dietary garcinol supplementation improves diarrhea and ... · in addition, garcinol may inhibit the...

RESEARCH Open Access

Dietary garcinol supplementation improvesdiarrhea and intestinal barrier functionassociated with its modulation of gutmicrobiota in weaned pigletsTongxin Wang, Weilei Yao, Juan Li, Yafei Shao, Qiongyu He, Jun Xia and Feiruo Huang*

Abstract

Background: The effects of dietary garcinol on diarrhea and intestinal barrier function associated with itsmodulation of gut microbiota in weaned piglets were investigated.

Method: One hundred forty four weaned piglets (Duroc × Yorkshire × Landrace) from 16 pens (9 piglets per pen)were randomly divided into four treatment groups: controls (CON) or those supplemented with 200 mg/kg (LOW),400 mg/kg (MID), or 600 mg/kg (HIGH) diet garcinol. After 14-day trial, three piglets per pen were chosen to collectplasma, intestinal tissue and colonic digesta samples.

Results: We demonstrated for the first time that garcinol promoted growth performance, as increased averagedaily feed intake (ADFI) and decreased feed/gain ratio (F/G); and reduced diarrhea incidence (P < 0.05); andstrengthened antioxidant capacity, as an increased antioxidative index (P < 0.05). Additionally, garcinol amelioratedintestinal barrier dysfunction, as an increased villus height to crypt depth ratio, increased zonula occludens protein1 (ZO-1), occludin and claudin-1 expression in the jejunum and ileum (P < 0.05), and decreased intestinalpermeability (P < 0.05); and reduced inflammation, as decreased cytokine interleukin (IL)-6, IL-10, IL-1β and tumornecrosis factor-α (TNF-α) levels in the mucosa of the jejunum and ileum, and NF-κB p65 translocation (P < 0.05).Moreover, garcinol inhibited the growth of most harmful bacteria in the gut, especially Escherichia coli, andincreased the growth of the beneficial bacteria Lactobacillus.

Conclusion: This work provides a fundamental basis for the future development of garcinol-functional food use forimproving diarrhea and intestinal barrier function in weaned piglets and for understanding the biological effects ofgarcinol and its potential as a functional feed additive.

Keywords: Diarrhea, Garcinol, Gut microbiota, Intestinal barrier function, Weaned piglets

BackgroundThe weaning period is one of the most stressfulphases in pig production [1]. During this time, pigletsmust rapidly adapt to a multitude of psychosocial andenvironmental stressors [2]. It has already beenproven that in the process of early weaning, pigletssuffer from reduced food intake, diarrhea, atrophy ofvilli in the small intestine and other symptoms, which

affect the digestion and absorption of nutrients [3].Many studies have demonstrated that the two import-ant effects of weaning stress are the change in intes-tinal structure and function of piglets and theimbalance in the intestinal microbiota [4, 5]. Indeed,weaning induces an impairment in intestinal epithelialbarrier function and results in the disruption of theintestinal microecological balance of piglets. Once themicroecological balance is broken, the potential path-ogens in the intestinal tract will invade and colonize,thus causing various diseases, especially inflammationand diarrhea.

© The Author(s). 2020 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

* Correspondence: [email protected] of Animal Nutrition and Feed Science, College of AnimalScience and Technology, Huazhong Agricultural University, Wuhan 430070,China

Wang et al. Journal of Animal Science and Biotechnology (2020) 11:12 https://doi.org/10.1186/s40104-020-0426-6

http://crossmark.crossref.org/dialog/?doi=10.1186/s40104-020-0426-6&domain=pdfhttp://orcid.org/0000-0001-5404-8091http://creativecommons.org/licenses/by/4.0/http://creativecommons.org/publicdomain/zero/1.0/mailto:[email protected]

Dietary interventions offer a viable and practical ap-proach to mitigate intestinal barrier dysfunction atweaning [6]. An overwhelming consensus emergesamong countless evidence showing that plant extractshave beneficial effects on improving the growth per-formance, antioxidant capacity, and immunity of live-stock and poultry and preventing various diseases [7, 8].Recently, it was reported that curcumin and resveratrol,antioxidative plant extracts, can regulate the gut micro-biota of weaned piglets, downregulate the TLR4 signal-ing pathway, alleviate intestinal inflammation, andultimately increase intestinal immune function [9]. Asanother excellent antioxidative plant extract, garcinol,the major component of Garcinia indica (G. indica) fruitrind, has been widely used in the dietary supplementa-tion of rodents [10–12]. Numerous studies have revealedthe effect of garcinol on antioxidant and anti-inflammatory properties [13, 14]. Previous studiesin vivo have indicated that garcinol can eliminate freeradicals and show protective antioxidation effects [15].In addition, garcinol may inhibit the activation of NF-κBand suppress the expression of interleukin IL-1β and IL-6 in the spinal cord of rats [16]. Moreover, garcinol hasbactericidal effects and changes the gut microbiota com-position in mice [17]. Due to these efficacies, garcinolmay be beneficial in improving the growth performance,diarrhea and gut health of weaning pigs.Currently, most of the studies on garcinol have fo-

cused on the anti-inflammatory and antioxidant activ-ities in model mice and human cells. It has long beenreported that oxidative stress can damage the structureand function of the gut of an animal. However, the bene-ficial effects of garcinol on the enhancement of the intes-tinal barrier function and gut microbiota as well as theimprovement of diarrhea in weaned pigs have rarelybeen reported. The purpose of this study was to investi-gate the effects of garcinol on the diarrhea, intestinalbarrier function and gut microbiota of weaned piglets,thus providing a theoretical basis and experimental evi-dence for understanding the biological effects of garcinoland its potential as a functional feed additive.

Material and methodsAnimals and experimental designAll animal protocols used in this study were in accord-ance with the Guidelines for the Care and Use of Ani-mals for Research and Teaching and approved by theAnimal Care and Use Committee of Huazhong Agricul-tural University. A total of 144 weaned pigs (Duroc ×Landrace × Yorkshire) were randomly assigned to 4 diet-ary treatments with 4 replicate pens per treatment. Theirinitial body weight (BW) was 7.19 ± 0.28 kg. Control pigs(CON) were fed a basal diet, and the other animals werefed a basal diet supplemented with 200mg/kg, 400mg/

kg or 600 mg/kg garcinol for a 14-day period (An inde-pendent experiment (unpublished) was carried out be-fore this study to determine the most appropriate of sixpossible doses garcinol (100, 200, 300, 400, 500 or 600mg/kg) on the performance of weaned piglets. It wasfound that the optimum effect on the growth perform-ance of weaned piglets was obtained when garcinol wasprovided at 200-600 mg/kg of diet). The basal diet wasformulated to based on (NRC, 2012) meet nutritional re-quirements. And the ingredients and composition of thebasal diet are listed in Table 1. The garcinol was pur-chased from Xin Lu Biotechnology Company (Xi’an,China), and extracted from dried fruit rind of Garciniaindica with a purity of 98.1%, as measured by HPLC. Allpigs were allowed ad libitum access to feed and waterthroughout the experimental period. The animals werekept in a temperature-controlled environment at24~25 °C and alternating light and dark cycles with 12 hintervals. All experimental pigs were healthy during thefeeding period. Weights were obtained on every pig andfeed disappearance was recorded on d 0, 7, 14 and priorto slaughter to calculate average daily feed intake(ADG), average daily gain (ADFI), and feed/gain ratio(F/G). Fecal scores were monitored during the feedingtrial and quantified using a scale ranging from 0 to 3with 0 = normally shaped feces, 1 = shapeless (loose)feces, 2 = thick, liquid (soft) feces, and 3 = thin, liquid

