Comparative Biochemistry and Physiology, Part C 151 (2010) 447–454

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C

j ourna l homepage: www.e lsev ie r.com/ locate /cbpc

Dexamethasone facilitates lipid accumulation and mild feed restriction improvesfatty acids oxidation in skeletal muscle of broiler chicks (Gallus gallus domesticus)

Xiaojuan Wang, Hai Lin ⁎, Zhigang Song, Hongchao JiaoDepartment of Animal Science, Shandong Agricultural University, Taian, Shandong 271018, PR China

Abbreviations: ACC, acetyl-CoA carboxylase; AMPK,BF, M. biceps femoris; BM, body mass; CORT, corticosterdexamethasone; FABPpm, plasma membrane fatty acidacid transport protein 1; GAPDH, glyceraldehydes-3-phglucocorticoids; H-FABP, heart-fatty acid binding proteinadrenal; LCAD, long-chain acyl-CoA dehydrogenase; LCFAliver-carnitine palmitoyltransferase 1; LPL, lipoproteinM-CPT1, muscle-carnitine palmitoyltransferase 1; NEFAM. pectoralis major; TG, triglyceride; VLDL, very low den⁎ Corresponding author. Tel.: +86 538 8249203; fax:

E-mail address: hailin@sdau.edu.cn (H. Lin).

1532-0456/$ – see front matter © 2010 Elsevier Inc. Aldoi:10.1016/j.cbpc.2010.01.010

a b s t r a c t

a r t i c l e i n f o

Article history:Received 18 December 2009Received in revised form 30 January 2010Accepted 30 January 2010Available online 4 February 2010

Keywords:Energy deficitGlucocorticoidsIntramyocellular lipidUptakeUtilization

Effects of dexamethasone (DEX) and mild feed restriction on the uptake and utilization of fatty acidsin skeletal muscle of broiler chicks (Gallus gallus domesticus) were investigated. Male Arbor Acres chicks (7-daysold, n=30)were injectedwith DEX or saline for 3 days, and a feed restriction groupwas included. DEX enhancedcirculating very low density lipoprotein (VLDL) level and the lipid accumulation in both adipose and skeletalmuscle tissues. Compared with the control, liver-carnitine palmitoyltransferase 1 (L-CPT1) and AMP-activatedprotein kinase (AMPK)α2mRNA level ofM. biceps femoris (BF)were down-regulated significantly byDEX,whilemRNA expression of lipoprotein lipase (LPL), fatty acid transport protein 1 (FATP1), heart-fatty acid bindingprotein (H-FABP), long-chain acyl-CoA dehydrogenase (LCAD), activities of LPL and AMPK in both skeletalmuscles were not obviously affected. Feed restriction increased themRNA expression of LPL, L-CPT1 and LCAD ofM. pectoralis major (PM), and FATP1, H-FABP, L-CPT1 and LCAD of BF. In conclusion, DEX retards the growth ofbody mass but facilitates lipid accumulation in both adipose and skeletal muscle tissues. In contrast to thefavorable effect ofmild feed restriction,DEXdidnot alter theuptakeof fatty acids in the skeletalmuscle. The resultsuggests that DEX may promote intramyocellular lipid accumulation by suppressed fatty acid oxidation whilemild feed restriction improved fatty acid oxidation in skeletal muscle, especially in red muscle. Glucocorticoids(GCs) regulated muscle fatty acid metabolism in a different way from energy deficit caused by mild feedrestriction.

AMP-activated protein kinase;one; CT, cycle threshold; DEX,binding protein; FATP1, fattyosphate dehydrogenase; GCs,; HPA, hypothalami-pituitary-, long-chain fatty acid; L-CPT1,lipase; M-CoA, malonyl-CoA;, nonesterified fatty acid; PM,sity lipoprotein.+86 538 8241419.

l rights reserved.

© 2010 Elsevier Inc. All rights reserved.

1. Introduction

As the final effectors of the hypothalamus-pituitary-adrenal (HPA)axis, glucocorticoids (GCs) evoke a series of essential physiologicalresponses related to the mobilization of energy stores and energyredistribution towards inhibiting non-essential functions such asgrowth, in favor of the maintenance of homeostasis and survival(Matteri et al., 2000). GCs have important effects on fatty acidmetabolism. In mammals, the up-regulated circulating GCs togetherwith the altered insulin sensitivity were suggested to be responsiblefor the enhanced visceral fat deposition (Geraert et al., 1996). Thedevelopment of obesity was attenuated by adrenalectomy andreversed by administration of GCs (Freedman et al., 1986). In the in

vitro cultured mammalian hepatocytes, dexamethasone (DEX), asynthetic GC, increased lipid synthesis and enhanced lipid secretion(Bartlett and Gibbons, 1988). In broiler chickens, DEX enhancedhepatic de novo lipogenesis as well as the circulating lipid flux (Caiet al., 2009). The enhanced fat accumulation accompanied by theretarded development of skeletal muscle by GCs indicates the alteredenergy stores toward fat deposition (Dong et al., 2007; Jiang et al.,2008; Yuan et al., 2008). However, the role of GCs in the regulation offatty acid metabolism remains unclear (Macfarlane et al., 2008).

Fatty acids, as well as glucose, serve as fuel in skeletal muscle. Fuelselection in normal muscle cells depends on the substrate availabilityand metabolic demands (McClelland, 2004). Changes in muscle fuelpartitioning of lipid, between oxidation and storage of fat, contributeto the accumulation of intramuscular triglycerides (TG) and to thepathogenesis of both obesity and type 2 diabetes mellitus (Beaudrapet al., 2006). There are many functional and structural steps as fattyacids are mobilized, transported, and oxidized in muscles. In thepathway of fatty acid uptake by muscle cells, lipoprotein lipase (LPL)is responsible for the release of fatty acids from TG carried in thecirculating lipoproteins (Goldberg, 1996). Fatty acid transport protein1 (FATP1) and heart-fatty acid binding protein (H-FABP) play animportant role in directing fatty acid to the appropriate site forintramyocellular metabolism (Veerkamp and Van Moerkerk, 1993;Maatman et al., 1994; Vannieuwenhoven et al., 1995). For the

448 X. Wang et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 447–454

oxidation of fatty acids in mitochondria, carnitine palmitoyltransfer-ase1 (CPT1) is a rate-limiting enzyme in transport of acyl-CoA acrossthe mitochondrial membrane for oxidation (McGarry et al., 1989;McGarry and Brown, 1997; Eaton, 2002), while the long-chain acyl-CoA dehydrogenase (LCAD) is the regulatory enzyme that catalyzesthe initial step of mitochondrial β-oxidation (Izai et al., 1992). Thetwo different isoforms of CPT1, liver-CPT1 (L-CPT1) and muscle-CPT1(M-CPT1), existing in mammalian cells, were proved to be present inchickens as well (Skiba-Cassy et al., 2007). In mammals, the increasedintramyocellular TG concentration was associated with diminishedinsulin sensitivity in skeletal muscle (Corcoran et al., 2007) which dueto reduced reliance on fatty acid oxidation during postabsorptiveconditions (Kelley and Goodpaster, 2001).

