Dp

KM

ARRAA

KMISTV

1

a11llH

craw2micih

LT

s

0d

Journal of Virological Methods 182 (2012) 1– 8

Contents lists available at SciVerse ScienceDirect

Journal of Virological Methods

jou rn al h om epage: www.elsev ier .com/ locate / jv i romet

evelopment of an in vitro system to measure the sensitivity to the antiviral Mxrotein of fish viruses

atherine Lester, Malcolm Hall, Katy Urquhart, Suresh Gahlawat1, Bertrand Collet ∗

arine Scotland, Marine Laboratory, 375 Victoria Road, Aberdeen AB11 9DB, United Kingdom

rticle history:eceived 18 November 2011eceived in revised form 12 January 2012ccepted 16 January 2012vailable online 1 March 2012

a b s t r a c t

Mx is a structural protein, induced by type I interferon (IFN), with direct antiviral properties. In fishthe inherent contribution of Mx protein to viral protection is unknown. The transgenic Chinook salmonembryonic (CHSE)-TOF cell line was genetically modified to express the rainbow trout Mx (rbtMx1) pro-tein under the control of the tetracycline derivative, doxycycline (DOX). Two clones CHSE-TOF-MX8 andCHSE-TOF-MX10 were isolated and characterised by qPCR. The level of resistance to Infectious Pancreatic

eywords:x protein

nterferonalmonet-Offiral resistance

Necrosis Virus (IPNV), Salmon Alphavirus (SAV), Infectious Haematopoietic Necrosis Virus (IHNV) andEpizootic Haematopoietic Necrosis Virus (EHNV) of the CHSE-TOF, CHSE-TOF-MX8 and CHSE-TOF-MX10cell lines cultivated with and without DOX was measured. A novel method was established to measureaccurately the level of sensitivity of any given viral isolate to Mx protein. IPNV and SAV viruses werehighly sensitive to the presence of rbtMx1 in the cells whereas IHNV and EHNV showed partial resistancesuggesting contrasting viral evasion strategies between these categories of viruses.

. Introduction

Mx is an antiviral protein that was discovered initially as angent conferring protection to myxoviridae (Haller et al., 1979,980; Horisberger et al., 1980; Lindenmann, 1964; Staeheli et al.,986). In mice, disruption of the single Mx1 gene causes complete

oss of innate immunity against mouse-adapted influenza virus,eading to overwhelming infection and rapid death (Haller, 1981;aller et al., 1998).

The Mx gene is induced by type I interferon (IFN) the mainytokine regulating innate antiviral immune functions (see foreview, Arnheiter et al., 1990; Haller et al., 2007a,b). In fish, IFNctivity has been detected for decades and a gene encoding IFNas isolated for the first time in 2003 in zebrafish (Altmann et al.,

003). Before the discovery of the IFN genes, Mx was used as aarker of the presence of IFN by measurement of the induction of

ts gene. Mx is a member of dynamin superfamily of large GTPase

haracterised by a large molecular weight (75 kDa), and the abil-ty to self-assemble (Haller et al., 2007a,b; Lee and Vidal, 2002). Inumans, MxA was found to have antiviral activity against a wide

∗ Corresponding author at: Immunology and Infection, Marine Scotland, Marineaboratory, PO Box 101, 375 Victoria Road, Aberdeen AB11 9DB, United Kingdom.el.: +44 01224 425512; fax: +44 01224 295511.

E-mail address: Bertrand.Collet@scotland.gsi.gov.uk (B. Collet).1 Permanent address: Department of Biotechnology, Chaudhary Devi Lal Univer-

ity, Sirsa-125055, India.

166-0934/$ – see front matter. Crown Copyright © 2012 Published by Elsevier B.V. All rioi:10.1016/j.jviromet.2012.01.014

Crown Copyright © 2012 Published by Elsevier B.V. All rights reserved.

range of RNA viruses. It accumulates in the cytoplasm of IFN-treatedcells, associating partly with the endoplasmic reticulum. It inter-feres with the transport of the Bunyavirus nucleocapsid protein(N) to the Golgi apparatus where the virus assembles naturallyand also prevents the incoming Thogoto virus nucleocapsids frombeing transported into the nucleus, the site of viral transcriptionand replication (Kochs and Haller, 1999a,b). However, the contri-bution of the Mx protein to the general IFN-dependent protectionagainst viruses is not clear and very little is known on the inher-ent ability of teleost Mx protein to prevent viral replication. Theartificial over expression of Mx gene in mammalian and fish cellshas been shown to confer resistance to a wide range of viruses. Infish, over expression of the Mx gene has provided different levelsof resistance to Infectious Pancreatic Necrosis Virus (IPNV), Infec-tious Salmon Anaemia Virus (ISAV), and sole aquabirnavirus in theChinook salmon embryonic (CHSE) cell line (Larsen et al., 2004;Fernández-Trujillo et al., 2008; Kibenge et al., 2005), reovirus inrare minnow (Su et al., 2009), Hirame rhabdovirus (HIRRV) andViral Hemorrhagic Septicaemia Virus (VHSV) in the Hirame Natu-ral Embryo (HINAE) cell line (Caipang et al., 2003), Yellow GrouperNervous Necrosis Virus (YGNNV) in grouper brain 3 (GB3) cells(Lin et al., 2006), and nodavirus in grouper fin cells GF-1 (Chenet al., 2008). In contrast, it does not provide good protection againstInfectious Haematopoietic Necrosis Virus (IHNV) in CHSE cells

(Trobridge et al., 1997) or against iridovirus in a baramundi cell line,cBB (Wu and Chi, 2007). Silencing experiments have also demon-strated the involvement of Mx protein in protection against viralnervous necrosis (VNN), nodavirus and IPNV in cBB cells (Wu et al.,

ghts reserved.

2 K. Lester et al. / Journal of Virological Methods 182 (2012) 1– 8

Table 1Names and sequences of all primers used in this study.

