiWSiGGiAARTCiAC
CIRev ACiCCRTTYTCDATDATRTTiGTiGC
NIBFor2 AAYAGYGGiCARCCiTCiACiGTiGT
PV2IT7* TAATACGACTCACTATAGGGiAAYAAYAGYGGiCARCC
N1T GACCACGCGTATCGATGTCGAC(T)17V
N1 GACCACGCGTATCGATGTCGAC
SCMV3EndRev GTCTCTCACCAAGAGACTCGCAGCAC
SrMV3EndRev GTCTCTTGCCACAAGACTCGCAGCAC
PVY3EndRev GTCTCCTGATTGAAGTTTACAGTCAC
TuMV3EndRev GTCCCTTGCATCCTATCAAATGTTAAG
ZYMV3EndRev AGGCTTGCAAACGGAGTCTAATCTCG
SPFMV3EndRev GCTCGATCACGAACCAAAAAGGCT
LYSV3EndRev GTCTCTTACTGCAACATAAGAACACAC
BCMV3EndRev1 GGAACAACAAACATTGCCGTAGC
DsMV3EndRev GAACACCGTGCACGAAGCATCTC
SYSV3EndRev GTCTCCCTAACAAAACGTACAACAC
ChiVMV3EndRev CGCCACTATTGAATAGCTTGAACGA
* From Mackenzie et al. [19]
209
210
2. SPFMV, ZYMV, LYSV, SYSV, OYDV, DsMV, SCMV, SrMV and BCMV: In
most cases, two rounds of PCR were used to amplify these viral genomes. In the first
round, the RT-PCRs were done as described for PVY and TuMV, except that
primers PV2IT7 [19] and N1T (Table 1) were used and the reaction parameters were
45○C for 40 min, 94○C for 3 min, then 35 cycles of 94○C (40 s), 54○C (40 s) and
68○C (2 min), terminating with 5 min at 68○C. With the exception of OYDV and
SYSV, a second round of PCR was done using the Expand Long Template PCR
System (Roche) with buffer 3. The reactions (25 µl) contained 0.5 µl of reaction mix
from the initial PCR (diluted 1/10 in water), 1 µl of NIbFor2 primer (20 µM), 0.5 µl
of 3’ end-specific primers (20 µM) (Table 1) and 0.5 µl Enzyme mix. The cycling
parameters were the same those of the first round excluding the cDNA synthesis
step.
3. ChiVMV and ChiRSV: First-strand cDNAs were synthesized using SuperScript™
III Reverse Transcriptase (Invitrogen) and N1T primer as first-strand primer, treated
with RNase A and H and purified using a High Pure PCR Product Purification Kit
(Roche). PCR was performed using the Expand Long Template PCR System with
buffer 3. The reactions (25 µl) contained 1.5 µl of purified cDNA, 1 µl of PV2IT7
primer (20 µM), 0.5 µl of N1 primer (20 µM) (Table 1), 1 µl dNTPs (10 mM each)
and 0.5 µl Enzyme mix. The reaction conditions were 94○C for 3 min, then 35 cycles
of 94○C (30 s), 50○C (45 s) and 68○C (2 min), terminating with 5 min at 68○C. For
ChiVMV, a second round of PCR was performed, as described above.
211
Cloning and sequencing
The PCR products were purified from agarose gels using a High Pure PCR Product
Purification Kit (Roche), ligated to the plasmid vector pGEM-T Easy (Promega) and
transformed into E. coli XL1-Blue competent cells (Stratagene). Cloned plasmids were
purified with a Wizard Miniprep Kit (Promega) and inserts were verified by restriction
digestion. Sequences were generated from overlapping clones and multiple clones were
sequenced in areas where sequences were ambiguous. The clones were sequenced using
the ABI Prism®BigdyeTM Terminator Kit (PE Applied Biosystem) and sent to the
Australia Genomic Research Facility (University of Queensland) for analysis.
Sequence analyses
Virus sequences were aligned using the ClustalX program [30], while sequence
identities were calculated using the “Sequence Identity Matrix” option in BioEdit
program version 7.05 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). The
phylogenetic trees were constructed from the ClustalX-aligned sequences using a
MEGA version 3.1 program [18] using the Neighbor-Joining method and a Kimura 2-
Parameter model for estimating the distances and bootstrapped (1000 replicates). All
sequence comparisons and phylogenetic analyses were done using the nucleotide
sequence of the CP-coding region.
212
Results
In most cases, the samples were initially tested for the presence of potyviruses using the
degenerate potyvirus primers, CIFor and CIRev. Amplicons derived from these reactions
were sequenced to confirm their identity. Once the sequence was confirmed, the NIb-3’
end fragment of each viral genome was amplified, cloned and sequenced.
Using primers CIFor and CIRev, an amplicon of the expected size was generated
from 52 plant samples. Sequence analysis of these amplicons confirmed the presence of
13 distinct potyviruses (Table 2), namely BCMV, Potato virus Y (PVY), Sugarcane
mosaic virus (SCMV), Sorghum mosaic virus (SrMV), Chilli veinal mottle virus
(ChiVMV), Chilli ringspot virus (ChiRSV), Zucchini yellow mosaic virus (ZYMV),
Leek yellow stripe virus (LYMV), Shallot yellow stripe virus (SYSV), Onion yellow
dwarf virus (OYDV), Turnip mosaic virus (TuMV), Dasheen mosaic virus (DsMV) and
Sweet potato feathery mottle virus (SPFMV). This was the first report of ChiRSV
infecting chilli.
Bean common mosaic virus (BCMV)
Nine BCMV isolates were identified from a variety of symptomatic legumes, including
black bean, red bean, yard-long bean, soybean and rabbit bell, a cover crop used in
coffee plantations. Sequence comparisons and phylogenetic analyses based on the
nucleotide sequences of the CP-coding region suggested these isolates were three
different strains of BCMV;
213
214
Table 2. List of the potyviruses identified in Vietnam Isolate
Accession
number
Location
Natural host
Identity (%)
in the CP nt sequence*
Most closely related virus in database
Bean common mosaic virus (BCMV)
BCMV-BlC-VN/BB1 DQ925417 Hoa Binh Black bean (Phaseolus vulgaris) 96.6 AY575773-BlCMV-[TW]-Taiwan BCMV-BlC-VN/BB2-6† DQ925423 Hoa Binh Black bean (P. vulgaris) 96.6 AY575773-BlCMV-[TW]-Taiwan BCMV-BlC-VN/RB1 DQ925420 Hue Red bean (P. vulgaris) 96.6 AY575773-BlCMV-[TW]-Taiwan BCMV-BlC-VN/RB2 DQ925421 Hue Red bean (P. vulgaris) 96.6 AY575773-BlCMV-[TW]-Taiwan BCMV-BlC-VN/YB1 DQ925424 Vinh Phuc Yard-long bean (Vigna unguiculata) 98.0 AJ312438-BlCMV-[Y]-China-cowpea BCMV-PSt-VN/SB1 DQ925418 Dak Lak Soybean (Glycine max) 98.4 Y11774-PStV-[T7]-Thailand-peanut BCMV-PSt-VN/Ca1 DQ925419 Dak Lak Rabbit bell (Crotalaria anagyroides) 97.3 Y11774-PStV-[T7]-Thailand-peanut BCMV-VN/BB2-5† DQ925422 Hoa Binh Black bean (P. vulgaris) 76.1 (80.1) Z15057-BCMV-[J8]-Spain BCMV-VN/YB2 DQ925425 Yenbai Yard-long bean (V. unguiculata) 76.3 (80.9) Z15057-BCMV-[J8]-Spain
Sugarcane mosaic virus (SCMV) and Sorghum mosaic virus (SrMV)
SCMV-VN/AR1 DQ925432 Son La Arrowroot (Maranta arundinacea) 89.7 AJ310105-SCMV-China-maize SCMV-VN/M1 DQ925426 Hoa Binh Maize (Zea mays) 94.3 AY629312-SCMV-Thailand-sugarcane SCMV-VN/M2 DQ925429 Ha Tay Maize (Z. mays) 98.2 AY629312-SCMV-Thailand-sugarcane SCMV-VN/SC1 DQ925431 Yen Bai Sugarcane (Saccharum officinarum) 98.5 AY629312-SCMV-Thailand-sugarcane SCMV-VN/SC2 DQ925427 Hoa Binh Sugarcane (S. officinarum) 76.6 AJ310107-SCMV-China-maize SCMV-VN/SC3 DQ925430 Bac Giang Sugarcane (S. officinarum) 76.4 AJ310105-SCMV-China-maize SCMV-VN/SC4 DQ925428 Ha Noi Sugarcane (S. officinarum) 79.1 AJ310107-SCMV-China-maize SrMV-VN/SC5 DQ925433 Hoa Binh Sugarcane (S. officinarum) 95.7 AJ310195-SrMV-China-sugarcane SrMV-VN/SC6 DQ925434 Ha Tay Sugarcane (S. officinarum) 96.0 AJ310195-SrMV-China-sugarcane
Potato virus Y (PVY), Chilli veinal mottle virus (ChiVMV) and Chilli ringspot virus (ChiRSV)
PVY-VN/P1 DQ925435 Da Lat Potato (Solanum tuberosum) 98.8 DQ15717 Y9-PVAJ390290 PVY
N:O –[OR1]-USA-potato PVY-VN/P2 DQ925437 Ha Noi Potato (S. tuberosum) 99.7 NTN –[v951156-2]-UK-potato PVY-VN/C10 DQ925436 Da Lat Chili (Capsicum annuum) 95.3 AJ439544-PVY-[SON41]-France-black nightshade ChiVMV-VN/C1 DQ925440 Ha Noi Chilli (C. annuum) 93.9 U72193-ChiVMV-Thailand-chilli ChiVMV-VN/C2 DQ925441 Ha Noi Chilli (C. annuum) 93.1 U72193-ChiVMV-Thailand-chilli ChiVMV-VN/C3 DQ925442 Ha Noi Chilli (C. annuum) 94.0 U72193-ChiVMV-Thailand-chilli ChiVMV-VN/C4 DQ925443 Yen Bai Chilli (C. annuum) 92.7 U72193-ChiVMV-Thailand-chilli ChiVMV-VN/C5 DQ925444 Ho Chi Minh Chilli (C. annuum) 96.5 U72193-ChiVMV-Thailand-chilli ChiVMV-VN/C6 DQ925446 Vinh Phuc Chilli (C. annuum) 94.8 AB012221-ChiVMV-[CM1]-Thailand-chilli ChiVMV-VN/C7 DQ925445 Hue Chilli (C. annuum) 94.6 AB012221-ChiVMV-[CM1]-Thailand-chilli ChiRSV-VN/C8 DQ925438 Ninh Thuan Chilli (C. annuum) 73.5 (60.0) AB020524-TVBMV-[SOL4]-tobacco ChiRSV-VN/C9 DQ925439 Dien Bien Phu Chilli (C. annuum) 73.0 (58.9) AB020524-TVBMV-[SOL4]-tobacco
