dimethylarginine dimethylaminohydrolase 1 regulates nerve growth factor-promoted differentiation of...

Dimethylarginine Dimethylaminohydrolase1 Regulates Nerve Growth Factor-PromotedDifferentiation of PC12 Cells in a NitricOxide-Dependent but AsymmetricDimethylargenine-Independent Manner

Shan Wang,1,2 Chang-Ping Hu,1* Qiong Yuan,1 Wei-Fang Zhang,1 Zhi Zhou,1

Sheng-Dan Nie,3 Jun-Lin Jiang,1 and Yuan-Jian Li1*1Department of Pharmacology, School of Pharmaceutical Sciences, Central South University,Changsha, China2Department of Pharmaceutical Engineering, College of Chemistry and Chemical Engineering,Central South University, Changsha, China3Institue of Clinical Medicine, Hunan Provincial People’s Hospital, Changsha, China

There are significant morphological and biochemicalalterations during nerve growth factor (NGF)-promotedneuronal differentiation, and the process is regulated bymolecules, including nitric oxide (NO). Dimethylargininedimethylaminohydrolase (DDAH) is thought to play acritical role in regulating NO production via hydrolyzingthe endogenous NO synthase (NOS) inhibitor asymmet-ric dimethylarginine (ADMA). Thus, we tested the role ofDDAH in NGF-promoted differentiation of PC12 (pheo-chromocytoma) cells. The present results show thatboth mRNA and protein levels of DDAH1 wereincreased, whereas those of DDAH2 were decreased,during NGF-promoted cell differentiation. Both theDDAH activity and the ADMA level in cultured mediumwere unchanged in this process. NGF promoted neuriteformation and induced the expression of microtubule-associated protein 2 (MAP2), a neuronal marker, whichwere both significantly repressed by DDAH1 silencewith small interfering RNA but not by DDAH2 silence.The expressions of three isoforms of NOS were mark-edly upregulated after NGF stimulation with a timecourse similar to that of DDAH1, which were attenuatedby DDAH1 silence. Conversely, overexpression ofDDAH1 accelerated neurite formation in PC12 cells,concomitantly with upregulating the expression of threeNOS isoforms. In summary, our data reveal the criticalregulatory effect of DDAH1 on NGF-promoted differen-tiation of PC12 cells in an NOS/NO-dependent butADMA-independent manner. VVC 2012 Wiley Periodicals, Inc.

Key words: DDAH; PC12; NGF; differentiation; nitricoxide

Nitric oxide (NO) is involved in neurogenesis andneuronal differentiation (Peunova and Enikolopov,1995). Exogenous inhibitor of NO synthases (NOS;

Nx-nitro-L-arginine methylester; L-NAME) attenuatesnerve growth factor (NGF)-promoted differentiation ofneuronal cells, which can be rescued by exogenous NO(Peunova and Enikolopov, 1995; Kalisch et al., 2002).NO is synthesized by NOS, three isoforms of whichhave been identified: endothelial, inducible, and neuro-nal NOS (eNOS, iNOS, and nNOS, respectively).Asymmetric dimethylarginine (ADMA), an endogenousNOS inhibitor, can competitively inhibit the activity ofNOS and reduce the generation of NO. ADMA isdegraded by dimethylarginine dimethylaminohydrolase(DDAH; Palm et al., 2007). It has been shown thatDDAH up-regulates NOS activity and consequentlyincreases NO production through inhibiting the ADMAlevel (Palm et al., 2007). Whether DDAH participates inthe process of neuronal differentiation via regulatingADMA/NOS/NO pathway remains to be defined.

DDAH exists in two isoforms, DDAH1 andDDAH2. The expression of the two isoforms differsmarkedly in a wide variety of tissues. DDAH1 predomi-nates in tissues that also express nNOS, whereasDDAH2 predominates in more highly vascularized tis-sues and immune tissue, which also express eNOS and

Contract grant sponsor: National Natural Science Foundation of China;

Contract grant numbers: 30801395 and 81001107.

*Correspondence to: Prof. Yuan-Jian Li or Prof. Chang-Ping Hu,

Department of Pharmacology, School of Pharmaceutical Sciences, Central

South University, P.O. Box 58, 110 Xiang-Ya Road, Changsha 410078,

China.