Name Function Sequence 5′–3′ % efficiency

MX1F1

Amplification of the full length Mx ORF

GCAGTGGGCATCAGATAGCAGAAAMX1F2 CTTGCTTTTTATTTAGGTTGTATCMX1R1 CAGCAGGAATATAAGCCACAAGTTMX1R2 TTATCAGGCAGGTTCCCACTCCACMX1MLUIF

Subcloning into pTRE2-hygGGGGGGACGCGTATGAATAATACGCTCAACCAA

MX1SALIR GGGGGGTCGACTAGAACTCAACTAGGTAGCTTRE2F

SequencingAAAGTGAAAGTCGAGCTCGGTACC

TRE2R CACCCTGAAAACTTTGCCCCELF-F

qPCR housekeeping controlCCCCTCCAGGACGTTTACAAA 98.3

ELF-R CACACGGCCCACAGGTACAELF-p (MGB) 6FAM-ATCGGTGGTATTGGAACtMX-F

qPCR verification of level of MX expression inGATGCTGCACCTCAAGTCCTACTA 87.7

tMX-R CGGATCACCATGGGAATCTGA

2ddc

wief(feaM

plboms

2

2

w(bl(amUC

TP

CHSE-TOF-MX clonestMX-p (MGB)

010; Wu and Chi, 2007). These independent studies are based onifferent fish species, cellular systems and methods. It is thereforeifficult to compare the levels of resistance against different virusesonferred by Mx.

In rainbow trout, three Mx isoforms have been isolated amonghich is rbtMx1. When over-expressed in CHSE-214 cells, rbtMx1

s located in the cytoplasm (Trobridge and Leong, 1995; Trobridget al., 1997). It shares 99% sequence identity with the rbtMx3 iso-orm and relates to the Atlantic salmon Mx1 and Mx2, respectivelyRobertsen et al., 1997) and its gene has been used as a markeror IFN activity in fish for many years (Collet et al., 2003; McBeatht al., 2007). Based on their sub cellular localisation, rbtMx1 and 3nd Atlantic salmon Mx1 and Mx2, are more related to the humanxA, than to the MxB (Altmann et al., 2004).In order to study the inherent role of Mx protein in the cellular

rotection against a wide range of viruses, a CHSE inducible celline expressing the rainbow trout Mx1 gene encoding for the rain-ow trout Mx1 isoform (rbtMx1) was established. The comparisonf viral sensitivity of these new cell lines gives some novel infor-ation on the contribution of Mx protein to the viral resistance in

almonids.

. Materials and methods

.1. Cell culture

The recombinant cell line CHSE-TOF (Collet and Lester, 2011a)as grown as monolayer in Eagle’s Minimum Essential Medium

Life Technologies, Paisley, UK) supplemented with 10% foetalovine serum (FBS, PAA Laboratories, Pasching, Austria), 20 mM-glutamine (Life Technologies, Paisley, UK) and 500 �g/ml G418Life Technologies, Paisley, UK). Stable cell lines CHSE-TOF-MX8

nd CHSE-TOF-MX10 were selected and maintained in the aboveedium supplemented with 16 �g/ml Hygromycin (Sigma, Irvine,K) and 1 �g/ml DOX (Sigma, Irvine, UK). To induce Mx protein inHSE-TOF-MX8 or CHSE-TOF-MX10 DOX was omitted.

able 2rimer combinations and cycling protocols used in this study for plasmid construction an

Use Primers Cycling protoco

Forward Reverse 1 cycle

Round I PCR MX1F1 MX1R1 95 ◦C2 minRound II PCR MX1F2 MX1R2

Round III PCR MX1MLUIF MX1SALIR

Screening PCR TRE2F MX1SALIR

Sequencing TRE2F TRE2R

6FAM-CTGGATATCCAGTCAGCGTC

2.2. Construction of the pTRE2hyg-rbtMx1 plasmid

The full coding region from the rbtMx1 was obtained by 3rounds of PCR amplification using the high fidelity antibody-basedHot Start KOD DNA PCR kit (Takara Bio Europe/Clontech, Saint-Germain-en-Laye, France). The reaction mix was as follows in a25 �l reaction: 2.5 �l 10× buffer for KOD Hot Start DNA poly-merase, 1.5 �l 25 mM MgSO4, 2.5 �l 2 mM each dNTP, 0.75 �l10 �M each primer, 1 �l template, 0.5 �l 1 U/�l KOD Hot StartDNA polymerase and 15.5 �l PCR grade water. The sequences ofprimers used (designed from Genbank OMU30253) and cyclingcondition are given in detail in Tables 1 and 2, respectively.The template for the first round PCR was a pool of cDNA madefrom RNA purified from kidney from two rainbow trout infectedwith VHSV. The first round of PCR was carried out with MX1F1and MX1R1 primers generating a 2.2 kb fragment that was sepa-rated on a 1% Agarose–Ethidium Bromide gel, excised and purifiedusing MiniElute purification kit according to the manufacturer’sinstructions (Qiagen, Crawley, UK). The second round of PCR wasperformed with MX1F2 and MX1R2 primers on un-diluted purifiedfirst round PCR product as template, generating a 2.1 kb fragmentthat was separated and purified as described above. The thirdround was carried out on un-diluted second round PCR productas template and with the primers MX1MLUIF and MX1SALIR con-taining a MluI and SalI restriction site, respectively. It generated a1.8 kb fragment that was separated and purified as described above.Two microlitres of purified PCR product was digested overnight at37 ◦C with MluI and SalI (Promega, Southampton, UK) alongside thepTRE2hyg plasmid (Takara Bio Europe/Clontech, Saint-Germain-en-Laye, France). Both digested fragments were separated, purifiedfrom gel as described above and ligated using the T4 DNA ligaseand 2× ligation mix (Promega) at 16 ◦C for 16 h. TOP10 compe-tent cells (Life Technologies, Paisley, UK) were transformed using

5 �l of the ligation mix and plated on LB-Agar 100 �g/ml Ampi-cillin plates. In parallel, TOP10 cells were transformed with 1 �l ofpTet-Off and pTRE2hyg-Luc vectors (Takara Bio Europe/Clontech,

d sequence verification.