Zucchini yellow mosaic virus (ZYMV)
ZYMV-VN/Cs1 DQ925449 Son La Cucumber (Cucumis sativus) 94.3 AJ515911-ZYMV-[WM]-China-watermelon ZYMV-VN/Cm1 DQ925448 Son La Pumpkin (Cucurbita moschata) 95.2 AJ515911-ZYMV-[WM]-China-watermelon ZYMV-VN/Cm2 DQ925450 Hoa Binh Pumpkin (C. moschata) 95.5 AJ515911-ZYMV-[WM]-China-watermelon ZYMV-VN/Cm3 DQ925447 Vinh Phuc Pumpkin (C. moschata) 88.8 AF014811-ZYMV-Singapore-cucumber ZYMV-VN/Bh1 DQ925451 Ho Chi Minh Waxy gourd (Benincasa hispida) 91.1 AY074808-ZYMV-[Shanxi]-China-pumpkin
Shallot yellow stripe virus (SYSV), Leek yellow stripe virus (LYSV) and Onion yellow dwarf virus (OYDV)
SYSV-VN/S1 DQ925456 Hue Shallot (Allium ascalonicum) 98.1 AJ865077-SYSV-[ZQ1]-China-Welsh onion SYSV-VN/S2 DQ925457 Hung Yen Shallot (A. ascalonicum) 98.4 AJ865077-SYSV-[ZQ1]-China-Welsh onion SYSV-VN/L1 DQ925458 Bac Ninh Leek (A. porrum) 90.8 AB000473-SYSV-Japan-Japanese Allium LYSV-VN/L2‡ DQ925452 Son la Leek (A. porrum) 82.6 AF538950-LYSV-Taiwan-garlic LYSV-VN/L3§ DQ925453 Ha Noi Leek (A. porrum) 84.1 AF538950-LYSV-Taiwan-garlic OYDV-VN/L4‡ DQ925454 Son La Leek (A. porrum) 90.4 AJ409312-OYDV-[YN1]-China-garlic OYDV-VN/L5§ DQ925455 Ha Noi Leek (A. porrum) 89.2 AJ307033-OYDV-[Xixia]-China-garlic
Turnip mosaic virus (TuMV)
TuMV-VN/Rs1 DQ925459 Dak Lak Chinese radish (Raphanus sativus) 98.4 AB105134-TuMV-[TU3]-Japan-cabbage TuMV-VN/Rs2 DQ925463 Lai Chau Chinese radish (R. sativus) 98.1 AB180026-TuMV-[CQS1]-Korea-Chinese cabbage TuMV-VN/Bj1 DQ925460 Dak Lak Chinese mustard (Brassica juncea) 97.7 AB105134-TuMV-[TU3]-Japan-cabbage TuMV-VN/Bj2 DQ925461 Hoa Binh Chinese mustard (B. juncea) 98.6 AF530056-TuMV-Taiwan-radish TuMV-VN/Bj3 DQ925462 Lai Chau Chinese mustard (B. juncea) 98.4 AB105134-TuMV-[TU3]-Japan-cabbage
Dasheen mosaic virus (DsMV)
DsMV-VN/Ce1 DQ925464 Yen Bai Taro (Colocasia esculenta) 79.0 AJ298036-DsMV-[TW]-Japan-taro DsMV-VN/Ce2 DQ925465 Ho Chi Minh Taro (C. esculenta) 90.5 AJ298036-DsMV-[TW]-Japan-taro DsMV-VN/Tt1 DQ925466 Ha Noi Typhonia (Typhonium trilobatum) 77.6 AJ616721-VaMVV-[CI-NAT]-Cook Islands-vanilla
Sweet potato feathery mottle virus (SPFMV)
SPFMV-VN/SP1 DQ925467 Hue Sweet potato (Ipomoea batatas) 96.2 AY459599-SPFMV-[Port/EA strain]-Portugal SPFMV-VN/SP2 DQ925468 Bac Giang Sweet potato (I. batatas) 96.1 AY523550-SPFMV-[Ruk55/EA strain]-Uganda
*Percentage identity with the most closely related sequence in databases; the number in brackets refers to identity in the 3’ UTR †, ‡ and §: The isolates with the same symbol were isolated from the same plant sample
215
216
1. Five isolates were grouped as BlCMV strains and were designated BCMV-BlC-
VN/BB1, -VN/BB2-6, -VN/RB1, -VN/RB2 and –VN/YB1 (Table 2). The nucleotide
sequences of these isolates showed high identities both amongst themselves (95.8–99%)
and with the sequences of published BlCMV isolates. The most closely related viruses to
the Vietnamese BlCMV isolates were BlCMV isolates from Taiwan (96.6%) and China
(98%) (Table 2). Phylogenetic analyses based on the nucleotide sequences of the CP-
coding region (Fig. 1) showed that all the five BlCMV isolates from Vietnam were
grouped within the well-supported BlCMV cluster.
2. Two isolates, from soybean and rabbit bell, were grouped as Peanut stunt virus
(PStV) strains and designated BCMV-PSt-VN/SB1 and –VN/Ca1, respectively. The two
isolates shared 98.1% nucleotide identity with each other, shared greater than 93%
identity with other reported PStV isolates and less than 90% identity with other non-
PStV isolates. The closest virus to each isolate was a PStV-[T7] isolate from Thailand
(Table 2). Phylogenetic analyses confirmed that the two isolates were grouped within the
PStV cluster and with the Thai isolates (Fig. 1).
3. This group included two isolates from black bean and yard-long bean (designated
BCMV-VN/BB2-5 and –VN/YB2, respectively). The two isolates shared 99.3%
nucleotide identity in the CP-coding region but were only very distally related to other
viruses of the BCMV group (Fig. 1). They shared approximately 75% identity with other
isolates from Vietnam and between 74.1-76.3% with other reported isolates (maximum
76.1 and 76.3% identity, respectively, with Spanish isolate BCMV-[J8], Table 2).
However, they shared less than 68% identity with other non-BCMV viruses of the
“BCMV subgroup”. In comparisons made using the amino acid sequence of the CP and
217
218
219
L19474-BCMV-[US7] L19539-BCMV-[CH1]-Capsicum annuum
L12740-BCMV-[US1] AF083559-BCMV-[NY 68-95]
S66252-BCMV-[NY15] S66251-BCMV-[NL1]
L15332-BCMV-[NL1] AY112735-BCMV-[NL1]-Phaseolus vulgaris
U37073-BCMV-[US3]-P. vulgaris U37072-BCMV-[US10]-P. vulgaris
DQ054366-BCMV-Australia Z15057-BCMV-[J8]
AY863025-BCMV-[RU1]-USA-P. vulgaris U37077-BCMV-[RU1]-P. vulgaris
L19472-BCMV-[NL2] AF361337-BCMV-[93/65]-South Africa-P. vulgaris
U37074-BCMV-[US4]-P. vulgaris AB012663-AzMV-[H]
U23564-DeMV-USA-Dendrobium superbum U60100-AzMV
AY575773-BlCMV-[TW]-Taiwan Y17823-BlCMV-[Florida]-cowpea
S66253-BlCMV-[W] AJ312438-BlCMV-[Y]-China-cowpea AJ312437-BlCMV-[R]-China-cowpea
BlCMV-VN/YB1 BlCMV-VN/BB2-6
BlCMV-VN/RB1 BlCMV-VN/BB1 BlCMV-VN/RB2 AF045065-BCMV-[GGSUS]-USA-Cyamopsis tetragonolaba
AF045066-BCMV-[GGSSA]-South Africa-C. tetragonolaba U37075-BCMV-[N17]-P. vulgaris
L21767-BCMV-[BR1]-Puerto Rico L11890-BCMV-[Mexican]
L19473-BCMV-[US5] AF200623-PStV-[SN-Nib2]-Thailand
AF073380-PStV-[T6-97]-Thailand-peanut Y11773-PStV-[T6]-Thailand-peanut
Y11771-PStV-[T3]-Thailand-peanut Y11776-PStV-[T1]-Thailand-peanut
Y11774-PStV-[T7]-Thailand-peanut Y11772-PStV-[T5]-Thailand-peanut
PStV-VN/SB1 PStV-VN/Ca1
AF063222-PStV-[Ts]-Taiwan-peanut AY968604-PStV-[Ts]-Taiwan-peanut
U34972-PStV-[Blotch]-China-peanut X63559-PStV-[Blotch]-China-peanut
U05771-PStV-[Blotch]-China-peanut AJ132143-PStV-[G]-China-peanut
AJ132144-PStV-[W]-China-peanut Y11775-PStV-[95/399] DQ367846-PStV[Hongan]-China-peanut
Fig. 1. A bootstrap con Z21700-PStV-[370]-Indonesia-peanut AJ132155-PStV-[I12]-Indonesia-peanut AJ132156-PStV-[I13]-Indonesia-peanut AJ132147-PStV-[I2]-Indonesia-peanut AJ132146-PStV-[I1]-Indonesia-peanut AJ132149-PStV-[I5]-Indonesia-peanut
BCMV-VN/BB2-5 BCMV-VN/YB2
WVMV-AY656816 WMV-AY437609
SMV-AY216010 DsMV-AJ298033
CABMV-AF348210 BCMNV-U19287
ZYMV-AF127929 EAPV-AB246773
99
99
88
97
84
66
63
99
95
97
91
72
94
52
99
7257
99
7996
8792
58
99
99
99
8982
99
6992
87
7778
79
75 65
54
82
87
857669
99
99
99 96
92
51 50
0.05
Other viruses of the “BCMV subgroup”
BCMV
BlCMV strain
PStV strain
Fig. 1. A bootstrap consensus tree based on the complete CP nt sequences of the nine BCMV isolates from Vietnam (dotted, in bold and highlighted in grey) and 62 database sequences. Other viruses of the “BCMV subgroup” were included as an outgroup. Only bootstrap values (%) greater than 50% (1000 replicates) are indicated. WVMV, Wisteria vein mosaic virus; WMV, Watermelon mosaic virus; SMV, Soybean mosaic virus; CABMV, Cowpea aphid-borne mosaic virus; BCMNV, Bean common mosaic necrosis virus; EAPV, East Asian Passiflora virus.
220
the nucleotide sequence of the 3’ UTR, they shared 75.9-80.1% and 74.3-80.9%
identity, respectively, with all other BCMV isolates. Isolates BCMV-VN/BB2-5 and -
BlC-VN/BB2-6 were amplified from the same black bean sample, indicating a mixed
infection with two distinct, but closely related viruses (Table 2).
Sugarcane mosaic virus (SCMV) and Sorghum mosaic virus (SrMV)
Seven SCMV isolates from maize, sugarcane and arrowroot and two SrMV isolates from
sugarcane were identified from North Vietnam (Table 2).
SCMV
Sequence and phylogenetic analyses showed that the SCMV isolates from Vietnam were
extremely diverse and were divided into three groups;
1. This group consisted of an isolate from arrowroot, designated SCMV-VN/AR1. This
isolate shared 75.1-80.7% CP nucleotide identity with other SCMV isolates from
Vietnam and had highest identity (89.7%) with a maize isolate from China (Table 2).