Table 1 Composition and nutrient levels of the basal diet (asfed basis)

Ingredient % Nutrient level

Extruded corn 58.08 DE, MJ/kg 14.39

Dehulled soybean meal 20.00 CP, % 20.57

Whey powder 10.00 Calcium, % 0.85

Fishmeal 4.00 Available P, % 0.46

Soybean oil 3.00 Lys, % 1.70

Calcium carbonate 0.85 Met, % 0.66

Dicalcium phosphate 1.00 Met + Cys, % 0.97

Sodium bicarbonate 0.15 Thr, % 1.06

Salt 0.15 Trp, % 0.28

L-Arg·HCl 0.87

DL -Met 0.22

Thr 0.30

Trp 0.08

Vitamin and mineral mix1 1.30

Total 1001Provided per kilogram of diet: vitamin A, 2200 IU; vitamin D3, 220 IU; vitaminE, 16 IU; vitamin K3, 0.5 mg; vitamin C, 200 mg; thiamin, 1.5 mg; riboflavin, 4mg; pyridoxine, 7 mg; cyanocobalamin, 0.02 mg; pantothenic acid, 12 mg;niacin, 30 mg; folic acid, 0.3 mg; biotin, 0.08 mg; Fe (FeSO4.H2O), 100 mg; Cu(CuSO4·5H2O), 6 mg; Mn (MnSO4·H2O), 4 mg; Zn (ZnSO4 ·H2O), 100 mg; I (Ca(IO3)2), 0.14 mg; Se (Na2SeO3), 0.30 mg; Co (CoSO4 ·7H2O), 0.15 mg. The carrierwas zeolite

Wang et al. Journal of Animal Science and Biotechnology (2020) 11:12 Page 2 of 13

feces and watery diarrhea. A piglet with a score greaterthan 1 was regarded as having diarrhea. The incidenceof diarrhea (%) was calculated as a percentage of thenumber of diarrheal piglets during the period divided bythe total number of piglets. On d 0 at the beginning andd 14 at the end of the study, three randomly selectedpigs from each pen within a treatment were selected forblood samples. The biochemical index of blood samplesshowed no difference among the treatments in the pig-lets at the start of the study (d 0). The blood samplesfrom piglets of each treatment (n = 12) were collectedfrom the jugular vein via 10 mL vacutainer tubes thatcontained EDTA as an anticoagulant. And the plasmasamples were then centrifuged at 3500×g for 10 min at4 °C. And then the piglets were sacrificed afteranesthesia by i.m. injection with 50mg/kg BW sodiumpentobarbital. Immediately, a piece (2 cm-length) of themiddle jejunum and distal ileum (2 cm-length) were col-lected (n = 12), rinsed with cold saline (NaCl 9 g/L, 4 °C),and fixed in paraformaldehyde. Other segments of themiddle jejunum and distal ileum (5 cm-length) of thepiglets (n = 12) were opened and thoroughly rinsed withsterile normal saline, and then the mucosa was collectedby scraping with glass slides and immediately snap-frozen in liquid nitrogen and stored at − 80 °C.

Analysis of serum biochemical indices and antioxidantpropertiesThe levels of serum total protein (TP); albumin (ALB);blood urea nitrogen (BUN); total cholesterol (TCH); glu-cose (GLU); serum alanine aminotransferase (ALT); as-partate aminotransferase (AST) were analyzed byZhongnan Hospital (Wuhan, Hubei, China); and thelevels of glutathione peroxidase (GSH-Px), catalase(CAT) and superoxide dismutase (SOD), and total anti-oxidant capacity (T-AOC) and malondialdehyde (MDA)in plasma were determined using commercial kits ac-cording to the instructions of the manufacturer (NanjingJiancheng Bioengineering company, Jiangsu, China).

Analysis of intestinal morphology and permeabilityThe fixed jejunal and ileal segments were dehydrated,embedded in paraffin, and sectioned for intestinalmorphology as described previously [18]. Briefly, sec-tions of 5-μm thickness were deparaffinized in xylene,rehydrated, and stained with hematoxylin and eosin(H&E). Images were obtained using an Axio Scope A1microscope (Zeiss, Germany). The villous height andcrypt depth of each segment were measured with Image-Pro software (Media Cybernetics, Rockville, MD). Aminimum of 9 villi from each sample were measured foreach treatment. The mean villus height, crypt depth, andvillus height to crypt depth ratio for each pig were usedfor analysis. The contents of diamine oxidase (DAO)

and D-lactate and endothelin -1 (ET-1) and nitric oxide(NO) were measured using an instrument (BiochemicalAnalytical Instrument, Beckman CX4, Beckman CoulterInc., Brea, CA).

Intestinal cytokines determined by ELISAAfter grinding in liquid nitrogen, total protein was ex-tracted from the jejunal and ileal mucosa samples withlysis buffer (KeyGEN, Nanjing, China), followed by clari-fication by centrifugation (3500×g for 10 min at 4 °C).The concentrations of IL-1β, IL-6, IL-10, and tumor ne-crosis factor-α (TNF-α) were determined by using ELISAkits (Nanjing Jiancheng Bioengineering company,Jiangsu, China).

Real-time PCR for the relative measurement of transcriptsand quantification of microbiota in the jejunum andileumTotal RNA was extracted from mucosal tissue powders(approximately 0.1 g, n = 12) using TRIzol reagent (100mg tissue per 1 mL TRIzol; Invitrogen, Carlsbad, CA).The purity and the yield of the RNA were evaluatedusing a NanoDrop 1000 (Thermo Fisher Scientific, Wal-tham, MA). The integrity of RNA was determined byboth agarose gel (1%) electrophoresis and spectrometry(A260/A280, Beckman DU-800; Beckman Coulter, Inc.).,and 1 μg of RNA was used to generate cDNA in a vol-ume of 20 μL with a PrimeScript RT Reagent Kit(Takara, Dalian, China). Real-time PCR was performedin duplicate with SYBR Green master mix on a CFXConnect Detection system (Bio-Rad, Hercules, CA).Each 10-μL reaction included 5 μL iTaq Universal SYBRGreen Supermix (Bio-Rad), 0.5 μL forward primer(10 μmol/L), 0.5 μL reverse primer (10 μmol/L), and 4 μL20-fold diluted cDNA. The thermocycler protocol con-sisted of 10 min at 95 °C followed by 40 cycles of 30 s at95 °C, 30 s at 60 °C, and 20 s at 72 °C. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin wereused as housekeeping genes, and the primers for thereal-time PCR in this study are listed in Table 2. Therelative mRNA expression of the target genes Zonula oc-cludens protein 1 (ZO-1), Occludin and anti-Claudin-1was determined using the 2–ΔΔCt method, all data foreach target transcript were normalized to the mRNAlevel of the GAPDH and β-actin gene.Digesta from jejunum and ileum samples (n = 12) were

collected for the real-time PCR assay. The species-specific PCR primers are listed in Table 3. Real-timePCR was performed on an iCycler IQ real-time detectionsystem using the iCycler optical system interface soft-ware version 2.3 (Bio-Rad, Veenen-daal, Netherlands) aspreviously described [19]. The reaction mixture (25 μL)consisted of 12.5 μL of a master mix (IQ SYBR GreenSupermix; Bio-Rad), 0.2 μmol/L of each primer set, and


5 μL of template DNA. The amount of DNA in eachtreatment was determined, and the mean values werecalculated. A standard curve was generated by using theserially diluted 16S rRNA gene amplicons obtained fromLactobacillus sp. The species-specific primer LAC1 andthe primer Lab0677 [20] were used for the quantificationof Lactobacillus sp. with the following conditions: an ini-tial DNA denaturation step at 95 °C for 3 min, followedby 40 cycles of denaturation at 95 °C for 30 s and primerannealing and extension at 60 °C for 1 min. TotalEscherichia coli (E. coli) were quantified using thecombination of the forward primer K88 AD and re-serve primer K88 AD [21] and the following cyclingprogram: after the initial denaturation 92 °C for 45 s,40 cycles were applied at 50 °C for 45 s, and bindingand extension at 75 °C for 45 s.