l

35 cycles 1 cycle 1 cycle

95 ◦C30 s

53.7 ◦C10 s 70 ◦C

45 s70 ◦C10 min

4 ◦Chold60 ◦C 10 s

55.7 ◦C 10 s

According to manufacturer’s instructions (Beckman Coulter)

ologic

S(tfMigStH

Lepa

2

gfppLpaarUgpow(D

2t

qwuTw

RU0tal51bat

TT

K. Lester et al. / Journal of Vir

aint-Germain-en-Laye, France). Colonies were screened by PCRBiotaq PCR kit, Bioline, London, UK) with the primers and condi-ions given in Tables 1 and 2, respectively. Plasmids were purifiedrom 3 ml of LB medium containing 100 �g/ml Ampicillin with the

iniprep kit (Qiagen, Crawley, UK) according to the manufacturer’snstructions. The inserts were partially sequenced with primersiven in Tables 1 and 2 and using the GenomeLabTM DTCS Quicktart Kit (Beckman Coulter, High Wycombe, UK). Sequencing reac-ions were run on a QE8000 capillary sequencer (Beckman Coulter,igh Wycombe, UK).

After sequence verification, a clone was used to inoculate 300 mlB broth with 100 �g/ml Ampicillin. A solution of plasmid free ofndotoxins (pTRE2hyg-rbtMx1, pTet-Off and pTRE2hyg-Luc) wasroduced using the Endofree Maxiprep kit (Qiagen, Crawley, UK)ccording to the manufacturer’s instructions.

.3. Isolation of CHSE-TOF-MX8 and CHSE-TOF-MX10 cell lines

CHSE-TOF cells were detached by Trypsin–EDTA (Life Technolo-ies, Paisley, UK) action and pelleted by centrifugation at 4200 × gor 5 min, washed once with culture medium and twice with phos-hate buffered saline (PBS, Life Technologies, Paisley, UK). Theellet was drained and re-suspended in solution R (Neon kit,ife Technologies, Paisley, UK) at a density of 1.5 × 107 cells/ml.TRE2hyg-rbtMx1 plasmid was added to half of the cell suspensiont a concentration of 0.2 �g/�l and the other half was left withoutny DNA as a mock-transfected control. Two transfections were car-ied out in a Neon® Transfection System (Life Technologies, Paisley,K) using a Neon® Transfection System 10 �L Kit (Life Technolo-ies, Paisley, UK) set to 2 pulses for 20 ms at 1300 V, according torior optimisation trials for CHSE (data not shown). The two setsf transfected cells were added to 5 ml of medium supplementedith 16 �g/ml hygromycin (Sigma, Irvine, UK) and 1 �g/ml DOX

Sigma, Irvine, UK) in a 20 cm diameter Petri dish (Nunc, Roskilde,enmark).

.4. Quantitative real-time PCR (qPCR) characterisation ofransgenic cell lines

The transcription activity of the transgene was measured byPCR. Each CHSE-TOF-MX clone was seeded and cultured with orithout DOX in a 6-well plate for 72 h. The total RNA was purifiedsing the RNA/DNA/Protein purification kit (Qiagen, Crawley, UK).he Mx expression levels relative to elongation factor 1 � gene (ELF)ere measured by qPCR in CHSE-TOF-MX clones.

RNA was reverse transcribed to cDNA using the TaqMan®

everse Transcription Reagent kit (Life Technologies, Paisley,K) with oligo-d(T)16 as follows: 9.625 �l of total RNA (approx..5 �g) and 1.25 �l 50 �M oligo-d(T)16 were mixed and heatedo 70 ◦C for 10 min and chilled on ice. The final volume wasdjusted to 25 �l by adding Master mix comprising the fol-owing: 1× RT buffer (25 mM Tris–HCl pH 8.3, 37.5 mM KCl,.5 mM MgCl2), 0.5 mM each dNTP, 0.4 U RNase inhibitor and

.25 U Multiscribe Reverse Transcriptase. Reactions were incu-ated at 48 ◦C for 90 min, heat inactivated at 95 ◦C for 5 minnd stored at −80 ◦C until use. For each sample, a mock reac-ion “no RT” control was made by omitting the Multiscribe

able 3axonomy information on the viruses used in this study.

Full name Family

Infectious Pancreatic Necrosis Virus Birnaviridae

Salmon Alpha Virus Togaviridae

Infectious Haematopoeitic Necrosis Virus Rabdoviridae

Epizootic Haematopoietic Necrosis Virus Iridoviridae

al Methods 182 (2012) 1– 8 3

Reverse Transcriptase to correct for direct amplification from plas-mid DNA potentially carried over during the RNA preparations.

Real-time PCR assays were performed on a LC480 96-well platereal time PCR machine (Roche, Burgess Hill, UK). The sequencesof the primers and TaqMan® probes to amplify the ELF or rbtMx1genes are presented in Table 1. One microlitre of cDNA was addedto the following mix contained in individual wells of a 96-well opti-cal plate (Life Technologies, Paisley, UK): 10 �l of TaqMan® 2× PCRmix with UNG (Life Technologies, Paisley, UK), 8 �l of dH2O and 1 �lof a 20× mix containing forward primer (18 �M), reverse primer(18 �M) and probe (5 �M). The standard cycling conditions were50 ◦C for 2 min, 95 ◦C for 10 min followed by 50 cycles of 95 ◦C for15 s and 60 ◦C for 1 min. The fluorescence output for each cyclewas measured and recorded upon the completion of the entire run.Absolute quantification of transcripts was carried out.

For each qPCR assay, a standard curve was generated using a10-fold serial dilution of plasmid (calibrator) containing the tar-get sequence. A linear statistical regression between crossing point(Cp) and log(concentration calibrator) was used to estimate theexpression level of the corresponding gene from its measured Cpvalue. The percentage efficiency was also calculated (Table 1). Theexpression level of the gene relative to ELF was calculated by divid-ing the gene expression level by ELF expression level. To correct forpotential genomic DNA carry-over of a given sample, the expres-sion level of the “no RT” control was subtracted from the cDNAexpression level.