E-mail: yuan_ [email protected] or [email protected]

Received 10 May 2011; Revised 5 November 2011; Accepted 18

November 2011

Published online 20 February 2012 in Wiley Online Library

(wileyonlinelibrary.com). DOI: 10.1002/jnr.23009

Journal of Neuroscience Research 90:1209–1217 (2012)

' 2012 Wiley Periodicals, Inc.

iNOS, respectively (Leiper et al., 1999; Tran et al.,2000). It has also been shown that, in central neuronalsystem, DDAH1 predominates in the forebrain and isformed at a later stage of embryo development, whereassignificant DDAH2 expression is apparent in the medullaand spinal cord, suggesting that DDAH2 may be moreancient than DDAH1 (Tran et al., 2000). Interestingly,the dynamic change of DDAH2 has also been foundduring development. DDAH2 is highly expressed in fetaltissues, with expression level falling in most tissues of theadult (Tran et al., 2000); DDAH2 gene expression dur-ing trophoblast cell differentiation is regulated in a differ-entiation status-dependent manner both in vivo and invitro (Tomikawa et al., 2006). Whether the expressionof DDAH1 and DDAH2 differs during NGF-promotedneuronal differentiation also remains unclear.

Rat pheochromocytoma (PC12) cells possess thepluripotency of a primitive progenitor that is capable ofdifferentiating toward sympathetic neurons and are usedextensively as a cell model to study neuronal differentia-tion and its underlying mechanisms (Kim et al., 2005;Cappelletti et al., 2006; Yu and Rasenick, 2006). Whenexposed to physiological levels of NGF, PC12 cellsassume many of the features of sympathetic neurons,including cell cycle arrest, elaboration of long neurites,and increase in expression of microtubule-associated pro-tein 2 (MAP2), a neuronal marker (Chiou et al., 2007).In the present study, we therefore chose PC12 cells toinvestigate the expression of two isoforms of DDAH andtheir regulatory roles in NGF-promoted neuronal differ-entiation.

MATERIALS AND METHODS

Materials

PC12 cells (CRL-1721) were originally obtained fromATCC (Manassas, VA). RPMI 1640, horse serum, and fetalbovine serum were from Hyclone (Logan, UT). The antibod-ies against DDAH1, DDAH2, nNOS, eNOS, iNOS, and b-actin were purchased from Santa Cruz Biotechnology (SantaCruz, CA). The antibody against MAP2 was obtained fromChemicon (Temecula, CA). NGF, L-NAME, and collagenwere from Sigma (St. Louis, MO). All other biochemicalsused were of the highest purity available.

Cell Culture and Neuronal Induction Medium

PC12 cells grew in collage-coated culture dishes inRPMI 1640 medium supplemented with 10% horse serumand 5% fetal bovine serum. For neuronal induction, the cellswere washed with serum-free medium and maintained inRPMI 1640 medium supplemented with 1% horse serum and50 ng/ml NGF.

Neurite Formation Assay

The total number of cells in five randomly chosen fieldsof each three replicates from five independent experimentswas counted at 3200 magnification. The result was expressedas the percentage of neurite-bearing cells among total cells(Nowroozi et al., 2005).

Determination of Nitrite/Nitrate Concentration

The levels of NO in medium were determined indi-rectly as the levels of nitrite and nitrate. The levels of nitrite/nitrate were measured as previously described (Jiang et al.,2002). Briefly, nitrate was converted to nitrite with Aspergillusnitrite reductase, and the total nitrite was measured with theGriess reagent. The absorbance was determined at 540 nmwith a spectrophotometer.

DDAH Activity Assay

The activity of DDAH in PC12 cells was estimated bydirectly measuring the amount of ADMA metabolized byDDAH as previously described (Lin et al., 2002) andexpressed as the percentage of the ADMA metabolized com-pared with the control.

Determination of ADMA Concentration

The level of ADMA in the conditioned medium wasmeasured by HPLC as described previously (Jiang et al., 2002;Wang et al., 2007).