2. Two isolates from maize (designated SCMV-VN/M1, -VN/M2) and one isolate from
sugarcane (-VN/SC1) were included in this group. They shared high CP nucleotide
identities with each other (93.7-98%) but shared only 72.7-80.7% identity with other
SCMV isolates from Vietnam. When compared with other reported isolates, they had
highest identities (94.3, 98.2 and 98.5%, respectively) with one isolate infecting
sugarcane from Thailand (Table 2).
221
3. This group consisted of three sugarcane isolates (SCMV-VN/SC2, -VN/SC3 and -
VN/SC4). Isolates in this group was considerably more diverse than isolates in the group
2, sharing 87.3-91.8% CP nucleotide identity between each other and 72.7-76.7%
identity with other SCMV isolates from Vietnam. SCMV-VN/SC2, -VN/SC3 and -
VN/SC4 also showed low identities with other published SCMV isolates; the highest
identities were 76.6%, 76% and 79.1%, respectively, with a maize isolate from China.
In phylogenetic analyses based on the CP nucleotide sequences (Fig. 2), all SCMV
sequences on databases, including the Vietnamese sequences, were grouped into four
well supported Clusters (I, II, III and IV). Cluster I was most diverse in terms of hosts
(maize, sugarcane, banana and arrowroot), geographical origins (Asia, Europe and
America) and sequence distances (branch lengths). The Vietnamese SCMV isolates
belonging to Groups 1 and 2 fell within this cluster. Consistent with the sequence
comparisons, SCMV-VN/AR1 (SCMV Group 1) formed a distinct branch independent
from all other isolates. Further, all three Vietnamese SCMV Group 2 isolates grouped
tightly with the isolates from Thailand to form a monophyletic Viet-Thai sub-cluster.
The three Vietnamese SCMV Group 3 isolates from sugarcane grouped together to form
Cluster 4. There were no Vietnamese isolates in Cluster II, which only comprised
isolates from Brazil, or Cluster III, which included sugarcane isolates from different
continents.
SrMV
The two SrMV isolates, designated SrMV-VN/SC5 and –VN/SC6, were 98%
identical in CP nucleotide sequence but showed only 63.3 - 66.8% identity with other
222
223
AJ310106-[DY]-China-maize AJ310107-[JS]-China-maize AJ310110-[HB]-China-maize AJ297628-[HZ]-China-maize AY639645-China-maize AY149118-[SD]-China-maize AF494510-China-maize
AY042184-[Beijing]-China-maize AY569692-[XS]-China-maize
X98167-[Borsdorf]-Germany-maize AJ006202-[G96]-Germany
X98169-[Hoendstedt]-Germany-maize AM110759-[Sp]-Spain-maize X98168-[Boetzingen]-Germany-maize
AJ006200-[G952]-Germany AY195610-[Mx]-Mexico-maize
X98165-[Seehausen/S26]-Germany-maize X98166-[Seehausen/S288]-Germany-maize
AJ006201-[Bg]-Bulgaria-maize AJ310105-[GD]-China-maize
SCMV-VN/AR1 AJ310104-[YH]-China-sugarcane AJ310102-[LP]-China-sugarcane
AJ310103-[XgS]-China-sugarcane AY222743-[Abaca]-Philippines-Musa textilis
SCMV-VN/M1 AY630923-[UT6TH]-Thailand-sugarcane
AY629310-[UT6.2]-Thailand-sugarcane AY629311-[UD7TH]-Thailand-sugarcane AY629312-[SBC2TH]-Thailand-maize
SCMV-VN/M2 SCMV-VN/SC1
DQ315495-[BR11]-Brazil DQ315494-[BR10]-Brazil
DQ315489-[BR01]-Brazil DQ315497-[BR14]-Brazil
DQ315492-[BR08]-Brazil DQ315493-[BR09]-Brazil
DQ315498-[BR15]-Brazil DQ315496-[BR13]-Brazil DQ315491-[BR06]-Brazil DQ315490-[BR02]-Brazil DQ369960-[KhzL66]-Iran-sugarcane DQ438949-[KhzQ86]-Iran-sugarcane
U57357-[E]-USA-sugarcane AY836523-[E]-USA-sugarcane AF006737-[USFL]-USA-sugarcane
AY953351-[D]-China-sugarcane U57355-[B]-USA-sugarcane
U57356-[D]-USA-sugarcane AF006738-[SA]-South Africa-sugarcane
U57354-[A]-USA-sugarcane AF006736-[USLA]-USA-sugarcane
D00948-[SC]-Australia-sugarcane AY241923-India
AF006732-[Nambour 2]-Australia-sugarcane AF006733-[Nambour 7]-Australia-sugarcane
AF006730-[Isis 5]-Australia-sugarcane AF006734-[Brisbane]-Australia-sugarcane AJ278405-[A/Brisbane]-Australia-sugarcane AF006735-[Bundaberg]-Australia-sugarcane AF006728-[Isis 3]-Australia-sugarcane AF006729-[Isis 2]-Australia-sugarcane AF006731-[Isis 7]-Australia-sugarcane
SCMV-VN/SC4 SCMV-VN/SC2
SCMV-VN/SC3 AJ310197-[XoS]-China-sugarcane
AJ310194-[XgS]-China-sugarcane AJ310198-[YH]-China-sugarcane
AJ310195-[LP]-China-sugarcane SrMV-VN/SC5 SrMV-VN/SC6
AJ310196-[LH]-China-sugarcane U57360-[SCM]-USA-sugarcane
U57358-[SCH]-USA-sugarcane U07219-SCH
U57359-[SCI]-USA-sugarcane MDMV-AJ001691-CP.SEQ
PenMV-AY642590-CP.SEQ ZeMV-AF228693-CP.SEQ
JGMV-Z26920-CP.SEQ
78 99
58 90
100
100
100
100 100
99 100
52 55 52
86 100
59 100
68 99
57
58
100
100 99
99
94
88
75
64
58
100
66
58 100
100
99 93
88
80
62
58
62
62
83
100
94
93
74 93
71
100
57 92
100
76
80
70
60
0.05
Sugarcane China,
Vietnam
Sugarcane
Iran USA China
South Africa India
Australia
Unknown
Brazil
Sugarcane Vietnam
Sugarcane USA
Sugarcane, maize, Musa,
arrowroot
China Thailand Vietnam
Philippines Mexico
Germany Bulgaria
Spain
SCMV
SrMV
IV
III
I
II
I
II
Other viruses of the “SCMV subgroup”
Fig. 2. A bootstrap consensus tree based on the complete CP nt sequences of the six SCMV and two SrMV isolates from Vietnam (dotted, in bold and highlighted in grey) and 60 SCMV and nine SrMV database sequences. Other viruses of the “SCMV subgroup were also included as an outgroup. Only bootstrap values (%) greater than 50% (1000 replicates) are indicated. MDMV, Maize dwarf mosaic virus; PenMV, Pennisetum mosaic virus; ZeMV, Zea mosaic virus; JGMV, Johnsongrass mosaic virus.
224
SCMV isolates from Vietnam. When compared with the CP sequences of other SrMV
isolates, the highest identities (95.7 and 96.0%, respectively) were with a sugarcane
isolate from China (Table 2). Phylogenetic analysis identified two distinct clusters of
SrMV isolates; one contained isolates from USA while the other included isolates from
China and Vietnam (Fig. 2).
Potyviruses infecting solanaceous plants: PVY, ChiVMV and ChiRSV
Twelve different potyviral sequences were amplified from diseased chilli and potato
plants (Table 2). Analyses revealed that the 12 sequences comprised three isolates of
PVY, seven isolates of ChiVMV and two isolates of ChiRSV.
Of the three PVY isolates, two were amplified from potato (PVY-VN/P1 and -
VN/P2) and one was amplified from chilli (-VN/C10). The sequences showed 89.6-92%
CP nucleotide identity between themselves and greater than 87% identity with other
reported PVY isolates (using 148 CP sequences). PVY-VN/P1 was most closely related
(98.8%) to a potato isolate from USA, PVY-VN/P2 was nearly identical (99.7%) to a
potato isolate from the UK, while the chilli isolate had highest identity (96.3%) with a
PVY isolate originating from black nightshade in France (Table 2). Phylogenetic
analyses of the Vietnamese isolates and their closest sequenced partners, including the
sequences of PVY isolates previously shown to be grouped into three phylogenetic
lineages, PVYN, PVYO and PVYNP (non-potato) [11], three distinct clusters were evident
(Fig. 3). Each of the three clusters contained a Vietnamese isolate, with the PVY-VN/P1,
-VN/P2 and -VN/C10 isolates grouped within the PVYO, PVYN and PVYNP clusters,
respectively.
225
Seven isolates of ChiVMV were identified and were named ChiVMV-VN/C1-7.
These isolates showed 89.7-98.7% identity with each other and 88.9-96.5% identity with
other published ChiVMV isolates from Thailand and India (although the Vietnamese
isolates always showed higher identities with the Thai isolates than with the Indian
isolate) (Table 2). Phylogenetic analysis showed that all the ChiVMV isolates formed a
well-supported distinct cluster and consistent with sequence comparisons, were more
closely related to the Thai isolates reflecting their close geographical relatedness (Fig.
3).
Two sequences were amplified from chilli which, based on sequence comparisons,
appeared to be novel potyviruses. The two sequences shared 91.8 and 93% identity to
each other in the CP gene and 3’UTR, respectively, while the most closely related
sequences on databases were with four isolates of Tobacco vein banding mosaic virus
(TVBMV), with identities ranging from 72.3-73.5% and 58.4-60% identity over the CP
gene and 3’UTR, respectively. Based on the nucleotide identity thresholds for species
discrimination of potyviruses (76% for both the CP gene and 3’UTR [2]), these two
sequences were clearly from two isolates of a novel potyvirus which we provisionally
named Chilli ringspot virus (ChiRSV) based on the characteristic symptoms and host
plant. The two isolates were designated ChiRSV-VN/C8 and –VN/C9. In a phylogenetic
tree (Fig. 3), the two ChiRSV isolates formed a separate branch consistent with the
sequence comparison data. Further, their relative branch lengths compared with those of
TVBMV confirmed the two viruses being distinct species.