2.5. Viral titration in CHSE-TOF-MX8, CHSE-TOF-MX10 andCHSE-TOF

CHSE-TOF, CHSE-TOF-MX8 or CHSE-TOF-MX10 cells wereseeded on 96-well plates (Nunc, Roskilde, Denmark) at a density of20,000 cells/cm2 (approx. 50% confluency) in culture medium withor without DOX supplemented with 25 mM HEPES buffer (Life Tech-nologies, Paisley, UK) and incubated at 15 ◦C for 24 h and during thefollowing infection. Six to 8 wells were left empty. Tenfold dilu-tions of virus inoculums (approx. 106–107 TCID50/ml) were addedin six replicate wells from dilution 10 to 1012. IPNV isolate A2 or A5,Salmon Alphavirus (SAV) isolates F93-125 or 4640, IHNV and Epi-zootic Haematopoietic Necrosis Virus (EHNV, Langdon et al., 1988)were used (Table 3). Sixteen to 18 wells were left un-infected.

The cells were checked regularly for onset of cytopathic effect(CPE). After 14 days, the cells were washed with PBS, fixed for10 min with 10% saline formalin, washed with PBS and incubatedfor 30 min with 0.1% crystal violet (Sigma, Irvine, UK), washed withdistilled water, drained and dried at room temperature. After theplates were photographed under a light box, the crystal violet dyewas redissolved in 100 �l 1% SDS solution (Sigma, Irvine, UK) andthe optical density (OD) was read on a 96 well plate at 590 nm witha PowerWave X spectrophotometer (BioTek, Potton, UK).

2.6. Statistical analysis

Analysis was intended to characterise the response of selectedcombinations of cell lines and medium (referred to as treatmentcombinations) to different dilutions (referred to as doses) of a viralstrain. The response of each treatment combination to the log10

Genus genome

Aquabirnavirus dsRNAalphavirus ssRNA PosNovirabdovirus ssRNA NegRanavirus dsDNA

4 rologic

dss2dpcspatotttsmwbfwfdwcdpcac

3

3

csDdr

3

A

F1i

K. Lester et al. / Journal of Vi

ose of the viral strain was measured as an optical density. Furthertatistical analysis was conducted using version 2.12.0 of the Rtatistical computing environment (R Development Core Team,010). Mean optical densities and 95% confidence intervals forefined treatment combinations at each dose were calculated andlotted. An un-weighted four-parameter logistic dose–responseurve was then fitted to the individual optical densities for theelected treatment combinations using the supplementary Rackage drc 2.0-1 (Ritz and Streibig, 2005). The statistical fit wasssessed by comparing the residual sums of squares obtained fromhe model to the residual sums of squares from a one way analysisf variance. Two parameters are of particular interest. The first ishe TCID50, a measure of the sensitivity of a treatment combinationo a viral strain. The second is the lower asymptote, a measure ofhe maximum sensitivity of the treatment combination to the viraltrain. The predicted values were plotted using a monotone Her-ite spline. Differences in response between cell lines cultivatedith or without DOX and virus strain combinations were evaluated

y comparing the residual variance of the dose–response curveor each cell line and virus strain combination assuming that thereas either no difference between responses between DOX or dif-

erences between responses for DOX. The residual variance of theose–response curve assuming no difference in responses to DOXill be greater than the residual variance of the dose–response

urves assuming a difference in responses to DOX when there is aifference in response to DOX. The difference in response betweenresence and absence of DOX was regarded as statistically signifi-ant when the probability of the variance ratio occurring by chancelone was ≤5%. This approach evaluates differences betweenurves rather than comparing the specific parameters.

. Results

.1. Isolation of CHSE-TOF-MX8 and CHSE-TOF-MX10

After transfection with pTRE2hyg-rbtMx1, five clones wereharacterised by qPCR. Among those, the clone CHSE-TOF-MX8howed the highest level of Mx induction with a fold increase uponOX removal of 27.95 (Fig. 1). No induction of IFN gene could beetected by qPCR in any of the cell lines established in the presenteport (CHSE-TOF, CHSE-TOF-MX clones, data not shown).

.2. Resistance tests to IPNV, SAV, IHNV and EHNV

There was no significant difference in the titres of IPNV isolates2 or A5, SAV isolates 4640 or SAV F93-125 in the parental cell line

15

17

19

21

23

25

27

29

31

33

35

TOF-MX10TOF-MX9TOF-MX8TOF-MX7TOF-MX4TOF

CHSE-TOF-MX clones

Av

era

ge

Cp

Cp DOX

Cp NO DOX

0.78

8.70

1.0727.95

1.63

5.75

ig. 1. Level of expression of Mx in CHSE-TOF and clones CHSE-TOF-MX4, 7, 8, 9 and0. The average fold increase relative to the control cultivated in absence of DOX is

ndicated above the bars. Data represent average Cp values (N = 3) ± SE.

al Methods 182 (2012) 1– 8

CHSE-TOF with or without DOX. This can be seen visually (Fig. 2)and was confirmed by statistical analysis (Table 4).

CHSE-TOF-MX10 and CHSE-TOF showed the same level of sen-sitivity against IPNV isolates A2 and A5 and against SAV isolateF93-125 irrespective of presence or absence of DOX in the cul-ture medium (Fig. 2). In contrast, CHSE-TOF-MX10 was completelyresistant to the SAV isolate 4640 irrespective of presence or absenceof DOX in the culture medium (Fig. 2).

There was a clear effect of the DOX removal on the resistanceof CHSE-TOF-MX8 cells to IPNV isolates A2 and A5 (Fig. 3 – lines1 and 2). The cell lines exhibited complete resistance to IPNV iso-lates A2 and A5 in the absence of DOX whereas in presence of DOX,the sensitivity was similar to the parental line CHSE-TOF. This wasconfirmed by statistical analysis (p < 0.001; Table 4; Fig. 4A and B).However, CHSE-TOF-MX8 cells were completely resistant to SAVisolates F93-125 and 4640 even in the presence of DOX (Table 4;Fig. 3 – lines 3 and 4).