Birds have higher plasma glucose concentrations compared tomammals with similar body mass (BM, Braun and Sweazea, 2008),while the circulating insulin levels are lower, only about one tenththat of rats (Dupont et al., 2004). Themodern broiler chicken has a fastgrowing rate, a high body mass and high fat deposition at young age,which makes it an interesting model in the development of insulinresistance (Zhao et al., 2009). Taken together, we hypothesized thatGCs may change the lipid utilization and, in turn, the lipidaccumulation in muscle cells in chickens.

AMP-activated protein kinase (AMPK), as a key indicator ofphysiological energy state (Hardie and Carling, 1997; Hardie et al.,1998, 2003), is activated by an increase in AMP to ATP ratio (Saha andRuderman, 2003). AMPK catalyzes the phosphorylation of acetyl-CoAcarboxylase (ACC), and in turn, diminishes malonyl-CoA (M-CoA),which is an allosteric inhibitor for CPT1 (Saha and Ruderman, 2003).The activation of AMPK results in stimulated muscle fatty acid uptakeand oxidation. In mammals, the decrease in AMPK and increases inM-CoA are linked to insulin resistance (Ye et al., 2005). Excess lipidaccumulation in skeletalmuscle in obesity could be the dysregulation ofthe AMPK/M-CoA fuel-sensing system (Ruderman and Saha, 2006).Although there is similar functional AMPK pathway in chickens(Proszkowiec-Weglarz et al., 2006), the linkage between AMPK andlipid accumulation in muscle cells needs to be investigated.

The objective of the present study was to investigate the uptakeand utilization of fatty acids in the skeletal muscle of stressed-broilerchickens mimicked by exogenous GCs administration. DEX, exhibitinga high affinity for GC receptors and a delayed plasma clearance(Foucaud et al., 1998) was employed to induce the hyperglucocorti-coid status in the present study. The expressions of genes related tothe uptake, transport and oxidation of fatty acids in skeletal musclewere investigated. The mechanism of GCs regulating the fatty acidutilization was compared with that of mild energy deficit as well.

2. Materials and methods

2.1. Experimental chicks and diets

Male broiler chicks (Arbor Acres, Gallus gallus domesticus) wereobtained from a local hatchery at 1day of age and reared in anenvironmentally controlled room. The brooding temperature wasmaintained at 35 °C (65% RH) for the first 2 days, and then decreasedgradually to 31 °C (45% RH) until 10 days. The light regime was23 L:1D. All chicks received a starter diet with 21.5% crude protein and12.33 MJ/kg of metabolizable energy (Zhao et al., 2009). All the birdshad free access to feed and water during the rearing period. The studywas approved by the University and carried out in accordance withthe “Guidelines for Experimental Animal” from Ministry of Scienceand Technology (Beijing, P. R. China).

2.2. Treatments

At 7-days of age, 90 broiler chicks were allocated to 9 pensaccording to the BM and each pen had 10 chicks. The 9 pens of chicks

were randomly subjected to one of the following three treatments for3 days: subcutaneous injection of DEX (2 mg/kg BM, according to ourprevious trial), sham-treated (injection of 0.5 mL of saline, control),and sham-treated and mild feed restriction group (FR) to keep thefeed consumption as that of the control chicks in the previous day(Urdaneta-Rincon and Leeson, 2002). BM and feed intake wererecorded daily.

At 10days of age, 4 chicks (Mean BM, 162 g) were selected fromeach pen. After feed withdrawal for 12 h, a blood sample was drawnfrom a wing vein by using a heparinized syringe within 30 s andcollected in iced tubes. Plasma was obtained after centrifugation at400g for 10 min at 4 °C and was stored at−20 °C for further analysis.Immediately after the blood sample had been obtained, the chick wassacrificed by exsanguination (Close et al., 1997). Abdominal fat,subcutaneous fat in cervical and thigh, and breast and thigh muscleswere respectively harvested and weighed. A 1 to 2 g sample wasrespectively obtained from left M. pectoralis major (PM, fast-twitchglycolytic fiber type muscle) and M. biceps femoris (BF, slow-twitchoxidative fiber type muscle), cooled down in liquid nitrogen andstored at −70 °C for further analysis.

2.3. Measurements

Plasma concentrations of glucose (No. F006), urate (No. C012), TG(No. F001) and nonesterified fatty acid (NEFA, No. A042) weremeasured spectrophotometrically with commercial diagnostic kits(Jiancheng Bioengineering Institute, Nanjing, P. R. China). Theconcentration of very low density lipoprotein (VLDL) was determinedwith the method described by Griffin and Whitehead (1982).

Plasma insulin was measured by radioimmunoassay with a guineapig anti-porcine insulin serum (3 V Bio-engineering group Co.,Weifang, P. R. China). In this measurement, 125I-labeled porcineinsulin competes with chicken insulin for sites on insulin-porcineantibody immobilized to the wall of a polypropylene tube. A largecross-reaction has been observed between chicken insulin and theguinea pig anti-porcine sera (Simon et al., 1974). The insulin in thisstudy is referred to as immunoreactive insulin. The sensitivity of theassay was 1 μIU/mL and all samples were included in the same assayto avoid interassay variability. The intraassay coefficient of variationwas 6.9%.

For the measurement of fat content in skeletal muscle, muscletissue homogenization was mixed with chloroform/methanol extractsolution (2:1, v/v). The chloroform phase was removed and reducedby evaporation at 40 °C in nitrogen and the fat content was measuredaccording to description by Folch et al. (1957).

LPL activity in muscle tissue was determined with commercialdiagnostic kit (Jiancheng Bioengineering Institute, Nanjing, P. R.China). One unit of enzyme activity was defined as 1 μmol NEFAreleased from 1 mg muscle tissue protein per hour.

The AMPK activity was measured by detecting released phosphatewith labeled 32P from [32P]ATP(5 μCi/assay), using SAMS peptide (His-Met-Arg-Ser-Ala-Met-Ser-Gly-Leu-His-Leu-Val-Lys-Arg-Arg) as thetarget analog of ACC as previous description (Davies et al., 1989;Winder and Hardie, 1996). Tissues were homogenized in buffer of pH7.5 (tris 50 mM, mannitol 250 mM, Na2EDTA 1 mM, EGTA 1 mM,dithiothreitol 1 mM, Phenylmethanesulfonyl fluoride 1 mM, benza-midine 1 mM, soybean trypsin inhibitor 4 μg/mL, sodium fluoride50 mM, and sodium pyrophosphate 5 mM) and centrifuged for20 min at 4 °C. The supernatant proteins were incubated withpolyethylene glycol 8000 for 10 min at 4 °C. The sediments werewashedwith the aforementioned homogenization buffer, centrifuged,re-suspended in suspending buffer of pH 7.5 (tris 100 mM, NaF50 mM, sodium pyrophosphate 5 mM, Na2EDTA 1 mM, EGTA 1 mM,dithiothreitol 1 mM, sodium azide 0.02%, benzamidine 1 mM, soybeantrypsin inhibitor 4 µg/mL, and glycerol 10%) and then incubated withreaction buffer of pH 7.0 (HEPES 40 mM, sodium chloride 80 mM,

Table 1Gene-specific primer of related genes.