DDAH1 and DDAH2 RNA Interference

The siRNA of DDAH1 and DDAH2 was designed andchemically synthesized by Dharmacon (Lafayette, CO). Dhar-macon SMARTpool uses an algorithm to combine four ormore SMART-selected DDAH1 or DDAH2 siRNA duplexesin a single pool. PC12 cells were plated in six-well plates andthe following day transfected with 100 nM DharmaconSMARTpool DDAH1 or DDAH2 siRNA along with 5 llDharmaFECT transfection reagent 3 (Dharmacon). As a con-trol, scrambled siRNA (Dharmacon) that did not exhibithomology to any coding region was used. NGF was added30 min posttransfection. For long-term treatment, cells weretransfected with siRNA every 60 hr.

DDAH1 Plasmid Construction and Cell Transfection

The full-length rat DDAH 1 cDNA was generated byRT-PCR using mRNA isolated from PC12 cells (forwardprimer GGAGCAAGCTTCGCCACCATGGCCGGCCTCAGCCA and reverse primer GCCTGCTCGAGTCAAGAGTCTGTCTTCTTGTTAAT) and subsequently cloned intoHindIII/XhoI sites in pcDNA 3.1/myc (Invitrogen, Carlsbad,CA; Kostourou et al., 2002).

Undifferentiated PC12 cells were transfected withpcDNA3.1/DDAH1 or pcDNA3.1 by Lipofectamine 2000(Invitrogen). One day after transfection, 800 lg/ml G418sulfate (Sigma) was added to the cells, all of which were sub-sequently preserved in a medium containing G418 at a finalconcentration of 300 lg/ml. DDAH1 expression level wasscreened by Western blot.

Real-Time Quantitative RT-PCR Analysis

Total RNA was extracted using the Trizol reagent(Invitrogen). Total RNA (2 lg) was used as a template in a20-ll cDNA synthesis reaction. The cDNA was synthesizedusing the RevertAidTM First Stand cDNA Synthesis Kit(Invitrogen) according to the manufacturer’s instructions.PCR was performed as described by the manufacturer using

1210 Wang et al.

Journal of Neuroscience Research

the Power SYBR Green PCR Master Mix (Applied Biosys-tems, Foster City, CA). The final reaction contained 10.7 llSYBR green/enzyme reaction mix, 0.4 lM primers, and 1 llcDNA in a total volume of 25 ll. PCR conditions were508C for 2 min, 958C for 10 min, followed by 45 cycles of958C for 15 sec and 608C for 1 min. GAPDH was used tonormalize the transcript levels of target genes. All results wererepeated in six independent experiments and performed intriplicate each time. Standard curves (cycle threshold values vs.template concentration) were prepared for each target geneand for the endogenous reference (GAPDH) in each sample.To confirm the specificity of the PCR, PCR products wereelectrophoresed on a 1.2% agarose gel.

The primers for each gene are as follows: GAPDH, 50-TGGCCTCCAAGGAGTAAGAAAC and 50-GGCCTCTCTCTTGCTCTCAGTATC; DDAH1, 50-AAGGACTACGCAGTTTCCACAGT and 50-CAGCCATGCTGCAGAAACTC; DDAH2, 50-AAAGCCGTCAGGGCAATG and 50-CGTCATCTGGGAGGGTCAGA; MAP2, 50-AGATCAGAAAGACTGGTTCATCGA and 50-CAGCTAAACCCCATTCATCCTT; nNOS, 50-CGATCGGCCCTTGGTAGA and 50-AGGCAATGCCCCTGAGAAC; eNOS, 50-CCCACGCTAGAGTGGTTTGC and GATTTCTAGCAGCATATTGGACACA; andiNOS, 50- TGGTGAAAGCGGTGTTCTTTG and 50-ACGCGGGAAGCCATGA.

Western Blot Analysis

Cells were lysed in iced lysis buffer. Total protein (50–100 lg) was separated by SDS-PAGE and transferred to anitrocellulose membrane. After incubation in blocking solu-tion (5% nonfat milk), membranes were incubated with pri-mary antibodies for DDAH1 (1:400), DDAH2 (1:400), nNOS(1:300), eNOS (1:500), iNOS (1:500), and b-actin (1:1,000)overnight at 48C. Membranes were washed and then incu-bated with a 1:2,000 dilution of horseradish peroxidase-conju-gated secondary antibodies (Santa Cruz Biotechnology). Rela-tive density of each protein band was normalized to that of b-actin. All results were representative of at least five independ-ent experiments.