Both parental CHSE-TOF and Mx-expressing CHSE-TOF-MX8 celllines were sensitive to EHNV infection. A significant effect of DOXon the resistance to EHNV infection could be observed in the CHSE-TOF-MX8 cell line (p < 0.001; Table 4; Fig. 3 – line 5).

A partial resistance to IHNV was observed when comparing theparental CHSE-TOF with and without DOX (Fig. 3 – line 6). Thiswas confirmed by quantification and statistical analysis (p < 0.05;Table 4; Fig. 4C and D).

4. Discussion

This is the first report on the production of a tetracyclineinducible expression system for salmon through the production ofa double recombinant fish cell line. The principle of tetracyclinedependent expression systems was investigated in 2005 in carpcells (Munoz et al., 2005) but has never been applied since. Singlerecombinant cell lines producing a reporter gene such as luciferasehave been established in the past as a tool to study specific generegulatory sequences, monitor toxicity of samples to fish cells orstudy signalling mechanisms (see for review Martin et al., 2008).In this study, the biological function of rbtMx1 was investigated inthe Tet-Off Chinook salmon cell line CHSE-TOF recently established(Collet and Lester, 2011b).

In fish, the Mx gene has been shown to be induced by manyviruses (McBeath et al., 2007; Fernández-Trujillo et al., 2011) andrelated to early viral protection (McLauchlan et al., 2003). However,the significance of this induction is difficult to evaluate becausevirus infection induces the production and release of type I and/orII IFN which in turn induces not only the Mx gene expressing theMx protein but also many other molecules with direct or indirectantiviral properties, most of which have never been fully charac-terised in mammalian or other vertebrates (Boo and Yang, 2010).Therefore, the exact contribution of Mx protein to the overall viralprotection in fish cells is not known.

It was observed that the Mx protein was less able to confer resis-tance to IHNV than to other viruses such as SAV or IPNV. This is inagreement with previous work where it was reported that Mx wasunable to inhibit IHNV nucleoprotein (N) production in CHSE cells(Trobridge et al., 1997) but its effect on viral replication is unknown.

The accumulation of Mx protein conferred complete resistanceto IPNV infection which is in agreement with previous data (Larsenet al., 2004), where it was associated with an inhibition of viralprotein production. In Larsen’s study a stable cell line of CHSEover-expressing Mx was generated and demonstrated that Mx

conferred a higher degree of protection to IPNV when compared tothe parental cell line and control cell line. However, the expressionof Mx protein declined with increasing passage number makingit difficult to compare the level of resistance against a panel of

K. Lester et al. / Journal of Virological Methods 182 (2012) 1– 8 5

F ut DOl 14 dayA

dwTt

TR

ig. 2. Resistance level of CHSE-TOF and CHSE-TOF-MX10 cultivated with or withoater, they were infected with serial 10-fold dilutions of virus inoculum, incubated

2 and A5) and SAV (isolates F93-125 and 4640).

ifferent viruses and isolates. The authors hypothesised that thereas a detrimental effect of artificially high levels of Mx expression.

he inducible system presented here would allow long term main-enance of such a cell line with stable properties over high passage

able 4elevant parameters of combination cell line–culture condition–virus.

Cell line Virus DOX TCID50

Mean

CHSE-TOF5

IPNV A2+ 4.95

− 5.20

IPNV A5+ 6.02

− 5.56

SAV 4640+ Po− 5.10

SAV F93-125+ 6.52

− 6.46

IHNV+ 6.49

− 6.03

EHNV+ 6.09

− 6.08

CHSE-TOF5-MX8

IPNV A2+ 2.90

− −0.18

IPNV A5+ 4.57

− −2.72

SAV 4640+ 0.39

− 2.30

SAV F93-125+ −0.79

− 2.39

IHNV+ 5.50

− 4.87

EHNV+ 4.91

− 5.02

CHSE-TOF5-MX10SAV 4640

+ 3.49

− 3.68

SAV F93-125+ Po− 5.25

X. The cells were plated in a 96-well plate with or without DOX. Twenty four hourss at 15 ◦C, fixed, stained and photographed. The viruses tested were IPNV (isolates

number currently reaching 35. As a matter of fact, a decrease inthe rate of cell division (data not shown) was observed upon DOXremoval suggesting that the unregulated over expression of Mxgene is indeed affecting the cell growth. In the presence of DOX,

p Lower asymptote

St dev Mean St dev

0.14NS

−0.04 0.130.60 0.00 0.110.07

NS0.01 9

0.25 0.02 0.09or model fit

No testPoor model fit

0.22 0.00 0.140.12

NS0.03 0.08

0.10 0.02 0.080.14

NS−0.04 0.11

0.2 −0.05 0.110.05

NS0.06 0.03

0.05 0.12 0.03

0.13<0.001

0.29 0.2038.67 3.02 2.480.15

<0.0010.01 0.12

1216.2 2.83 6.34ND

NS1.14 ND

1.26 2.75 0.148.99

NS0.20 26.47

1.08 3.13 0.050.13

0.015−0.07 0.09

0.21 −0.06 0.100.08

<0.001−0.02 0.04

0.06 −0.02 0.04

0.42<0.001

2.33 0.110.21 1.59 0.09

or model fit Notest

Poor model fit0.16 0.06 0.13

6 K. Lester et al. / Journal of Virological Methods 182 (2012) 1– 8

Fig. 3. Resistance level of CHSE-TOF and CHSE-TOF-MX8 cultivated with or without DOX. The cells were plated in a 96-well plate with or without DOX. Twenty four hoursl 14 dayA

ir

iweaosap

oCrpTbsiw

ater, they were infected with serial 10-fold dilutions of virus inoculum, incubated

2 and A5), SAV (isolates F93-125 and 4640), EHNV and IHNV.

n spite of a leakage in Mx expression, the cells showed a normalate of division very similar to the parental cell line.