226
227
AJ390290-[NTN/v951156-2]-UK-potato
PVY-[VN/P2]-Vietnam-potato X68223-[Europe-H]-Hungary-potato
AF321554-[NTN]-Slovenia-potato
AJ133454-[NTN]-Netherlands-petunia
AJ535662-[NTN-Ca/H]-Hungary-pepper
M95491-Hungary
AY166866-[NTN-Tu660]-Canada-potato
D12570-[T]-Japan-potato
AF255660-[NBR]-Brazil-potato
M22470-[N]-New Zealand-potato
X97895-[N-605]-Switzerland
S74813-[T13]
AJ390296-[NTN-NN-UK-N]-UK-potato
AJ390308--NTN-S-RBS96]-UK-potato
AF525081-Solanum palinacanthum
X12456-[N]-France-potato
U09509-[O]-Canada-potato
X68222-[O-US]-USA-potato
Z70238-[N-Wilga]Poland-potato
Z70239-[O-LW]-Poland-potato
AF118153-[O]-India-eggplant
DQ157179-[N:O-OR1]-USA-potato PVY-[VN/P1]-Vietnam-potato
AJ223593-[O-768]-Switzerland
AJ390305-[O-Des]-UK-potato
AF012028-[C-30]-Germany
AF463399-[MrNs]-USA-tobacco
X68224-[NsNr]-USA-tobacco
PVY-[VN/C10]-Vietnam-chilli AJ303096-[PN-82]-Spain-pepper
AJ439544-[Son41]-France-Solanum nigrum
AJ005639-[P21-82]-Spain-pepper
AJ390307-[C-O-Tom]-Portugal-tomato
AF012027-[C-28]-Germany
AF012029-[C-45]-Germany
AJ303093-[Si15]-Italy-pepper
AJ303094-[K16.94]-Tunisia-pepper
AF237963-[nnp]-Italy-pepper
AJ303095-[Tu12.3]-Turkey-pepper
AJ439545-[LYE84.2]-Spain-tomato
PepSMV-X66027
PepMoV-M96425
PepYMV-AF348610
TVBMV-X77637
TVBMV-L28816
TVBMV-AB020524
TVBMV-AF274315 ChiRSV-[VN/C8]-Vietnam-chilli
ChiRSV-[VN/C9]-Vietnam-chilli PVMV-AJ780968
PVMV-AJ780967
PVMV-AJ780966
PVMV-AJ780970
PVMV-AJ780969
WTMV-DQ851495
ChiVMV-[VN/C6]-Vietnam-chilli ChiVMV-[VN/C7]-Vietnam-chilli
AB012221- [CM1]-Thailand-chilli
U72193- Thailand-chilli
ChiVMV-[VN/C5]-Vietnam-chilli AJ237843- India-chilli
ChiVMV-[VN/C3]-Vietnam-chilli ChiVMV-[VN/C4]-Vietnam-chilli
ChiVMV-[VN/C1]-Vietnam-chilli ChiVMV-[VN/C2]
100 99
78
100
62 99
98 58
98
93 52
79
100
90
100
100
99
67 88
100
64
82
99
98
92
100
98
76
69
61
100
97
93
92
80
80
77
74
100
99
86
100
73 97
100
99
100
0.05
PVYN
PVYO
PVYNP
(Non-potato)
ChiRSV
ChiVMV
Fig. 3. A bootstrap consensus tree based on the complete CP nt sequences of solanaceous plant-infecting potyviruses identified from Vietnam (dotted, in bold and highlighted in grey) and in databases. Only bootstrap values (%) greater than 50% (1000 replicates) are indicated. PepSMV, Pepper severe mosaic virus; PepMoV, Pepper mottle virus; PepYMV, Pepper yellow mosaic virus; PVMV, Pepper veinal mottle virus; WTMV, Wild tomato mosaic virus.
228
Zucchini yellow mosaic virus (ZYMV)
Cucurbits showing a range of typical viral symptoms were commonly observed
throughout Vietnam. Samples were initially tested for potyviruses using the CI primers
and those that tested positive were subsequently tested for the commonly found PRSV
using specific primers MB12A and MB11 [3]. From the samples testing positive for
potyviruses but negative for PRSV, we detected five ZYMV isolates infecting cucumber
(ZYMV-VN/Cs1), pumpkin (ZYMV-VN/Cm1, -Cm2 and –Cm3) and waxy gourd
(ZYMV-VN/Bh1) (Table 2). Sequence and phylogenetic analyses showed that the
ZYMV isolates were very diverse (79.4-98.9% identity with each other) and could be
divided into three groups.
1. This group included only one isolate, ZYMV-VN/Cm3, from pumpkin. The isolate
shared very low identity with other Vietnamese ZYMV isolates (maximum 81.8%), with
the most closely related virus originating from Singapore (88% identity).
2. This group also included a single isolate, ZYMV-VN/Bh1, from waxy gourd. This
isolate had low identity with other Vietnamese isolates (maximum 86.4%) but shared a
much higher identity (91.1%) with one Chinese ZYMV isolate (AY074808).
3. Three isolates were included in this group, ZYMV-VN/Cs1, -VN/Cm1 and –
VN/Cm2. These three isolates shared high sequence similarity (95.9-98.9% identity),
and when compared to other sequences, shared the highest identities (95.2, 94.3 and
95.5%, respectively) with a Chinese ZYMV isolate from watermelon (Table 2).
229
Phylogenetic analysis of the five Vietnamese isolates and 56 database sequences
revealed that the ZYMV isolates were grouped into three major clusters (I, II, III) (Fig.
4). The viruses that were in Cluster I had a worldwide distribution; none of the
Vietnamese isolates fell in this cluster. ZYMV-VN/Cm3 (Group 1), along with two
isolates from Singapore and Reunion Island, formed Cluster II, while Cluster III
comprised the remaining four Vietnamese ZYMV isolates and six Chinese isolates. On
the bases of the branch lengths and bootstrap support, Cluster III could be divided into
two sub-clusters, each of which would contain Vietnamese ZYMV isolates from either
group 1 or 2.
Potyviruses infecting bulb crops from Vietnam: OYDV, LYSV and SYSV
Three distinct potyviruses, SYSV, LYSV and OYDV, were detected in symptomatic
bulb plants. Of the three SYSV isolates, two were found in shallot (SYSV-VN/S1 and -
VN/S2) and one in leek (SYSV-VN/L1). Two isolates each of LYSV and OYDV were
detected in leek, and these were designated LYSV-VN/L2 and -VN/L3 and OYDV-
VN/L4 and -VN/L5, respectively (Table 2). Interestingly, the pairings of LYSV-VN/L2
with OYDV-VN/L4, and LYSV-VN/L3 with OYDV-VN/L5, were each isolated from
different leek plants, indicating mixed infection of different potyviruses in the one plant
(Table 2).
230
231
AJ420014-[Austria 6]-Austria-Cucurbita pepo AJ459956-[H272-8]-Hungary-C. pepo AJ459955-[H272-6]-Hungary-C. pepo AJ459954-[H266-2]-Hungary-C. pepo
AJ251527-[10]-Hungary-Cucumis sativus AJ420013-[Austria 5]-Austria-C. pepo AJ420018-[Slovenia 1]-Slovenia-C. pepo
AJ420019-[Berlin 1]-Germany-C. pepo AY188994-B
M35095-[NAT]-Israel-C. sativus AB127936-[Pak]-Pakistan-Lageneria siceneria AB004641-[M]-Japan AB063251[-M39]-Japan-Cucumis melo AF513550-[Shangyu]-China- Cucurbita moschata AY074809-[Beijing]-China
AY611021-China-C. moschata AF513551-[Ningbo 2]-China-C. moschata AY074810-[Ningbo]-China-C. melo
AJ316229-[WG]-China-Benicasa hispida D13914-[Florida]-USA-C. moschata
AF127933-[NT1]-Taiwan-C. sativus AB188115-[Z5-1]-Japan-C. sativus AB188116-[Z5-1/2002]-Japan-C. sativus AJ420020-[Italy 1]-Italy-C. pepo D00692-[Connecticut]-USA L31350-[California]-USA-C. moschata
AJ307036-[CU]-China-C. sativus AY611022-[99/90]-China-C. melo
AY611024-[99/246]-China-squash AY279000-[KR-PS]-Korea-C. moschata
AF486822-[Dongyang]-China-C. moschata AF062518-[CU]-Korea-C.sativus
AY597207-[Hefei]-China AY611023-[193/90]-China-squash
AY278998-[KR-PA]-Korea-C. moschata AF486823-[Hainan]-China-B. hispida
AB004640-[169]-Japan-C. melo AF127930-[TW-CY2]-Taiwan-L. cylindrica
AF127934-[TW-PT5]-Taiwan-Momordica charantia AJ316227-[P]-China-C. moschata AJ316228-[SG]-China-L. cylindrica
AF127931-[TW-TC1]-Taiwan-C. maxima AF127929-[TW-TN3]-Taiwan-L. cylindrica AJ429071-[A]-Korea-Altheae rosea
AF435425-[Hangzhou]-China-C. moschata AY611026-[HN-01]-China-C. lanatus
AF127932-[TW-TNML1]-Taiwan-C. melo AY995216-New Zealand-zucchini
L29569-[Reunion]-Reunion Island-M. charantia AF014811-[Singapore]-Singapore-C. sativus
ZYMV-VN/Cm3 AF513552-[Shandong]-China
AY074808-[Shanxi]-China-C. moschata ZYMV-VN/Bh1
ZYMV-VN/Cm1 ZYMV-VN/Cs1
ZYMV-VN/Cm2 AY611025-[BJ-03]-China-C. lanatus AJ515911-[WM]-China-C. lanatus AJ515907-[SXS]-China-C. moschata
AJ515908-[MM]-China-C. melo EAPV- AB246773
DsMV- AJ298033 BCMV- AJ312437
CABMV-AF348210 BCMNV-U19287
WVMV-AY656816 WMV- AY437609
SMV- AY216010
96 100
100
84 99
93
52
100
87 100
72
97
76
65
87
69 100
100
100
99
66
62
79
99
99
69
98
7377
99
89 92
98
94 97
90
81
86
100
99
52 93
96
100
97 99
0.05
I
III
II
ZYMV
Other viruses of the “BCMV subgroup”
World wide
Vietnam China
Vietnam Reunion,
Singapore
Fig. 4. A bootstrap consensus tree based on the complete CP nt sequences of the five ZYMV isolates from Vietnam (dotted, in bold and highlighted in grey) and 56 database sequences. Other viruses of the “BCMV subgroup” were also included as an outgroup. Only bootstrap values (%) greater than 50% (1000 replicates) are indicated.
232
The sequences of the two SYSV isolates from shallot (SYSV-VN/S1 and -VN/S2) were
nearly identical (98.9% identity) and shared lower identities (90.1 and 90.6%,
respectively) with the leek isolate. When compared with other reported SYSV isolates,
SYSV-VN/S1 and -VN/S2 showed very high identities (98.1 and 98.4%, respectively)
with a Welsh onion SYSV isolate from China, whereas the leek isolate SYSV-VN/L1
showed highest identity (90.8%) with a Japanese SYSV isolate infecting Japanese
Allium (Table 2).
For LYSV, the two isolates, LYSV-VN/L2 and –VN/L3, shared 93.4% identity, and
showed between 77.5-84.1% identity with other reported LYSV isolates. The highest
identities (82.6 and 84.1%, respectively) were with a garlic isolate from Taiwan (Table
2).
For OYDV, isolates OYDV-VN/L4 and –VN/L5 shared 86.7% identity, and showed
between 79.8-90.4% identity with other reported OYDV isolates. The highest identities
(90.4 and 89.2%, respectively) were with two garlic isolates from China (Table 2).
Turnip mosaic virus (TuMV)
Five TuMV isolates were identified; two from Chinese radish (TuMV-VN/Rs1 and –
VN/Rs2) and three from Chinese mustard (-VN/Bj1, -VN/Bj2 and –VN/Bj3) (Table 2).