Genename

GenBanknumber

Primerdirection

Primer sequence (5′→3′) Productlength (bp)

GAPDH NM_204305 Forward ctacacacggacacttcaag 244Reverse acaaacatgggggcatcag

LPL NM_205282 Forward cagtgcaacttcaaccatacca 150Reverse aaccagccagtccacaacaa

FATP1 DQ352834 Forward tcaggagatgtgttggtgatggat 138Reverse cgtctggttgaggatgtgactc

H-FABP NM_001030889 Forward tgaccaaacccaccaccatca 203Reverse tgtctccttcccatcccacttc

L-CPT1 AY675193 Forward ggagaacccaagtgaaagtaatgaa 135Reverse gaaacgacataaaggcagaacaga

LCAD NM_001006511 Forward cgtggtgattgtggttacggtta 203Reverse tgttctctttcccaagcaaggc

AMPKα2 DQ340396 Forward gggacctgaaaccagagaacg 215Reverse acagaggagggcatagaggatg

Abbreviations: AMPKα2, AMP-activated protein kinase α2; FATP1, fatty acid transportprotein 1; GAPDH, glyceraldehydes-3-phosphate dehydrogenase; H-FABP, heart-fattyacid binding protein; LCAD, long-chain acyl-CoA dehydrogenase; LPL, lipoproteinlipase; L-CPT1, liver-carnitine palmitoyltransferase 1.

Table 3Effect of DEX treatment (daily subcutaneously injection of 2 mg/kg BM for 3 days) andfeed restriction on the yield of skeletal muscle and the fat content in skeletal muscle andadipose tissues of broiler chickens.

Control DEX FR Probability

Breast muscleMuscle yield, g 28.26±0.71 27.22±0.79 26.73±1.16 NSFat content, % 3.96±0.33 4.13±0.32 3.17±0.27 0.0898

Thigh muscleMuscle yield, g 59.12±1.77a 52.27±1.11b 52.91±1.20b 0.0025Fat content, % 3.62±0.56 4.54±0.56 3.38±0.40 NS

Abdominal fat, g 3.58±0.12b 4.21±0.19a 3.24±0.13b 0.0003Subcutaneous fat

Cervical fat, g 3.34±0.14ab 3.66±0.13a 3.20±0.16b 0.1203Thigh fat, g 2.20±0.08b 2.56±0.13a 2.19±0.10b 0.0255

Values are means±SE (n=12).NS: not significant, PN0.05.a, b: Means within the same line with different superscript differ significantly, Pb0.05.

449X. Wang et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 447–454

magnesium chloride 5 mM, EDTA 0.8 mM, dithiothreitol 0.8 mM,SAMS peptide 0.2 mM, γ-[32P]ATP 0.2 mM, AMP 0.2 mM, glycerol 8%,and triton X-100 0.01%) for 30 min at 30 C. An aliquot of eachsupernatant was spotted on phosphocellulose paper, washed in 1%phosphoric acid and then in acetone. After being air-dried, theincorporated radioactivity was measured in a SN-6930 scintillationcounter (Nucleus Research Institute Rihuan Photoelectric InstrumentCo., Ltd. Shanghai, P. R. China).

Gene expression was measured by using real-time RT-PCR. Briefly,total RNA from PM and BF was extracted using Trizol (Invitrogen, SanDiego, CA, USA), The quantity and quality of the isolated RNA weredetermined by biophotometer (Eppendorf, Hamburg, Germany) andagarose-gel electrophoresis, respectively, and then, reverse transcrip-tion was carried out using an RT reactions (10 μL) consisted of 500 ngtotal RNA, 5 mmol/LMgCl2, 1 μL RT buffer, 1 mmol/L dNTP, 2.5 U AMV,0.7 nmol/L oligo d(T) and 10 U Ribonuclease inhibitor (TaKaRaBiotechnology, Co., Ltd. Dalian, P. R. China). cDNA was amplified in a20 μL PCR reaction containing 0.2 µmol/L of each specific primer(Sangon Biological Engineering Technology & Service Co., Ltd.Shanghai, P. R. China) and SYBR green master mix (TaKaRaBiotechnology, Co., Ltd. Dalian, P. R. China). Each cycle consisted ofdenaturation at 95 °C for 10 s, annealing at 95 °C for 5 s, and extensionat 60 °C for 34 s. Glyceraldehyde-3-phosphate dehydrogenase(GAPDH) was amplified as an internal control to normalize thedifferences in individual samples. The primer sequences for chickenLPL, FATP1, H-FABP, L-CPT1, LCAD, AMPKα2 and GAPDH are listed inTable 1.

The PCR products were verified by electrophoresis on a 0.8%agarose-gel and by DNA sequencing. Standard curves were generatedusing pooled cDNA from the samples being assayed, and thecomparative cycle threshold (CT) method (2−ΔΔCT) was used toquantitate mRNA expression according to Livak and Schmittgen

Table 2Effect of DEX treatment (daily subcutaneously injection of 2 mg/kg BM for 3 days) andfeed restriction on the growing performance of broiler chickens.

Control DEX FR Probability

Body mass gain, g/days 25.1±0.7a 15.4±2.1b 23.1±0.5a 0.0045Feed intake, g/days 46.9±0.7a 47.5±0.8a 43.9±0.4 b 0.0202Feed:gain, g/g 1.87±0.02b 3.22±0.46a 1.90±0.03b 0.0180

Values are means±SE (n=3).a, b: means within the same line with different superscripts differ significantly, Pb0.05.

(2001). All samples were run in duplicates, and primers weredesigned spanning an intron to avoid genomic DNA contamination.

2.4. Statistical analysis

All the data were subjected to one-way ANOVA analysis by usingStatistical Analysis Systems statistical software package (Version 8e,SAS Institute, Cary, NC, USA) and themain effect of DEX treatmentwasevaluated. Means were considered significantly different at Pb0.05.

Fig. 1. Effect of DEX treatment (daily subcutaneously injection of 2 mg/kg BM for3days) and feed restriction on plasma concentrations of glucose (mmol/L), insulin(uIU/mL) and urate (10 mg/L) (A), VLDL (absorbance), TG (mmol/L) and NEFA (mmol/L)(B) of broiler chickens. Values are means±SEM (n=12); a and b: means with differentletters differ significantly (Pb0.05).