In a cell line constitutively expressing Mx1 but IFN-deficient,t was demonstrated that different isolates of the influenza virus

ere affected differently by the over-expression of Mx1 (Dittmannt al., 2008). To date no fish cell lines deficient in IFN productionre available. In this study, the production effect of large amountsf rbtMx1 proteins induced a range of levels of protection againsteveral fish virus types and isolates. This cellular system is therefore

good model to compare the early protection conferred by rbtMx1roteins against different virus types and isolates.

A clear difference could be seen on the resistance levelf CHSE-TOF-MX10 cells against SAV isolates 4640 and F93-125.HSE-TOF-MX10 was found to express a relatively lower amount ofbtMx1 when compared to CHSE-TOF-MX8 which exhibited a com-lete resistance to both isolates irrespective of the presence of DOX.he parental CHSE-TOF cell line showed similar sensitivity levels to

oth isolates. These results demonstrated that isolate 4640 is moreensitive to the antiviral effect of rbtMx1 than isolate F93-125. SAVsolate 4640 produced a fast and strong induction of the Mx gene

hereas isolate F93-125 gave a delayed and lower response in a

s at 15 ◦C, fixed, stained and photographed. The viruses tested were IPNV (isolates

fish macrophage-like cell line (unpublished results). Cytopathiceffect was observed for isolate F93-125 but not for isolate 4640. Therelatively high rbtMx1 sensitivity and high Mx gene inducing abil-ity of SAV isolate 4640 contrast with the low rbtMx1 sensitivity andthe low Mx gene inducing ability of isolate F93-125. In addition,viral gene nsP1 expression levels were much higher in cells infectedwith isolate F93-125 rather than with isolate 4640 (unpublishedresults). It is likely that the relative resistance of isolate F93-125results in an excess of viral protein that could not be neutralisedby rbtMx1 in CHSE-TOF-MX10. CHSE-TOF-MX8 cells produce alarger amount of rbtMx1 protein, even in presence of DOX, capableof neutralising viral proteins from the two isolates. A given virusisolate can be characterised in vitro by its ability to induce the Mxgene and to resist to the rbtMx1 protein in CHSE-TOF-MX8/10.Whether this correlates accurately with the virulence measured invivo remains to be established but it can potentially constitute amethod of prediction that does not require the use of animals.

Unlike SAV, IPNV was able to propagate in cells expressing mod-erate levels of rbtMx1. This was observed in CHSE-TOF-MX8 cellscultured in the presence of DOX expressing a leakage level of Mxprotein and showing sensitivity to IPNV but not to SAV (Fig. 2). This

K. Lester et al. / Journal of Virological Methods 182 (2012) 1– 8 7

1 2 3 4 5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

Log10 dilution

op

tica

l d

en

sity

TCID50 = -0.18±38.67

Lower asymptote = 3.02 ±2.48

1 2 3 4 5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

Log10 dilution

op

tica

l d

en

sity

TCID50 = 2.9±0.13

Lower asymptote = 0.29 ±0.2

1 2 3 4 5 6 7 8

0.0

0.5

1.0

1.5

2.0

2.5

3.0

Log10 dilution

op

tica

l d

en

sity

TCID50 = 4.87±0.21

Lower asymptote = -0.06 ±0.1

1 2 3 4 5 6 7 8

0.0

0.5

1.0

1.5

2.0

2.5

3.0

Log10 dilution

op

tica

l d

en

sity

TCID50 = 5.5±0.13

Lower asymptote = -0.07 ±0.09

A B

C D

F h (A)

o

stsTIs(w(bs

ttth

ig. 4. Comparative resistance levels of CHSE-TOF-MX8 against IPNV isolate A2 witptical density (ROD) ± SE and the 4-parameter logistic model.

uggests that IPNV propagation is less affected by rbtMx1 proteinhan SAV since the moderate leakage expression of Mx protein isufficient to provide protection against SAV but not against IPNV.his can be explained by a lack of affinity of the Mx oligomers forPNV proteins or the ability of IPNV to counteract the viral proteinequestration by Mx through an active viral evasion mechanismVersteeg and Garcia-Sastre, 2010). Although this result agreesith past observations that IPNV is capable of inhibiting IFN action

Collet et al., 2003), this study demonstrates a direct interactionetween IPNV and rbtMx1 protein whilst previous work empha-ised the effect of IPNV on the regulation of Mx gene expression.

A wider comparison showed that the presence of Mx protein in

he cell confers a range of resistance levels to different viruses. Inhis study SAV is the virus found to be most sensitive to the Mx pro-ein, followed by IPNV and IHNV. The ability of EHNV to induce IFNas not been reported and very little is known about the immune

or without (B) DOX, or against IHNV with (C) or without (D) DOX. Data are average

response to this virus in fish. It is interesting to note that of all theviruses tested, EHNV is the only one showing complete resistanceto rbtMx1 and the only one having a nuclear genome replication.Other fish iridoviruses such as the Orange-spotted Grouper virushave been shown to induce Mx protein (Chen et al., 2006).

These results give valuable information on the type of strategyemployed by different categories of viruses to escape the effect ofIFN. For example, IPNV which is highly sensitive to rbtMx1, hasdeveloped strategies to limit the production of Mx by blocking stepsof the IFN signalling pathway (Collet et al., 2007). It is likely that SAVhas a similar strategy, as documented in other alphaviruses such asthe Semliki Forest virus (SFV), where nsP2 has been described as a

strong inhibitor of IFN production (Breakwell et al., 2007).

