Developmental expression of the Notch signaling pathway genes

during mouse preimplantation development

Sarah Cormier, Sandrine Vandormael-Pournin, Charles Babinet, Michel Cohen-Tannoudji

aUnite de Biologie du Developpement, Institut Pasteur, CNRS URA 2578, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France

Received 16 December 2003; received in revised form 22 March 2004; accepted 6 April 2004

Available online 10 May 2004

Abstract

Notch signaling is an evolutionary conserved pathway involved in intercellular signaling and essential for proper cell fate choices during

development. Thus, it could be involved in mouse preimplantation development where intercellular signaling plays a crucial role,

particularly between the inner cell mass and the trophectoderm of the blastocyst. At their face value, the phenotypes observed when

disrupting each of the four Notch genes known in the mouse do not support this view as none of them involves perturbation of

preimplantation development. However this could be due to functional redundancy and/or maternal expression. As a first step to address this

issue, we decided to examine the expression in early development of various genes known to participate in Notch signaling. Here, we report

on the expression pattern of Notch1-4, Jagged1 (Jag1), Jag2, Delta-like1 (Dll-1), Dll-3, Dll-4, Rbpsuh, Deltex1(Dtx1)and Dtx2 genes during

preimplantation development from unfertilized eggs until late blastocyst stage using a RT-PCR strategy. We show that Notch1, 2, Jag1-2,

Dll-3, Rbpsuh and Dtx2 transcripts are expressed at all stages. Notch4 and Dll-4 mRNAs are synthesized from the 2-cell through to the

hatched blastocyst stage. Notch3, Dll-1 and Dtx1exhibit a stage dependent expression as their mRNAs are detected in 2-cell embryos and in

hatched blastocysts, but are absent or weakly detected at the morula stage. Finally, we show that all the above genes are expressed both in

Embryonic and Trophoblast Stem cells (ES and TS cells, respectively). Our results suggest that the Notch pathway may be active during

mouse preimplantation development.

q 2004 Elsevier B.V. All rights reserved.

Keywords: Notch receptors; Delta-like; Jagged; Rbpsuh; Deltex; Early mouse development; Embryonic stem cells; Trophoblast stem cells

1. Results and discussion

The genes of the Notch family encode large single

spanning transmembrane receptors that interact with

membrane-bound ligands encoded by Delta and Serrate/

Jagged family genes. After activation by one ligand, the

notch receptor is proteolytically cleaved, releasing the

Notch intracellular (NIc) domain from the membrane, that

translocates to the nucleus and interacts with the CSL DNA-

binding protein (CBF1 or Rbpsuh in vertebrates, Suppressor

of hairless in Drosophila, Lag-1 in C. elegans) to regulate

selected target gene expression (Weinmaster, 1998; Mumm

and Kopan, 2000). This Notch signaling pathway is

modulated by numerous accessory proteins, for example

members of the Deltex family (Artavanis-Tsakonas et al.,

1995).

The Notch signaling pathway has been shown to be of

pivotal importance throughout development in many

organisms ranging from sea urchins to humans, by

controlling numerous cell fate decisions. Basically, this is

achieved through local cell to cell interactions, the Notch

receptor being expressed by one cell type and interacting

with the ligand present on a neighbouring cell (Lewis, 1998;

Artavanis-Tsakonas et al., 1999). The first steps of the

mouse preimplantation development lead to the formation of

a blastocyst that consists of two cell types: the trophecto-

derm and an inner cell mass (ICM) from which the foetus

will develop. This developmental process requires cellular

interactions that could be controlled by the Notch pathway.

Expression patterns of the Notch pathway genes have

been described in many organs of postimplantation mouse

embryos. Disruption of these genes either leads to

embryonic lethality at midgestation (Swiatek et al., 1994;

Conlon et al., 1995; de la Pompa et al., 1997; Hrabe de

Angelis and McIntyre, 1997; Sidow et al., 1997; Jiang et al.,

1567-133X/$ - see front matter q 2004 Elsevier B.V. All rights reserved.

doi:10.1016/j.modgep.2004.04.003

Gene Expression Patterns 4 (2004) 713–717

www.elsevier.com/locate/modgep

* Corresponding author. Tel.:þ33-1-45-68-85-59; fax:þ33-1-45-68-86-34.