450 X. Wang et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 447–454

3. Results

3.1. Animal growth and tissue relative weight

Compared with control chicks, DEX had no significant (PN0.05)effect on feed intake. In contrast, the feed consumption of FR chickswas significantly (Pb0.05) lower than that of control and DEXtreatments (Table 2). Compared with the control and FR chicks, bodymass gain (Pb0.01) and feed efficiency (Pb0.05) of broiler chickswere significantly decreased by DEX treatment, while there was nosignificant difference between control and FR chicks.

The yield of breast muscle was not significantly (PN0.05) affectedby treatments. In contrast, the thigh yield of control chicks wassignificantly (Pb0.01) higher compared with both DEX and FRtreatments (Table 3). The fat content in BF was not significantly(PN0.05) altered by treatments. In PM, however, the FR chicks tendedto have lower fat content in breast muscle (P=0.0898) comparedwith control or DEX treatment. Compared with both control and FRgroups, DEX chicks had significantly higher levels of abdominal fat(Pb0.001) and subcutaneous fat in thigh (Pb0.05).

3.2. Plasma parameters

Neither the plasma level of glucose nor insulin was significantlyaffected (PN0.05) by different treatments (Fig. 1A). In contrast, uratewas significantly (Pb0.001) increased by DEX treatment comparedwith both control and FR chicks. Plasma concentration of NEFA wassignificantly (Pb0.05) high in FR chicks compared with either DEX or

Fig. 2. Effect of DEX treatment (daily subcutaneous injection of 2 mg/kg BM for 3 days)and feed restriction on activities of LPL (A) and AMPK (B) in PM (M. pectoralis major) andBF (M. biceps femoris) of broiler chickens. CPM: count per minute. Values are means±SEM (n=8); a and b: means with different letters differ significantly (Pb0.05).

Fig. 3. Effect of DEX treatment (daily subcutaneously injection of 2 mg/kg BM for3 days) and feed restriction on gene expression of fatty acid uptake (A) and utilization(B) in PM (M. pectoralis major) of broiler chickens. Values are means±SEM (n=8);a and b: means with different letters differ significantly (Pb0.05).

control treatment (Fig. 1B). In reverse, the VLDL concentration tendedto be increased by DEX treatment (P=0.0867) compared with FRchicks. The level of TG was not significantly (PN0.05) altered bytreatments.

3.3. Enzyme activity

Muscle LPL activity was higher in BF than in PM, and the DEXchicks had lower LPL activity compared with FR treatment in BF(Pb0.05) but not in PM (PN0.05) (Fig. 2A). In contrast, muscle AMPKactivity was consistent in PM and BF and tended to be increased in FRchicks (Fig. 2B) compared with control group at least in PM muscle(P=0.0561).

3.4. Enzyme mRNA level

In PM, DEX treatment had no significant effect (PN0.05) on themRNA levels of LPL, FATP1, H-FABP, L-CPT1, LCAD and AMPKα2,compared with control group. In contrast, FR chicks had significantlyhigher level of LPL (Pb0.0001), L-CPT1 (Pb0.01) and LCAD (Pb0.01)mRNA levels compared with both control and DEX groups (Fig. 3).

The mRNA levels of LPL, FATP1, H-FABP and LCAD were notaffected significantly (PN0.05) by DEX compared with control groupin BF muscle (Fig. 4). However, the expressions of L-CPT1 andAMPKα2 were significantly (Pb0.001) suppressed by DEX treatment,compared with either control or FR treatment. Compared with con-trol group, the mRNA levels of FATP1 (Pb0.01), H-FABP (Pb0.0001),L-CPT1 (Pb0.001) and LCAD (Pb0.0001) were all significantly up-

Fig. 4. Effect of DEX treatment (daily subcutaneously injection of 2 mg/kg BM for3 days) and feed restriction on gene expression of fatty acid uptake (A) and utilization(B) in BF (M. biceps femoris) of broiler chickens. Values are means±SEM (n=8); a, b,and c: means with different letters differ significantly (Pb0.05).

451X. Wang et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 447–454

regulated in FR chicks. There was no significant difference (PN0.05) inmRNA levels of LPL and AMPKα2 between control and FR groups.

4. Discussion

The primary objective of the present study was to investigatewhether exogenous GC administration would result in altered fattyacid utilization, leading to intramyocellular lipid accumulation. Inorder to define the effect of DEX, a mild feed-restricted group wasdesigned and the expressions of genes related to fatty acid oxidationwere measured under a 12-h fasting status.

4.1. Effect of DEX and feed restriction treatments on the development ofBM, skeletal muscle and adipose tissues

In accordance with previous works (Bowes et al., 1996; Malheiroset al., 2003; Lin et al., 2004, 2006, 2007), the present result indicatedthat GCs retarded body mass growth. Yuan et al. (2008) reported thedecreased caloric efficiency and augmented energy expenditureshould be responsible for the decreased feed efficiency by GCs. Inthe present study, the significantly enhanced fat accumulation ofabdominal and subcutaneous adipose tissues in DEX chicks comparedwith both control (abdominal fat, +17.6%; cervical fat, +9.6%; andthigh fat, +16.4%) and FR chicks (abdominal fat, +29.9%; cervical fat,+14.4%; thigh fat, +16.9%) contributed to the decreased feedefficiency by DEX as well. Compared with control, the DEX chicksgained less thigh muscle while the development of breast muscle was

not affected, indicating the tissue specificity and the high suscepti-bility of thigh muscle to the effect of GCs.

The stimulating effect of GCs on fat accumulation in adipose tissueshad been proven by many studies (Bartov et al., 1980a, b; Bartov,1985; Buyse et al., 1987; Kafri et al., 1988; Lin et al., 2006). Theincreased hepatic de novo lipogenesis and circulating lipid flux wereresponsible for the fat accumulation in abdominal and peripheraladipose tissues induced by DEX (Cai et al., 2009). The simultaneouslyretarded development of skeletal muscle with enhanced fat storeindicated the altered energy redistribution toward lipid deposition(Jiang et al., 2008; Yuan et al., 2008). In the present study, theintramyocellular lipid content was slightly but not significantlyincreased by DEX compared with control (breast, +4.3%; thigh,+25.4%) and FR (breast, +30.3%; thigh, +34.3%). Korach-André et al.(2005) reported that DEX had minimal effects on visceral fataccumulation while increased intramyocellular lipid levels in ratmodels (8-weeks old). In modern broilers, feed efficiency, as one ofthe traits that are extensively selected, is negatively correlated withthe capacity of fat deposition (N'Dri et al., 2006). Moreover, the youngbroilers in the initial growing period (10 days of age) deposit lessamount of fat (Zerehdaran et al., 2004). Therefore, the promotingeffect of DEX on the intramyocellular lipid accumulation needs to beinvestigated further.