The use of optical densities to characterise the cellular responseto a viral isolate combined to a model-based analysis is a method-ological innovation. It contributes to reduce the subjectivity of

8 rologic

sicpsrtpiififsm

vvawaticat

A

MpsHwav

R

A

A

A

B

B

C

C

C

C

C

C

C

K. Lester et al. / Journal of Vi

coring by eye, facilitates the estimation of parameters character-stic of the response and allows identification of partially resistantell responses. It is reasonable to suggest that this approach isromising but is not necessarily problem free. The reliance on atatistical modelling approach to generate results means that theesults are only as good as the model. Whilst there is no evidencehat the models presented in this report are not satisfactory twoossible improvements can be envisaged. One is a form of weight-

ng which takes into account the different amounts of variationn optical densities for given doses. The second is the use of ave-parameter logistic dose–response curve which would correct

or any asymmetry in the relationship if present. Despite thesehortcomings there is no evidence that these more sophisticatedethods would affect the conclusions of this report.The isolation of the novel cell lines CHSE-TOF-MX8/10 has pro-

ided an opportunity to study the intimate relationship betweeniral proteins and the rbtMx1 protein in fish. More specifically, itllows understanding how diverse group of viruses have developedays to successfully evade the effect of IFN (see for review Versteeg

nd Garcia-Sastre, 2010). Further studies are being undertaken toest a wider range of SAV isolates and establish correlates betweenn vivo virulence and rbtMx1 sensitivity using CHSE-TOF-MX8/10ell lines. In addition, in the absence of DOX, CHSE-TOF-MX8 cellsre completely resistant to IPNV or SAV making it the ideal materialo test for risk of emergence of virulence in vitro.

cknowledgements

S.K. Gahlawat is grateful to the Department of Biotechnology,inistry of Science & Technology, and Government of India for

roviding a fellowship under Biotechnology Overseas Associate-hip and the authorities of CCS Haryana Agricultural University,isar (India) for allowing uptake of the fellowship. Part of this workas funded by EU FP6 IMAQUANIM project no. 7103. The authors

re grateful to the virology staff at Marine Scotland for providingiruses.

eferences

ltmann, S.M., Mellon, M.T., Distel, D.L., Kim, C.H., 2003. Molecular and functionalanalysis of an interferon gene from the zebrafish, Danio rerio. J. Virol. 77,1992–2002.

ltmann, S.M., Mellon, M.T., Johnson, M.C., Paw, B.H., Trede, N.S., Zon, L.I., Kim,C.H., 2004. Cloning and characterization of an Mx gene and its correspondingpromoter from the zebrafish, Danio rerio. Dev. Comp. Immunol. 28, 295–306.

rnheiter, H., Skuntz, S., Noteborn, M., Chang, S., Meier, E., 1990. Transgenic micewith intracellular immunity to influenza virus. Cell 62, 51–61.

oo, K.H., Yang, J.S., 2010. Intrinsic cellular defenses against virus infection by antivi-ral type I interferon. Yonsei Med. J. 51, 9–17.

reakwell, L., Dosenovic, P., Karlsson Hedestam, G.B., D’Amato, M., Liljestrom, P.,Fazakerley, J., McInerney, G.M., 2007. Semliki Forest virus nonstructural pro-tein 2 is involved in suppression of the type I interferon response. J. Virol. 81,8677–8684.

aipang, C.M., Hirono, I., Aoki, T., 2003. In vitro inhibition of fish rhabdoviruses byJapanese flounder, Paralichthys olivaceus Mx. Virology 317, 373–382.

hen, Y.-M., Su, Y.-L., Lin, J.H.-Y., Yang, H.-L., Chen, T.-Y., 2006. Cloning of an orange-spotted grouper (Epinephelus coioides) Mx cDNA and characterisation of itsexpression in response to nodavirus. Fish Shellfish Immunol. 20, 58–71.

hen, Y.-M., Su, Y.-L., Shie, P.-S., Lin, J.H.-Y., Yang, H.-L., Chen, T.-Y., 2008. GrouperMx confers resistance to nodavirus and interacts with coat protein. Dev. Comp.Immunol. 32, 825–836.

ollet, B., McDonald, C., Secombes, C.J., 2003. The promoter for the Interferon Reg-ulatory Factor (IRF)-2 in the rainbow trout Oncorhynchus mykiss: cloning andreporter gene activity. Fish Shellfish Immunol. 15, 473–477.

ollet, B., Munro, E.S., Gahlawat, S., Acosta, F., Garcia, J., Roemelt, C., Zou, J., Sec-ombes, C.J., Ellis, A.E., 2007. Infectious Pancreatic Necrosis Virus suppresses typeI interferon signalling in rainbow trout gonad cell line but not in Atlantic salmonmacrophages. Fish Shellfish Immunol. 22, 44–56.

ollet, B., Lester, K., 2011a. Isolation of an inducible expression cell line in Atlanticsalmon Salmo salar. J. Biotech. 154, 209–211.

ollet, B., Lester, K., 2011b. Establishment of a Chinook salmon cell line with aninducible gene expression system? In vitro Cell. Dev. Biol. – Anim. 47 (10),695–697.

al Methods 182 (2012) 1– 8

Dittmann, J., Stertz, S., Grimm, D., Steel, J., Garcia-Sastre, A., Haller, O., Kochs, G., 2008.Influenza A virus strains differ in sensitivity to the antiviral action of Mx-GTPase.J. Virol. 82, 3624–3631.

Fernández-Trujillo, M.A., Novel, P., Manchado, M., Sepulcre, M.P., Mulero, V., Borrego,J.J., Alvarez, M.C., Béjar, J., 2011. Three Mx genes with differential response toVNNV infection have been identified in Gilthead seabream (Sparus aurata). Mol.Immunol. 48 (9–10), 1216–1223.

Fernández-Trujillo, M.A., García-Rosado, M.E., Borrego, J.J., Alvarez, M.C., Béjar, J.,2008. In vitro inhibition of sole Aquabirnavirus by recombinant Senegalese soleMx. Fish Shellfish Immunol. 24, 187–193.

Haller, O., 1981. Inborn resistance of ice to orthomyxoviruses. Curr. Top. Microbiol.Immunol. 92, 25–52.

Haller, O., Staeheli, P., Kochs, G., 2007a. Interferon-induced Mx proteins in antiviralhost defense. Biochimie 89, 812–818.