Immunofluorescence Staining

Cells were fixed in 4% paraformaldehyde, and permeab-ilized with 0.3% Triton X-100. Nonspecific binding waseliminated by incubating the cells in blocking solution (1%bovine serum albumin, 10% fetal bovine serum, and 10% goatserum) for 1 hr at room temperature. The cells were thenwashed with phosphate-buffered saline (PBS) and incubatedwith primary antibody overnight at 48C. The cells werewashed again with PBS and incubated with fluorescein iso-thiocyanate-conjugated secondary antibodies (Santa Cruz Bio-technology) for an additional 1 hr. The cells were mounted inthe mounting medium supplemented with Hoechst33342 tostain the nuclei and viewed with a fluorescence microscope(Nikon Eclipse E800).

Statistical Analysis

The results are expressed as mean 6 SEM. Data wereanalyzed by ANOVA, followed by the Student-Newman-Keuls test. The significance level chosen was P < 0.05.

RESULTS

Inhibitory Effect of L-NAME on NGF-PromotedDifferentiation of PC12 Cells

PC12 cells differentiated modestly with prolongedculture time. In keeping with a previous study (Kalischet al., 2002), treatment of PC12 cells with NGF (50 ng/ml) promoted visible neurite formation in a time-de-pendent manner, and more than 85% of the cells hadgenerated long neurites 6 days after treatment withNGF, an effect that was inhibited in the presence of L-NAME (20 mM; Fig. 1).

Different Expression of DDAH1 andDDAH2 During NGF-Promoted Differentiationof PC12 Cells

To observe the roles of DDAH1 and DDAH2 inNGF-promoted differentiation of PC12 cells into neuro-nal cells, we analyzed the mRNA and protein expressionof DDAH1 and DDAH2 at different time points duringNGF treatment. As shown in Figure 2A–C, NGF treat-ment increased the mRNA and protein expression ofDDAH1 in a time-dependent manner, whereas themRNA and protein expression of DDAH2 was progres-

Fig. 1. Inhibitory effect of L-NAME on NGF-promoted differentia-tion of PC12 cells. A: Quantification of differentiated PC12 cells. B:Representative microscopic images of differentiated PC12 cells. Dataexpressed as mean 6 SEM of five independent experiments (**P <0.01 vs. without NGF at 0 day; ##P < 0.01 vs. with NGF at 0 day;$P < 0.05, $$P < 0.01 vs. with NGF at the corresponding timepoint). Scale bar 5 50 lm.

DDAH1 and Differentiation of PC12 Cells 1211


Fig. 2. Different expression of DDAH1 and DDAH2 during NGF-promoted differentiation of PC12 cells. A: Summary of DDAH1mRNA expression. B: Summary of DDAH2 mRNA expression. C:Representative images and summary of protein expression ofDDAH1 and DDAH2. D: Immunofluorescence staining of DDAH1

and DDAH2. Data are expressed as mean 6 SEM of five independ-ent experiments (*P < 0.01 vs. NGF at 0 day). Scale bar 5 100 lm.[Color figure can be viewed in the online issue, which is available atwileyonlinelibrary.com.]

Fig. 3. Effect of NGF treatment on DDAH activity, ADMA level, and NO concentration inPC12 cells. Data are expressed as mean 6 SEM of five independent experiments (**P < 0.01 vs.without NGF at 0 day; ##P < 0.01 vs. with NGF at 0 day; $$P < 0.01 vs. with NGF at thecorresponding time point).

1212 Wang et al.


sively decreased during NGF treatment. The alterationsof mRNA expression of DDAH1 and DDAH2 werenot affected by L-NAME (Fig. 2A,B). We also per-formed immunofluorescence analysis to investigatethe subcellular localization of DDAH1 and DDAH2and found that DDAH1 and DDAH2 localized notonly in the cytoplasma but also in the growing neurites(Fig. 2D).