E-mail address: chbabi@pasteur.fr (C. Babinet).

1998; Kusumi et al., 1998; Hamada et al., 1999; Xue et al.,

1999; Krebs et al., 2000; McCright et al., 2001; Dunwoodie

et al., 2002) or give no obvious phenotype (Krebs et al.,

2000, 2003). Absence of phenotype during the preimplanta-

tion development could be explained either by the Notch

pathway not being involved during this period of develop-

ment or by functional redundancy: disruption of one gene

could be compensated by the activity of another; finally, it

could be due to maternal expression, the proteins involved

being accumulated during oocyte growth. The aim of the

present study was to analyse the mRNA expression of

various genes known to participate to Notch signaling in

preimplantation embryos and in Embryonic and Tropho-

blast Stem (ES and TS) cells: the four Notch receptors

(Notch1-4), the five ligands (Delta-like1 (Dll-1), Dll-3, Dll-

4, Jagged1 (Jag1) and Jag2), the transcription factor

Rbpsuh and two regulators, Deltex1 (Dtx1) and Dtx2.

Expression patterns were assessed in oocytes, zygotes,

2-cell embryos, morulae, blastocysts (E3.5) and hatched

blastocysts. 2-cell embryos and hatched blastocyst were

obtained from in vitro culture of fertilized-eggs and E3.5-

blastocysts, respectively (see Section 2). Because of the low

amount of mRNA that can be isolated from early embryos

and to avoid irrelevant amplification of genomic DNA, we

performed nested PCR using two pairs of specific primers

that span exon splicing sites (Table 1). The integrity of all

cDNA samples used for this study has been verified by

HPRT transcripts amplification (Fig. 1). We show that

Notch1 and Notch2 transcripts are detected in oocytes and

all along the preimplantation development (Fig. 1). The

Notch4 mRNAs are not present in oocytes; onset of

expression takes place at the 2-cell stage at the time of the

embryonic genome activation and it persists until the

hatched blastocyst stage (Fig. 1). Notch3 mRNAs are

detected in the 2-cell embryos and hatched blastocysts. This

expression pattern has been confirmed in three independent

experiments. We also detected a weak specific signal for

Notch3 between these two stages, namely at the morula and

blastocyst (E3.5) stages but, for unexplained reasons, this

result was not fully reproducible. However, it should be

noted that such a transient expression at the 2-cell stage of

mouse development has been described for several genes

such as HSP 70.1 and eIF-1A (Christians et al., 1995; De

Sousa et al., 1998; Ko et al., 2000).

Among the five ligands of the Notch receptors, three

(Jag1, Jag2 and Dll-3) are expressed both in oocytes and in

all the stages from the zygote until the late blastocyst stage

(Fig. 1). Dll-1 and Dll-4 transcripts appear at the 2-cell stage

(Fig. 1). Dll-4 mRNA expression persists until the late

blastocyst stage. It is worth noting that Dll-1 transcripts are

not detectable in morulae and that the gene expression is

only weakly resumed in blastocysts. Recently, expression

profile of the Notch receptor and ligands genes has been

established by non-radioactive in situ hybridization on adult

mice ovary sections (Johnson et al., 2001). The authors

showed that Notch2, Notch3 and Jag2 were expressed in

granulosa cells of developing follicles while Jag1

expression was restricted to the oocytes. These results are

at variance with our findings most probably due to the

fact that we used nested PCR, a method which is more

sensitive than in situ hybridization. Absence of possible

Table 1

Sequence of specific primers used for nested PCR amplification. The first

PCR was achieved using p1 and p2 primers and the second PCR using p3

and p4 primers

Genes Primers Product length (bp)