When compared to each other, the sequences showed between 94.2-97.6% identity.
Interestingly, these isolates showed higher identities to East Asian TuMV isolates than
233
to each other. Isolates, TuMV-VN/Rs1, -VN/Bj1 and –VN/Bj3, had highest identities
(98.4, 97.7 and 98.4%, respectively) with the cabbage TuMV-TU3 isolate from Japan
(Table 2). Similarly, the TuMV-VN/Rs2 and –VN/Bj2 isolates shared highest identities
with a Chinese cabbage isolate from Korea and a radish isolate from Taiwan (98.1 and
98.6%, respectively) (Table 2). In phylogenetic analysis (not shown), all Vietnamese
isolates grouped with the East Asian isolates.
Dasheen mosaic virus (DsMV)
Three DsMV isolates were isolated; two from taro (DsMV-VN/Ce1 and –VN/Ce2) and
one (-VN/Tt1) from typhonia (Typhonium trilobatum), a medicinal herb (Table 2). The
sequence identities between all three isolates were low, ranging from 68.1-74.1%.
Similarly, when the sequences of DsMV–VN/Ce1 and –VN/Tt1 were compared with
other reported isolates, the highest identities were only 79% and 77.6%, respectively
(Table 2). In the case of DsMV–VN/Ce2, the most closely related virus was a Japanese
DsMV taro isolate (90.7% identity) (Table 2).
The size of the CP-coding region in the three Vietnamese DsMV isolates varied
considerably, comprising 1008 nucleotides (336 amino acids) for DsMV–VN/Ce1, 939
nucleotides (313 amino acids) for DsMV–VN/Ce2 and 855 nucleotides (283 amino
acids) for DsMV–VN/Tt1. Analysis of these CP sequences revealed that the N-terminal
region, located between the DAG motif and the conserved sequence, KDVNA, was
234
highly variable and contained repeated motifs comprising uncharged amino acids, such
as G, T, P and N.
Sweet potato feathery mottle virus (SPFMV)
Two SPFMV sequences were isolated from symptomatic sweet potato plants, and were
designated SPFMV-VN/SP1 and -VN/SP2 (Table 2). The sequences of the two isolates
shared 94.8% identity. When compared with the other sequences, SPFMV-VN/SP1 had
highest identity (96.2%) with a SPFMV isolate from Portugal, whereas SPFMV–
VN/SP2 had highest identity (96.1%) with an isolate from Uganda.
A phylogenetic tree, constructed using 69 available SPFMV CP nucleotide
sequences, showed that SPFMV isolates were grouped into four distinct clusters
corresponding to the four SPFMV strains, namely RC (russet crack), C (common), EA
(East Africa) and O (result not shown). The two Vietnamese isolates grouped within the
EA cluster; this cluster was unusual in that, of the 33 SPFMV sequences, 31 originated
from African countries while the remaining two were from Portugal and Spain.
Discussion
With the exception of BCMV and PVY, which have been previously reported in
Vietnam, this is the first report of SCMV, SrMV, ChiVMV, ZYMV, LYMV, SYSV,
OYDV, TuMV, DsMV and SPFMV in Vietnam. Further, a novel potyvirus associated
235
with distinctive ringspot symptoms was identified in chilli plants and designated
ChiRSV.
Two isolates of the PStV strain of BCMV, infecting soybean and rabbit bell, were
reported in Vietnam for the first time. Although PStV is considered a peanut-infecting
strain of BCMV [21], it has also often been found infecting other legumes, particularly
soybean [33]. The identification of rabbit bell (Crotalaria anagyroides) as a natural host
of PStV indicates the virus has a wider natural host range than previously known. Two
isolates of BCMV, isolated from black bean and yard-long bean (BCMV-VN/BB2-5 and
-YB2, respectively), showed surprisingly high variability in the CP gene. Both isolates
shared low sequence identities with other BCMV isolates, and their N-terminal regions
did not contain the three epitopes, B/3 (QPQPPI), B3A (GVES) and B/4
(VV/LDAGV/ADTV), which are specific for the BlCMV, PStV and many other strains
of BCMV [20]. These isolates also formed a distinct phylogenetic cluster that was
intermediate between the major BCMV cluster and that comprising other viruses of the
“BCMV subgroup”. The complete sequences of these isolates will be required to further
clarify their relationships with other BCMV isolates.
The SCMV isolates from Vietnam were extremely diverse. Interestingly, the SCMV-
VN/AR1 isolated from arrowroot was distinct from the SCMV-Abaca strain that
naturally infects arrowroot in the Philippines [13]. Within the diverse Cluster I of the
SCMV phylogenetic tree, several sub-clusters have been defined based on hosts or
geographical origins [9, 14]. The three Vietnamese isolates, SCMV-VN/M1, –VN/M2
236
and –VN/SC1, together with the isolates from Thailand, formed such a sub-cluster
which was closely related to isolates infecting sugarcane and maize from Thailand.
Phylogenetic analyses also showed that three sugarcane isolates, SCMV-VN/SC2, -
VN/SC3 and –VN/SC4, comprised a distinct cluster, Cluster IV. The basal position of
this cluster and their highly divergent CP sequences suggested that these three isolates
may have evolved from a common ancestor.
PVY, and many other potyviruses that currently infect solanaceous plants, are
thought to have originated from Peru [28]. Although the exact origin of PVY in Vietnam
is unknown, it is thought that the virus was introduced into Vietnam, probably from
infected potato originating from Europe, sometime in the 19th century. The presence of
three different phylogenetic lineages of PVY in Vietnam, however, indicates that this
might not be the case and that the introduction of the virus into Vietnam might have
arisen from both potato and non-potato sources.
Phylogenetic analysis showed that the ZYMV isolates in Vietnam were very diverse.
Surprisingly, none of the Vietnamese isolates grouped in Cluster I which comprised
ZYMV isolates distributed worldwide and is equivalent to the “Group A” ZYMV
isolates described by Desbiez et al. [10] or Group I and II ZYMV isolates described by
Zhao et al. [34]. ZYMV-VN/Cm3 grouped with two ZYMV isolates from Singapore and
Reunion Island to form Cluster II which was considered “Group B” by Desbiez et al.
[10] or “Out group” by Zhao et al. [34]. The four Vietnamese isolates (ZYMV-VN/Bh1,
ZYMV-VN/Cs1, -VN/Cm1 and –VN/Cm2), together with six Chinese isolates, formed
237
Cluster III, which was equivalent to the Group III by Zhao et al. [34] and clearly distal
and basal to all other clusters.
Although this is the first report of TuMV from brassica plants in Vietnam, the virus
has been previously reported infecting calla lily bulbs imported into Taiwan from
Vietnam [7]. In phylogenetic analysis, all Vietnamese TuMV isolates grouped with East
Asian isolates within the cluster equivalent to the World-B group defined by Tomimura
et al. [32]. The World-B group includes most of the TuMV isolates isolated from
brassica plants. This group appeared to be split into 2 sub-populations, one from West
Eurasia and other continents, which included B type (infect only Brassica plants)
isolates, and another from East Asia (China, Korea and Japan) which contained both B
and BR type (infect both Brassica and Raphanus plants) isolates [22, 29, 31, 32].
This study identified typhonia (Typhonium trilobatum) as a new natural host of
DsMV. Further, consistent with previous studies [8, 12, 23, 26], sequence analyses
revealed that the CP sequences of the DsMV isolates from Vietnam were highly variable
and contained repeated motifs in the N-terminal region.
In conclusion, we have identified many new potyviruses in Vietnam, infecting a
broad range of plant species. The high degree of sequence diversity and the basal
position of many of the viral sequences in phylogenetic trees, suggests that potyviruses
have been present in Vietnam for a considerable period.
238
Acknowledgements
The authors thank the Australian Centre for International Agricultural Research
(ACIAR) for funding this research. HC was supported by a QUT International
Postgraduate Research Scholarship.
References
1. Adams MJ, Antoniw JF, Beaudoin F (2005) Overview and analysis of the
polyprotein cleavage sites in the family Potyviridae. Mol Plant Pathol 6: 471-487
2. Adams MJ, Antoniw JF, Fauquet CM (2005) Molecular criteria for genus and
species discrimination within the family Potyviridae. Arch Virol 150: 459-479
3. Bateson MF, Henderson J, Chaleeprom W, Gibbs AJ, Dale JL (1994) Papaya
ringspot potyvirus - isolate variability and the origin of PRSV type-P (Australia).
J Gen Virol 75: 3547-3553
4. Bateson MF, Lines RE, Revill P, Chaleeprom W, Ha CV, Gibbs AJ, Dale JL
(2002) On the evolution and molecular epidemiology of the potyvirus Papaya
ringspot virus. J Gen Virol 83: 2575-2585
5. Bell KE, Dale JL, Ha CV, Vu MT, Revill PA (2002) Characterisation of Rep-
encoding components associated with Banana bunchy top nanovirus in Vietnam.
Arch Virol 147: 695-707
239
6. Berger PH, Adams MJ, Barnett OW, Brunt AA, Hammond J, Hill JH, Jordan
RL, Kashiwazaki S, Rybicki E, Spence N, Stenger DC, Ohki ST, Uyeda I, van
Jaayen A, Valkonen J, Vetten HJ (2005) Potyviridae. In: Fauquet CM, Mayo
MA, Maniloff J, Desselberger U and Ball LA (eds) Virus Taxonomy. VIIIth
Report of the International Committee on Taxonomy of Viruses.