In mammals, the up-regulated circulating corticosterone togetherwith the altered insulin sensitivity was involved in the enhanced fatdeposition (Freedman et al., 1986; Geraert et al., 1996). At feedingstatus, the induced hyperinsulinism was suggested to be responsiblefor the enhanced fat deposition in GCs-challenged chickens (Yuanet al., 2008; Cai et al., 2009). In this work, insulin as well as glucosewas not significantly changed by DEX at fasting status (12 h). Theresult indicates that the gentle balance between glucose and insulincould bemaintained in DEX chicks during fasting status, rather than infeeding status (Jiang et al., 2008; Yuan et al., 2008).

4.2. Effect of DEX on muscle fatty acid transport and oxidation

In line with the previous works (Yuan et al., 2008; Cai et al., 2009),circulating level of VLDL was increased by DEX, which was related tothe enhanced hepatic de novo lipogenesis by DEX (Bartlett andGibbons, 1988; Cai et al., 2009). The increased blood concentrations ofVLDL are facilitated to lipid utilization by peripheral tissues.

In mammals, increased LPL activity was strongly associated withfat deposition, which was regulated by both insulin and GCs (Friedet al., 1993). Both GCs and starvation increased skeletal muscle LPLactivity in mammals (Lithell et al., 1981; Nikkilä, 1987; Ladu et al.,1991). However, the mRNA expression of LPL seemed to be lesssensitive to these physiological regulators in rats (Enerbäck andGimble, 1993; Ong et al., 1994). As LPL activity and its mRNAexpression in both PM and BF were not significantly influenced byDEX in the present work, circulating VLDL level in DEX chicks wasmaintained at a comparable but not significantly increased levelcompared with control, therefore DEX may not alter the fatty aciduptake from circulation into skeletal muscle. As both the concentra-tions of VLDL and TG were significantly increased by GCs in feedingstatus (Yuan et al., 2008), it is speculated that the augmentedcirculating lipid fluxwould facilitate the fatty acids uptake intomuscletissue.

FATP1 and H-FABP have been proven to facilitate long-chain fattyacid (LCFA) uptake and utilization in both skeletal and cardiacmuscles (Corcoran et al., 2007). In the present study, the transcriptionlevels of FATP1 and H-FABP were not significantly affected by DEX ineither PM or BF compared with control, indicating the unaffected fattyacid transport into muscle cells.

In the present study, the expression of L-CPT1 was investigated asthat L-CPT1 mRNA expression seemed to be more sensitive than thatof M-CPT1 to energy deficit (Skiba-Cassy et al., 2007). The result

452 X. Wang et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 447–454

showed theexpressionsof L-CPT1 and LCADwerenot affectedbyDEX inPM compared with control, indicating that fatty acid oxidation was notincreased in PM by DEX. In contrast, the expression of L-CPT1 wassignificantly down-regulated in BF by DEX, suggesting that fatty acidutilization was suppressed in red muscle by DEX. This speculation wassupported by the observation that thigh muscle had relatively higherlipid content compared with control (thigh, +25.4% vs. breast, +4.3%)in DEX treatment. Taken together, the result implied that the increasedfatty acid availability together with the unaffected or suppressed fattyacid oxidation lead to increased intramuscular TG stores.

In rats, acute DEX treatment promoted ACC phosphorylation, andincreased cardiac palmitate oxidation, likely through its effects onincreasing AMPK phosphorylation and total AMPK protein and geneexpression (Qi et al., 2006). In the present study, similar to the changein L-CPT1 expression, AMPKα2 mRNA level was down-regulated inBF, suggesting the partner relationship between AMPK and CPT1. Thisresult is also in line with the increased fat content in BF. As the activityof AMPK was not significantly affect by DEX in either PM or BF, theeffect of AMPK in the regulation of fatty acid oxidation needs to bestudied further. Moreover, the different responses in AMPK mRNAexpression in PM and BF showed the effect of GCs on AMPK activitywas tissue-dependent, in line with previous work (Christ-Crain et al.,2008).

4.3. Effect of mild feed restriction on fatty acid oxidation

The LPL mRNA expression in abdominal adipose of broilers wasless responsive to aging and nutritional manipulation than inmammals (Sato and Akiba, 2002). In contrast, the transcription levelof LPL in PM and BF respectively increased 4.66- and 1.98-fold by mildfeed restriction compared with control, indicating that mild restric-tion could stimulate the gene expression of LPL in skeletal muscle. Inaccordance with the previous work (Chartrin et al., 2007), however,feed restriction had no effect on the LPL activity in skeletal muscle,indicating that the up-regulated LPL transcription may not beconsistent with the LPL activity. Moreover, the relative higher levelof LPL activity in BF compared with PM was in line with the fatty acidoxidation capacity (He et al., 2001). However, the relatively higher LPLactivity (1.29 fold) in BF by feed restriction compared with DEXindicated that the uptake of fatty acids is differently changed in thetwo physiological statuses.

The up-regulated expression of FATP1 (1.88 fold) and H-FABP(3.26 fold) in BF by feed restriction compared with control, was inaccordance with the previous works in mammals (Carey et al., 1994;Man et al., 1996). Fasting increased FATP1 gene expression in mouseadipose tissue, whereas refeeding restored the basal levels (Man et al.,1996). The level of both H-FABP protein and mRNA increasedapproximately 2-fold in fasting rats (Carey et al., 1994). In obesewomen, the increased content of H-FABP was associated with theincreased capacity of intracellular fatty acid transport in skeletalmuscle cells to facilitate the physiological adaptations of fatmetabolism to energy restriction (Kempen et al., 1998). The resultsuggested that feed restriction could facilitate the utilization of fattyacid by skeletal muscles. Furthermore, the significantly up-regulatedexpressions in FATP1 (3.08 fold) and H-FABP (4.23 fold) in BF of feed-restricted chicks compared with DEX indicated that the mode of fattyacids utilization in GCs-stressed status is different from that of mildenergy deficit induced by feed restriction.

In PM, however, the expression of FATP1 and H-FABP was notsignificantly affected, indicating that fatty acid utilization was moreenhanced in BF, the red muscle, compared with PM, the white one.This assertion was supported by the observation that fatty acidoxidative enzyme activity and fat content were higher in type I musclefiber than that in type II (He et al., 2001). Our results implied the tissuespecificity in fatty acid utilization was changed by feed restriction andred muscle had a higher capacity of fatty acid oxidation. Also, short-

term fasting on rats significantly increased plasma membrane FABP(FABPpm) protein content by 60% in red skeletal muscle while nochange was measured in white skeletal muscle (Turcotte et al., 1997).