Notch1 p1: GTCAATGCCGTGGATGACCT 865

p2: TCACACTGGCCATTCAAGCT

p3: CGGTGAACAATGTGGATGCT 116

p4: ACTTTGGCAGTCTCATAGCT

Notch2 p1: ATCTGCCCTCCACTGGGCAGCT 933

p2: TGGGTGGACATGTGCTTCCCT

p3: GTGGAGGCGACTCTTCTGCT 242

p4: GCTGGGAGTCACGTTATACT

Notch3 p1: GCTTGGGAAATCTGCCTTAC 319

p2: GAGCAATGGCCCTAAGCCAT

p3: GAGGCTACCTTGGCTCTGCT 166

p4: GGCAGCCTGTCCAAGTGATCT

Notch4 p1: CAGCCCGAGCAGATGTAGGA 146

p2: CGGCGTCTGTTCCCTACTGT

p3: TAGGAGCCAGGGATAAAAGG 119

p4: CCTACTGTCCTGGGCATCTT

Jag1 p1: GACGGAGACAACTGGTATCG 947

p2: TTGTTGGTGGTGTTGTCCTC

p3: CCAGCCAGTGAAGACCAAGT 398

p4: TCAGCAGAGGAACCAGGAAA

Jag2 p1: GTGGAGGTGGCTGTGTCTTT 570

p2: GCTGGGGTCTTTGGTGAACT

p3: GAGGTCAAGGTGGAAACAGT 120

p4: TGTCCACCATACGCAGATAA

Dll-1 p1: GCTTCAATGGAGGACGATGT 936

p2: GAATCTCCCCACCCCTAAGT

p3: ACAGAAACACCAGCCTCCAC 108

p4: GCCCCAATGATGCTAACAGA

Dll-3 p1: CAAGACGGTGCTGGGGATGG 220

p2: CGGTAGGGGGAGGTAGAGAT

Dll-4 p1: AACTGTCCTTATGGCTTTGT 520

p2: CACACTCGTTCCTCTCTTCT

p3: CTGTCCTTATGGCTTTGTGG 260

p4: GCTCCTTCTTCTGGTTTGTG

Rbpsuh p1: GGCACTCCCAAGATTGATA 854

p2: CTGGACTGGCTGGCGGACC

p3: CAGACAAGGCCGAGTACAC 162

p4: GTTTCGGCTTCTACATCCC

Dtx1 p1: GGGCGTGCTCCGAAAC 786

p2: GCCCTTGCTGGTGGTCCTAT

p3: CCCTCGCCACTGCTACCTA 292

p4: AAAGGGAAGGCGGGCAACTC

Dtx2 p1: GCAACGGGAACAAGGACGG 369

p2: GCGGTCCATCTCGGTCTTGT

p3: AGTCTTCAGTGTCCGTCGTG 356

p4: CGTTGCGGTCCATCTCGGTC

S. Cormier et al. / Gene Expression Patterns 4 (2004) 713–717714

contamination of oocyte or zygote samples by residual

granula cells was carefully checked by visual examination

under the stereomicroscope.

The main transcription factor Rbpsuh is a regulatory

protein which plays a central role in Notch signaling; it

binds to NIc domain and, in association with other proteins,

promotes the expression of various target genes. Impor-

tantly, Rbpsuh binds to the four NIc domains originating

from each of the four Notch receptors (Notch1–4) and

therefore might be a common link for the function of the

four respective Notch genes. Rbpsuh mRNAs are expressed

in oocytes and all along the preimplantation development

(Fig. 1). Likewise, Dtx2 transcripts are detected in all the

embryonic stages examined in this study (Fig. 1). In

contrast, Dtx1 transcripts were first detected at the 2-cell

stage and then in hatched blastocysts. However, as in the

case of Notch3, only weak and inconstant specific signals at

the morulae and E3.5 stages were observed.

We have also monitored the expression of the various

Notch signaling actors in ES and TS cells; these two types

of cells maintained in vitro differ in their potentialities: ES

cells are pluripotent stem cells, similar to the cells of the

ICM of the blastocyst, retaining the ability to differentiate

into all tissues of the mouse; TS cells are stem cells of the

trophoblast which gives rise to part of the placenta

Rossant, 2001. We found that all the components of the

Notch signaling pathway studied are expressed in these

two cell lines (Fig. 2). Due to the limits of the technique

used (classical RT-PCR) we think that the slight

differences between signal intensities we observe are not

significant.