Elsevier/Academic Press, London
7. Chen CC, Chao CH, Yeh SD, Tsai HT, Chang CA (2003) Identification of
Turnip mosaic virus isolates causing yellow stripe and spot on calla lily. Plant
Dis 87: 901-905
8. Chen J, Chen JP, Chen JS, Adams MJ (2001) Molecular characterisation of an
isolate of Dasheen mosaic virus from Zantedeschia aethiopica in China and
comparisons in the genus Potyvirus. Arch Virol 146: 1821-1829
9. Chen J, Chen JP, Adams MJ (2002) Characterisation of potyviruses from
sugarcane and maize in China. Arch Virol 147: 1237-1246
10. Desbiez C, Wipf-Scheibel C, Lecoq H (2002) Biological and serological
variability, evolution and molecular epidemiology of Zucchini yellow mosaic
virus (ZYMV, Potyvirus) with special reference to Caribbean islands. Virus Res
85: 5-16
11. Fanigliulo A, Comes S, Pacella R, Harrach B, Martin DP, Crescenzi A (2005)
Characterisation of Potato virus Y nnp strain inducing veinal necrosis in pepper:
a naturally occurring recombinant strain of PVY. Arch Virol 150: 709-720
240
12. Farreyrol K, Pearson MN, Grisoni M, Cohen D, Beck D (2006) Vanilla mosaic
virus isolates from French Polynesia and the Cook Islands are Dasheen mosaic
virus strains that exclusively infect vanilla. Arch Virol 151: 905-919
13. Gambley CF, Thomas JE, Magnaye LV, Herradura L (2004) Abaca mosaic
virus: a distinct strain of Sugarcane mosaic virus. Australas Plant Pathol 33: 475-
484
14. Gemechu AL, Chiemsombat P, Attathom S, Reanwarakorn K, Lersrutaiyotin R
(2006) Cloning and sequence analysis of coat protein gene for characterization of
Sugarcane mosaic virus isolated from sugarcane and maize in Thailand. Arch
Virol 151: 167-172
15. Gibbs AJ, Mackenzie AM, Gibbs MJ (2003) The 'potyvirid primers' will
probably provide phylogenetically informative DNA fragments from all species
of Potyviridae. J Virol Methods 112: 41-44
16. Ha C, Coombs S, Revill P, Harding R, Vu M, Dale J (2006) Corchorus yellow
vein virus, a New World geminivirus from the Old World. J Gen Virol 87: 997-
1003
17. Hao NB, Albrechtsen SE, Nicolaisen M (2003) Detection and identification of
the blackeye cowpea mosaic strain of Bean common mosaic virus in seeds of
Vigna unguiculata sspp. from North Vietnam. Australas Plant Pathol 32: 505-
509
241
18. Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for molecular
evolutionary genetics analysis and sequence alignment. Brief Bioinform 5: 150-
163
19. Mackenzie AM, Nolan M, Wei KJ, Clements MA, Gowanlock D, Wallace BJ,
Gibbs AJ (1998) Ceratobium mosaic potyvirus: another virus from orchids. Arch
Virol 143: 903-914
20. Mink GI, Vetten HJ, Wyatt SD, Berger PH, Silbernagel MJ (1999) Three
epitopes located on the coat protein amino terminus of viruses in the bean
common mosaic potyvirus subgroup. Arch Virol 144: 1173-1189
21. Mishra A, Gohel VR, Valand GB, Patel JG, Shukla DD (1993) Peanut stripe
virus-disease of groundnut - a review. Int J Pest Manag 39: 210-215
22. Ohshima K, Yamaguchi Y, Hirota R, Hamamoto T, Tomimura K, Tan ZY, Sano
T, Azuhata F, Walsh JA, Fletcher J, Chen JS, Gera A, Gibbs A (2002) Molecular
evolution of Turnip mosaic virus: evidence of host adaptation, genetic
recombination and geographical spread. J Gen Virol 83: 1511-1521
23. Pappu S, Pappu H, Rybicki E, Niblett C (1994) Unusual amino-terminal
sequence repeat characterizes the capsid protein of Dasheen mosaic potyvirus. J
Gen Virol 75: 239-242
24. Revill PA, Ha CV, Lines RE, Bell KE, Vu MT, Dale JL (2004) PCR and ELISA-
based virus surveys of banana, papaya and cucurbit crops in Vietnam. Asia Pac J
Mol Biol Biotechnol 12: 27-32
242
25. Rodoni BC, Dale JL, Harding RM (1999) Characterization and expression of the
coat protein-coding region of Banana bract mosaic potyvirus, development of
diagnostic assays and detection of the virus in banana plants from five countries
in southeast Asia. Arch Virol 144: 1725-1737
26. Shi YH, Hong XY, Chen J, Adams MJ, Zheng HY, Lin L, Qin BX, Chen JP
(2005) Further molecular characterisation of potyviruses infecting aroid plants
for medicinal use in China. Arch Virol 150: 125-135
27. Shukla DD, Ward CW, Brunt AA, Berger PH (1998) Potyviridae family. AAB
Descriptions of Plant Viruses No. 366
28. Spetz C, Taboada AM, Darwich S, Ramsell J, Salazar LF, Valkonen JPT (2003)
Molecular resolution of a complex of potyviruses infecting solanaceous crops at
the centre of origin in Peru. J Gen Virol 84: 2565-2578
29. Tan ZY, Wada Y, Chen JS, Ohshima K (2004) Inter- and intralineage
recombinants are common in natural populations of Turnip mosaic virus. J Gen
Virol 85: 2683-2696
30. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The
CLUSTAL_X windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882
31. Tomimura K, Gibbs AJ, Jenner CE, Walsh JA, Ohshima K (2003) The
phylogeny of Turnip mosaic virus; comparisons of 38 genomic sequences reveal
a Eurasian origin and a recent 'emergence' in East Asia. Mol Ecol 12: 2099-2111
243
32. Tomimura K, Spak J, Katis N, Jenner CE, Walsh JA, Gibbs AJ, Ohshima K
(2004) Comparisons of the genetic structure of populations of Turnip mosaic
virus in West and East Eurasia. Virology 330: 408-423
33. Vetten HJ, Green SK, Lesemann DE (1992) Characterization of Peanut stripe
virus isolates from soybean in Taiwan. J Phytopathol 135: 107-124
34. Zhao MF, Chen J, Zheng HY, Adams MJ, Chen JP (2003) Molecular analysis of
Zucchini yellow mosaic virus isolates from Hangzhou, China. J Phytopathol 151:
307-311
244
CHAPTER 7
GENERAL DISCUSSION AND CONCLUSIONS
245
SPECIFICITY OF DEGENERATE PRIMERS
Degenerate primers to detect begomoviruses The number of complete geminiviruses sequences in databases, particularly of
viruses in the genus Begomovirus has increased dramatically over the past five years
(389 DNA-A sequences by 2005) (Fauquet and Stanley, 2005). This increase in
genomic sequences has provided an opportunity to design effective degenerate
primers for use in geminivirus-specific PCR-based diagnostic tests. Despite the
analysis of all available geminivirus sequences in this study, universal geminivirus-
specific primers could not be designed due to a lack of suitably sized, highly
conserved sequences. Degenerate primers were designed, however, to specifically
detect the DNA-A and DNA-B components of viruses in the genus Begomovirus. For
the detection of DNA-A, primer BegoAFor1 was designed to the CEGPCKVQS
motif located at the N-end of the CP C-terminal region. This region of the CP gene
was highly conserved in all begomoviruses, irrespective of whether they were from
the Old or New Worlds. The second primer, BegoARev1, was designed to the highly
conserved IPT/A/SIF/VLCNP motif which is about 70 amino acids downstream of
the putative P loop sequence in the Rep C-terminal region (Laufs et al., 1995). When
used in PCR, this primer pair amplified a product of approximately 1.2 kb product
which encompassed over two thirds of the CP gene, the entire REn gene and one
third of the Rep gene of DNA-A. Sequence analysis of the amplicons generated with
these primers also assisted in the discrimination between new and previously
characterised begomoviruses; using known begomovirus-infected samples, the
nucleotide sequence of the BegoAFor1/BegoARev1-derived amplicon, in most cases,
correlated well with that of the complete published sequence. Using these primers,
we were able to detect and characterise a large number of begomoviruses from
246
Vietnam. Interestingly, two of them, CoYVV and CoGMV, were more similar to the
New World viruses than previously characterised viruses from the Old World
(discussed later).
To detect begomovirus DNA-B, primer BegoBFor was designed to the
QVPI/F/VNAxG motif which is involved in infectivity and whose N residue is a
potential glycosylation site (Ingham et al., 1995). This motif is located at the N-
terminal region of the MP and is approximately 700 bp from the nicking site in the
stem-loop. Initial attempts using BegoBFor in combination with a consensus primer
designed on the invariable loop sequences of the stem-loop structure were
unsuccessful, probably due to the high content of C and G residues in the stem
sequences. However, when BegoBFor was used in combination with a new, specific
primer designed on the iteron sequences in the CR, amplicons of the expected size
were obtained from DNA-B of three bipartite begomoviruses (CoGMV, KuMV and
ClGMV). The use of primers designed from the iteron sequences is preferred as the
iteron sequences are identical in both DNA components even in bipartite viruses
exhibiting substantial differences in the CR sequences such as ToLCGV, CoYVV,
CaLCV and CLCrV (Chakraborty et al., 2003; Ha et al., 2006; Hill et al., 1998; Idris
and Brown, 2004).
Degenerate primers to detect potyviruses The conserved sequences previously used to design degenerate primers for potyvirus
detection are mainly located in the 3’ region (NIb and CP-coding regions, and 3’
UTR) of potyvirus genomes. In the NIb-coding region, the consensus motif
(GNNSGQPSTVVDN) was shown to be highly conserved among members of the
family Potyviridae (Gibbs et al., 2003), and the use of degenerate primers designed
247
from this motif have been demonstrated for numerous potyviruses (Chen and Adams,
2001; Gibbs and Mackenzie, 1997). In this study, degenerate primers were designed
to sequences of the GQPSTVV (NIbFor1) and NSGQPSTVV (NIbFor2) motifs and
these were used as diagnostic primers to detect numerous viruses in the genus
Potyvirus. To amplify additional 3’ sequences, primer PV2IT7 primer (Mackenzie et
al., 1998) and a dT primer were normally used. In many instances, however, no
amplicons were obtained using this primer combination, probably due to a low
concentration of viral RNA. To overcome this problem, diluted products from the
initial PCR were used in a second round of amplification, using primer NIbFor2 in
combination with a 3’ end specific primer; in most cases, a single, strong band was
generated.
Due to the large genome size, the complete sequences of members of the family
Potyviridae have usually been obtained from overlapping PCR fragments. In this
study, two alternative sets of degenerate primers, HPFor/HPRev and CIFor/CIRev,
were developed to amplify genomic sequences in the 5’ (HC-Pro) and central (CI)
regions, respectively, of the potyvirus genome. These primers specifically detected
members of the genus Potyvirus and their use offered several advantages over
existing methods. Arguably, the major advantage of these primers lies in their ability
to amplify sequences in the central and 5’ regions of the potyviral genome. The
distance from the HPFor/HPRev-derived sequence to the 5’ end of the genome is
approximately 2 kb, which, as demonstrated in this study, can be obtained by a
RACE protocol. From the observation that the 5’ ends of potyvirus genomes are
terminated in few (usually 2 – 4) adenosine residues, the specificity and yield of 5’
RACE was also improved by using a dT primer terminated by two A’s
248
(Anchor17T2A). The combination of the newly developed primers with currently
available primers to amplify the 3’ genome sequences will facilitate the cloning,
sequencing and characterisation of complete potyvirus genomes. Indeed, the utility
of this strategy was clearly demonstrated by the sequencing and characterisation of
the complete genomes of four potyviruses, TelMV, PeLMV, WTMV and BBrMV.
Finally, the use of the CIFor and CIRev primers may also have utility from a
taxonomic perspective, since overall sequence identities in potyviruses are most
accurately reflected in the CI gene (Adams et al., 2005a). As such, the sequence of
the CIFor/CIRev-derived amplicons may provide sufficient genetic information to
allow the differentiation of potyviruses at the species level. In support of this
statement, the three new viruses identified in this study were initially predicted from
the sequences of their CIFor/CIRev-derived amplicons.