Western blotting and immunoprecipitationThe mucosal scrapings were homogenized on ice inRIPA lysis buffer (Upstate; Temecula, CA) containingprotease inhibitor cocktail (Sigma-Aldrich, St. Louis,MO) and phosphathase inhibitor cocktail 1 (Sigma-Al-drich, St. Louis, MO). After centrifugation at 4 °C and14,000×g, the supernatants were collected for the assay.The primary antibodies used were: anti-ZO-1, anti-Occludin and anti-Claudin-1 antibodies (1:1,000

dilution; Abcam). For western blotting, the lysates werethen resolved by SDS-PAGE and immunoblotted withthe indicated antibodies. Membranes processed with theantibodies of interest were treated with Restore™ PlusWestern Blot Stripping Buffer (Pierce, Rockford, IL) forone hour or overnight and then exposed to anti-β-actinor anti-nucleolin (Sigma-Aldrich, St. Louis, MO) to as-sess the equal loading.

Microbial genomic DNA extractionTotal bacterial genomic DNA was extracted from co-lonic digesta (approximately 0.2 g) by using FastDNASPIN extraction kits (MP Biomedicals, Santa Ana, CA,USA) following the manufacturer’s instructions andstored at − 20 °C until further analysis. The quantity andquality of extracted DNA were measured using a Nano-Drop ND-1000 spectrophotometer (Thermo FisherScientific, Waltham, MA, USA) and agarose gel electro-phoresis, respectively. After genomic DNA quantity andquality testing, 30 ng genomic DNA was used to runPCR per reaction.

16S rDNA amplicon pyrosequencing and sequenceanalysisTen milliliters of colonic digesta samples from piglets(n = 12) were collected and stored at − 80 °C. PCR ampli-fication of the bacterial 16S rRNA gene V-3V4 regionwas performed using the forward primer 338F (5′-ACTCCTACGGGAGGCAGCA-3′) and the reverse pri-mer 806R (5′ -GGACTACHVGGGTWTCTAAT-3′).Sample-specific 7-bp barcodes were incorporated intothe primers for multiplex sequencing. The PCR compo-nents contained 5 μL Q5 reaction buffer (5×), 5 μL Q5High-Fidelity GC buffer (5×), 0.25 μL Q5 High-FidelityDNA Polymerase (5 U/μL), 2 μL (2.5 mmol/L) dNTPs,1 μL (10 μmol/L) of each forward and reverse primer,2 μL DNA Template, and 8.75 μL ddH2O. Thermal cyc-ling consisted of initial denaturation at 98 °C for 2 min,followed by 25 cycles of denaturation at 98 °C for 15 s,annealing at 55 °C for 30 s, and extension at 72 °C for 30s, with a final extension for 5 min at 72 °C. The PCRamplicons were purified with Agencourt AMPure Beads(Beckman Coulter, Indianapolis, IN) and quantifiedusing a PicoGreen dsDNA Assay Kit (Invitrogen, Carls-bad, CA, USA). After the individual quantification step,the amplicons were pooled in equal amounts, and pair-end 2 × 300 bp sequencing was performed using anIllumina MiSeq platform with a MiSeq Reagent Kit v3 atShanghai Personal Biotechnology Co., Ltd. (Shanghai,China).The Quantitative Insights Into Microbial Ecology

(QIIME, v1.8.0) pipeline was employed to process the se-quencing data, as previously described [22]. Briefly, rawsequencing reads with exact matches to the barcodes

Table 2 PCR primer sequences used in this study

Genes Accession No. Sequence (5’→3’) Size, bp

ZO-1 XM_021098896.1 F:CCAACCATGTCTTGAAGCAGC 215

R:TGCAGGAGTGTGGTCTTCAC

Occludin NC_010458.4 F:TCAGGTGCACCCTCCAGATT 169

R:TATGTCGTTGCTGGGTGCAT

Claudin-1 NC_010455.5 F:AAGGACAAAACCGTGTGGGA 247

R:CTCTCCCCACATTCGAGATGATT

GAPDH NM_001206359.1 F:CCAAGGAGTAAGAGCCCCTG 125

R:AAGTCAGGAGATGCTCGGTG

β-actin XM_003124280.4 F:CTCCAGAGCGCAAGTACTCC 153

R:AATGCAACTAACAGTCCGCC

ZO1 Zona occludens protein 1, GAPDH Glyceraldehyde3-phosphate dehydrogenase

Table 3 Primers used for Escherichia coli and Lactobacillus

Bacteria Primer Sequence (5′→3′) Reference

Lactobacillus Forward: LAC1 AGCAGTAGGGAATCTTCCA

[20]

Reverse:Lab0677

CACCGCTACACATGGAG

Escherichiacoli

Forward: K88 AD GGCACTAAAGTTGGTTCA [21]

Reverse: K88 AD CACCCTTGAGTTCAGAATT


were assigned to respective samples and identified asvalid sequences. The low-quality sequences were filteredthrough following criteria [23, 24]: sequences that had alength of < 150 bp, sequences that had average Phredscores of < 20, sequences that contained ambiguousbases, and sequences that contained mononucleotide re-peats of > 8 bp. Paired-end reads were assembled usingFLASH (v1.2.7) [25]. After chimera detection, theQIIME software (v1.8.0) USEARCH (v5.2.236) was usedto check and remove chimeric sequences, and theremaining high-quality sequences were clustered intooperational taxonomic units (OTUs) at 97% sequenceidentity by UCLUST (v1.2.22q) [26]. A representative se-quence was selected from each OTU using default pa-rameters. OTU taxonomic classification was conductedby BLAST searching the representative sequences setagainst the Greengenes Database [27] using the best hit[28]. An OTU table was further generated to record theabundance of each OTU in each sample and the tax-onomy of these OTUs. OTUs containing < 0.001% oftotal sequences across all samples were discarded. Tominimize the difference in sequencing depth across sam-ples, an averaged, rounded rarefied OTU table was gen-erated by averaging 100 evenly resampled OTU subsetsunder a 90% minimum sequencing depth for furtheranalysis.

Statistical analysesAll the results from experiment were analyzed by usingthe one-way ANOVA, performed using the MIXED pro-cedure of SAS (SAS Inst., Inc., Cary, NC, US). Replicate(n = 4) served as the experimental unit. Data were ana-lyzed using the general linear model (GLM) with SPSS16.0 (SPSS Inc., Chicago, IL, USA). The results in the ta-bles are shown with the means ± SEM, and other figureresults are presented with means ± SEM. Means areconsidered significantly different at P < 0.05.