The transcription levels of L-CPT1 and LCAD were increased to2.98- and 4.18-fold in PM and 2.36- and 1.82-fold in BF by feedrestriction compared with control, in line with the work of Abe et al.(2006), who reported that the transcription level of L-CPT1 reachedthe highest level (9.5-fold) after a 24 h fast, whereas the expression ofLCADwas gradually up-regulated from 12 to 48 h of fasting in skeletalmuscle of chickens. The enhanced L-CPT1 indicated the increasedmitochondrial fatty acid oxidation (Sebastián et al., 2009), and this isfurther corroborated by the over-expression of FATP1, increasing themitochondrial transport of fatty acid. Taken together, our resultssuggested that food restriction more effectively improved fatty acidoxidation in BF compared to PM. Compared with DEX treatment, mildfeed restriction improved the fatty acids oxidation as indicated bythe significantly higher levels of L-CPT1 and LCADmRNA in both PM (L-CPT1, 1.83 fold; LCAD 1.73 fold) and BF (L-CPT1, 39.3 fold; LCAD, 3.50fold). The results suggest that skeletal muscle tends to save rather thanto utilize energy from fatty acids under stress conditions, whereas itenhances the utilization of fatty acids in feed-restricted status.

Compared with control, the activity of AMPK in PM and BF wasdoubled by feed restriction, whereas the AMPKα2 mRNA level wasnot changed in both PM and BF. In line with this observation, thephosphorylation of AMPK α subunits increased modestly after 48 hfasting, while no change in mRNA expression of the two AMPK αsubunit genes in chicken liver was observed in response to fasting orrefeeding (Proszkowiec-Weglarz et al., 2009). The result suggestedthat AMPK activity rather than AMPK α transcription level could beup-regulated by feed restriction in skeletal muscle. Moreover, in rats,it was suggested that an increased AMPKα2 activity is not essential forincreased skeletal muscle fatty acid oxidation during enduranceexercise (Miura et al., 2009).

In conclusion, DEX retards the body mass gain but facilitates lipidaccumulation in both adipose and skeletal muscle. In contrast to thefavorable effect of mild feed restriction, DEX did not alter the uptakeof fatty acids in skeletal muscle. The result suggests that DEX maypromote intramyocellular lipid accumulation by suppressed fatty acidoxidation while mild feed restriction improved fatty acid oxidation inskeletal muscle, especially in red muscle. GCs regulated muscle fattyacid metabolism in a different way from energy deficit caused by mildfeed restriction.

Acknowledgements

This work was supported by grants from Shandong Science Fund forDistinguished Youth Scholars, National Basic Research Programof China(2004CB117507), National Natural Science Foundation of China(No. 30771573) and the Doctoral Program of Higher Education (RFDP).

References

Abe, T., Mujahid, A., Sato, K., Akiba, Y., Toyomizu, M., 2006. Possible role of avianuncoupling protein in down-regulating mitochondrial superoxide production inskeletal muscle of fasted chickens. FEBS Letts. 580, 4815–4822.

Bartlett, S.M., Gibbons, G.F., 1988. Short- and longer-term regulation of very-low-density lipoprotein secretion by insulin, dexamethasone and lipogenic substratesin cultured hepatocytes. A biphasic effect of insulin. Biochem. J. 249, 37–43.

Bartov, I., 1985. Effects of dietary protein concentration and corticosterone injections onenergy and nitrogen balances and fat deposition in broiler chicks. Br. Poult. Sci. 26,311–324.

Bartov, I., Jensen, L.S., Veltmann, J.R., 1980a. Effect of corticosterone and prolactin onfattening in broiler chicks. Poult. Sci. 59, 1328–1334.

Bartov, I., Jensen, L.S., Veltmann, J.R., 1980b. Effect of dietary protein and fat levels onfattening of corticosterone-injected broiler chicks. Poult. Sci. 59, 1864–1872.

Beaudrap, P.De., Witten, G., Biltz, G., Perrier, E., 2006. Mechanistic model of fuelselection in the muscle. J. Theor. Biol. 242, 151–163.

Bowes, S.B., Jackson, N.C., Papachristodoulou, D., Umpleby, A.M., Sönksen, P.H., 1996.Effect of corticosterone on protein degradation in isolated rat soleus and extensordigitorum longus muscles. J. Endocrinol. 148, 501–507.

453X. Wang et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 447–454

Braun, E.J., Sweazea, K.L., 2008. Glucose regulation in birds. Comp. Biochem. Physiol. B151, 1–5.

Buyse, J., Decuypere, E., Sharp, P.J., Huybrechts, L.M., Kuhn, E.R., Whitehead, C., 1987.Effect of corticosterone on circulating concentrations of corticosterone, prolactin,thyroid hormones and somatomedin-C and on fattening in broilers selected forhigh or low fat content. J. Endocrinol. 112, 229–237.

Cai, Y.L., Song, Z.G., Zhang, X.H., Wang, X.J., Jiao, H.C., Lin, H., 2009. Increased de novolipogenesis in liver contributes to the augmented fat deposition in dexamethasoneexposed broiler chickens (Gallus gallus domesticus). Comp. Biochem. Physiol. C 150,164–169.

Carey, J.O., Neufer, P.D., Farrar, R.P., Veerkamp, J.H., Dohm, G.L., 1994. Transcriptionalregulation of muscle fatty acid-binding protein. Biochem. J. 298, 613–617.

Chartrin, P., Bernadet, M.D., Guy, G., Mourot, J., Hocquette, J.F., Rideau, N., Duclos, M.J.,Baéza, E., 2007. Do age and feeding levels have comparable effects on fat depositionin breast muscle of mule ducks? Animal 1, 113–123.

Christ-Crain, M., Kola, B., Lolli, F., Fekete, C., Seboek, D., Wittmann, G., Feltrin, D., Igreja,S.C., Ajodha, S., Harvey-White, J., Kunos, G., Müller, B., Pralong, F., Aubert, G.,Arnaldi, G., Giacchetti, G., Boscaro, M., Grossman, A.B., Korbonits, M., 2008. AMP-activated protein kinase mediates glucocorticoid-induced metabolic changes: anovel mechanism in Cushing's syndrome. FASEB J. 22, 1672–1683.

Close, B., Banister, K., Baumans, V., Bernoth, E.M., Bromage, N., Bunyan, J., Erhardt, W.,Flecknell, P., Gregory, N., Hackbarth, H., Morton, D., Warwick, C., 1997.Recommendations for euthanasia of experimental animals: Part 2. DGXT of theEuropean Commission. Lab. Anim. 31, 1–32.

Corcoran, M.P., Lamon-Fava, S., Fielding, R.A., 2007. Skeletal muscle lipid deposition andinsulin resistance: effect of dietary fatty acids and exercise. Am. J. Clin. Nutr. 85,662–677.

Davies, S.P., Carling, D., Hardie, D.G., 1989. Tissue distribution of the AMP-activatedprotein kinase, and lack of activation by cyclic-AMP-dependent protein kinase,studied using a specific and sensitive peptide assay. Eur. J. Biochem. 186, 123–128.

Dong, H., Lin, H., Jiao, H.C., Song, Z.G., Zhao, J.P., Jiang, K.J., 2007. Altered developmentand protein metabolism in skeletal muscle of broiler chickens (Gallus gallusdomesticus) by corticosterone. Comp. Biochem. Physiol. A 147, 189–195.