SIGNIFICANCE OF THE IDENTIFICATION OF TWO BIPARTITE
BEGOMOVIRUSES INFECTING JUTE PLANTS IN VIETNAM
Two bipartite viruses, CoYVV and CoGMV, were isolated from jute in Vietnam and
were shown to be related, but distinct, begomoviruses using sequence and
phylogenetic analyses. This distinction was based on the low sequence identities in
both DNA-A and –B between the two viruses (71.3% and 50.9%, respectively), the
different sequence and arrangement of their iterons and iteron-related domains (IRD)
and the lack of evidence for any recombination events involving the two viruses.
249
In addition to their high sequence similarity and close phylogenetic relationships, the
genomes of both CoGMV and CoYVV, and other New World viruses, shared several
common features including; (i) they were bipartite, (ii) their CP N-terminal region
contained a conserved motif, 7-PWRsMaGT, but lacked the second and third basic
domains which form an essential part of the nuclear localization signal (NLS) whose
role in nuclear targeting has been demonstrated for the Old World viruses, TYLCV
(Kunik et al., 1998), ACMV (Unseld et al., 2001) and MYMV (Guerra-Peraza et al.,
2005) and (iii) they lacked an AV2 gene which plays a role in symptom
development, efficient viral movement and viral DNA accumulation (Padidam et al.,
1996; Rigden et al., 1993).
Bipartite viruses are thought to have evolved from monopartite viruses by gene
duplication and/or DNA acquisition, with gene products encoded on DNA-B
providing enhanced viral movement within the host (Mansoor et al., 2003; Rojas et
al., 2005). The evolution of bipartite viruses was also thought to have occurred
before continental separation since bipartite viruses are found in both of the Old
World and New World (Rojas et al., 2005). All New World viruses lack the AV2
ORF, and it was proposed that they evolved from a common ancestor that had lost
the AV2 ORF after the Gondwana continental separation (Rybicki, 1994). However,
the presence of both CoYVV and CoGMV in Vietnam bearing features similar to
New World viruses suggests that viruses with characteristics of New World viruses
were present in the Old World prior to continental separation.
250
The presence of putatively New World viruses such as CoYVV and CoGMV in
Vietnam raises the question about the mechanism(s) by which bipartite viruses
evolved into distinct Old World and New World populations. It is possible that this
process involves the genomic sequences encoding the AV2 ORF and CP N-terminal
region. Harrison et al. (2002) and Sharma et al. (2005) observed the apparent
variability in the N-terminal 50 residues from 27 and 10 CP sequences, respectively,
of viruses originating from different continents. In the current study, comparison of
the deduced CP sequences from a large number of the New World and Old World
viruses showed that their CPs were clearly divided into distinct N-terminal and C-
terminal regions. The C-terminal region was conserved in all begomoviruses,
irrespective of whether they were from the Old or New Worlds, supporting the
hypothesis that New World viruses emerged more recently (Rybicki, 1994). In
contrast, the N-terminal region, which consisted of ~39 amino acids for the New
World viruses and ~45 amino acids for the Old World viruses, was relatively
conserved within the two groups but differed markedly between them. The AV2 gene
(~115 amino acids) overlaps the CP gene by approximately 60 amino acids, and thus
encompasses the entire CP N-terminal region, suggesting that a change in this region,
would affect the function of both the AV2 and CP genes. Both CoYVV and
CoGMV lack these sequences suggesting that they, and their progenitors, required
these functions to be encoded on an additional DNA molecule, namely DNA-B. This
may explain (i) why all New World viruses have a bipartite genome and (ii) why the
DNA-B of some Old World bipartite viruses, such as TYLCTHV (Rochester et al.,
1990) or Sri Lankan cassava mosaic virus (SLCMV) (Saunders et al., 2002), are
dispensable for disease induction.
251
Phylogenetic analysis based on complete begomovirus genome sequences revealed
two geographically defined major clusters (the Old World and New World viruses)
and three other distinct clusters distinguished on the basis of the host (legume, sweet
potato and jute). The intermediate positions of the sweet potato and jute viruses
between the Old World and New World populations suggested that the geographical
separation appears to play a less important role than previously thought in the
evolution of the genus Begomovirus.
Based on above analyses, an evolutionary model of the genus Begomovirus is
proposed (Fig. 8.1) to explain the speciation of the New World bipartite virus
population. If correct, it is possible that other begomoviruses, similar to the New
World viruses, will be found in the Old World.
A HIGH DEGREE OF BEGOMOVIRUS AND SATELLITE DIVERSITY
WAS IDENTIFIED IN VIETNAM
Using novel degenerate primers, we identified 17 begomovirus species infecting crop
and weed species from Vietnam including CoYVV and CoGMV. Analyses based on
the complete nucleotide sequences revealed that ten of the viruses (six monopartite
and four bipartite) were new species. Of seven previously characterised viruses, five
were identified in Vietnam for the first time. Eight DNA-β and three nanovirus-like
DNA-1 molecules were also found associated with the monopartite viruses; five of
the DNA-β molecules were putatively novel.
252
DNA-B DNA-β
DNA-1
DNA-B
DNA-A
DNA-B DNA-B
DNA-A DNA-A
Gondwana separation?
Ancestral bipartite viruses
New World
Monopartite viruses
Monopartite virus, DNA-β and DNA-1
complexes
Ancestral monopartite
viruses
Old World bipartite viruses
Recombination or mutation in
the overlapping region of the AV2 and CP
genes
Ancestral New World bipartite virus
CoYVV CoGMV
New World bipartite viruses
Old World
Origin: Component and
gene duplication/ acquisition
Origin: Unknown
Origin: Nanovirus
Origin: Ancient extrachromosomal
ssDNA replicons in prokaryotic or primitive
eukaryotic ancestors
DNA-A
DNA-B
DNA-A
DNA-A DNA-A DNA-A
Figure 8.1. An evolutionary model of the genus Begomovirus. The model is based on that proposed
by Mansoor et al. (2003) and Rojas et al. (2005), and on the findings from this study. The
evolutionary pathway of New World bipartite viruses is based on comparisons of the AV2 and CP
genes.
253
254
Ten begomoviruses identified in this study infect many different weed species.
Weeds can serve as reservoirs for crop-infecting geminiviruses (Gilbertson et al.,
1993; Stonor et al., 2003) and it has been proposed that weed-infecting
begomoviruses can adapt to infect crops via recombination during mixed infections
(Hofer et al., 1997; Padidam et al., 1999; Roye et al., 1999). The significant
similarities in replication-related genomic features (the iterons, IRD motif and Rep
protein) observed between distinct viruses such as ErYMV/TYLCCNV,
LuYVVNV/ToLCLV and TYLCVNV/AYVV, suggested that they can replicate in a
trans-acting manner similar to that previously reported (Fontes et al., 1994a; Fontes
et al., 1994b; Jupin et al., 1995); this may facilitate gene exchanges between them,
during mixed infections, via recombination-dependent replication (RDP) (Jeske et
al., 2001). Indeed, computer programs detected recombination events between
SiLCV-[Tha:Abu:61] and StaLCuV, ErYMV and TYLCCNV, and between
TYLCVNV and ToLCVV; in the latter case, the non-ToLCVV part of TYLCVNV
probably originated from an AYVV-like virus.
One interesting finding from this study was the nonanucleotide sequence of CoGMV
comprising TATTATTAC rather than TAATATTAC. Although the third residue of
this sequence seems to be relaxed among nanoviruses (TAT/GTATTAC) and animal
circoviruses (T/C/AAT/GTATTAC) (Hattermann et al., 2003), this was the first
report of such variation in geminiviruses. This study also provided the first report of
differences in the stem sequences between two components of a bipartite
begomovirus (KuMV). This was unexpected because the sequence of this structure
has been found to be almost identical between the two genomic components of
255
geminiviruses, even in those exhibiting low identities in the CR sequences
(Chakraborty et al., 2003; Ha et al., 2006; Hill et al., 1998; Idris and Brown, 2004).
However, since it is the ability to form a stem-loop structure, and not the sequence of
the stem itself, that is important for DNA replication (Orozco and Hanley-Bowdoin,
1996), the differences in the putative stem sequences of KuMV should not affect
replication.
The high degree of both bipartite and monopartite begomoviruses and satellite
diversity, identified from a wide range of plants, suggested that Vietnam is probably
a centre of origin for begomovirus evolution.
A HIGH DEGREE OF POTYVIRUS DIVERSITY WAS IDENTIFIED IN
VIETNAM
Four new, and 12 previously characterised, potyviruses were identified in a range of
crops and weeds in Vietnam. With the exception of BCMV (BlCMV strain) and
PVY (Hao et al., 2003; Vu, 1984), the remaining viruses were detected in Vietnam
for the first time.
The complete genomes of three novel potyviruses, TelMV, PeLMV and WTMV
infecting telosma, peace lily and wild tomato, respectively, were sequenced. The
complete genome of a Philippines isolate of BBrMV, a characterised potyvirus
infecting banana in the Southeast Asian region (Rodoni et al., 1999), was also
obtained for the first time. All four viruses possessed genomic features typical of the
256
genus Potyvirus. The sequence comparisons and phylogenetic analyses indicated that
WTMV was most closely related to ChiVMV and PVMV, two potyviruses infecting
solanaceous crops, while PeLMV, TelMV and BBrMV were related to members of
the BCMV subgroup which includes several different viruses infecting both monocot
and dicot, legume and non-legume plants (Berger et al., 1997).
Using degenerate CI primers, 13 potyviruses were detected in a broad range of crops
showing typical virus symptoms. The identity of these viruses was subsequently
determined by sequencing. To date, the CP-coding region of potyviruses has been
mainly used to establish evolutionary relationships at both species and strain levels
(Shukla and Ward, 1989; Ward et al., 1992; Ward and Shukla, 1991) primarily
because the majority of potyvirus sequences on databases are derived from this
region (Adams et al., 2005b). Therefore, the NIb-3’ end genomic region (which
includes the entire CP) of the 13 potyviruses detected in this study was amplified,
cloned and sequenced. Interestingly, using degenerate primers specific for the NIb-
coding region, a fourth novel potyvirus, ChiRSV, was detected in a chilli sample
with ringspot symptoms.
Previously undescribed natural hosts of the PStV strain of BCMV (PStV-VN/Ca1)
and DsMV (DsMV-VN/Tt1) were also identified. Rabbit bell (Crotalaria
anagyroides), a fabaceous cover crop in coffee plantations, was found to be another
fabaceous host for the PStV strain of BCMV, having been previously reported from
peanut and soybean (Vetten et al., 1992; this study). Typhonia (Typhonium
trilobatum), a medicine herb, was found to be a new host for DsMV.
257
Sequence and phylogenetic analyses based on the complete CP gene revealed
considerable variability in many species within Vietnam. The species with
unexpected variability in the CP gene were BCMV, SCMV, PVY and ZYMV. The
phylogenetic evidence also suggested the presence of the ancestral groups of BCMV,
SCMV and ZYMV in Vietnam.