ResultsEffect of dietary garcinol on the performance, diarrhearate and blood biochemical indices of weaned pigsThe growth performance and diarrhea of weaned pigsare shown in Table 4. Compared with the control group,dietary supplementation with garcinol significantly in-creased ADG (P < 0.05) and decreased F/G (P < 0.05) buthad no effect on ADFI (P > 0.05). In addition, dietarygarcinol significantly decreased the diarrhea rate com-pared with that in control group (P < 0.05). The F/G anddiarrhea rates in the 200 and 400 mg/kg garcinol groupswere significantly lower than those in the 600 mg/kggroup. The blood indices of weaned pigs are shown inTable 5. Compared with the control group, dietary garci-nol had no effect on TP, ALB, BUN, TCH, GLU, ALTand AST in plasma. Moreover, compared with the

control group, garcinol significantly increased T-AOC,SOD, CAT and GSH-Px and decreased the MDA con-tent (P < 0.05).

Effect of dietary garcinol on intestinal morphology ofweaned pigsAs shown in Table 6 and Fig. 1, compared with the con-trol group, dietary supplementation with garcinol signifi-cantly decreased the (P < 0.05) jejunal crypt depth andincreased (P < 0.05) villus height to crypt depth ratio inboth jejunum and ileum (Table 4). In addition, the villusheight to crypt depth ratios in both the jejunum andileum in the 200 and 400 mg/kg garcinol groups weresignificantly lower than those in the 600mg/kg group(P < 0.05). For intestinal permeability (Table 7),

Table 4 Effects of garcinol on growth performance anddiarrhea rate of weaned piglets

Items Controlgroup

The level of garcinol, mg/kg SEM

200 400 600

Initial weight, kg 7.21 7.19 7.18 7.20 0.03

Final weight, kg 11.35ab 12.56a 12.62a 12.79a 0.17

ADG, g 154.67b 192.15a 202.63a 199.58a 5.27

ADFI, g 349.53 350.46 356.72 358.68 11.56

F/G 2.26a 1.97b 1.96b 2.02c 0.05

Diarrhea incidence 10.34a 7.25b 6.54b 4.67c 0.70

In the same row, values with no letter or the same letter superscripts mean nosignificant difference (P > 0.05), while with different letter superscripts meansignificant difference (P < 0.05). ADFI Average daily feed intake, ADG Averagedaily gain, and F/G Feed/gain ratio. n = 12

Table 5 Effects of garcinol on blood biochemical indices ofweaned piglets

Items Controlgroup


200 400 600

TP, g/L 34.16 36.25 27.45 28.46 0.95

ALB, g/L 26.21 23.47 21.35 22.76 0.62

BUN, U/L 3.71 3.67 3.58 3.69 0.22

TCH, U/L 2.05 2.24 2.01 2.09 0.05

GLU, mmol/L 5.94 5.99 5.84 5.89 0.10

ALT, U/L 72.56 51.35 61.35 52.34 3.26

AST, U/L 65.21 69.35 78.45 72.53 2.76

MDA, nmol/mL 2.92a 2.08b 1.82b 1.72b 0.19

T-AOC, U/mL 1.94b 2.54a 2.69a 2.72a 2.21

SOD, U/mL 67.59b 77.33a 81.06a 82.95a 3.87

CAT, U/mL 20.91b 22.47a 24.09a 24.37a 1.42

GSH- Px, U/mL 872.4b 896.1a 911.6a 932.75a 43.56

In the same row, values with no letter or the same letter superscripts mean nosignificant difference (P > 0.05), while with different letter superscripts meansignificant difference (P < 0.05). TP, serum total protein; ALB Albumin, BUNBlood urea nitrogen, TCH Total cholesterol, GLU Glucose, ALT Serum alanineaminotransferase, AST Aspartate aminotransferase, MDA Malonaldehyde, GSH-Px Glutathione peroxidase, CAT Catalase, T-AOC Total antioxidative capacity, T-SOD Total superoxide dismutase. n = 12


compared to the control group, dietary garcinol signifi-cantly decreased the diamine oxidase (DAO) and D-lactate contents (P < 0.05). The DAO and D-lactatecontents in the groups treated with 200 and 400 mg/kggarcinol were significantly lower than those in the 600mg/kg group (P < 0.05).

Effect of dietary garcinol on tight junctions in theintestinal mucosaAs shown in Fig. 2, for tight junction-related compo-nents, compared with the control group, dietary garcinolsignificantly increased (P < 0.05) ZO-1 and occludin pro-tein expression in both the jejunal and ileal mucosa andclaudin-1 in the ileum (Fig. 2a). The expression of ZO-1and occludin in both jejunal and ileal mucosa andclaudin-1 in the ileum of the 200 and 400 mg/kg

garcinol groups was significantly lower than those in the600 mg/kg group (P < 0.05). In addition, the expressionof claudin-1 in the jejunum of 400 and 600 mg/kg garci-nol groups was significantly lower than that in the con-trol group (P < 0.05).

Effect of dietary garcinol on intestinal inflammation inweaned pigsTo evaluate the effects of garcinol on immune responsesin the intestine of weaned pigs, the serum levels of im-munoglobulin, cytokines IL-6, IL-10, IL-1β and TNF-αand NF-κB p65 translocation in the mucosa of the je-junum and ileum were determined (Tables 8, 9 andFig. 3). There was no effect of dietary garcinol on theserum levels of immunoglobulin (P > 0.05). In addition,compared with the control group, dietary garcinol de-creased the levels of IL-10 and significantly decreased(P < 0.05) the serum contents of IL-6, IL-1β and TNF-α.The levels of IL-6, IL-1β and TNF-α in the 200 and 400mg/kg garcinol groups were significantly lower thanthose in the 600 mg/kg group (P < 0.05). Additionally,compared with CON, garcinol significantly decreasedthe NF-κB p65 protein content in both the jejunum andileum (Fig. 3), and jejunal and ileal NF-κB p65 transloca-tion in the 200 and 400 mg/kg garcinol groups was sig-nificantly lower (P < 0.05) than that in the 600 mg/kggroup.

Effect of dietary garcinol on the diversity of gutmicrobiotaWe then used high-throughput sequencing to perform16S rRNA gene analysis in colonic digesta samples from48 pigs. The results of the Chao index, Shannon index,ACE index and Simpson index are shown in Table 10.

Table 6 Effects of garcinol on small intestine structure ofweaned piglets

Items Controlgroup


200 400 600

Villus height, μm

Jejunum 310.26a 319.52b 324.67b 375.64c 4.36

Ileum 267.63a 346.57b 342.27b 398.43c 9.24

Crypt depth, μm

Jejunum 108.35a 105.67b 96.27b 87.36b 3.24

Ileum 90.83 92.67 87.67 88.59 2.89

V/C

Jejunum 2.86a 3.02b 3.37b 4.30c 0.10

Ileum 2.95a 3.74b 3.91b 4.49c 0.12

In the same row, values with no letter or the same letter superscripts mean nosignificant difference (P > 0.05), while with different letter superscripts meansignificant difference (P < 0.05). V/C Villus height/Crypt depth. n = 12

Fig. 1 Effects of garcinol on histopathological changes of jejunum and ileum with H&E staining (original magnification of 100×). Dietarytreatments: a control (basal diet), b basal diet+ 200mg/kg garcinol, c basal diet+ 400mg/kg garcinol, d basal diet+ 600mg/kg garcinol