Effect of NGF Treatment on DDAH Activity,ADMA Level, and NO Concentrationin PC12 Cells

To investigate the role of the DDAH/ADMA/NOpathway in modulating NGF-promoted differentiation ofPC12 cells, the activity of DDAH, level of ADMA, andconcentration of NO in PC12 cells were measured. Asshown in Figure 3A,B, neither DDAH activity norADMA level was changed with or without NGF treat-ment. In contrast, the concentration of NO was timedependently increased modestly in PC12 cells withoutNGF treatment, and NGF significantly increased theconcentration of NO in PC12 cells, which was inhibitedby L-NAME (Fig. 3C).

Effect of DDAH1 or DDAH2 Knockdownon NGF-Promoted Neurite Formation andMAP2 Expression

To determine the roles of DDAH1 and DDAH2in NGF-promoted differentiation of PC12 cells, wedeveloped DDAH1- or DDAH2-specific siRNA. Asshown in Figure 4A–C, DDAH1 siRNA successfullyknocked down DDAH1 mRNA and protein levels ofPC12 cells with or without NGF treatment (50 ng/ml,6 days) but had no effect on DDAH2 mRNA expres-sion. The scrambled siRNA, which had no homology toany known cDNA, did not affect the expression ofDDAH1 or DDAH2 (Fig. 4A). We next examined theeffect of DDAH1 knockdown by siRNA on differentia-tion of PC12 cells. As shown in Figures 4 and 5,DDAH1 siRNA blunted the stimulation of cell differen-tiation induced by NGF, as shown by less neurite forma-tion (Fig. 4D,E) and decreased MAP2 expression (Fig.5A,B). In contrast, although DDAH2 siRNA success-fully knocked down mRNA and protein levels ofDDAH2 in PC12 cells with or without NGF treatment(50 ng/ml, 6 days; Fig. 6A,B), DDAH2 siRNA had noeffect on the differentiation of PC12 cells induced byNGF (Fig. 6C).

Fig. 4. Effect of DDAH1 knockdown on NGF-promoted neuriteformation. A: Representative mRNA expression of DDAH1 andDDAH2 by RT-PCR. B: Summary of DDAH1 mRNA expressionby real-time PCR. C: Representative DDAH1 protein expression.D: Representative microscopic images of differentiated PC12 cells.

E: Quantification of differentiated cells. 1, Present; –, absent. Dataare expressed as mean 6 SEM of five independent experiments (*P< 0.01 vs. scrambled siRNA-treated group, #P < 0.01 vs. NGF andscrambled siRNA-treated group). Scale bar 5 100 lm.



Effect of DDAH1 Overexpression onNeurite Formation

To confirm further the significance of DDAH1 inneuronal differentiation, we transfected PC12 cells withDDAH1-expressing plasmid and observed the effect ofDDAH1 overexpression on neurite formation. Westernblot analysis showed that DDAH1 expression was signifi-cantly increased after transfection (Fig. 7A). Interestingly,overexpression of DDAH1 also promoted neurite forma-tion of PC12 cells in the absence of NGF, which wasabolished by L-NAME (Fig. 7B).

Effect of DDAH1 on Expression of nNOS,eNOS, and iNOS in PC12 Cells

It has been documented that NGF induces threeisoforms of NOS in neuronal cells (Peunova and Eniko-lopov, 1995). As expected, we found that treatment ofPC12 cells with NGF significantly upregulated theexpressions of nNOS, eNOS, and iNOS (both mRNAand protein; Fig. 8A,B). To seek evidence of the role ofDDAH1 in NGF-induced NOS expression, the effectsof DDAH1 knockdown and overexpression were tested.As shown in Figure 8C,D, the mRNA and protein lev-els of iNOS, eNOS, and nNOS were down-regulated inDDAH1 siRNA-transfected cells 2 days after treatmentwith NGF. In contrast, DDAH1 overexpression upregu-

Fig. 5. Effect of DDAH1 knockdown on NGF-induced MAP2expression. A: Summary of DDAH1 mRNA expression. B: Immuno-fluorescence analysis of MAP2. Data are expressed as mean 6 SEM offive independent experiments (*P < 0.01 vs. NGF 1 scrambledsiRNA). Scale bar 5 100 lm. [Color figure can be viewed in theonline issue, which is available at wileyonlinelibrary.com.]