IMPACT OF THESE STUDIES ON PLANT QUARANTINE IN VIETNAM
At the commencement of this project, only 13 plant viruses had been identified in
Vietnam by either ELISA or sequencing. Currently, the list of quarantine plant
viruses in Vietnam is restricted to Rice hoja blanca virus (RHBV), Peanut stripe
virus (PStV) strain of BCMV and Coffee ringspot virus (CoRSV) (Ministry of
Agriculture and Rural Development of Vietnam, 2005). The large number of
potyviruses and begomoviruses identified in Vietnam in this study will provide
valuable information to establish a plant virus list that will be useful for conducting a
pest risk analysis (PRA) (FAO, 1996) relating to the movement of plant material
imported into, and exported from, Vietnam.
258
REFERENCES
Adams, M. J., Antoniw, J. F., and Beaudoin, F. (2005a). Overview and analysis of
the polyprotein cleavage sites in the family Potyviridae. Molecular Plant
Pathology 6, 471-487.
Adams, M. J., Antoniw, J. F., and Fauquet, C. M. (2005b). Molecular criteria for
genus and species discrimination within the family Potyviridae. Archives of
Virology 150, 459-479.
Berger, P. H., Wyatt, S. D., Shiel, P. J., Silbernagel, M. J., Druffel, K., and Mink, G.
I. (1997). Phylogenetic analysis of the Potyviridae with emphasis on legume-
infecting potyviruses. Archives of Virology 142, 1979-1999.
Chakraborty, S., Pandey, P. K., Banerjee, M. K., Kalloo, G., and Fauquet, C. M.
(2003). Tomato leaf curl gujarat virus, a new begomovirus species causing a
severe leaf curl disease of tomato in Varanasi, India. Phytopathology 93,
1485-1495.
Chen, J., and Adams, M. J. (2001). A universal PCR primer to detect members of the
Potyviridae and its use to examine the taxonomic status of several members
of the family. Archives of Virology 146, 757-766.
FAO (1996). Guidelines for Pest Risk Analysis. International Standards for
Phytosanytary Measures (ISPM). Pub. No. 2. FAO. Rome
Fauquet, C. M., and Stanley, J. (2005). Revising the way we conceive and name
viruses below the species level: A review of geminivirus taxonomy calls for
new standardized isolate descriptors. Archives of Virology 150, 2151-2179.
259
Fontes, E., Eagle, P., Sipe, P., Luckow, V., and Hanley-Bowdoin, L. (1994a).
Interaction between a geminivirus replication protein and origin DNA is
essential for viral replication. Journal of Biological Chemistry 269, 8459-
8465.
Fontes, E., Gladfelter, H. J., Schaffer, R. L., Petty, I., and Hanley-Bowdoin, L.
(1994b). Geminivirus replication origins have a modular organization. Plant
Cell 6, 405-416.
Gibbs, A., and Mackenzie, A. (1997). A primer pair for amplifying part of the
genome of all potyvirids by RT-PCR. Journal of Virological Methods 63, 9-
16.
Gibbs, A. J., Mackenzie, A. M., and Gibbs, M. J. (2003). The 'potyvirid primers' will
probably provide phylogenetically informative DNA fragments from all
species of Potyviridae. J Virol Methods 112, 41-4.
Gilbertson, R. L., Hidayat, S. H., Paplomatas, E. J., Rojas, M. R., Hou, Y. M., and
Maxwell, D. P. (1993). Pseudorecombination between infectious cloned
DNA-components of tomato mottle and bean dwarf mosaic geminiviruses.
Journal of General Virology 74, 23-31.
Guerra-Peraza, O., Kirk, D., Seltzer, V., Veluthambi, K., Schmit, A. C., Hohn, T.,
and Herzog, E. (2005). Coat proteins of Rice tungro bacilliform virus and
Mungbean yellow mosaic virus contain multiple nuclear-localization signals
and interact with importin α. Journal of General Virology 86, 1815-1826.
Ha, C., Coombs, S., Revill, P., Harding, R., Vu, M., and Dale, J. (2006). Corchorus
yellow vein virus, a New World geminivirus from the Old World. Journal of
General Virology 87, 997-1003.
260
Hao, N. B., Albrechtsen, S. E., and Nicolaisen, M. (2003). Detection and
identification of the blackeye cowpea mosaic strain of Bean common mosaic
virus in seeds of Vigna unguiculata sspp. from North Vietnam. Australasian
Plant Pathology 32, 505-509.
Harrison, B. D., Swanson, M. M., and Fargette, D. (2002). Begomovirus coat
protein: serology, variation and functions. Physiological and Molecular Plant
Pathology 60, 257-271.
Hattermann, K., Schmitt, C., Soike, D., and Mankertz, A. (2003). Cloning and
sequencing of Duck circovirus (DuCV). Archives of Virology 148, 2471-
2480.
Hill, J. E., Strandberg, J. O., Hiebert, E., and Lazarowitz, S. G. (1998). Asymmetric
infectivity of pseudorecombinants of cabbage leaf curl virus and squash leaf
curl virus: Implications for bipartite geminivirus evolution and movement.
Virology 250, 283-292.
Hofer, P., Bedford, I. D., Markham, P. G., Jeske, H., and Frischmuth, T. (1997). Coat
protein gene replacement results in whitefly transmission of an insect
nontransmissible geminivirus isolate. Virology 236, 288-295.
Idris, A. M., and Brown, J. K. (2004). Cotton leaf crumple virus is a distinct western
hemisphere begomovirus species with complex evolutionary relationships
indicative of recombination and reassortment. Phytopathology 94, 1068-
1074.
Ingham, D. J., Pascal, E., and Lazarowitz, S. G. (1995). Both bipartite geminivirus
movement proteins define viral host range, but only BL1 determines viral
pathogenicity. Virology 207, 191-204.
261
Jeske, H., Lutgemeier, M., and Preiss, W. (2001). DNA forms indicate rolling circle
and recombination-dependent replication of Abutilon mosaic virus. EMBO
Journal 20, 6158-6167.
Jupin, I., Hericourt, F., Benz, B., and Gronenborn, B. (1995). DNA replication
specificity of TYLCV geminivirus is mediated by the amino-terminal 116
amino acids of the Rep protein. FEBS Letters 362, 116-120.
Kadare, G., and Haenni, A. L. (1997). Virus-encoded RNA helicases. Journal of
Virology 71, 2583-2590.
Kunik, T., Palanichelvam, K., Czosnek, H., Citovsky, V., and Gafni, Y. (1998).
Nuclear import of the capsid protein of tomato yellow leaf curl virus
(TYLCV) in plant and insect cells. Plant Journal 13, 393-399.
Laufs, J., Jupin, I., David, C., Schumacher, S., Heyraud-Nitschke, F., and
Gronenborn, B. (1995). Geminivirus replication: Genetic and biochemical
characterisation of Rep protein function, a review. Biochimie 77, 765-773.
Mackenzie, A. M., Nolan, M., Wei, K.-J., Clements, M. A., Gowanlock, D., Wallace,
B. J., and Gibbs, A. J. (1998). Ceratobium mosaic potyvirus: another virus
from orchids. Archives of Virology 143, 903-914.
Mansoor, S., Briddon, R. W., Zafar, Y., and Stanley, J. (2003). Geminivirus disease
complexes: an emerging threat. Trends in Plant Science 8, 128-134.
Ministry of Agriculture and Rural Development of Vietnam (2005). The list of plant
quarantine pests of Socialist Republic of Vietnam. Decision No:
73/2005/QÐ-BNN (in Vietnamese).
262
Orozco, B., and Hanley-Bowdoin, L. (1996). A DNA structure is required for
geminivirus replication origin function. Journal of Virology 70, 148-158.
Padidam, M., Beachy, R. N., and Fauquet, C. M. (1996). The role of AV2 ("precoat")
and coat protein in viral replication and movement in tomato leaf curl
geminivirus. Virology 224, 390-404.
Padidam, M., Sawyer, S., and Fauquet, C. M. (1999). Possible emergence of new
geminiviruses by frequent recombination. Virology 265, 218-225.
Rigden, J. E., Dry, I. B., Mullineaux, P. M., and Rezaian, M. A. (1993). Mutagenesis
of the virion-sense open reading frames of tomato leaf curl geminivirus.
Virology 193, 1001-1005.
Rochester, D. E., Kositratana, W., and Beachy, R. N. (1990). Systemic movement
and symptom production following agroinoculation with a single DNA of
tomato yellow leaf curl geminivirus (Thailand). Virology 178, 520-526.
Rodoni, B. C., Dale, J. L., and Harding, R. M. (1999). Characterisation and
expression of the coat protein-coding region of banana bract mosaic
potyvirus, development of diagnostic assays and detection of the virus in
banana plants from five countries in southeast Asia. Archives of Virology 144,
1725-1737.
Rojas, M. R., Hagen, C., Lucas, W. J., and Gilbertson, R. L. (2005). Exploiting
chinks in the plant's armor: Evolution and emergence of geminiviruses.
Annual Review of Phytopathology 43, 361-394.
Roye, Wernecke, McLaughlin, Nakhla, and Maxwell (1999). Tomato dwarf leaf curl
virus, a new bipartite geminivirus associated with tomatoes and peppers in
263
Jamaica and mixed infection with tomato yellow leaf curl virus. Plant
Pathology 48, 370-378.
Rybicki, E. P. (1994). A phylogenetic and evolutionary justification for 3 genera of
geminiviridae. Archives of Virology 139, 49-77.
Saunders, K., Salim, N., Mali, V. R., Malathi, V. G., Briddon, R., Markham, P. G.,
and Stanley, J. (2002). Characterisation of Sri Lankan cassava mosaic virus
and Indian cassava mosaic virus: Evidence for acquisition of a DNA B
component by a monopartite begomovirus. Virology 293, 63-74.
Sharma, P., Rishi, N., and Malathi, V. G. (2005). Molecular cloning of coat protein
gene of an Indian cotton leaf curl virus (CLCuV-HS2) isolate and its
phylogenetic relationship with others members of geminiviridae. Virus Genes
30, 85-91.
Shukla, D. D., and Ward, C. W. (1989). Identification and classification of
potyviruses on the basis of coat protein sequence data and serology. Brief
review. Archives of Virology 106, 171-200.
Stonor, J., Hart, P., Gunther, M., DeBarro, P., and Rezaian, M. A. (2003). Tomato
leaf curl geminivirus in Australia: occurrence, detection, sequence diversity
and host range. Plant Pathology 52, 379-388.
Unseld, S., Hohnle, M., Ringel, M., and Frischmuth, T. (2001). Subcellular targeting
of the coat protein of African cassava mosaic geminivirus. Virology 286, 373-
383.
Vetten, H. J., Green, S. K., and Lesemann, D. E. (1992). Characterisation of peanut
stripe virus isolates from soybean in Taiwan. Journal of Phytopathology 135,
107-124.
264
Vu, M. T. (1984). Study of the viruses infecting poatato in North Vietnam. PhD
thesis (in Vietnamese). Hanoi Agricultural University. Hanoi - Vietnam.
Ward, C. W., McKern, N. M., Frenkel, M. J., and Shukla, D. D. (1992). Sequence
data as the major criterion for potyvirus classification. Archives of Virology
(Suppl.) 5, 283-297.
Ward, C. W., and Shukla, D. D. (1991). Taxonomy of potyviruses: current problems
and some solutions. Intervirology 32, 269-296.
265