Dupont, J., Dagou, C., Derouet, M., Simon, J., Taouis, M., 2004. Early steps of insulinreceptor signaling in chicken and rat: apparent refractoriness in chicken muscle.Domest. Anim. Endocrinol. 26, 127–142.

Eaton, S., 2002. Control of mitochondrial β-oxidation flux. Prog. Lipid. Res. 41, 197–239.Enerbäck, S., Gimble, J.M., 1993. Lipoprotein lipase gene expression: physiological

regulators at the transcriptional and post-transcriptional level. Biochim. Biophys.Acta. 1169, 107–125.

Folch, J., Lees, M., Sloane Stanley, G.H., 1957. A simple method for the isolation andpurification of total lipids from animal tissues. J. Biol. Chem. 226, 497–509.

Foucaud, L., Niot, I., Kanda, T., Besnard, P., 1998. Indirect dexamethasone down-regulation of the liver fatty acid-binding protein expression in rat liver. Biochim.Biophys. Acta. 1391, 204–212.

Freedman, M.R., Horwitz, B.A., Stern, J.S., 1986. Effect of adrenalectomy and glucocorticoidreplacement on development of obesity. Am. J. Physiol. 250, R595–607.

Fried, S.K., Russell, C.D., Grauso, N.L., Brolin, R.E., 1993. Lipoprotein lipase regulation byinsulin and glucocorticoid in subcutaneous and omental adipose tissues of obesewomen and men. J. Clin. Invest. 92, 2191–2198.

Geraert, P.A., Padilha, J.C.F., Guillaumin, S., 1996. Metabolic and endocrine changesinduced by chronic heat exposure in broiler chickens: biological and endocrino-logical variables. Brit. J. Nutr. 75, 205–216.

Goldberg, I.J., 1996. Lipoprotein lipase and lipolysis: central roles in lipoproteinmetabolism and atherogenesis. J. Lipid. Res. 37, 693–707.

Griffin, H.D., Whitehead, C.C., 1982. Plasma lipoprotein concentration as an indicator offatness in broilers: development and use of a simple assay for plasma very lowdensity lipoproteins. Br. Poult. Sci. 23, 307–313.

Hardie, D.G., Carling, D., 1997. The AMP-activated protein kinase: fuel gauge of themammalian cells? Eur. J. Biochem. 246, 259–273.

Hardie, D.G., Carling, D., Carlson, M., 1998. The AMP-activated/SNF1 protein kinasesubfamily: metabolic sensors of the eukaryotic cell? Annu. Rev. Biochem. 67,821–855.

Hardie, D.G., Scott, J.W., Pan, D.A., Hudson, E.R., 2003. Management of cellular energy bythe AMP-activated protein kinase system. FEBS Lett. 546, 113–120.

He, J., Watkins, S., Kelley, D.E., 2001. Skeletal muscle lipid content and oxidative enzymeactivity in relation to muscle fiber type in type 2 diabetes and obesity. Diabetes 50,817–823.

Izai, K., Uchida, Y., Orii, T., Yamamoto, S., Hashimoto, T., 1992. Novel fatty acid beta-oxidation enzymes in rat liver mitochondria. I. Purification and properties of very-long-chain acyl-coenzyme A dehydrogenase. J. Biol. Chem. 267, 1027–1033.

Jiang, K.J., Jiao, H.C., Song, Z.G., Yuan, L., Zhao, J.P., Lin, H., 2008. Corticosteroneadministration and dietary glucose supplementation enhance fat accumulation inbroiler chickens. Br. Poult. Sci. 49, 625–631.

Kafri, I., Rosebrough, R.W., McMurtry, J.P., Steele, N.C., 1988. Corticosterone implantsand supplemental dietary ascorbic acid effects on lipid metabolism in broilerchicks. Poult. Sci. 67, 1356–1359.

Kelley, D.E., Goodpaster, B.H., 2001. Skeletal muscle triglyceride: an aspect of regionaladiposity and insulin resistance. Diabetes Care 24, 933–941.

Kempen, K.P.G., Saris, W.H.M., Kuipers, H., Glatz, J.F.C., Van Der Vusse, G.J., 1998. Skeletalmuscle metabolic characteristics before and after energy restriction in humanobesity: fibre type, enzymatic beta-oxidative capacity and fatty acid-bindingprotein content. Eur. J. Clin. Invest. 28, 1030–1037.

Korach-André, M., Gao, J., Gounarides, J.S., Deacon, R., Islam, A., Laurent, D., 2005.Relationship between visceral adiposity and intramyocellular lipid content in tworat models of insulin resistance. Am. J. Physiol. Endocrinol. Metab. 288, E106–116.

Ladu, M.J., Kapsas, H., Palmer, W.K., 1991. Regulation of lipoprotein lipase in adiposeand muscle tissues during fasting. Am. J. Physiol. Regul. Integr. Comp. Physiol. 260,953–959.

Lin, H., Decuypere, E., Buyse, J., 2004. Oxidative stress induced by corticosteroneadministration in broiler chickens (Gallus gallus domesticus): 1. Chronic exposure.Comp. Biochem. Physiol. B 139, 737–744.

Lin, H., Sui, S.J., Jiao, H.C., Buyse, J., Decuypere, E., 2006. Impaired development of broilerchickens by stress mimicked by corticosterone exposure. Comp. Biochem. Physiol.A 143, 400–405.

Lin, H., Sui, S.J., Jiao, H.C., Jiang, K.J., Zhao, J.P., Dong, H., 2007. Effects of diet and stressmimicked by corticosterone administration on early postmortem muscle metab-olism of broiler chickens. Poult. Sci. 86, 545–554.

Lithell, H., Cedermark, M., Fröberg, J., Tesch, P., Karlsson, J., 1981. Increase oflipoprotein-lipase activity in skeletal muscle during heavy exercise. Relation toepinephrine excretion. Metabolism 30, 1130–1134.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) method. Methods 25, 402–408.

Maatman, R.G.H.J., Van Moerkerk, H.T.B., Nooren, I.M.A., Van Zoelen, E.J.J., Veerkamp, J.H.,1994. Expression of human liver fatty acid binding protein in Escherichia coli andcomparative analysis of its binding characteristics with muscle fatty acid bindingprotein. Biochim. Biophys. Acta 1214, l–10.

Macfarlane, D.P., Forbes, S., Walker, B.R., 2008. Glucocorticoids and fatty acidmetabolism in humans: fuelling fat redistribution in the metabolic syndrome.J. Endocrinol. 197, 189–204.

Malheiros, R.D., Moraes, V.M.B., Collin, A., Decuypere, E., Buyse, J., 2003. Free dietselection by broilers as influenced by dietary macronutrient ratio and corticoste-rone supplementation: 1. Diet selection, organ weights, and plasma metabolites.Poult. Sci. 82, 123–131.

Man, M.Z., Hui, T.Y., Schaffer, J.E., Lodish, H.F., Bernlohr, D.A., 1996. Regulation of themurine adipocyte fatty acid transporter gene by insulin. Mol. Endocrinol. 10,1021–1028.