There were no significant differences between the 200mg/kg garcinol and the control group, while all indicesof the samples in the 400 and 600 mg/kg groups weresignificantly higher than those in the other groups (P <0.05). The relative abundances of four different taxo-nomic levels are shown in Fig. 4 (phylum, order andgenus). The results of phylum, order and genus analysisshowed that the 200 mg/kg garcinol and control groupshad a similar relative abundance, while the 400 and 600mg/kg garcinol groups had a similar relative abundance.At the phylum level, 400 and 600 mg/kg garcinoldecreased the relative abundance of Proteobacteria butincreased the relative abundance of Firmicutes, Actino-bacteria, Tenericutes and Bacteroidetes compared withthe effects of 200mg/kg garcinol and control treatments

Table 7 Effects of garcinol on intestinal permeability in piglets

Items Controlgroup


200 400 600

DAO, ng/mL 39.46a 10.76b 9.56b 5.67c 2.79

D-Lactate, μmol/mL 55.26a 39.47b 32.79b 27.64c 1.98

ET-1, ng/L 130.67 110.47 95.26 91.58 5.04

NO, μmol/L 54.23 44.26 41.89 43.28 1.67

In the same row, values with no letter or the same letter superscripts mean nosignificant difference (P > 0.05), while with different letter superscripts meansignificant difference (P < 0.05). DAO Diamine oxidase, ET-1 Endothelin-1, NONitric oxide. n = 12

Fig. 2 Effect of dietary garcinol on tight junctions in the intestinal mucosa. a Relative protein expression of ZO-1, occludin and claudin-1 injejunum, b Relative protein expression of ZO-1, occludin and claudin-1 in ileum, c The relative mRNA expression of ZO-1, occludin and claudin-1in jejunum. Values with no common superscripts means significant difference (P < 0.05). n = 12


(Fig. 4a). At the order level, 400 and 600 mg/kg garcinoldecreased the relative abundance of Enterobacterialesbut increased the relative abundance of Lactobacillales,Clostridiales, Pseudomonadales, Actinomycetales, Bur-kholderiales, Pasteurellales and Mycoplasmatales (Fig.4b). At the genus level, there was a significant change in6 genera (Pseudomonas, Streptococcus, Cupriavidus,Lactobacillus, Actinobacillus and Veillonella) (Fig. 4c).However, most microbiota were not identified. The rela-tive abundance of these 6 genera was significantlyincreased in the 400 and 600 mg/kg garcinol groupscompared with those in the other groups (P < 0.05),while the relative abundance of Pseudomonas, Strepto-coccus, Lactobacillus, Actinobacillus and Veillonella inthe 400 mg/kg garcinol group was significantly lowerthan that in the 600 mg/kg garcinol group (P < 0.05)(Fig. 4d). Enterobacteriales and Lactobacillales were sig-nificantly changed in the 400 and 600 mg/kg garcinolgroups. We quantified these two important bacterialspecies in the jejunum and ileum digesta by using quan-titative real-time PCR analysis. The results are shown inTable 11. The 200mg/kg garcinol and control groupshad a similar relative abundance of E. coli and Lactoba-cillus. Moreover, the number of Lactobacillus in pigsfrom the 400 and 600 mg/kg garcinol groups was signifi-cantly higher while the number of E. coli was signifi-cantly lower than those in the other groups (P < 0.05),and the number of Lactobacillus in the 600 mg/kg group

was significantly higher than that in the 400 mg/kg garci-nol group (P < 0.05). In addition, the results of both non-metric multidimensional scaling (NMDS) and theprincipal component analysis (PCA) plot showed a sig-nificantly different composition of microbiota among thegroups (P < 0.05) (Fig. 5).

DiscussionWeaning, on the one hand, is a critical stage of gutdevelopment in mammals, while on the other hand,weaning stress can cause intestinal barrier dysfunc-tion, inflammation, and gut microbiota disruption, ac-companied by a reduction in the absorption capacityof the small intestine, eventually lead to the increas-ing of diarrhea [3, 5]. The weaning period is associ-ated with impairment of cellular immunity, oxidativestress and an increased prevalence of gastrointestinalinfection in many species [29]. Therefore, appropriateweaning nutrition appears to be essential for enhan-cing the gut health of animals. Previous studies haveshown that some plant extracts (e.g., curcumin, res-veratrol and essential oils) had beneficial effects onthe performance and intestinal barrier function ofmice and weaned piglets [9, 30, 31]. Currently, garci-nol is regarded as one of the most promising plantextracts with effective antioxidant properties [32].However, the effect and dose effect of dietary garcinolon growth performance, diarrhea, intestinal barrierfunction and gut microbiota are poorly understood.In this work, we demonstrated for the first time thatas a natural antioxidant, garcinol efficiently improvedgrowth performance and diarrhea, strengthened anti-oxidant capacity, ameliorated intestinal barrier dys-function and inflammation, and altered the gutmicrobiota of weaning piglets.First, the effect of dietary garcinol on growth perform-

ance, diarrhea and the blood biochemical index weremeasured. At the beginning of the study, we collectedthe blood samples and verified there were no differencesamong the piglets, and they were healthy at the start ofthe study. However, after 14-day period trial, the diar-rhea incidence is high in control group, which may beassociated with the weaning event [3, 5] Compared withthe control group, dietary garcinol increased the ADGand F/G, suggesting that the growth performance wasimproved. In addition, dietary garcinol significantly de-creased the diarrhea rate of weaned pigs. Previous stud-ies have shown that the body gain and nutrientabsorption of piglets, as well as the diarrhea rate are as-sociated with oxidative stability, intestinal morphologyand gut microbiota balance [33]. Then, we further ana-lyzed the biochemical and antioxidative index in serum.Blood biochemical indices can reflect the growth or pro-duction performance of animals. The results showed

Table 8 Effects of garcinol on serum immunoglobulin inweaned piglets

Items Controlgroup


200 400 600

IgA, g/L 1.29 1.24 1.28 1.26 0.03

IgG, g/L 2.59 3.74 3.95 3.82 0.24

IgM, g/L 0.42 0.37 0.36 0.40 0.02

In the same row, values with no letter or the same letter superscripts mean nosignificant difference (P > 0.05), while with different letter superscripts meansignificant difference (P < 0.05). IgA Immuneglobulin A, IgG Immuneglobulin G,IgM Immuneglobulin M. n = 12

Table 9 Effects of garcinol on serum cytokines in weanedpiglets

Items Controlgroup


200 400 600

TNF-α, ng/L 297.36a 106.58b 96.26b 73.59c 11.26

IL-1β, ng/L 17.56a 14.56b 11.23b 8.95c 0.79

IL-6, ng/L 45.72a 25.62b 20.67b 14.58c 1.85

IL-10, ng/L 157.92 192.34 210.53 219.57 6.15

In the same row, values with no letter or the same letter superscripts mean nosignificant difference (P > 0.05), while with different letter superscripts meansignificant difference (P < 0.05). TNF-α, tumor Necrosis Factor α; IL-1β,intermediate language 1 β; IL-6, intermediate language 6; IL-10, intermediatelanguage 10. n = 12


that the antioxidant capacity was improved after treatingwith all doses of garcinol, while the levels of ALT, AST,BUN were not affected by garcinol. These findings sug-gested that garcinol supplementation did not have sideeffects on the hepatic and renal functions of weaned pig-lets. As an antioxidant additive, the effect of garcinol onthe antioxidative index is consistent with other studiesboth in vitro and in vivo [16].We further evaluated the effect of dietary garcinol on