Finally, Mus Musculus Unigene database searches show

that ESTs corresponding to Dtx2, Rbpsuh, Jag1 and Jag2

gene have been obtained from unfertilized eggs, preim-

plantation embryos and ES cells libraries (http://www.ncbi.

nlm.nih.gov/UniGene; library built #131). In the present

study, we directly confirm these results and extend it to

other genes implicated in the Notch signaling pathway

during preimplantation development. Altogether, our results

are consistent with the possibility that the Notch signaling

Fig. 1. mRNA expression of the four Notch receptors during mouse preimplantation development. Detection of transcripts for Notch1–4, Jag1-2, Dll-1, Dll-3,

Dll-4, Rbpsuh and Dtx1-2 in oocytes, one-cell embryos, 2-cell embryos, morulae (E2.5), blastocysts (E3.5) and hatched blastocyts using nested RT-PCR.

Negative PCR control with no cDNA is shown on the right of each panel. The 100 bp ladder (Eurobio) was used as molecular weight marker for all migrations.

As a control for cDNAs synthesis, RT-PCR was performed using HPRT primers in all samples (HPRT panel). In addition to the specific PCR band, a

contaminating product was occasionally observed when amplifying Jag1, Dll-3 and Rbpsuh. Note that in the case of Jag2, the additional band observed results

from cDNA amplification with the p2 and p3 primer pair (Table 1).

S. Cormier et al. / Gene Expression Patterns 4 (2004) 713–717 715

pathway could be active during the first steps of mouse

development.

2. Materials and methods

2.1. Production of staged embryos

All the oocytes/embryos were collected from (C57Bl/6 X

SJL/J)F1 superovulated females mated with males of the

same genotype. Oocytes were obtained by hyaluronidase

treatment (0.5 mg/ml) of cumulus masses. Absence of

follicular cells was carefully checked under the stereo-

microscope. Zygotes were obtained the day of the plug

(E0.5) and cultured in KSOM/AA medium to produce 2-cell

stage embryos (Ho et al., 1995). Morulae were collected

from superovulated females at E2.5. Blastocysts were

collected from superovulated females at E3.5 and even-

tually cultured for 24 h in DMEM medium completed with

15% fetal bovine serum and 0.1 mM b-mercaptoethanol to

obtain hatched blastocysts.

2.2. RNAs isolation and RT-PCR

Poly (A)þ RNAs were isolated from 30 to 130 oocytes/

embryos with DynabeadswmRNA DIRECTeKit (DYNAL).

Totality of poly (A)þ RNAs were reversed transcribed during

60 min at 42 8C using 200 units of Superscript II (Invitrogen).

An equivalent of 1–3 oocytes/embryos was used for

nested RT-PCR. Conditions of RT-PCR were 96 8C, 5 min

then 27 to 30 cycles at 96 8C, 30 s; 53–63 8C, 30 s; 72 8C,

1 min followed by 10 min at 72 8C. A second round of

PCR was performed under similar conditions using 1 ml of

the first PCR reaction. Specific nested primer pairs

were used at 0,25 mM and are listed in Table 1.

HPRT primers (GTTCTTTGCTGACCTGCTGGATTAC

and GTCAAGGGCATATCCAACAACAAAC) were used

to check integrity of cDNAs and give a 346 bp PCR product.

Total RNAs from CK35 ES (Kress et al., 1998) and TS

(TS-F3, isolated and kindely provided by Philip Avner) cells

were extracted using Chomczynski method (Chomczynski

and Sacchi, 1987). Two micrograms of total RNA were

reversed transcribed during 60 min at 42 8C using 200 units

of Superscript II (Invitrogen). An equivalent of 50 ng of

total RNA reverse transcribed or not (negative control) was

used for RT-PCR. No amplification of cDNA was observed

in negative control tubes. Conditions of RT-PCR were

96 8C, 5 min then 30–40 cycles at 96 8C, 30 s; 53–63 8C,

30 s; 72 8C, 1 min followed by 10 min at 72 8C. TBP

primers (AAGAGAGCCACGGACAACTG and TACT-

GAACTGCTGGTGGGTC) were used to check integrity

of cDNAs and give a 250 bp PCR product.