Fig. 6. Effect of DDAH2 knockdown on NGF-promoted neuriteformation. A: Summary of DDAH2 mRNA expression by real-timePCR. B: Representative DDAH2 protein expression. C: Quantifica-tion of differentiated cells. 1, Present; –, absent. Data are expressed

as mean 6 SEM of five independent experiments (*P < 0.01 vs.scrambled siRNA-treated group, #P < 0.01 vs. NGF and scrambledsiRNA-treated group).

1214 Wang et al.


lated the mRNA and protein levels of iNOS, eNOS,and nNOS in the absence of NGF (Fig. 8E,F).

DISCUSSION

The major findings of the present study are as fol-lows. 1) NGF promotes differentiation of PC12 cells,whereas the mRNA and protein expressions of DDAH1and three isoforms of NOS as well as NO productionwere upregulated in PC12 cells. 2) Knockdown ofDDAH1 and application of exogenous L-NAME attenu-ate NGF-promoted differentiation of PC12 cells, themRNA and protein expressions of three isoforms ofNOS, and NO production. 3) Overexpression ofDDAH1 mimics the promoting effect of NGF on differ-entiation of PC12 cells and NOS expression. Collec-tively, these findings suggest, for the first time, thatDDAH1 regulates NGF-promoted differentiation ofPC12 cells via activating the NOS/NO system.

The present study shows that the expression ofDDAH1 was upregulated during NGF-promoted differ-entiation of PC12 cells, whereas the expression ofDDAH2 was decreased dramatically. The differentialregulation of DDAH1 and DDAH2 has also beenreported. In diabetic kidneys, DDAH1 expression wasfound to be decreased, but DDAH2 expression was

Fig. 7. Effect of DDAH1 overexpression on neurite formation. A:Representative DDAH1 protein expression. B: Quantification of dif-ferentiated cells. Data are expressed as mean 6 SEM of five inde-pendent experiments (**P < 0.01 vs. control; ##P < 0.01 vs.DDAH1).

Fig. 8. Effect of DDAH1 on expression of nNOS, eNOS, andiNOS in PC12 cells. A,C,E: Summary of NOS mRNA expression.B,D,F: Representative images and summary of NOS protein expres-

sion. Data are expressed as mean 6 SEM of five independent experi-ments (A: **P < 0.01 vs. NGF at 0 day; C: *P < 0.05, **P < 0.01vs. NGF 1 scrambled siRNA; E: *P < 0.05, **P < 0.01 vs. mock).



increased, an effect that was reversed by telmisartan(Onozato et al., 2008). The functional significance ofthis conflicting regulation of two DDAH isoformsremains poorly understood. To define the roles ofDDAH1 and DDAH2 in NGF-promoted differentiationprocess of PC12 cells, we developed DDAH1- orDDAH2-specific siRNA and DDAH1 overexpressingplasmids. The results showed that knockdown ofDDAH1, but not DDAH2, attenuated NGF-promoteddifferentiation, whereas overexpression of DDAH1 mim-icked the stimulation of differentiation of PC12 cellsinduced by NGF. These results suggest that DDAH1may play a critical role in mediating NGF-promoted dif-ferentiation of PC12 cells.

DDAH is the specific hydrolase of ADMA andplays an important role in the modulation of ADMAlevel (Palm et al., 2007). We therefore investigatedwhether alteration of ADMA level is involved in theregulatory effect of DDAH1 on NGF-promoted differ-entiation of PC12 cells. We found that neither DDAHactivity nor ADMA level was changed during NGF-pro-moted cell differentiation, even though there was a con-comitant increase in the expression of DDAH1 andthree isofroms of NOS as well as NO concentration.These results suggest that DDAH1 regulates NGF-pro-moted differentiation of PC12 cells via activatation ofthe NOS/NO system independently of ADMA level.