the intestinal morphology of weaned pigs. It has re-ported that weaning stress could cause intestinal injurywith the reduced intestinal villi height, the deepened re-cess, the changes of intestinal morphology from denseand finger-like villi to smooth and tongue-like villi, andthe reduced active absorption capacity of the small intes-tine [5]. Normal intestinal function depends on the localbarrier, which prevents the translocation of bacteria andendotoxins contained within the intestinal lumen to

extraintestinal sites, and largely prevents the occurrenceof diarrhea [34]. Intestinal mucosa permeability is theprincipal basis for the diagnosis of the intestinal barrierdysfunction [34]. Serum D-lactate and DAO can be usedas indicators of intestinal integrity of the gastrointestinaltract [35]. Furthermore, the tight junction is the mostimportant structure of the epithelial barrier function.The tight junction structure between intestinal epithelialcells is closely related to the function of the intestinalphysical barrier. Protecting the tight junction of the in-testinal tract plays an important role in maintaining thepolarity of intestinal epithelial cells and preventing ma-terial spillage in the epithelial cell gap [36]. ZO-1 proteinis not only involved in the formation of tight junctionsand the regulation of the permeability of epithelial cellsbut also involved in the regulation of the compositionand function of the parietal cytoskeleton [37]. Occludinis a transmembrane protein closely associated with theintegrity of the structure and the role of the intestinalepithelial barrier function [38]. This study showed thatoccludin protein expression was positively associatedwith intestinal epithelial barrier function. Interestingly,the results of the previous study also clearly indicatedthat dietary administration of garcinol at two dose levelsmarkedly ameliorated DSS-induced ACF formation,morphological signs of mucosal damage, and subsequentinflammation [39]. In the present study, dietary garcinolimproved the intestine structure of piglets. The villusheight to crypt depth ratio and the expression of tightjunction protein ZO-1, occludin and claudin-1 were in-creased, and intestinal permeability was decreased.There are no relevant studies on garcinol intestinalmorphology; thus, these results may be the first to report

Fig. 3 Effect of dietary garcinol on NF-κB p65 expression in jejunum and ileum of weaned pigs. a Relative protein expression of NF-κB p65 injejunum, b Relative protein expression of NF-κB p65 in ileum. Values with no common superscripts means significant difference (P < 0.05). n = 12

Table 10 Effect of garcinol on bacterial community alphadiversity in weaned piglet colon

Items Controlgroup


200 400 600

Richness index

Chao 361.50a 350.97a 770.00b 712.51b 53.85

Ace 364.51a 357.41a 772.20b 713.90b 53.71

Diversity index

Shannon 1.74a 1.97a 6.92b 6.10b 0.71

Simpson 0.31a 0.35a 0.97b 0.96b 0.10

The richness index (Chao and ACE) and diversity index (Shannon andSimpson) were calculated using the mothur program. Values with no letter orthe same letter superscripts mean no significant difference (P > 0.05), whilewith different letter superscripts mean significant difference (P < 0.05). n = 12


the beneficial effects of garcinol. These effects may alsobe due to the antioxidant properties of garcinol, as react-ive oxygen species (ROS) could be one of the maincauses of intestinal injury and oxidative damage, leadingto the decrease of growth performance and increase ofdiarrhea. Therefore, in this case, the improvement in in-testine structure and permeability by dietary garcinolcould be one of the reasons for the improvement of per-formance and diarrhea of weaned pigs.Weaning-associated intestinal inflammation has been

reported in weaned piglets [40]. Inflammatory cytokinesplay a paramount role in immune and inflammatory re-sponses and in the regulation of intestinal barrier integ-rity, and are also closely related to the occurrence ofdiarrhea [41]. Therefore, we next tested the effect ofdietary garcinol on the intestinal inflammation ofweaned pigs. In the current study, dietary supplementa-tion with garcinol decreased the cytokine IL-6, IL-10, IL-1β and TNF-α in the mucosa of jejunum and ileum and

Fig. 4 Effect of dietary garcinol on the composition of colonic microbiota in weaned piglets. a Graph represents the OTUs at differenttaxonomical levels: phylum (n = 12). b Graph represents the OTUs at different taxonomical levels: order (n = 12). c Graph represents the OTUs atdifferent taxonomical levels: genus (n = 12). d The change in the relative abundance of genus Pseudomonas, Streptococcus, Cupriavidus,Lactobacillus, Actinobacillus and Veillonella. Metastats analysis was applied to identify the significantly differentially abundant genera amonggroups. Different letters above the bars denotes significantly differentially abundant genera among groups. (P < 0.05). n = 12

Table 11 Quantitative real-time PCR analysis of total Escherichiacoli, Lactobacillus in jejunum and ileum samples [log10 (copies/gwet weight)]a

Items Controlgroup


200 400 600

Escherichia coli

Jejunum 8.55a 8.17a 7.23b 7.24b 0.86

Ileum 8.74a 8.21a 7.42b 7.36b 0.44

Lactobacillus

Jejunum 7.69b 8.03b 8.64a 8.56a 0.68

Ileum 7.91b 8.25b 8.97a 8.82a 0.32

In the same row, values with no letter or the same letter superscripts mean nosignificant difference (P > 0.05), while with different letter superscripts meansignificant difference (P < 0.05). n = 12


the NF-κB p65 protein content at all dosages, suggestingthat garcinol ameliorated intestinal inflammation. Previ-ous studies have indicated that controlling the release ofintestinal pro-inflammatory cytokines may have poten-tial benefits for alleviating gut disorders induced byweaning stress [42]. As an effective antioxidative plantextract, garcinol also shows anti-inflammatory effects.Studies in rodent models have shown the capability ofgarcinol in treating different oxidative and inflammatorysituations and demonstrated that garcinol can reducethe expression of cytokines [39]. In addition, garcinolsuppressed the expression of interleukin (IL)-1β and IL-6 in the spinal cord of rats [16]. The presented resultsare consistent with these observations. Furthermore, NF-κB plays a significant role in maintaining the normalphysiological functions of the body. The classic NF-κBsignaling pathway is associated with intestinal immunefunction, permeability and the occurrence of diarrhea[43]. Previous studies have indicated that the TNF-α-induced increase in intestinal epithelial tight junctionpermeability requires NF-κB activation, while anotherstudy showed that garcinol can inhibit the activation ofNF-κB in vitro [43]. In the present study, dietary supple-mentation with garcinol at 3 dosages decreased NF-κBactivity, suggesting that autoimmune and inflammationhave been ameliorated. This effect could also be the rea-son for the improvement of intestinal permeability andthe diarrhea rate of weaned piglets by dietary garcinol.Recent studies have shown that plant extract can result

in the intestinal flora shift and reduce inflammation,which in turn can improve the intestinal health of piglets[9]. Finally, we used high-throughput sequencing to per-form 16S rRNA gene analysis in the colon of piglets.