Haller, O., Stertz, S., Kochs, G., 2007b. The Mx GTPase family of interferon-inducedantiviral proteins. Microbes Infect. 9, 1636–1643.

Haller, O., Frese, M., Kochs, G., 1998. Mx proteins: mediators of innate resistance toRNA viruses. Rev. Sci. Tech. 17, 220–230.

Haller, O., Arnheiter, H., Lindenmann, J., Gresser, I., 1980. Host gene influences sen-sitivity to interferon action selectively for influenza virus. Nature 283, 660–662.

Haller, O., Arnheiter, H., Gresser, I., Lindenmann, J., 1979. Genetically determined,interferon-dependent resistance to influenza virus in mice. J. Exp. Med. 149,601–612.

Horisberger, M.A., Haller, O., Arnheiter, H., 1980. Interferon-dependent genetic resis-tance to influenza virus in mice: virus replication in macrophages is inhibitedat an early step. J. Gen. Virol. 50, 205–210.

Kibenge, M.J.T., Munir, K., Kibenge, F.S.B., 2005. Constitutive expression of Atlanticsalmon Mx1 protein in CHSE-214 cells confers resistance to Infectious SalmonAnaemia virus. Virol. J. 2, 75.

Kochs, G., Haller, O., 1999a. Interferon-induced human MxA GTPase blocks nuclearimport of Thogoto virus nucleocapsids. Proc. Natl. Acad. Sci. U. S. A. 96,2082–2086.

Kochs, G., Haller, O., 1999b. GTP-bound human MxA protein interacts with the nucle-ocapsids of thogoto virus (Orthomyxoviridae). J. Biol. Chem. 274, 4370–4376.

Langdon, J.S., Humphrey, J.D., Williams, L.M., 1988. Outbreaks of EHNV-like iri-dovirus in cultured rainbow trout, Salmo gairdneri Richardson, in Australia. J.Fish Dis. 11, 93–96.

Larsen, R., Rokenes, T.P., Robertsen, B., 2004. Inhibition of infectious pancre-atic necrosis virus replication by Atlantic salmon Mx1 protein. J. Virol. 78,7938–7944.

Lee, S.H., Vidal, S.M., 2002. Functional diversity of Mx proteins: variations on a themeof host resistance to infection. Genome Res. 12, 527–530.

Lin, C.H., Christopher John, J.A., Lin, C.-H., Chang, C.Y., 2006. Inhibition of nervousnecrosis virus propagation by fish Mx proteins. Biochem. Biophys. Res. Commun.351, 534–539.

Lindenmann, J., 1964. Inheritance of resistance to influenza virus in mice. Proc. Soc.Exp. Biol. Med. 116, 506–509.

McBeath, A.J., Snow, M., Secombes, C.J., Ellis, A.E., Collet, B., 2007. Expression kineticsof interferon and interferon-induced genes in Atlantic salmon (Salmo salar) fol-lowing infection with infectious pancreatic necrosis virus and infectious salmonanaemia virus. Fish Shellfish Immunol. 22, 230–241.

McLauchlan, P.E., Collet, B., Ingerslev, E., Secombes, C.J., Lorenzen, N., Ellis, A.E.,2003. DNA vaccination against viral haemorrhagic septicaemia (VHS) in rainbowtrout: size, dose, route of injection and duration of protection–early protectioncorrelates with Mx expression. Fish Shellfish Immunol. 15, 39–50.

Martin, S.A.M., Collet, B., MacKenzie, S., Evensen, O., Secombes, C.J., 2008. Genomictools for examining immune gene function in salmonid fish. Rev. Fish Sci. 16,110–116.

Munoz, I., Carrillo, M., Zanuy, S., Gomez, A., 2005. Regulation of exogenous geneexpression in fish cells: an evaluation of different versions of the tetracycline-regulated system. Gene 363, 173–182.

R Development Core Team, 2010. R: A Language and Environment for StatisticalComputing. R Foundation for Statistical Computing, Vienna, Austria, ISBN 3-900051-07-0, http://www.R-project.org.

Ritz, C., Streibig, J.C., 2005. Bioassay analysis using R. J. Stat. Software 12, 5.Robertsen, B., Trobridge, G., Leong, J.A., 1997. Molecular cloning of double-stranded

RNA inducible Mx genes from Atlantic salmon (Salmo salar L.). Dev. Comp.Immunol. 21, 397–412.

Staeheli, P., Haller, O., Boll, W., Lindenmann, J., Weissmann, C., 1986. Mx protein:constitutive expression in 3T3 cells transformed with cloned Mx cDNA confersselective resistance to influenza virus. Cell 44, 147–158.

Su, J., Yang, C., Zhu, Z., Wang, Y., Jang, S., Liao, L., 2009. Enhanced grass carp reovirusresistance of Mx-transgenic rare minnow (Gobiocypris rarus). Fish ShellfishImmunol. 26, 828–835.

Trobridge, G.D., Leong, J.A., 1995. Characterization of a rainbow trout Mx gene. J.Interferon Cytokine Res. 15, 691–702.

Trobridge, G.D., Chiou, P.P., Leong, J.A., 1997. Cloning of the rainbow trout(Oncorhynchus mykiss) Mx2 and Mx3 cDNAs and characterization of trout Mxprotein expression in salmon cells. J. Virol. 71, 5304–5311.

Versteeg, G.A., Garcia-Sastre, A., 2010. Viral tricks to grid-lock the type I interferonsystem. Curr. Opin. Microbiol. 13, 508–516.

Wu, Y.C., Lu, Y.-F., Chi, S.C., 2010. Anti-viral mechanism of barramundi Mx againstbetanodavirus involves the inhibition of viral RNA synthesis through the inter-ference of RdRp. Fish Shellfish Immunol. 28 (3), 467–475.

Wu, Y.C., Chi, S.C., 2007. Cloning and analysis of antiviral activity of a barramundi(Lates calcarifer) Mx gene. Fish Shellfish Immunol. 23, 97–108.