NO is generated from L-arginine by NOS, whichis markedly induced and triggers a switch to growtharrest during NGF-promoted cell differentiation (Kalischet al., 2002; Peunova and Enikolopov, 1995). Theinduction of NOS is an important step in the commit-ment of neuronal precursors, and NOS serves as agrowth-arrest gene, initiating the switch to cytostasisduring differentiation (Peunova and Enikolopov, 1995).The activity of NOS is affected by multiple factors,including its expression level, endogenous inhibitors, andcofactor activity. In our setting, we found that, eventhough the level of ADMA, an endogenous NOS inhib-itor, was not altered during NGF-promoted cell differ-entiation, increases in expression of three isoforms ofNOS (nNOS, iNOS, eNOS) were detected. We alsofound that DDAH1 siRNA inhibited the expression ofthe three isoforms of NOS, whereas overexpression ofDDAH1 upregulated the expressions of the three iso-forms. These results suggest that DDAH1 could directlyregulate the expressions of the three isoforms of NOSvia an ADMA-independent pathway. It has been dem-onstrated that DDAH2 directly stimulates Sp1 bindingactivity (Hasegawa et al., 2006) and that the promoter ofNOS gene contains an Sp1-dependent enhancer (Tanget al., 1995; Bachir et al., 2003). In fact, several lines ofevidence suggest that, besides hydrolyzing ADMA,DDAH might have a nonenzymetic function via pro-tein–protein interaction. DDAH1 can bind directly tothe C-terminal domain and to the cysteine/serine-richdomain of neurofibromin (Tokuo et al., 2001), whichcan regulate neuronal differentiation of PC12 cells(Yunoue et al., 2003; Patrakitkomjorn et al., 2008).

In summary, the present study for the first timesuggests that DDAH1 plays a critical role in NGF-pro-moted differentiation of PC12 cells via ADMA-inde-pendent activation of the NOS/NO pathway. The con-clusion is somewhat counterintuitive, and further effortsare required to investigate how DDAH1 directly acts onNOS expression and NO production independently ofthe levels of ADMA.

REFERENCES

Bachir LK, Garrel G, Lozach A, Laverriere JN, Counis R. 2003. The rat

pituitary promoter of the neuronal nitric oxide synthase gene contains

an Sp1-, LIM homeodomain-dependent enhancer and a distinct bipar-

tite gonadotropin-releasing hormone-responsive region. Endocrinology

144:3995–4007.

Cappelletti G, Maggioni MG, Ronchi C, Maci R, Tedeschi G. 2006.

Protein tyrosine nitration is associated with cold- and drug-resistant

microtubules in neuronal-like PC12 cells. Neurosci Lett 401:159–164.

Chiou SH, Kao CL, Chang YL, Ku HH, Tsai YJ, Lin HT, Yen CJ,

Peng CH, Chiu JH, Tsai TH. 2007. Evaluation of anti-Fas ligand-

induced apoptosts and neural differentiation of PC12 cells treated with

nerve growth factor using small interfering RNA method and sampling

by microdialysis. Anal Biochem 363:46–57.

Hasegawa K, Wakino S, Tanaka T, Kimoto M, Tatematsu S, Kanda T,

Yoshioka K, Homma K, Sugano N, Kurabayashi M, Saruta T, Hayashi

K. 2006. Dimethylarginine dimethylaminohydrolase 2 increases vascular

endothelial growth factor expression through Sp1 transcription factor in

endothelial cells. Arterioscler Thromb Vasc Biol 26:1488–1494.

Jiang JL, Li Ns NS, Li YJ, Deng HW. 2002. Probucol preserves endo-

thelial function by reduction of the endogenous nitric oxide synthase

inhibitor level. Br J Pharmacol 135:1175–1182.

Kalisch BE, Bock NA, Davis WL, Rylett RJ. 2002. Inhibitors of nitric

oxide synthase attenuate nerve growth factor-mediated increases in

choline acetyltransferase expression in PC12 cells. J Neurochem 81:

624–635.

Kim TA, Jiang S, Seng S, Cha K, Avraham HK, Avraham S. 2005. The

BTB domain of the nuclear matrix protein NRP/B is required for neu-

rite outgrowth. J Cell Sci 118:5537–5548.

Kostourou V, Robinson SP, Cartwright JE, Whitley GS. 2002. Dimethy-

larginine dimethylaminohydrolase I enhances tumour growth and

angiogenesis. Br J Cancer 87:673–680.