The large intestine supports a dynamic microenviron-ment that varies with age and environmental factors[34]. Any alteration in the physical or chemical proper-ties of colonic contents has the potential to impact theresident bacterial population and potentially favor or in-hibit the establishment of pathogenic species. In thecurrent study, garcinol supplementation increased therelative abundance of genera Pseudomonas, Streptococ-cus, Cupriavidus, Lactobacillus, Actinobacillus and Veil-lonella, and increased the number of Lactobacillusspecies, while decreased the number of E. coli in je-junum and ileum. Most probiotics currently used belongto Lactobacillus, such as L. rhamnosus GG (LGG). TheseLactobacillus strains promote weight gain; thus, garcinolsupplementation promotes the weight gain of weanedpiglets possibly through colonic microbiota, especiallyLactobacillus. In addition, a previous study showed thatLactobacillus is a common probiotic that has been asso-ciated with the regulation of the immune system, pre-vention of diarrhea, and improvement of pig health [44].Hence, it is plausible that garcinol supplementationcould improve immune function in weaned piglets by in-creasing the relative abundance of Lactobacillus. Inaddition, as E. coli causes diarrhea, garcinol supplemen-tation may improve the diarrhea rate by decreasing thenumber of E. coli species.Nevertheless, this study has several limitations. The 4

replications and the length of the trial (14-day period) inthis study may not be adequate for the evaluation ofgrowth responses nor gut microbiota in weaned piglets.Generally, microflora require 4 to 6 weeks to stabilizeafter a change, so the variation of gut microbiota in thisstudy may just be a short snapshot. In addition, the

Fig. 5 Microbial structure analysis: a NMDS analysis, b PCA. n = 12


mechanism of gut microbiota alterations in response togarcinol treatment is superficial. Further research shouldfocus on solving these problems.

ConclusionIn summary, the present study provides the first evi-dence that dietary supplementation with garcinol pro-moted growth performance, improved diarrhea,strengthened antioxidant capacity, ameliorated intestinalbarrier dysfunction and inflammation, and altered gutmicrobiota of weaning piglets in 14-day trial without af-fecting hepatic and renal functions. These results pro-vide a fundamental basis for the future development ofgarcinol-functional foods for improving diarrhea, intes-tinal barrier function and gut microbiota of weaned pig-lets, and a theoretical basis and experimental evidencefor understanding the biological effects of garcinol andits potential as a functional feed additive.

AbbreviationsG. indica: Garcinia indica; ADFI: Average daily feed intake; ADG: Average dailygain; ALB: Albumin; ALT: Alanine aminotransferase; AST: Aspartateaminotransferase; BUN: Blood urea nitrogen; CAT: Catalase; DAO: Diamineoxidase; ET-1: Endothelin-1; F/G: Feed/gain ratio; GLU: Glucose; GSH-Px: Glutathione peroxidase; IL: Interleukin; MDA: Malondialdehyde;NMDS: Nonmetric multidimensional scaling; PCA: Principal componentanalysis; ROS: Reactive oxygen species; SOD: Superoxide dismutase; T-AOC: Total antioxidant capacity; TCH: Total cholesterol; TNF-α: Tumornecrosis factor-α; TP: Total protein; ZO1: Zonula occludens protein 1

AcknowledgmentsThe authors would like to thank members of their laboratory for helpful andconstructive advice.

Authors’ contributionsThe authors’contributions are as follows: F. H. and T. W. contributed to thestudy design and data analyses; T. W. was the principal investigator andcontributed to the study design and interpretation of the findings and wrotethe manuscript; W. Y. contributed to the study design, subject briefings anddata collection and analyses; J. L. contributed to the data analysesandversion of the manuscript. All authors read and approved the final version ofthe manuscript.

FundingThis study was partly supported by National Key Research and DevelopmentProgram (grant no. 2018YFD0500600), National Natural Science Foundationof China (grant no. 31572409), Hubei Provincial Natural Science Foundationof China (grant no. 2018CFA071).

Availability of data and materialsThe datasets during and/or analyzed during the current study available fromthe corresponding author on reasonable request.

Ethics approvalAll animal protocols used in this study were in accordance with theGuidelines for the Care and Use of Animals for Research and Teaching andapproved by the Animal Care and Use Committee of Huazhong AgriculturalUniversity.

Consent for publicationNot applicable.

Competing interestsThe authors declare that they have no competing interests.

Received: 1 November 2019 Accepted: 6 January 2020

References1. Madec F, Bridoux N, Bounaix S, Jestin A. Measurement of digestive

disorders in the piglet at weaning and related risk factors. Prev VetMed. 1998;35:53–72.

2. Madec F, Josse J. Influence of environmental factors on the onset ofdigestive disorders of the weaned piglet. Annales De RecherchesVétérinaires. 1983;14:456.

3. Lallès JP, Boudry G, Favier C, Floc’H NL, Luron I, Montagne L, et al. Gutfunction and dysfunction in young pigs: physiology. Physiology. 2002;53:301–16.

4. Li XQ, Zhu YH, Zhang HF, Yue Y, Cai ZX, Lu QP, et al. Risks associated withhigh-dose Lactobacillus rhamnosus in an Escherichia coli model of pigletDiarrhoea: intestinal microbiota and immune imbalances. PLoS One. 2012;7:e40666.

5. Smith F, Clark JB. Early weaning stress impairs development of mucosalbarrier function in the porcine intestine. Am J Physiol Gastrointest LiverPhysiol. 2010;298:352–63.

6. Peace RM, Campbell J, Polo J, Crenshaw J, Russell L, Moeser A. Spray-driedporcine plasma influences intestinal barrier function, inflammation, anddiarrhea in weaned pigs. J Nutr. 2011;141:1312.

7. Shah MA, Bosco SJD, Mir SA. Plant extracts as natural antioxidants in meatand meat products. Meat Sci. 2014;98:21–33.

8. Fang CL, Sun H, ., Wu J, Niu HH, Feng J, . Effects of sodium butyrate ongrowth performance, haematological and immunological characteristics ofweanling piglets. J Anim Physiol Anim Nutr 2014;98:680–685.

9. Gan Z, Wei W, Li Y, Wu J, Zhao Y, Zhang L, et al. Curcumin and resveratrolregulate intestinal Bacteria and alleviate intestinal inflammation in weanedpiglets. Molecules. 2019;24:1220.

10. Jing Y, Ai Q, Lin L, Dai J, Jia M, Zhou D, et al. Protective effects of garcinol inmice with lipopolysaccharide/D-galactosamine-induced apoptotic liverinjury ☆. Int Immunopharmacol. 2014;19:373–80.

11. Tanaka T, Kohno H, Shimada R, Kagami S, Yamaguchi F, Kataoka S, et al.Prevention of colonic aberrant crypt foci by dietary feeding of garcinol inmale F344 rats. Carcinogenesis. 2000;21:1183–9.

12. Yoshida K, Tanaka T, Hirose Y, Yamaguchi F, Kohno H, Toida M, et al. Dietarygarcinol inhibits 4-nitroquinoline 1-oxide-induced tongue carcinogenesis inrats. Cancer Lett. 2005;221:29–39.

13. Hong J, Kwon SJ, Sang S, Ju J, Zhou JN, Ho CT, et al. Effects ofgarcinol and its derivatives on intestinal cell growth: inhibitory effectsand autoxidation-dependent growth-stimulatory effects. Free Radic BiolMed. 2007;42:1211–21.

14. Liao CH, Sang S, Liang YC, Ho CT, Lin JK. Suppression of inducible nitricoxide synthase and cyclooxygenase-2 in downregulating nuclear factor-kappa B pathway by Garcinol. Mol Carcinog. 2004;41:140.

15. Yamaguchi F, Saito M, Ariga T, Yoshimura Y, Nakazawa H. Free radicalscavenging activity and antiulcer activity of garcinol from Garcinia indicafruit rind. J Agric Food Chem. 2000;48:2320.