3. Note added in proof

After the present paper was submitted, two whole

genome studies on gene expression dynamics during

mouse preimplantation development using microarrays

were reported (Hamatani et al., and Wang et al., Develop-

mental Cell, (2004), Vol.6, pp. 117–131 and pp. 133–144,

respectively). Expression of multiple components of the

Notch signaling pathway was demonstrated including three

of the genes (Notch3, Dtx2 and Jag2) examined in our study

Acknowledgements

We thank Corinne Chureau-Pommier for providing TS

cell total RNAs. This work was funded by the Centre

National de la Recherche Scientifique and the Pasteur

Institute (GPH 07 Program). Sarah Cormier is recipient of

Fig. 2. mRNA expression of the Notch signaling pathway genes in ES and TS cells. Detection of transcripts for Notch1–4, Rbpsuh, Dll-1, Dll-3, Dll-4, and

Jag1-2 in ES (E) and TS (T) cells using RT-PCR. Primer pairs used for PCR (Table 1): p1 and p2 for Notch1, Dll-1, Dll-3, Dll-4; p3 and p4 for Notch2-4, Jag1-

2, Rbpsuh and Dtx1-2. Negative PCR control with no cDNA is shown on the right of each panel. The 100 bp ladder (Eurobio) was used as molecular weight

marker for migrations. As a control for cDNAs synthesis, RT-PCR was performed using TBP primers in all samples.

S. Cormier et al. / Gene Expression Patterns 4 (2004) 713–717716

a fellowship from Association de la Recherche contre le

Cancer.

References

Artavanis-Tsakonas, S., Matsuno, K., Fortini, M.E., 1995. Notch signaling.

Science 268, 225–232.

Artavanis-Tsakonas, S., Rand, M.D., Lake, R.J., 1999. Notch signaling: cell

fate control and signal integration in development. Science 284,

770–776.

Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation

by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal.

Biochem. 162, 156–159.

Christians, E., Campion, E., Thompson, E.M., Renard, J.P., 1995.

Expression of the HSP 70.1 gene, a landmark of early zygotic activity

in the mouse embryo, is restricted to the first burst of transcription.

Development 121, 113–122.

Conlon, R.A., Reaume, A.G., Rossant, J., 1995. Notch1 is required for the

coordinate segmentation of somites. Development 121, 1533–1545.

de la Pompa, J.L., Wakeham, A., Correia, K.M., Samper, E., Brown, S.,

Aguilera, R.J., Nakano, T., Honjo, T., Mak, T.W., Rossant, J., Conlon,

R.A., 1997. Conservation of the Notch signalling pathway in

mammalian neurogenesis. Development 124, 1139–1148.

De Sousa, P.A., Watson, A.J., Schultz, R.M., 1998. Transient expression of

a translation initiation factor is conservatively associated with

embryonic gene activation in murine and bovine embryos. Biol.

Reprod. 59, 969–977.

Dunwoodie, S.L., Clements, M., Sparrow, D.B., Sa, X., Conlon, R.A.,

Beddington, R.S., 2002. Axial skeletal defects caused by mutation in

the spondylocostal dysplasia/pudgy gene Dll3 are associated with

disruption of the segmentation clock within the presomitic mesoderm.

Development 129, 1795–1806.

Hamada, Y., Kadokawa, Y., Okabe, M., Ikawa, M., Coleman, J.R.,

Tsujimoto, Y., 1999. Mutation in ankyrin repeats of the mouse Notch2

gene induces early embryonic lethality. Development 126, 3415–3424.

Ho, Y., Wigglesworth, K., Eppig, J.J., Schultz, R.M., 1995. Preimplanta-

tion development of mouse embryos in KSOM: augmentation by

amino acids and analysis of gene expression. Mol. Reprod. Dev. 41,

232–238.

Hrabe de Angelis, M., McIntyre, J. 2nd, Gossler, A., 1997. Maintenance of

somite borders in mice requires the Delta homologue DII1. Nature 386,

717–721.

Jiang, R., Lan, Y., Chapman, H.D., Shawber, C., Norton, C.R., Serreze,

D.V., Weinmaster, G., Gridley, T., 1998. Defects in limb, craniofacial,

and thymic development in Jagged2 mutant mice. Genes Dev. 12,

1046–1057.