Leiper JM, Santa Maria J, Chubb A, MacAllister RJ, Charles IG, Whitley

GS, Vallance P. 1999. Identification of two human dimethylarginine

dimethylaminohydrolases with distinct tissue distributions and homol-

ogy with microbial arginine deiminases. Biochem J 343:209–214.

Lin KY, Ito A, Asagami T, Tsao PS, Adimoolam S, Kimoto M, Tsuji H,

Reaven GM, Cooke JP. 2002. Impaired nitric oxide synthase pathway

in diabetes mellitus: role of asymmetric dimethylarginine and dimethy-

larginine dimethylaminohydrolase. Circulation 106:987–992.

Nowroozi N, Raffioni S, Wang T, Apostol BL, Bradshaw RA, Thomp-

son LM. 2005. Sustained ERK1/2 but not STAT1 or 3 activation is

required for thanatophoric dysplasia phenotypes in PC12 cells. Hum

Mol Genet 14:1529–1538.

Onozato ML, Tojo A, Leiper J, Fujita T, Palm F, Wilcox CS. 2008.

Expression of NG,NG-dimethylarginine dimethylaminohydrolase and

protein arginine N-methyltransferase isoforms in diabetic rat kidney:

effects of angiotensin II receptor blockers. Diabetes 57:172–180.

Palm F, Onozato ML, Luo Z, Wilcox CS. 2007. Dimethylarginine dime-

thylaminohydrolase (DDAH): expression, regulation and function in the

cardiovascular and renal systems. Am J Physiol Heart Circ Physiol 293:

H3227–H3245.

Patrakitkomjorn S, Kobayashi D, Morikawa T, Wilson MM, Tsubota N,

Irie A, Ozawa T, Aoki M, Arimura N, Kaibuchi K, Saya H, Araki N.

1216 Wang et al.


2008. Neurofibromatosis type 1 (NF1) tumor suppressor, neurofibro-

min, regulates the neuronal differentiation of PC12 cells via its associat-

ing protein, CRMP-2. J Biol Chem 283:9399–9413.

Peunova N, Enikolopov G. 1995. Nitric oxide triggers a switch

to growth arrest during differentiation of neuronal cells. Nature 375:

68–73.

Tang JL, Zembowicz A, Xu XM, Wu KK. 1995. Role of Sp1 in tran-

scriptional activation of human nitric oxide synthase type III gene. Bio-

chem Biophys Res Commun 213:673–680.

Tokuo H, Yunoue S, Feng L, Kimoto M, Tsuji H, Ono T, Saya H,

Araki N. 2001. Phosphorylation of neurofibromin by cAMP-dependent

protein kinase is regulated via a cellular association of N(G),N(G)-

dimethylarginine dimethylaminohydrolase. FEBS Lett 494:48–53.

Tomikawa J, Fukatsu K, Tanaka S, Shiota K. 2006. DNA methylation-

dependent epigenetic regulation of dimethylarginine dimethylaminohy-

drolase 2 gene in trophoblast cell lineage. J Biol Chem 281:12163–

12169.

Tran CT, Fox MF, Vallance P, Leiper JM. 2000. Chromosomal localiza-

tion, gene structure, and expression pattern of DDAH1: comparison

with DDAH2 and implications for evolutionary origins. Genomics

68:101–105.

Wang S, Jiang JL, Hu CP, Zhang XJ, Yang DL, Li YJ. 2007. Relationship

between protective effects of rosiglitazone on endothelium and endoge-

nous nitric oxide synthase inhibitor in streptozotocin-induced diabetic

rats and cultured endothelial cells. Diabetes Metab Res Rev 23:157–164.

Yu JZ, Rasenick MM. 2006. Tau associates with actin in differentiating

PC12 cells. FASEB J 20:1452–1461.

Yunoue S, Tokuo H, Fukunaga K, Feng L, Ozawa T, Nishi T, Kikuchi A,

Hattori S, Kuratsu J, Saya H, Araki N. 2003. Neurofibromatosis type I tumor

suppressor neurofibromin regulates neuronal differentiation via its GTPase-

activating protein function toward Ras. J Biol Chem 278:26958–26969.



dimethylarginine dimethylaminohydrolase 1 regulates nerve growth factor-promoted differentiation of...

Documents