16. Wang YW, Zhang X, Chen CL, Liu QZ, Xu JW, Qian QQ, et al. Protectiveeffects of Garcinol against neuropathic pain- evidence from in vivo andin vitro studies. Neurosci Lett. 2017;647:85.

17. Chatterjee A, Yasmin T, Bagchi D, Stohs SJ, et al. Mol Cell Biochem. 2003;243:29–35.

18. Gao Y, Han F, Huang X, Rong Y, Yi H, Wang Y. Changes in gut microbialpopulations, intestinal morphology, expression of tight junction proteins,and cytokine production between two pig breeds after challenge withEscherichia coli K88: a comparative study. J Anim Sci. 2013;91:5614–25.

19. Namkung H, Li MJ, Yu H, Cottrill M, Lange CFMD. Impact of feeding blendsof organic acids and herbal extracts on growth performance, gutmicrobiota and digestive function in newly weaned pigs. Can J Anim Sci.2004;84:697–704.

20. Su Y, Yao W, Perez-Gutierrez ON, Smidt H, Zhu WY. 16S ribosomal RNA-based methods to monitor changes in the hindgut bacterial community ofpiglets after oral administration of Lactobacillus sobrius S1. Anaerobe. 2008;14:78–86.

21. Alexa P, Stouracova K, Hamrik J, Rychlik I. Gene typing of the colonisationfactor K88 (F4) in enterotoxigenic Escherichia coli strains isolated fromdiarrhoeic piglets. Veterinarni Medicina-Praha. 2001;46:46–9.


22. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, CostelloEK, et al. QIIME allows analysis of high-throughput community sequencingdata. Nat Methods. 2010;7:335–6.

23. Gill SR, Mihai P, Deboy RT, Eckburg PB, Turnbaugh PJ, Samuel BS, et al.Metagenomic analysis of the human distal gut microbiome. Science. 2006;312:1355–9.

24. Chen Y, Yang F, Lu H, Wang B, Chen Y, Lei D, et al. Characterization of fecalmicrobial communities in patients with liver cirrhosis. Hepatology. 2011;54:562–72.

25. Tanja M, Salzberg SL. FLASH: fast length adjustment of short reads toimprove genome assemblies. Bioinformatics. 2011;27:2957–63.

26. Edgar RC. Search and clustering orders of magnitude faster than BLAST.Bioinformatics. 2010;26:2460–1.

27. DeSantis TZ, Hugenholtz P, Larsen N, Rojas M, Brodie EL, Keller K, et al.Greengenes, a chimera-checked 16S rRNA gene database and workbenchcompatible with ARB. Appl Environ Microbiol. 2006;72:5069–72.

28. Altschul SF, Madden TL, SchäFfer AA, Zhang J, Zhang Z, Miller W, et al.Gapped BLAST and PSI-BLAST: a new generation of protein database searchprograms. Nucleic Acids Res. 1997;25:3389–402.

29. Xu J, Xu C, Chen X, Cai X, Yang S, Sheng Y, et al. Regulation of anantioxidant blend on intestinal redox status and major microbiota in earlyweaned piglets. Nutrition. 2014;30:584–9.

30. Li SY, Ru YJ, Liu M, Xu B, Péron A, Shi XG. The effect of essential oils onperformance, immunity and gut microbial population in weaner pigs. LivestSci. 2012;145:119–23.

31. Soltan M. Effect of essential oils supplementation on growth performance,nutrient digestibility, health condition of Holstein male calves during pre-and post-weaning periods. Pak J Nutr. 2009;8:642–52.

32. Liu C, Ho PC-L, Wong FC, Sethi G, Wang LZ, Goh BC. Garcinol: current statusof its anti-oxidative, anti-inflammatory and anti-cancer effects. Cancer Lett.2015;362:8–14.

33. Sies H, Stahl W, Sevanian A. Nutritional, dietary and postprandial oxidativestress. J Nutr. 2005;135:969–72.

34. Qin L, Ji W, Wang J, Li B, Hu J, Wu X. Effects of dietary supplementationwith yeast glycoprotein on growth performance, intestinal mucosalmorphology, immune response and colonic microbiota in weaned piglets.Food Funct. 2019;10:2359–71.

35. Wu M, Xiao H, Ren W, Yin J, Tan B, Liu G, et al. Therapeutic effects ofglutamic acid in piglets challenged with deoxynivalenol. PLoS One. 2014;9:e100591.

36. Huber D, Balda MS, Matter K. Occludin modulates transepithelial migrationof neutrophils. J Biol Chem. 2000;275:5773.

37. Van Itallie CM, Anderson JM. Architecture of tight junctions and principlesof molecular composition. Semin Cell Dev Biol. 2014: Elsevier;2014:157–65.

38. Al-Sadi R, Khatib K, Guo S, Ye D, Youssef M, Ma T. Occludin regulatesmacromolecule flux across the intestinal epithelial tight junction barrier. AmJ Physiol-Gastroin Liver Physiol. 2011;300:G1054–G64.

39. Tsai ML, Chiou YS, Chiou LY, Ho CT, Pan MH. Garcinol suppressesinflammation-associated colon carcinogenesis in mice. Mol Nutr Food Res.2014;58:1820–9.

40. McCracken BA, Spurlock ME, Roos MA, Zuckermann FA, Gaskins HR.Weaning anorexia may contribute to local inflammation in the piglet smallintestine. J Nutr. 1999;129:613–9.

41. Al-Sadi R, Boivin M, Ma T. Mechanism of cytokine modulation of epithelialtight junction barrier. Front Biosci. 2009;14:2765.

42. Liu Y, Huang J, Hou Y, Zhu H, Zhao S, Ding B, et al. Dietary argininesupplementation alleviates intestinal mucosal disruption induced by Escherichiacoli lipopolysaccharide in weaned pigs. Br J Nutr. 2008;100:552–60.

43. Ma TY, Iwamoto GK, Hoa NT, Akotia V, Pedram A, Boivin MA, et al. TNF-α-induced increase in intestinal epithelial tight junction permeability requiresNF-κB activation. Am J Physiol-Gastroin Liver Physiol. 2004;286:G367–G76.

44. Hou C, Zeng X, Yang F, Liu H, Qiao S. Study and use of the probioticLactobacillus reuteri in pigs: a review. J Animl Sci Biotechnol. 2015;6:14.


AbstractBackgroundMethodResultsConclusion

BackgroundMaterial and methodsAnimals and experimental designAnalysis of serum biochemical indices and antioxidant propertiesAnalysis of intestinal morphology and permeabilityIntestinal cytokines determined by ELISAReal-time PCR for the relative measurement of transcripts and quantification of microbiota in the jejunum and ileumWestern blotting and immunoprecipitationMicrobial genomic DNA extraction16S rDNA amplicon pyrosequencing and sequence analysisStatistical analyses

ResultsEffect of dietary garcinol on the performance, diarrhea rate and blood biochemical indices of weaned pigsEffect of dietary garcinol on intestinal morphology of weaned pigsEffect of dietary garcinol on tight junctions in the intestinal mucosaEffect of dietary garcinol on intestinal inflammation in weaned pigsEffect of dietary garcinol on the diversity of gut microbiota

DiscussionConclusionAbbreviationsAcknowledgmentsAuthors’ contributionsFundingAvailability of data and materialsEthics approvalConsent for publicationCompeting interestsReferences

dietary garcinol supplementation improves diarrhea and ... · in addition, garcinol may inhibit the...

Documents