Johnson, J., Espinoza, T., McGaughey, R.W., Rawls, A., Wilson-Rawls, J.,

2001. Notch pathway genes are expressed in mammalian ovarian

follicles. Mech. Dev. 109, 355–361.

Ko, M.S., Kitchen, J.R., Wang, X., Threat, T.A., Hasegawa, A., Sun, T.,

Grahovac, M.J., Kargul, G.J., Lim, M.K., Cui, Y., Sano, Y., Tanaka,

T., Liang, Y., Mason, S., Paonessa, P.D., Sauls, A.D., DePalma,

G.E., Sharara, R., Rowe, L.B., Eppig, J., Morrell, C., Doi, H., 2000.

Large-scale cDNA analysis reveals phased gene expression patterns

during preimplantation mouse development. Development 127,

1737–1749.

Krebs, L.T., Xue, Y., Norton, C.R., Shutter, J.R., Maguire, M.,

Sundberg, J.P., Gallahan, D., Closson, V., Kitajewski, J., Callahan,

R., Smith, G.H., Stark, K.L., Gridley, T., 2000. Notch signaling is

essential for vascular morphogenesis in mice. Genes Dev. 14,

1343–1352.

Krebs, L.T., Xue, Y., Norton, C.R., Sundberg, J.P., Beatus, P., Lendahl, U.,

Joutel, A., Gridley, T., 2003. Characterization of Notch3-deficient

mice: Normal embryonic development and absence of genetic

interactions with a Notch1 mutation. Genesis 37, 139–143.

Kress, C., Vandormael-Pournin, S., Baldacci, P., Cohen-Tannoudji, M.,

Babinet, C., 1998. Nonpermissiveness for mouse embryonic stem (ES)

cell derivation circumvented by a single backcross to 129/Sv strain:

establishment of ES cell lines bearing the Omd conditional lethal

mutation. Mamm. Genome 9, 998–1001.

Kusumi, K., Sun, E.S., Kerrebrock, A.W., Bronson, R.T., Chi, D.C.,

Bulotsky, M.S., Spencer, J.B., Birren, B.W., Frankel, W.N., Lander,

E.S., 1998. The mouse pudgy mutation disrupts Delta homologue

Dll3 and initiation of early somite boundaries. Nat. Genet. 19,

274–278.

Lewis, J., 1998. Notch signalling and the control of cell fate choices in

vertebrates. Semin. Cell Dev. Biol. 9, 583–589.

McCright, B., Gao, X., Shen, L., Lozier, J., Lan, Y., Maguire, M.,

Herzlinger, D., Weinmaster, G., Jiang, R., Gridley, T., 2001. Defects in

development of the kidney, heart and eye vasculature in mice

homozygous for a hypomorphic Notch2 mutation. Development 128,

491–502.

Mumm, J.S., Kopan, R., 2000. Notch signaling: from the outside in. Dev.

Biol. 228, 151–165.

Rossant, J., 2001. Stem cells from the Mammalian blastocyst. Stem Cells

19, 477–482.

Sidow, A., Bulotsky, M.S., Kerrebrock, A.W., Bronson, R.T., Daly, M.J.,

Reeve, M.P., Hawkins, T.L., Birren, B.W., Jaenisch, R., Lander, E.S.,

1997. Serrate2 is disrupted in the mouse limb-development mutant

syndactylism. Nature 389, 722–725.

Swiatek, P.J., Lindsell, C.E., del Amo, F.F., Weinmaster, G., Gridley, T.,

1994. Notch1 is essential for postimplantation development in mice.

Genes Dev. 8, 707–719.

Weinmaster, G., 1998. Notch signaling: direct or what? Curr. Opin. Genet.

Dev. 8, 436–442.

Xue, Y., Gao, X., Lindsell, C.E., Norton, C.R., Chang, B., Hicks, C.,

Gendron-Maguire, M., Rand, E.B., Weinmaster, G., Gridley, T., 1999.

Embryonic lethality and vascular defects in mice lacking the Notch

ligand Jagged1. Hum. Mol. Genet. 8, 723–730.

S. Cormier et al. / Gene Expression Patterns 4 (2004) 713–717 717