Matteri, R.L., Carroll, J.A., Dyer, C.J., 2000. Neuroendocrine responses to stress. In:Moberg, G.P., Mench, J.A. (Eds.), The Biology of Animal Stress. CAB InternationalWallingford, OXON, pp. 43–76.

McClelland, G.B., 2004. Fat to the fire: the regulation of lipid oxidation with exercise andenvironmental stress. Comp. Biochem. Physiol. B 139, 443–460.

McGarry, J.D., Brown, N.F., 1997. The mitochondrial carnitine palmitoyltransferasesystem. From concept to molecular analysis. Eur. J. Biochem. 244, 1–14.

McGarry, J.D., Woeltje, K.F., Kuwajima, M., Foster, D.W., 1989. Regulation of ketogenesisand the renaissance of carnitine palmitoyltransferase. Diabetes. Metab. Res. Rev. 5,271–284.

Miura, S., Kai, Y., Kamei, Y., Bruce, C.R., Kubota, N., Febbraio, M.A., Kadowaki, T., Ezaki, O.,2009. α2-AMPK activity is not essential for an increase in fatty acid oxidationduring low-intensity exercise. Am. J. Physiol. Endocrinol. Metab. 296, E47–55.

N'Dri, A.L., Mignon-Grasteau, S., Sellier, N., Tixier-Boichard, M., Beaumont, C., 2006.Genetic relationships between feed conversion ratio, growth curve and bodycomposition in slow-growing chickens. Br. Poult. Sci. 47, 273–280.

Nikkilä, E.A., 1987. Role of lipoprotein lipase in metabolic adaptation to exercise andtraining. In: Borensztajn, J. (Ed.), lipoprotein lipase. Evener, Chicago, IL, pp. 187–199.

Ong, J.M., Simsolo, R.B., Saghizadeh, M., Pauer, A., Kern, P.A., 1994. Expression oflipoprotein lipase in rat muscle: regulation by feeding and hypothyroidism. J. Lipid.Res. 35, 1542–1551.

Proszkowiec-Weglarz, M., Richards, M.P., Ramachandran, R., McMurtry, J.P., 2006.Characterization of the AMP-activated protein kinase pathway in chickens. Comp.Biochem. Physiol. B 143, 92–106.

Proszkowiec-Weglarz, M., Richards, M.P., Humphrey, B.D., Rosebrough, R.W., McMur-try, J.P., 2009. AMP-activated protein kinase and carbohydrate response elementbinding protein: a study of two potential regulatory factors in the hepatic lipogenicprogram of broiler chickens. Comp. Biochem. Physiol. B 154, 68–79.

Qi, D., An, D., Kewalramani, G., Qi, Y., Pulinilkunnil, T., Abrahani, A., Al-Atar, U., Ghosh, S.,Wambolt, R.B., Allard, M.F., Innis, S.M., Rodrigues, B., 2006. Altered cardiac fatty acidcomposition and utilization following dexamethasone-induced insulin resistance.Am. J. Physiol. Endocrinol. Metab. 291, E420–427.

Ruderman, N.B., Saha, A.K., 2006. Metabolic syndrome: adenosine monophosphate-activated protein kinase and malonyl coenzyme A. Obesity 14, 25S–33S.

Saha, A.K., Ruderman, N.B., 2003. Malonyl-CoA and AMP-activated protein kinase: anexpanding partnership. Mol. Cell. Biochem. 253, 65–70.

Sato, K., Akiba, Y., 2002. Lipoprotein lipase mRNA expression in abdominal adiposetissue is little modified by age and nutritional state in broiler chickens. Poult. Sci.81, 846–852.

Sebastián, D., Guitart, M., García-Martínez, C., Mauvezin, C., Orellana-Gavaldà, J.M., Serra,D., Gómez-Foix, A.M., Hegardt, F.G., Asins, G., 2009. Novel role of FATP1 inmitochondrial fatty acid oxidation in skeletalmuscle cells. J. Lipid. Res. 50, 1789–1799.

Simon, J., Freychet, P., Rosselin, G., 1974. Chicken insulin: radioimmunologicalcharacterization and enhanced activity in rat fat cells and liver plasma membranes.Endocrinology 95, 1439–1449.

Skiba-Cassy, S., Collin, A., Chartrin, P., Médale, F., Simon, J., Duclos, M.J., Tesseraud, S.,2007. Chicken liver and muscle carnitine palmitoyltransferase 1: nutritionalregulation of messengers. Comp. Biochem. Physiol. B 147, 278–287.

Turcotte, L.P., Srivastava, A.K., Chiasson, J.L., 1997. Fasting increases plasma membranefatty acid-binding protein (FABPPM) in red skeletal muscle. Mol. Cell. Biochem. 166,153–158.

Urdaneta-Rincon, M., Leeson, S., 2002. Quantitative and qualitative feed restriction ongrowth characteristics of male broiler chickens. Poult. Sci. 81, 679–688.

Vannieuwenhoven, F.A., Verstijnen, C.P.H.J., Abumrad, N.A., Willemsen, P.H.M., Vaneys,G.J.J.M., Vandervusse, G.J., Glatz, J.F.C., 1995. Putative membrane fatty acid

454 X. Wang et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 447–454

translocase and cytoplasmic fatty-acid-binding protein are co-expressed in ratheart and skeletal muscle. Biochim. Biophys. Res. Commun. 207, 747–752.

Veerkamp, J.H., Van Moerkerk, H.T.B., 1993. Fatty acid-binding protein and its relationto fatty acid oxidation. Mol. Cell. Biochem. 123, 101–106.

Winder, W.W., Hardie, D.G., 1996. Inactivation of acetyl-CoA carboxylase and activationof AMP-activated protein kinase in muscle during exercise. Am. J. Physiol.Endocrinol. Metab. 270, E299–304.

Ye, J.M., Ruderman, N.B., Kraegen, E.W., 2005. AMP-activated protein kinase andmalonyl-CoA: targets for treating insulin resistance? Drug Discovery Today:Therapeutic Strategies 2, 157–163.

Yuan, L., Lin, H., Jiang, K.J., Jiao, H.C., Song, Z.G., 2008. Corticosterone administration andhigh-energy feed results in enhanced fat accumulation and insulin resistance inbroiler chickens. Bri. Poult. Sci. 49, 487–495.

Zerehdaran, S., Vereijken, A.L.J., van Arendonk, J.A.M., van der Waaijt, E.H., 2004.Estimation of genetic parameters for fat deposition and carcass traits in broilers.Poult. Sci. 83, 521–525.

Zhao, J.P., Lin, H., Jiao, H.C., Song, Z.G., 2009. Corticosterone suppresses insulin- and NO-stimulated muscle glucose uptake in broiler chickens (Gallus gallus domesticus).Comp. Biochem. Physiol. C 149, 448–454.